Correlation of nonsilent somatic mutations with the age and the disease stage of 25 people with NKTCL, subjected to whole-exome sequencing.

Supplementary Figure 1 Correlation of nonsilent somatic mutations with the age and the disease stage of 25 people with NKTCL, subjected to whole-exome sequencing. (a) Distribution of non-silent somatic mutations according to the age of the patients. P value was calculated by two-sided F-test (n = 25 subjects). (b) Distribution of non-silent somatic mutations according to the disease stage of the patients. P value was calculated by twosided Student s t test (mean ± s.d.; n = 25 subjects).

Supplementary Figure 2 Distribution of reads mapped to the EBV genome in tumor and matched peripheral blood samples of 25 people with NKTCL, subjected to whole-exome sequencing.

Supplementary Figure 3 Somatic copy-number alterations (CNAs) and uniparental disomies (UPDs) in 25 people with NKTCL, subjected to whole-exome sequencing. (a) Types and genomic distribution of somatic copy number alterations (CNAs) and uniparental disomies (UPDs) in each patient. (b) Types and genomic distribution of somatic CNAs and UPDs according to the chromosomes.

Supplementary Figure 4 Functional categories of somatic mutations in 25 people with NKTCL, subjected to whole-exome sequencing. (a) Gene ontology analysis of 795 somatic mutations expected to alter the function or structure of the encoded protein. Adjusted P value < 0.01 and False Discover Rate < 0.1 (Online Methods). (b) Functional categories of 26 candidate gene mutations according to 6q21 deletions.

Supplementary Figure 5 Relationship between mutations of DDX3X, tumor suppressors, JAK-STAT-pathway molecules and epigenetic modifiers in NKTCL. (a) Distribution of mutations in DDX3X, tumor suppressors (TP53 and MGA), JAK-STAT pathway (STAT3 and STAT5B) and epigenetic modifiers (MLL2, ARID1A, EP300 and ASXL3) in NKTCL. (b) Comparison of the allele frequencies of selected mutations in samples harboring mutations in DDX3X and tumor suppressors. (c) Comparison of the allele frequencies of selected mutations in samples harboring mutations in DDX3X and JAK-STAT pathway molecules. (d) Comparison of the allele frequencies of selected mutations in samples harboring mutations in and DDX3X and epigenetic modifiers. Each axis showed the frequencies of the mutant alleles. When a single gene had 2-Hit mutation, the frequencies of major alleles were indicated. Data were analyzed statistically by two-sided Wilcoxon rank-sum test.

Supplementary Figure 6 Cellular localizations of DDX3X and EBV-associated RNA or protein in EBV-infected natural killer cell line KAI3. (a) Cellular localizations of DDX3X and EBV-Encoded RNA (EBER). (b) Cellular localizations of DDX3X and latent membrane protein 1 (LMP-1). Images were visualized by confocal laser scanning microscopy. Scale bar, 5μm.

Supplementary Figure 7 Apoptosis assay of DDX3X wild-type natural killer cell line KAI3 transfected with empty vector (vector), wild-type or DDX3X mutants (E348K and A404P). P values were calculated using two-sided Student s t test (mean ± s.d.; n = 3 per group).

Supplementary Figure 8 shrna-mediated knockdown of DDX3X enhanced the growth of DDX3X wild-type natural killer cell line KAI3. (a) Flow cytometric plots showing the percentage of GFP + KAI3 cells 3 days (considered as day 0 for cell growth evaluation) and 15 days (considered day 12 for cell growth evaluation) post transduction of cells with scrambled shrna (Scrambled shrna) or shrna targeting DDX3X (DDX3X shrna1). Cells were switched to natural killer culture medium with reduced IL-2 (25 U/mL). (b) Quantification of the percentages of GFP + KAI3 cells transfected with scrambled shrna or DDX3X shrna1 at regular time intervals, as normalized to the levels at day 0. **: P < 0.01 as compared to the scrambled shrna. P values were calculated using two-sided Student s t test (mean ± s.d.; n = 3 per group). (c) Western blot images of DDX3X levels in shrna-transfected, GFP + sorted cells post transduction with the scrambled shrna or DDX3X shrna1. (d) Flow cytometric plots showing the percentage of GFP + KAI3 cells 3 days (considered as day 0 for cell growth evaluation) and 15 days (considered day 12 for cell growth evaluation) post transduction of cells with scrambled shrna (Scrambled shrna) or shrna targeting DDX3X (DDX3X shrna2). Cells were switched to natural killer culture medium with reduced IL-2 (25 U/mL). (e) Quantification of the percentages of GFP + KAI3 cells transfected with scrambled shrna or DDX3X shrna2 at regular time intervals, as normalized to the levels at day 0. **: P < 0.01; ***: P < 0.001, as compared to the scrambled shrna. P values were calculated using two-sided Student s t test (mean ± s.d.; n = 3 per group). (f) Western blot images of DDX3X levels in shrna-transfected, GFP + sorted cells post transduction with the scrambled shrna or DDX3X shrna2.

