FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP
|
|
- Πρίσκιλλα Ζάππας
- 6 χρόνια πριν
- Προβολές:
Transcript
1 FENXI HUAXUE Chinese Journal of Analytical Chemistry ~ 1713 DOI /SP. J * Single nucleoitide polymorphism SNP PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps PCR DNA 24 MTHFR C677T 1 SNP ~ 9 10 ~ 13 Lien 12 DNA SNP Nakagawa 13 DNA ALDH2 SNP MTHFR C677T Cy3 Cy Nos No. 2007AA Nos. 2007CB CB No No. 2009ZX No C No. 08B018 No. 09JJ JJ3017 * nyhe1958@ 163. com
2 PTC 220 PCR MJ Research GenePix 4100A Axon Nano-Plotter Gesim 1 MTHFR C677T Table 1 Oligonucleotide sequence 1 Name Type Sequence 5'-3' C677T-F Primer TGAAGGAGAAGGTGTCTGCGGGA Biotin-C677T-R Biotin-labeled primer Biotin- T 15 AGGACGGTGCGGTGAGAGTG C677T-CC Cy3 labeled probes Cy3-CGGGAGCCGATTT Taq DNA Taq DNA C677T-TT Cy5 labeled probes Cy5-CGGGAGTCGATTT polymerase 5U /μl dntp Thermo Fisher Sigma-Aldrich NH 4 Fe SO H 2 O 99. 0% NH 4 Fe SO H 2 O 99. 0% NaOH 95% AuCl 3 HCl 4H 2 O 3-Mercaptopropyltriethoxysilane MPTES Sigma-Aldrich - 36 nm 4. 0 g /L PBS ph EDTA DNA QIAGEN D PCR SA-GMNPs ssdna-gmnps HoW CC Cy3 HoM TT Cy5 Cy3 Cy Gold coated magnetic nanoparticles GMNPs 16 1 mg 200 μg 0. 1 mol /L PBS ph ml 0. 1 mol /L PBS 2 4 g /L PBS PCR DNA PCR 95 dsdna-gmnps ssdna- GMNPs - DNA DNA ssdna C677T PCR SNP PCR MTHFR C677T 30 μl 10 PCR 3 μl 25 mmol /L Mg μl 10 mmol /L dntp 0. 6 μl PCR 1 ml U Taq DNA 5 U /L DNA 80 ng PCR 94 5 min s s s min μg μl 10 μmol /L 5'-Biotin-TGAAGGAGAAGGTGTCTGCGGGA-Cy3 5'-Biotin-
3 TGAAGGAGAAGGTGTCTGCGGGA-Cy5 15 min ddh 2 O 5 μl ddh 2 O μl ss-dna SA-GMNPs 3 SSC ddh 2 O 2 3 min SNP MTHFR C677T PCR 10 μmol /L 677CC 677TT 6. 5 μl 22 μl 30 μl 38 1 h 3 SSC ddh 2 O Cy3 Cy5 4100A Axon USA Cy3 550 nm 570 nm Cy5 649 nm 670 Cy3 Cy5 Genepix 6. 0 Origin SNP SNP 3 I = log Signal Cy3 + Cy5 G = Signal Cy3 /Signal Cy3 + Cy I > 3 I G 1 G 0 G G < 0. 2 HoM < G < He G > 0. 8 HoW I G SNP Fig. 1 Quality detection standard of single nucleotide polymorphism SNP genotyping results 2A 2B 8%
4 DNA PCR 10 μmol /L 1 μl μmol /L 3 MTHFR C677T PCR PCR 3b Fig. 2 Immobility assay of magnetic bead array 1 4 A. Fluorescence images before and after washing B. Relative fluorescence intensities before and after washing. Cy Cy PCR Fig. 3 DNA Effect of primer proportion on SNP genotyping after asymmetry PCR DNA PCR PCR PCR - PCR PCR μmol /L μmol /L DNA S1 ~ S5 S'1 ~ S'5 50% PCR μmol /L 3. 4 SNP SNP 24 C677T 5A C677T B 24 I G SNP I > 3 24
5 C677T G > PCR Cy3 677CC 677CC 3 G < PCR Cy5 677TT 677TT 8 G = ~ Cy3 677CC Cy5 677TT 677CT 4 DNA Fig. 4 Effect of primer concentration on SNP genotyping 95 PCR of five samples after asymmetry PCR A. Preparation of scanning results B. Comparation of relative PCR DNA fluorescence intensities. 5 C677T 24 Fig. 5 Results of SNP detection of 24 samples based on bead array and dual-color hybridization assayed for C677T locus. A Fluorescence images of microarray B All spots were measured for Cy3 and Cy5 fluorescence intensities to generate a scatter plot PCR References 1 Fan J B Chee M S Gunderson K L. Nat. Rev. Genet ~ Pastinen T Raitio M Lindroos K Tainola P Peltonen L Syv nen A C. Genome Res ~ ZHANG Xiao-Yan ZUO Ming-Xue ZHANG Zhan-Jun WANG Zhong LI Yao. China Biotechnology ~ 56 4 Schena M Heller R A Theriault T P Konrad K Lachenmeier E Davis R W. Trends Biotechnology ~ Dieh F Beckmann B Kellner N Hauser N C Diehl S Hoheisel J D. Nucleic Acids Res e79
6 WANG Feng-Hua LIU Jun TONG Chun-Yi WANG Qi-Ming TANG Dong-Ying YI Long WANG Ling-Ling LIU Xuan-Ming. Chinese J. Anal. Chem ~ Saiyed Z M Bochiwal C Gorasia H Telang S D Ramchand C N. Analytic Biochemistry ~ ZHANG Zhi-Chao YUAN Cui WAN Qian-Hong. Chinese J. Anal. Chem ~ 36 9 LIU Ya-Ling JIA Li XING Da. Chinese J. Anal. Chem ~ Zhou H J Xing D Zhu D B Zhou X M. Talanta ~ Yoshino T Tanaka T Takeyama H Matsunaga T. Biosensors and Bioelectronics ~ Lien K Y Liu C J Lin Y C Kuo P L Lee G B. Microfluid Nanofluid ~ Nakagawa T Hashimoto R Maruyama K Tanaka T Takeyama H Matsunaga T. Biotechnol. Bioeng ~ Li S Liu H N Wang Z F Hou P Guo Y F He Q G He N Y. Anal. Biochem ~ Liu H N Li S Wang Z F Ji M J Nie L B He N Y. Journal of Biotechnology ~ Takuya K Satoshi S Yoshiteru M Yohei O Takashi N Kenji O Takao A Y. J. Magn. Magn. Mater ~ 110 Single Nucleotide Polymorphism Genotyping Based on Magnetic Bead Array and Dual-color Hybridization LIU Hong-Na 1 LI Song 1 2 LIU Li-Shang 2 TIAN Lan 1 JIA Ying-Ying 1 LI Zhi-Yang 2 DENG Yan 1 2 HE Nong-Yue * State Key Laboratory of Bioelectronics Southeast University Nanjing Hunan Key Laboratory of Green Packaging and Application of Biological Nanotechnology Hunan University of Technology Zhuzhou Abstract An approach to fabricate magnetic bead array using gold coated magnetic nanoparticles was developed. Single strand DNAs ssdna obtained using asymmetry PCR were captured on gold coated magnetic nanoparticles SA-GMNPs modified with streptavidin. The GMNPs-ssDNA mixtures were spotted onto a clean glass slide adhered with a magnet to fabricate a bead array and then interrogated by hybridization with a pair of dual-color probes to determine single nucleotide polymorphism SNP. The genotype of each sample can be simultaneously identified on the surface of GMNPs by scanning the microarray. The amplification factors were optimized to