Supplementary Figure 9 Gene-expression profiles of NF- B and MAPK pathways in NKTCL. (a) Significantly upregulated and downregulated genes of NF- B pathway in DDX3X-mutated tumors, as compared to those in DDX3Xwild-type (wt) tumors of NKTCL. (b) Significantly upregulated and downregulated genes of MAPK pathway in DDX3X-mutated tumors, as compared to those in DDX3X-wild-type (wt) tumors of NKTCL.

Supplementary Figure 10 Kaplan-Meier analysis of the survival of people with NKTCL, excluding extranasal cases or stage III and stage IV cases. (a) Overall survival (OS) and progression-free survival (PFS) of NKTCL patients excluding extranasal cases according to mutation status of DDX3X and TP53 (upper panel) and according to risk stratification combining International Prognostic Index (IPI) and mutation status of DDX3X and TP53 (lower panel). (b) OS and PFS of NKTCL patients excluding stage III IV cases according to mutation status of DDX3X and TP53 (upper panel) and according to risk stratification combining IPI and mutation status of DDX3X and TP53 (lower panel). Risk stratification combining IPI and mutation status of DDX3X and TP53: Group 1: IPI0 1 and wtddx3x/wttp53; Group 2: IPI0 1 and mutddx3x/muttp53 or IPI2 5 and wtddx3x/wttp53; Group 3: IPI2 5 and mutddx3x/muttp53. wt: wild-type, individuals without DDX3X or TP53 mutations; mut: mutation, individuals with DDX3X or TP53 mutations. One individual with both DDX3X and TP53 mutations was grouped into two cohorts with mutations.

Supplementary Figure 11 Variant allele frequency of single-nucleotide variations in 25 people with NKTCL, subjected to whole-exome sequencing. In each plot, the density curve depicted the clustered variant allele frequency (VAF) to determine the number of clusters.

Supplementary Figure 12 Flow chart for identification of somatic single-nucleotide variations and indels from paired whole-exome-sequencing data.

Supplementary Figure 13 Representative GeneScanning results of TRB or TRG rearrangement in NKTCL. (a) TCRB rearrangement negative. (b) TCRG rearrangement negative. (c) TCRG rearrangement positive. The control gene peaks were shown at 101, 200, 300 and 395nt.

Supplementary Figure 14 Representative GeneScanning results of TRD rearrangement in NKTCL. (a) TCRD rearrangement negative. (b) TCRD rearrangement positive. The control gene peaks were shown at 101, 200, 300 and 395nt.

Supplementary Figure 15 Positive controls of immunohistochemistry of human anti-relb antibody and human anti-p-erk antibody. (a) The positive control of immunohistochemistry of human colon cancer tissue using anti-relb antibody (Proteintech, 25027-1-AP). (b) The positive control of immunohistochemistry of human lung cancer tissue using anti-p-erk antibody (Cell Signaling, 4370S). Scale bar, 20μm.

Supplementary Table 4. Minimal common regions of somatic copy number alterations and uniparental disomies analysis. No. Region Type of alterations Number of alterations Alteration size (Mb) Involved genes 1 1q31.3 UPD 3 0.37 NEK7, ATP6V1G3, PTPRC 2 6q21 Deletion 11 1.12 3 7q35 Amplification 3 0.95 4 9p24.1 Deletion 4 0.58 BVES, POPDC3, PREP, PRDM1, ATG5 FAM115C, CTAGE6, FAM115A, OR2F1, CTAGE4, ARHGEF35, ARHGEF5, NOBOX, TPK1 PDCD1LG2, KIAA1432, ERMP1, MLANA, KIAA2026, RANBP6 UPD: uniparental disomy 5 13q14.11 Deletion 3 0.33 FOXO1

Supplementary Table 6. Ki67 expression of NKTCL patients according to mutation status. Mutation Status Ki67 50% Ki67 > 50%* P value (mutation vs. wild-type) wild-type 25 46 - DDX3X 2 19 0.028* TP53 1 13 0.055 * One individual with both DDX3X and TP53 mutations was in Ki67 > 50% group and was grouped into two cohorts with mutations.

Supplementary Table 7. The upregulated and downregulated genes of NF- B and MAPK pathway in DDX3X-mutated NKTCL revealed by gene expression profiling. GeneSymbol GenbankAccession GenomicCoordinates NF- B pathway PIDD NM_145886 chr11:799239 799180 IRAK4 NM_016123 chr12:44181072 44181131 IL1B NM_000576 chr2:113587488 113587429 TRAF2 NM_021138 chr9:139820997 139821056 PLCG1 NM_002660 chr20:39803549 39803609 ZAP70 NM_001079 chr2:98354523 98355849 TNFAIP3 NM_006290 chr6:138203679 138203738 PTGS2 NM_000963 chr1:186641528 186641469 CXCL2 NM_002089 chr4:74964401 74964342 PLAU NM_002658 chr10:75677050 75677109 TRAF3 NM_145725 chr14:103372362 103372421 VCAM1 NM_001078 chr1:101203783 101203842 DDX58 NM_014314 chr9:32455787 32455728 NFKBIA NM_020529 chr14:35870847 35870788 TRAF1 NM_005658 chr9:123664733 123664674 IKBKG NM_003639 chrx:153792864 153792923 TRADD NM_003789 chr16:67188251 67188192 MAP3K14 NM_003954 chr17:43340768 43340709 PIAS4 AK022481 chr19:4038087 4038146 TAB2 NM_015093 chr6:149700594 149700653 RELA NM_021975 chr11:65421710 65421651 LTA NM_000595 chr6:31541154 31541213 TNF NM_000594 chr6:31545837 31545896 TRIM25 NM_005082 chr17:54965333 54965274 XIAP NM_001167 chrx:123047703 123047762 ERC1 NM_178040 chr12:1604999 1605058 CCL4 NM_002984 chr17:34432641 34432700 TNFRSF13C NM_052945 chr22:42321231 42321172 ICAM1 NM_000201 chr19:10396298 10396358 NFKB2 NM_001261403 chr10:104161053 104161229 LTB NM_002341 chr6:31548394 31548335 GADD45B NM_015675 chr19:2478178 2478237 CARD11 AK097139 chr7:3082928 3082869 CCL19 NM_006274 chr9:34690267 34690208 LAT NM_014387 chr16:29001732 29001791 CD14 NM_001174104 chr5:140011377 140011318 BLNK NM_013314 chr10:97956745 97956686 MYD88 NM_002468 chr3:38183932 38183991 BIRC3 NM_001165 chr11:102208356 102208415 RELB NM_006509 chr19:45541385 45541444 CD40LG NM_000074 chrx:135742456 135742515 BTK NM_000061 chrx:100604520 100604461 TRAF5 NM_004619 chr1:211548188 211548247

CD40 NM_001250 chr20:44755280 44755339 RIPK1 NM_003804 chr6:3115338 3115397 TNFSF13B NM_006573 chr13:108922693 108922752 PLCG2 NM_002661 chr16:81991575 81991634 PRKCQ NM_006257 chr10:6470247 6470188 TNFRSF1A NM_001065 chr12:6438123 6438064 UBE2I XM_005255542 chr16:1371388 1371447 CHUK NM_001278 chr10:101948251 101948192 TLR4 NM_138554 chr9:120479236 120479295 TAB3 NM_152787 chrx:30848882 30848823 LTBR NM_002342 chr12:6500070 6500129 SYK NM_003177 chr9:93658142 93658201 LY96 NM_015364 chr8:74941211 74941270 BCL2 NM_000633 chr18:60790782 60790723 BCL2A1 NM_004049 chr15:80253252 80253220 TAB1 NM_153497 chr22:39833073 39833132 TRAF6 NM_145803 chr11:36511240 36511181 CSNK2A2 NM_001896 chr16:58192239 58192180 TICAM1 NM_182919 chr19:4816695 4816636 BIRC2 NM_001166 chr11:102248391 102248450 TNFSF11 NM_003701 chr13:43181387 43181446 PRKCB NM_002738 chr16:24226173 24226233 CCL21 NM_002989 chr9:34709062 34709003 CCL13 NM_005408 chr17:32685309 32685365 CSNK2B NM_001320 chr6:31637220 31637279 IL1R1 NM_000877 chr2:102792046 102792105 IRAK1 NM_001569 chrx:153276900 153276841 LYN NM_002350 chr8:56922829 56922888 TNFSF14 NM_003807 chr19:6664998 6664939 CXCL12 NM_199168 chr10:44872947 44872888 ATM NM_000051 chr11:108236085 108236144 CSNK2A1 NM_177559 chr20:464048 463989 MAP3K7 NM_003188 chr6:91225746 91225687 CFLAR NM_001127184 chr2:202000731 202000790 TIRAP NM_001039661 chr11:126163586 126163645 IKBKB XM_005273494 chr8:42183031 42183090 LCK NM_005356 chr1:32751432 32751491 NFKB1 NM_003998 chr4:103537856 103537915 PARP1 NM_001618 chr1:226549220 226549161 MALT1 NM_006785 chr18:56416474 56416533 IL8 NM_000584 chr4:74609265 74609324 BCL10 NM_003921 chr1:85731997 85731938 BCL2L1 NM_138578 chr20:30253383 30253324 MAPK pathway FOS NM_005252 chr14:75748214 75748273 JUN NM_002228 chr1:59246570 59246511 DUSP1 NM_004417 chr5:172195355 172195296