obtain ssdna directly by use of polymerase chain reaction PCR. In this method the genotyping results were obtained from 24 different samples analyzed for C677T loci. The method described here is simple and easily to be automated which is suitable for molecular diagnostics and forensic analysis. Keywords Magnetic bead array Asymmetry polymerase chain reaction Dual-color hybridization Single nucleotide polymorphism type Received 25 February 2010 accepted 5 June 2010
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
- A. A Biphenol A BPA BPA BPA LLE 5 SPE Electrospinning Kang. Packed-fiber solid-phase extraction PFSPE 1 ml
38 200 4 FENXI HUAXUE Chinese Journal of Analytical Chemistry 4 503 ~ 507 DOI 0. 3724 /SP. J. 096. 200. 00503 6 - A * 2 2 * 2 20009 2 20096 6 - A ph 6 0 ml ph 8. 0 3 ml /min. 5 mg 6 300 μl A 6 0. 20 ~
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *
DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
SFO-DLLME 12 DLLME DLLME SFO-DLLME. 1 L NaCl 1 mol /L H 3 PO 4
38 2010 10 FENXI UAXUE Chinese Journal of Analytical Chemistry 10 1400 ~ 1404 DOI 10. 3724 /P. J. 1096. 2010. 01400 - - * 442700 442000 - FO-DLLME - 3 24 1-200 μl 300 μl 1. 2 g NaCl 1 mol /L 3 PO 4 200
FENXI HUAXUE Chinese Journal of Analytical Chemistry. LC-MS n Thermo Christ
42 2014 4 FENXI HUAXUE Chinese Journal of Analytical Chemistry 4 552 ~ 558 DOI 10. 3724 /SP. J. 1096. 2014. 30594 α- 1 2 * 1 1 * 1 1 130022 2 100039 LC-ESI-MS n α- 4- -α-d- PNPG α- 0. 027 0. 050 g /L α-
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
Preparation of Hydroxyapatite Coatings on Enamel by Electrochemical Technique
25 7 2009 7 CHINESE JOURNAL OF INORGANIC CHEMISTRY Vol.25 No.7 1187~1193 1,2 *,1 1 ( 1, 361005) ( 2, 363105) : Ca(NO 3 ) 2 NH 4 H 2 PO 4 NaNO 3, (HA) X (XRD) (SEM) (EDS), ph (HA), HA c ph 6 0.5 ma cm -2
1010 C 73 H 108 O 12. FENXI HUAXUE Chinese Journal of Analytical Chemistry 399 ~ HPLC. PDA 282 nm PP 1010 Weibull PP PP.
43 2015 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 399 ~ 403 DOI 10. 11895 /j. issn. 0253-3820. 140659 1 2 1 2 2 2 * 1 1 100081 2 100089 PP 2 6- BHT 3 5- -4-1010 190 PP 0. 1 mm HPLC PDA 282
) ; GSP ) ;PXD g, 100 ml
30 (FENXI HUAXUE) 10 2002 10 Chinese Journal of Analytical Chemistry 1163 1167 3 3 3 (, 225002) PVC, 1. 0 10-4 1. 0 10-8 molπl, 58. 6 mvπdecade ; 2. 5 10-9 molπl, 2 3,,,,, 1, PVC Pretsch 1, EDTA,, 5 10-12
Analysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis
2012 3 Vol. 30 No. 3 March 2012 Chinese Journal of Chromatography 304 ~ 308 DOI 10. 3724 /SP. J. 1123. 2011. 11015 * 210009 9. 5% v /v 80 2 h 234 nm 60 cm 50 cm 50 μm 25 20 kv 350 mmol /L ph 10. 21 3.