DUSP5 NM_004419 chr10:112270900 112270959 CACNA1E NM_001205293 chr1:181770655 181770714 RASGRP1 NM_005739 chr15:38780497 38780438 PLA2G2C NM_001105572 chr1:20490544 20490485 STK3 NM_001256312 chr8:99466971 99466912 MAP2K3 NM_145109 chr17:21218464 21218523 JUND NM_001286968 chr19:18391430 18391371 CDC25B NM_021873 chr20:3786178 3786237 PRKX NM_005044 chrx:3522850 3522791 PLA2G2D BC025706 chr1:20438949 20438890 FGF20 NM_019851 chr8:16850546 16850487 GADD45G NM_006705 chr9:92221400 92221459 NFKB2 NM_001261403 chr10:104161053 104161229 JMJD7-PLA2G4B NM_005090 chr15:42140278 42140337 NFATC4 NM_001136022 chr14:24848746 24848805 GADD45B NM_015675 chr19:2478178 2478237 MAP2K4 NM_001281435 chr17:12045140 12045199 MAP3K12 NM_006301 chr12:53875961 53875902 DUSP2 NM_004418 chr2:96809962 96809903 MAP4K2 NM_004579 chr11:64557236 64557072 ELK4 NM_021795 chr1:205592863 205592804 MAP3K4 NM_006724 chr6:161455421 161455480 CDC42 NM_044472 chr1:22416563 22416622 CACNA2D2 NM_001005505 chr3:50400526 50400467 PDGFB NM_002608 chr22:39620158 39620099 MAPK8IP3 NM_015133 chr16:1820258 1820317 AKT2 NM_001626 chr19:40761134 40761075 MAP3K14 NM_003954 chr17:43340768 43340709 HSPA1B NM_005346 chr6:31797870 31797929 TRAF2 NM_021138 chr9:139820997 139821056 CACNB3 NM_000725 chr12:49222321 49222380 MAP3K1 NM_005921 chr5:56191750 56191809 IL1B NM_000576 chr2:113587488 113587429 MAP3K6 NM_004672 chr1:27684040 27683981 DUSP4 NM_001394 chr8:29194441 29194382 NR4A1 NM_002135 chr12:52453226 52453285 IKBKG NM_003639 chrx:153792864 153792923 CD14 NM_001174104 chr5:140011377 140011318 CACNB2 NM_000724 chr10:18829909 18829968 FGFR1 NM_023110 chr8:38270529 38270470 MRAS NM_012219 chr3:138124161 138124220 MAP4K4 NM_145686 chr2:102510718 102510777 FGFR3 NM_000142 chr4:1809054 1809113 GNG12 NM_018841 chr1:68167216 68167157 ATF2 NM_001880 chr2:175939522 175939463 HSPA1A NM_005345 chr6:31785491 31785550 MAP3K5 NM_005923 chr6:136878408 136878349 MAP4K1 NM_001042600 chr19:39087748 39087689

PDGFRB NM_002609 chr5:149493523 149493464 MAPK10 NM_138980 chr4:86938098 86938039 HSPA6 NM_002155 chr1:161495332 161495391 NLK NM_016231 chr17:26523332 26523391 TAB2 NM_015093 chr6:149700594 149700653 TGFB3 NM_003239 chr14:76424963 76424904 MKNK1 NM_003684 chr1:47023654 47023595 CACNA1A NM_023035 chr19:13317339 13317280 HSPB1 NM_001540 chr7:75933550 75933609 RELA NM_021975 chr11:65421710 65421651 PLA2G6 NM_001004426 chr22:38525521 38525462 CACNA1C NM_000719 chr12:2801192 2801251 BRAF NM_004333 chr7:140434478 140434419 FGF2 NM_002006 chr4:123819317 123819376 TAOK1 NM_020791 chr17:27871269 27871328 MAPK7 NM_139033 chr17:19286634 19286693 TNF NM_000594 chr6:31545837 31545896 PPP3CC NM_005605 chr8:22398566 22398625 RASGRP2 NM_153819 chr11:64508476 64508420 RELB NM_006509 chr19:45541385 45541444 MAP3K11 NM_002419 chr11:65365286 65365227 MAP3K3 NM_203351 chr17:61773608 61773667 GADD45A NM_001924 chr1:68153371 68153430 PLA2G5 NM_000929 chr1:20417423 20417482 PDGFA NM_002607 chr7:536988 536929 MAP3K8 NM_005204 chr10:30749980 30750039 SOS1 NM_005633 chr2:39213330 39213271 KRAS NM_004985 chr12:25378608 25378549 ATF4 NM_001675 chr22:39918577 39918636 AKT1 NM_005163 chr14:105236034 105235975 ARRB2 NM_004313 chr17:4624528 4624587 FGF7 NM_002009 chr15:49776810 49776869 HRAS NM_005343 chr11:533812 533600 CACNA1B NM_000718 chr9:141018581 141018640 STK4 NM_006282 chr20:43708442 43708501 RPS6KA2 NM_021135 chr6:166827367 166827308 FAS NM_000043 chr10:90774545 90774604 TNFRSF1A NM_001065 chr12:6438123 6438064 MAPK11 NM_002751 chr22:50703284 50703225 NTRK2 NM_001018064 chr9:87366940 87366999 SRF NM_003131 chr6:43148285 43148344 CACNG3 NM_006539 chr16:24373365 24373424 MAPKAPK5 NM_139078 chr12:112330780 112330839 RASGRP3 NM_001139488 chr2:33783949 33784008 DUSP6 NM_001946 chr12:89742203 89742144 CHUK NM_001278 chr10:101948251 101948192 DDIT3 NM_004083 chr12:57911526 57911200 RRAS NM_006270 chr19:50138792 50138733

CACNA2D4 NM_172364 chr12:1902076 1902017 TRAF6 NM_145803 chr11:36511240 36511181 TAOK2 NM_016151 chr16:29999515 29999574 MEF2C NM_002397 chr5:88016876 88016817 RAF1 NM_002880 chr3:12625670 12625611 MAPK8 NM_001278547 chr10:49634025 49634084 CACNA1I NM_021096 chr22:40085423 40085482 CACNA1H NM_021098 chr16:1271711 1271770 PAK2 NM_002577 chr3:196559045 196559104 DUSP16 NM_030640 chr12:12629429 12629370 RPS6KA4 NM_003942 chr11:64139354 64139413 BDNF-AS NR_002832 chr11:27699226 27699285 FLNB NM_001457 chr3:58157442 58157501 ECSIT NM_016581 chr19:11616951 11616892 MAP3K2 NM_006609 chr2:128065062 128065003 MAX NM_145114 chr14:65550893 65550834 TGFBR1 NM_004612 chr9:101916322 101916381 TAB1 NM_153497 chr22:39833073 39833132 NFATC2IP NM_032815 chr16:28976611 28976670 MAP2K7 NM_145185 chr19:7979302 7979361 FGFR2 NM_022970 chr10:123243276 123243217 RAPGEF2 NM_014247 chr4:160281049 160281108 FGF11 NM_004112 chr17:7347918 7347977 STMN1 NM_203401 chr1:26227291 26227232 MYC NM_002467 chr8:128753268 128753327 MKNK2 NM_199054 chr19:2038249 2038190 RASA1 NM_002890 chr5:86686765 86686824 PRKCB NM_002738 chr16:24226173 24226233 HSPA2 NM_021979 chr14:65009538 65009597 PRKACB NM_002731 chr1:84702761 84702820 MAP2K1 NM_002755 chr15:66783224 66783283 MAP4K3 NM_003618 chr2:39477451 39477392 NRAS NM_002524 chr1:115249992 115249933 PRKACA NM_002730 chr19:14203200 14203141 TGFBR2 NM_001024847 chr3:30735163 30735222 MAPKAPK3 NM_004635 chr3:50686364 50686423 MAPK9 NM_002752 chr5:179669726 179669667 MAPK13 NM_002754 chr6:36107315 36107374 MECOM NM_005241 chr3:168806898 168806839 RASA2 NM_006506 chr3:141328847 141328906 RAP1A NM_001010935 chr1:112255449 112255508 PPP3R1 NM_000945 chr2:68408138 68408079 PDGFRA NM_006206 chr4:55163989 55164048 CRK NM_016823 chr17:1326464 1326405 IL1R1 NM_000877 chr2:102792046 102792105 TAOK3 NM_016281 chr12:118610340 118610281 HSPA8 NM_153201 chr11:122929537 122929478 PLA2G2A NM_000300 chr1:20305279 20305011