Separation and Determination of Ephedrine Pseudoephedrine and Methylephedrine by Capillary Electrophoresis with Electrochemiluminescence Detection
31 2 2012 2 FENXI CESHI XUEBAO Journal of Instrumental Analysis Vol. 31 No. 2 127 ~ 132 - * 730070 PB - Eu - 3 8 min 0. 025 ~ 10 0. 025 ~ 25 0. 05 ~ 10 mg /L 3 1. 00 mg /L 3 6 RSD 4. 5% 0. 95% 3 101%~
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon
13 1 Vol13 No1 29 2 Life Science Research Feb 29 29 *,,,,, 4182 :,, (Molecular Beacon, MB),,,, 5~5 U / ml, 5 U / ml, Alu : ; ; : Q55 : A : 17-7847(29)1-6-5 A Novel Fluorescence Assay for the Activity of
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
The Exploitation and Utilization of Magnesium Resources in Salt Lakes
21 11 2009 11 PROGRESS IN CHEMISTRY Vol. 21 No. 11 Nov., 2009 3 1,2 1 1,2 1,2 1,2 1,2 1 3 3 (1. 810008 ; 2. 100049),,, : O61412 ; TQ13212 : A : 10052281X(2009) 1122358207 The Exploitation and Utilization
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
Evaluation on precision of occurrence measurement based on theory of errors
35 2 2016 6 GLOBAL GEOLOGY Vol. 35 No. 2 Jun. 2016 1004 5589 2016 02 0567 08 130026 5 ± 4 ± 3 4 P21 TD17 A doi 10. 3969 /j. issn. 1004-5589. 2016. 02. 030 Evaluation on precision of occurrence measurement
Preparation of superfine aluminum hydroxide by ion-exchange membrane electrolysis
18 7 2008 7 Vol.18 No.7 The Chinese Journal of Nonferrous Metals Jul. 2008 1004-0609(2008)07-1330-06 ( 410083) r/min g/l 0. g/l 3.9 µm TF 111.52 A Preparation of superfine aluminum hydroxide by ion-exchange
Supplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
ph Maillard MRPs maillard reaction products Maillard ph kDa Maillard Maillard DOI /j. issn
2015 29 1 0063 ~ 0069 Journal of Nuclear Agricultural Sciences 63 1000-8551 2015 01-0063-07 ph Maillard 1 1 2 2 2 2 2 1 400067 2 / 100193 ph Maillard MRPs maillard reaction products ph ph 5 7 9 100. 11
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Study of Ne w Chemiluminescence Technique Recognition of Sodium Azide by External Reference Method
2004 62 8, 794 798 ACTA CHIMICA SINICA Vol 62, 2004 No 8, 794 798 Ξ Ξ ( 200032),, : :H 2 O 2 2CH 3 CN2 ( ) H 2 O 2 2CH 3 CN2N2 252 ( ),,, IgG Study of Ne w Chemiluminescence Technique Recognition of Sodium
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Inhibition of mushroom tyrosinase by flavonoid from Sorbus tianschanica Ruper in Xinjiang
13 4 2015 7 Chinese Journal of Bioprocess Engineering Vol. 13 No. 4 Jul. 2015 doi 10. 3969 /j. issn. 1672-3678. 2015. 04. 012 1 2 2 2 2 1. 830054 2. 361005 L- 50% IC 50 0. 27 mg /ml K I - K IS 0. 218 0.
Investigation on Fast Determination of Trace N2Nitrosamines Assisted by Microwave Radiation
2002 60 5, 876 881 ACTA CHIMICA SINICA Vol 60, 2002 No 5, 876 881 Ξ ( 210093), NOBr NO x ( x < 2),, CrO 3, NO x ( x < 2) NO 2, 90 %, (TEA) (76 % 96 %) ; 2 10-8 mol/ L /,, 3 min, ( ),, Investigation on
ZnO-Bi 2 O 3 Bi 2 O 3
20 7 2010 7 Vol.20 No.7 The Chinese Journal of Nonferrous Metals July 2010 1004-0609(2010)07-1396-06 ZnO-Bi 2 O 3 Bi 2 O 3 1, 2 1 1 1 2 (1., 212013; 2., 200444) ZnO-Bi 2 O 3 XRD SEM 1 100 1 000 1 100 1
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Journal of Central South University (Science and Technology) May Bragg TU443 A (2011)
42 5 ( ) Vol.42 No.5 2011 5 Journal of Central South University (Science and Technology) May 2011 Bragg 1 1 1 2 2 (1. 330099 2. 330038) ( ) D10 Bragg TU443 A 1672 7207(2011)05 1442 05 Fiber Bragg grating
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Research on explaining porosity in carbonate reservoir by capture cross section method
33 4 2014 12 GLOBAL GEOLOGY Vol. 33 No. 4 Dec. 2014 1004-5589 2014 04-0875 - 05 1 2 1 2 1. 130026 2. 830011 PND SIGMA CATO SIGMA CNL 0. 91 SIGMA CATO P631. 325 A doi 10. 3969 /j. issn. 1004-5589. 2014.