IL1R2 NM_004633 chr2:102632505 102636150 RRAS2 NM_012250 chr11:14299525 14299466 MAP2K5 NM_002757 chr15:67985864 67995691 TGFB1 NM_000660 chr19:41847802 41838142 RPS6KA5 NM_182398 chr14:91360557 91360498 FASLG NM_000639 chr1:172635685 172635744 MAPK1 NM_138957 chr22:22123603 22123544 DUSP3 NM_004090 chr17:41844207 41844148 CRKL NM_005207 chr22:21307425 21307484 PLA2G1B NM_000928 chr12:120760012 120759953 PTPN7 NM_080588 chr1:202116504 202116445 PPP3CA NM_000944 chr4:101945353 101945294 RASGRF1 NM_002891 chr15:79282572 79277529 RAC3 NM_005052 chr17:79992018 79992077 GRB2 NM_002086 chr17:73314921 73314862 PLA2G12A NM_030821 chr4:110635616 110635557 LAMTOR3 NM_021970 chr4:100803178 100803119 RPS6KA1 NM_002953 chr1:26898034 26898093 RAP1B NM_015646 chr12:69054183 69054242 RAC1 NM_018890 chr7:6443013 6443072 DUSP14 NM_007026 chr17:35873238 35873297 MAP2K6 NM_002758 chr17:67537962 67538021 SOS2 NM_006939 chr14:50584382 50584323 PLA2G4A NM_024420 chr1:186957652 186957711 ZAK NM_133646 chr2:174091756 174091815 EGFR NM_005228 chr7:55274841 55274900 PPM1B NM_001033556 chr2:44436360 44436419 FGF1 NM_001257206 chr5:142077336 142077277 MAPK3 NM_002746 chr16:30128296 30128237 DAXX NM_001350 chr6:33287319 33287260 RPS6KA3 NM_004586 chrx:20173538 20173480 MAP3K7 NM_003188 chr6:91225746 91225687 FGF14-AS2 NR_036487 chr13:103047919 103047978 RAC2 NM_002872 chr22:37621511 37621452 FLNA NM_001110556 chrx:153577323 153577264 FGF13 NM_004114 chrx:137713947 137713888 MAPKAPK2 NM_004759 chr1:206906945 206907004 GNA12 NM_007353 chr7:2769904 2769845 CASP3 NM_004346 chr4:185549080 185549021 DUSP10 NM_007207 chr1:221875832 221875773 NF1 NM_000267 chr17:29541564 29546042 ARRB1 NM_004041 chr11:74978736 74977300 PPP3CB AK301582 chr10:75204417 75204358 HSPA1L NM_005527 chr6:31777957 31777898 MAPK8IP2 AK094442 chr22:51052343 51052402 IKBKB XM_005273494 chr8:42183031 42183090 NFKB1 NM_003998 chr4:103537856 103537915 PAK1 TCONS_00019715 chr11:77185567 77185508

MAP2K2 NM_030662 chr19:4097325 4095437 PRKCA NM_002737 chr17:64806770 64806829 AKT3 NM_005465 chr1:243665260 243665201 DUSP8 NM_004420 chr11:1575341 1575282 MOS NM_005372 chr8:57025995 57025936 RASGRP4 NM_170604 chr19:38899919 38899860