Potentiometric Diphtheria Immunosensor Based on a Glassy Carbon Electrode Modified with Colloidal Gold and Anti2Diph
2004 62 20, 2062 2066 ACTA CHIMICA SINICA Vol 62, 2004 No 20, 2062 2066 ΞΞ ( 400715) (AET) ( GCE), (NG), (Cys) ( GA) (anti2diph), (Diph), 24 600 ng ml - 1, 8 9 mv/ decade, 0 9979, 5 2 ng ml - 1,,,,, Potentiometric
Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent
Supplementary information for the paper Protease-catalysed Direct Asymmetric Mannich Reaction in Organic Solvent Yang Xue, Ling-Po Li, Yan-Hong He * & Zhi Guan * School of Chemistry and Chemical Engineering,
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR
1277 HBV DNA* 1 2 3 2 1 1 210029 2 210002 3 200001 5' 10 min 15 33 HBsAg PCR 250 copies/ml PCR 100% PCR DNA R446.5 B 1673-6273 2011 07-1277-05 Development of a sensitive, visual nucleic acid dipstick assay
N 2. Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites and Molecular Sieves
2003 61 3, 376 381 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 376 381 N 2 Ξ Ξ ( 210093), N 2 (NNN) NNN ; NNN :NNN N N O NNN, N 2,,,, Temperature Programmed Surface Reaction of N 2Nitrosonornicotine on Zeolites
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
(bpy) 2 + , ECL, (polarization fluoroimmunometry) [8 ],HPLC [9 ] (CZE) [10 ] 2. 1 Ru(bpy) 3 Cl 2 6H 2 O Aldrich, ;
30 HUAXUE) 5 (FENXI 2002 5 Chinese Journal of Analytical Chemistry 513 517 3 (, 361005) (, 361005) [ Ru(bpy) 3 Cl 2 ] ( ECL), ECL, 0. 05 molπl (ph = 9. 0), (METH) ECL 6. 8 10-11 6. 8 10-3 molπl, 2 10-16
Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Supplementary material
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2015 Supplementary material Recyclable
Application of Mohr-Coulomb yield criterion in geo-technical engineering
29 4 2010 12 GLOBAL GEOLOGY Vol. 29 No. 4 Dec. 2010 1004-5589 2010 04-0633 - 07 Mohr-Coulomb 1 2 3 1. 130026 2. 130031 3. 100024 Tresca Mises Mohr-Coulomb Mohr-Coulomb Mohr-Coulomb Mohr-Coulomb Mohr-Coulomb
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Electronic Supplementary Information (ESI)
Electronic Supplementary Information (ESI) Lanthanide metal-organic frameworks constructed by asymmetric 2-nitro-biphenyl-4,4 -dicarboxylate ligand: syntheses, structures, luminescence and magnetic investigations
HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1
HPLC- ESI-MS * 200 Vol.11 No.1 ** 266061 266061 361005 266003 - HPLC-ESI-MS HPLC-ESI-MS HPLC HPLC-ESI-MS 11 HPLC - Asterias rollestoni Bell. [1~7] [1] [5~7] - - [8~] LC- MS * ** 173 2008-11-04 200-01-06
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
CdSe Hg? CdTe. Cu 2 + CdTe DNA. CdS / CdS /DNA NPs 10. CdSe /D-Pen /L-Cys Eeinburgh AFS-230E. D % Avocado Research Chemicals L- 98%
38 2010 10 FENXI HUAXUE Chinese Journal of Analytical Chemistry 10 1405 ~ 1410 DOI 10. 3724 /SP. J. 1096. 2010. 01405 CdSe Hg? * 510631 D- L- CdSe Hg? Hg? Cd 2 + HSe - D-Pen L-Cys 1 0. 25 2 1. 2 ph = 7.