Supplementary Table 8. Clinical characteristics of sequencing and validation cohorts of NKTCL patients with follow-up data (n = 95). Variable wild-type (n = 62) DDX3X (n = 20) mutations* TP53 (n = 14) Age (years) Gender Ann Arbor stage ECOG Extranodal involvement LDH level IPI score B symptom Therapy 60 49 16 10 > 60 13 4 4 P = 1.000 P = 0.689 Female 25 3 4 Male 37 17 10 P = 0.056 P = 0.410 I II 52 16 10 III IV 10 4 4 P = 0.736 P = 0.689 0 1 51 13 10 2 5 11 7 4 P = 0.126 P = 1.000 < 2 51 14 8 2 11 6 6 P = 0.340 P = 0.487 Normal 37 9 7 Elevated 25 11 7 Low and low-intermediate risk (0 2) High-intermediate and high risk (3 5) P = 0.304 P = 1.000 54 13 10 8 7 4 P = 0.043 P = 1.000 Absent 40 10 8 Present 22 10 6 P = 0.296 P = 0.738 Chemotherapy alone 11 4 6 Chemotherapy plus Radiotherapy 51 16 8 P = 1.000 P = 0.071 * One individual with both DDX3X and TP53 mutations was grouped into two cohorts with mutations. LDH, lactate dehydrogenase; IPI, International Prognostic Index. All variables were analyzed by Fisher s exact test. The P value was obtained by comparing wild-type and DDX3X mutations groups or DDX3X and TP53 mutations groups.

Supplementary Table 9. The multivariate analysis and univariate analysis for clinical and biological characteristics of overall survival and progression-free survival in NKTCL patients (n = 95*). Variable Multivariate analysis OS PFS P OR (95% CI) P OR (95% CI) DDX3X 3.798 2.551 0.003 0.016 (mutation vs. wild-type) (1.580 9.130) (1.190 5.468) TP53 4.918 5.803 0.000 0.000 (mutation vs. wild-type) (2.137 11.316) (2.639 12.757) IPI score 4.396 4.008 0.000 0.001 (3 5 vs. 0 2) (2.001 9.656) (1.831 8.774) B symptom (present vs. absent) NS 0.055 Radiotherapy 0.282 0.005 (yes vs. no) (0.117 0.682) Extranasal involvement (yes vs. no) NS - Univariate analysis Variable P (OS) P (PFS) NS 2.145 (0.984 4.672) Age (> 60y vs. 60y) 0.737 0.762 Gender (male vs. female) 0.754 0.530 DDX3X (mutation vs. wild-type) 0.027 0.009 TP53 (mutation vs. wild-type) 0.000 0.000 IPI score (3 5 vs. 0 2) 0.000 0.000 B symptom (present vs. absent) 0.000 0.000 Radiotherapy (yes vs. no) 0.000 0.002 Extranasal involvement (yes vs. no) 0.018 0.061 * OS, overall survival; PFS, progression free survival; IPI, International Prognostic Index; wild-type, individuals without DDX3X or TP53 mutations; mutation, individuals with DDX3X or TP53 mutations.