Syntheses of a Series of Lactato Cobalt Complexes and Their Interaction with Bovine Serum Albumin
27 7 2011 7 CHINESE JOURNAL OF INORGANIC CHEMISTRY Vol.27 No.7 1239-1244 1,2 1 *,2 ( 1, 363000) ( 2, 361005) :,, 0.206 0(2) nm 0.206 8(2) nm [Co(Hlact) 2 (H 2 O) 2 ] (2) [Co(Hlact) 2 (phen)] 2H 2 O (4)
Arsenic removal from high-arsenic dust by NaOH-Na 2 S alkaline leaching
25 3 2015 3 Volume 25 Number 3 The Chinese Journal of Nonferrous Metals March 2015 1004-0609(2015)-03-0806-09 ( 410083) 0.5 0.2 5:1 90 2.0 h 400 r/min 89.64% 10.11% 1.16% 0.89% TF09 A Arsenic removal from
Capillary Gel Electrophoresis for Ligase Detection Reaction Products
THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko
PNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
100102; 2. Fe Cu Hg. Rapid multi-elemental analysis on four precious Tibetan medicines based on LIBS technique
2015 6 40 11 Vol. 40 No. 11 June 2015 LIBS 4 1,2, 1,2, 1,2, 1,2, 1,2* 1,2*, ( 1., 100102; 2., 100102) LIBS 4 4 Nd YAG 1 064 nm NIST LIBS 4 Ca Na K Mg C-N Fe Cu Hg Ag LIBS 4 LIBS Rapid multi-elemental analysis
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )
23 6 2003 12 Metallurgical Analysis :1000-7571(2003) 06-0024 - 09 3, (, 130022) : (19982001), 147 :; :O657132 :A,,Cu 2 + 4,22 2, ph10 Cu + 2,2 2 (Bi2qu) (BPB) Cu(Bi2 qu) 2 BPB,, [13 ] BPB (19982001) Cu
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus
3 3 Vol3 No3 2009 6 Life Science Research June2009 2009 HPV *,, 2,, 3, 5055 2 5000 3 50800 : HPV(Human papillomavirus) HPV (6 6 8 ), (Tm) ~60 mer,, HPV,, HPV,, : (HPV); ; ; :R372 :A :007-787(2009)03-020-06
1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Matrix solid-phase dispersion MSPD 6 Solid phase extraction SPE 8. Accelerated solvent extraction ASE 3 9 Solid phase microextraction SPME 10
38 2010 1 FENXI HUAXUE Chinese Journal of Analytical Chemistry 1 67 ~ 71 * 361005 - ph 3 1. 0 ~ 200 μg /L LOD S /N = 3 0. 13 ~ 0. 66 μg /L LOQ S /N = 10 0. 44 ~ 2. 19 μg /L 3 37. 8% ~ 101. 1% A 1 Alkylphenols
Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions
This journal is The Royal Society of Chemistry 213 Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions Wenjing Cui, a Bao Zhaorigetu,* a Meilin Jia, a and Wulan
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
5%~20% ( :
32 8 OOD & MACHINERY 2016 8 食品与机械 Vol.32No.8 Aug.2016 DOI:10.13652/j.issn.1003-5788.2016.08.001 α- Synthesisandcharacterizationofbrewer sgrainspeptidewith α-glucosidaseinhibitoryactivity FANG Yu-wen WU
VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Recent advances in coal to chemicals technology developed by SINOPEC
2013 Chinese Journal of Catalysis Vol. 34 No. 1 DOI: 10.3724/SP.J.1088.2013.21056 : 217 224 *,,, 201208 : : S-MTO ; ;. : ; ; ; ; ; : 2012-10-31. : 2012-12-03. : 2013-01-20. *. : (021)68463382; : (021)68462283;
Advance in Nanorealgar Studies
21 5 2009 5 PROGRESS IN CHEMISTRY Vol. 21 No. 5 May, 2009 1 1 2 3 (1. 430074 ; 2. 430074),,, ;,, : O61316 ; R284 : A : 10052281X(2009) 0520934206 Advance in Nanorealgar Studies Ye Xiaochuan 1 Yang Xiangliang
Supporting Information
Supporting Information Copper/Silver Cocatalyzed Oxidative Coupling of Vinylarenes with ICH 2 CF 3 or ICH 2 CHF 2 Leading to β-cf 3 /CHF 2 -Substituted Ketones Niannian Yi, Hao Zhang, Chonghui Xu, Wei
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
16 1 Vol. 16 No ELECTROCHEMISTRY Feb MnO 6 Bir-Co5% Bir-Co10% Bir-Co15% Bir-Co20%. 3 3 Li mol L - 1 MgCl 2.