Supplementary Table 10. Sequencing analysis summary of samples from 25 NKTCL patients subject to whole-exome sequencing. Patient ID L01 L02 L03 L04 L05 L06 L07 L08 L09 L10 L11 L12 L13 L14 L15 L16 L17 L18 L19 L20 L21 Sample Depth * Coverage * 1X 2X 4X 8X 10X 15X 20X Tumor 117.1 95.5% 93.3% 90.2% 85.9% 84.1% 79.8% 76.1% Blood 121.5 94.9% 92.5% 89.2% 84.5% 82.5% 78.0% 74.2% Tumor 68.1 96.6% 95.2% 92.8% 88.4% 86.3% 81.0% 76.0% Blood 77.2 96.6% 95.2% 92.9% 88.9% 87.0% 82.3% 77.9% Tumor 68.5 96.3% 94.9% 92.8% 89.0% 87.0% 82.1% 77.2% Blood 72.9 96.8% 95.4% 93.2% 89.4% 87.5% 82.7% 78.1% Tumor 118.1 96.5% 94.8% 92.2% 88.4% 86.7% 83.0% 79.4% Blood 113.8 96.3% 94.5% 91.8% 87.9% 86.2% 82.3% 78.6% Tumor 108.1 96.2% 94.5% 91.9% 88.0% 86.3% 82.3% 78.6% Blood 120.1 96.5% 94.8% 92.2% 88.4% 86.9% 83.2% 79.7% Tumor 111.7 96.3% 94.8% 92.4% 88.8% 87.3% 83.6% 80.1% Blood 112.7 96.1% 94.3% 91.8% 87.9% 86.2% 82.3% 78.6% Tumor 69.9 96.5% 95.1% 93.0% 89.2% 87.4% 82.6% 78.0% Blood 78.8 96.3% 94.9% 92.8% 89.1% 87.3% 82.9% 78.6% Tumor 75.3 96.1% 94.5% 91.9% 87.4% 85.2% 79.9% 74.8% Blood 58.8 96.3% 94.5% 91.6% 86.5% 84.0% 77.6% 71.5% Tumor 85.4 96.7% 95.3% 93.2% 89.6% 87.8% 83.3% 78.8% Blood 88.0 96.6% 95.1% 93.1% 89.5% 87.9% 83.7% 79.5% Tumor 102.4 95.4% 93.2% 89.9% 85.2% 83.0% 78.1% 73.8% Blood 117.2 94.7% 92.3% 88.7% 83.5% 81.2% 76.1% 71.8% Tumor 105.5 95.3% 93.1% 89.8% 84.8% 82.6% 77.6% 73.2% Blood 103.3 95.3% 93.0% 89.6% 84.5% 82.3% 77.1% 72.7% Tumor 93.8 95.8% 93.9% 91.0% 86.7% 84.8% 80.3% 76.2% Blood 59.6 96.2% 94.5% 91.8% 87.5% 85.6% 80.6% 75.6% Tumor 64.7 95.5% 93.4% 90.0% 84.7% 82.3% 76.5% 71.3% Blood 70.5 97.1% 95.6% 93.3% 89.6% 88.0% 84.1% 80.0% Tumor 239.5 98.2% 97.6% 96.7% 95.3% 94.6% 93.1% 91.7% Blood 216.1 98.3% 97.6% 96.6% 94.9% 94.2% 92.5% 91.0% Tumor 258.1 98.9% 98.6% 98.3% 97.9% 97.7% 97.2% 96.8% Blood 265.1 98.9% 98.6% 98.3% 97.8% 97.6% 97.2% 96.8% Tumor 225.8 98.4% 97.8% 96.8% 95.3% 94.6% 93.0% 91.6% Blood 227.8 98.1% 97.4% 96.3% 94.4% 93.5% 91.7% 90.0% Tumor 209.6 99.0% 98.8% 98.5% 98.0% 97.8% 97.3% 96.8% Blood 192.4 98.9% 98.7% 98.3% 97.8% 97.6% 97.0% 96.4% Tumor 113.1 98.7% 98.3% 97.8% 97.0% 96.6% 95.5% 94.1% Blood 206.3 98.8% 98.6% 98.2% 97.7% 97.5% 97.0% 96.4% Tumor 156.5 98.9% 98.6% 98.2% 97.5% 97.3% 96.5% 95.7% Blood 166.7 99.0% 98.7% 98.3% 97.7% 97.5% 96.8% 96.0% Tumor 188.2 99.0% 98.7% 98.4% 97.9% 97.6% 97.0% 96.4% Blood 192.3 98.9% 98.6% 98.3% 97.8% 97.5% 96.9% 96.3% Tumor 170.8 98.8% 98.5% 98.1% 97.6% 97.3% 96.6% 95.9% Blood 192.4 98.9% 98.6% 98.2% 97.7% 97.4% 96.8% 96.2%

L22 L23 L24 Tumor 160.0 99.0% 98.6% 98.2% 97.6% 97.3% 96.5% 95.6% Blood 191.8 99.1% 98.8% 98.4% 97.9% 97.6% 97.0% 96.4% Tumor 117.2 98.8% 98.4% 98.0% 97.2% 96.9% 95.8% 94.6% Blood 120.3 98.8% 98.4% 98.0% 97.3% 96.9% 96.0% 94.8% Tumor 98.9 99.3% 98.9% 98.1% 97.0% 96.5% 95.1% 93.3% Blood 200.8 98.9% 98.6% 98.3% 97.7% 97.5% 96.9% 96.3% Tumor 121.7 98.7% 98.4% 98.0% 97.3% 97.0% 96.0% 94.9% L25 Blood 129.2 98.8% 98.5% 98.0% 97.4% 97.0% 96.1% 95.0% * Based on 33Mb RefSeq coding sequence region.

Supplementary Table 11. The RNA oligonucleotide sequences of RNA unwinding assay. Name Sequence (5 3 ) r18mer_fam r36mer CCCAAGAACCCAAGGAAC ACCAGCUUUGUUCCUUGGGUUCUUGGGAGCAGCAGG

Supplementary Table 12. The primer sequences of DDX3X shrna. Name Sequence (5 3 ) DDX3X-shRNA1 DDX3X-shRNA2 Non-targeting shrna GATCCGGATCTCGTAGTGATTCAAGATTCAAGAGATCTTGAATCACTACGAGAT CCTTTTTTACGCGTG GATCCGGTAGAATAGTCGAACAAGATTTCAAGAGAATCTTGTTCGACTATTCTAC CTTTTTTACGCGTG GATCCAGCGTGTAGCTAGCAGAGGTTCAAGAGACCTCTGCTAGCTACACGCTT TTTTTACGCGTG