16 1 Vol 16 No 1 2010 2 ELECTROCHEMISTRY Feb 2010 1006-3471 2010 01-0090-06 * 430070 X- XRD TG Mg x Co y MnO z nh 2 O 0 18 x 0 22 0 y 0 24 2 10 z 2 53 0 35 n 0 73 Tod-Co10% 10% Co Mg 0 18 Co 0 12 MnO 2
Copper-Catalyzed Oxidative Dehydrogenative N-N Bond. Formation for the Synthesis of N,N -Diarylindazol-3-ones
Electronic Supplementary Material (ESI) for Organic Chemistry Frontiers. This journal is the Partner Organisations 2016 Supporting information Copper-Catalyzed Oxidative Dehydrogenative - Bond Formation
Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer
4 Vol No4 4 009 8 Life Science Research ug 009 *,, 08 :,,, SYBR Green I,,,, β Ivs--654 (C T) CD7 ( T) : ; ; SYBR Green I; :Q9 : :007-7847(009)04-08-05 Point Mutation Detection Using Ligase-mediated Induced
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Protective and regeneration-promoting effects of Ruyi Zhenbao Pill on nerve injury in zebrafish
Drug Evaluation Research 40 3 2017 3 307 1 2 2 2 1 1 1 1. 310051 2. 250101 10.0 33.3 100.0 µg/ml NIDS-Element s 10.0 33.3 100.0 µg/ml 2% 24% 50% P 0.001 3% 29% 48% P 0.05 44% P 0.05 49% P 0.01 93% P 0.001
and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol
FeCl 3 6H 2 O-Catalyzed Disproportionation of Allylic Alcohols and Selective Allylic Reduction of Allylic Alcohols and Their Derivatives with Benzyl Alcohol Jialiang Wang, Wen Huang, Zhengxing Zhang, Xu
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
(paeonia lactiflora pall),,
31 2003 1 (FENXI HUAXUE) 1 Chinese Journal of Analytical Chemistry 59 1,3 1 1 2 2 3 1 1 (, 100084) 2 (, 100700) 3 (, 438000), 18 18 6, 45,,,,,, 1 (paeonia lactiflora pall),,, ;, 1,,,,,,, 2,, :,, 2 2. 1
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
(FENXI HUAXUE) Chinese Journal of Analytical Chemistry. Boosting
42 (FENXI HUAXUE) 11 2014 11 Chinese Journal of Analytical Chemistry 1679~ 1686 10.11895 / j.issn.0253-3820.140465 Bagging Boosting * * 100102 Near infrared spectroscopy NIR NIR Bagging Bagging-PLS Boosting
Οδηγίες χρήσης Elucigene TRP
Οδηγίες χρήσης Elucigene TRP Κωδικός καταλόγου: TH003B2 50 εξετάσεις Για in vitro διαγνωστική χρήση Κατασκευάζεται από την: Elucigene Diagnostics Greenheys House Pencroft Way Manchester Science Park Manchester
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Geological characteristics and genesis of Huanggoushan and Banmiaozi gold deposits in Laoling metallogenic belt of southern Jilin
29 3 2010 9 GLOBAL GEOLOGY Vol. 29 No. 3 Sept. 2010 1004-5589 2010 03-0392 - 08 1 2 1 1. 130026 2. 116021 P618 P618. 51 A doi 10. 3969 /j. issn. 1004-5589. 2010. 03. 005 Geological characteristics and
Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών
Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών Επιστημονικοί Υπεύθυνοι έργου: A. Τσερέπη Ινστιτούτο Μικροηλεκτρονικής Π. Σ. Πέτρου Ινστιτούτο Ραδιοϊσοτόπων
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Motion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
SUPPLEMENTAL INFORMATION. Fully Automated Total Metals and Chromium Speciation Single Platform Introduction System for ICP-MS
Electronic Supplementary Material (ESI) for Journal of Analytical Atomic Spectrometry. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTAL INFORMATION Fully Automated Total Metals and Chromium
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography
2010 10 October 2010 ROCK AND MINERAL ANALYSIS Vol. 29 No. 5 503 ~ 507 0254 5357 2010 05 0503 05-1 2 3 1 1 1. 100037 2. 710021 3. 100083 13 Carb Rtx - OPP2-0. 67 ~ 1. 50 ng /ml 0. 67 ~ 600 ng /ml 0. 999