HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus
|
|
- Φιλομηλος Βικελίδης
- 5 χρόνια πριν
- Προβολές:
Transcript
1 3 3 Vol3 No Life Science Research June HPV *,, 2,, 3, : HPV(Human papillomavirus) HPV (6 6 8 ), (Tm) ~60 mer,, HPV,, HPV,, : (HPV); ; ; :R372 :A : (2009) Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus WEI Min MA Wen-li * SUN Zhao-hui 2 ZHANG Jin-fang LI Ling ZHENG Wen-ling 3 Institute of Genetic Enginerring Southern Medical University Guangzhou 5055 Guangdong China 2Clinical Laboratory General Hospital of Guangzhou Command Guangzhou 5055 Guangdong China 3 Southern China Genomics Research Center Guangzhou Guangdong China Abstract: An oligonucleotide microarray assay for detection and sub-typing of human papillomavirus HPV was developed and optimized Biological softwares Arraydesigner 20 and BLAST program were applied to analyze the whole genome of four different HPV types 6 6 and 8 to design ~ 60 mer oligonucleotide probes with high specificity and similar melting temperature Tm The cultured HPV samples were labeled with fluorescence dyes Cy3 using a method of restriction display PCR RD-PCR The labeled samples were hybridized with the oligo microarray HPV DNA samples were hybridized specifically with multiple spots correspondingly to show positive signals and the corresponding HPV subtypes were recognized as well while no signals were detected of all the negative and blank controls With optimization of glass slide treatment and fluorescence labeling method the hybrid specificity and fluorescence signal intensity of oligo microarray were heightened Key words human papillomavirus oligonucleotide microarray RD-PCR detection Life Science Research ~25 : : : D WSTJJ : 978- Tel weimin78@26com * 96- Tel Fax wenli668@gmailcom
2 3 :HPV 2 HPV / [] HPV HPV HPV HPV [2] HPV HPV6 HPV HPV6 HPV8 39% HPV De Villier EM 2 2 HPV 3 5 [3,] HPV Taq T DNA TaKaRa 5 -GTTTGGCTGGTCTCCATC-3 SIP 5 -CCAGCCAAACCCA-3 SIR 5 - HPV GGTTTGGCTGGTGTG-3 ABI 3900 Cy3 U 5 -Cy3- UGTTTGGCTGGTCTCCATC-3 Cy3 9 HPV mer Trilink 60~ pmd-8 T Sau3A 70 mer 2 GenBank HPV6 HPV HPV6 HPV8 DNA Array Designer 20 BLAST HPV HPV Tm HPV 0 Table HPV specific, positive and negative control oligonucleotide probes of microarray Target Probe No Region Sequence 5-3 HPV6 HPV HPV6 HPV8 Positive probes Negative probes Negative probes E2 E6 L E6 L E2 CCCAACCACCCGTGGAGGCTAATGGACATATATT AATTTCTGCACCCACTATAACGTCACACCCT GGCACTGGGCCTCCTCAAAGGCACCACATAAAC ATGCCATTGTAACTGTAACATATCATAGTGAG ATGCCTATAAGAACCTAAAGGTTGTGTGGCGAG ACAACTTTCCCTTTGCAGCGTGTGCCTGTTGCT AACAAGTTTGCATTACCTGATTCATCCCTGTTTG ACCCCACTACACAGCGTTTAGTATGG TGCTGAACCATTTGACCCTATCCCTGACCCTGTC CAACATTCTGTTACACAGTCTTATCTTACCTCCA GCAATGTTTCAGGACCCACAGGAGCGACCCAGA AAGTTACCACAGTTATGCACAGAGCTG ACATTAGGAAAACGAAAAGCTACACCCACCACC TCATCTACCTCTACAACTGCTAAACGCA CCTGCCACACCACTAAGTTGTTGCACAGAGACT CAGTGGACAGTGCTCCAATCCTCACTGCATT AGTGGCTAACCCTGAGTTTCTTACACGTCCATC CTCTTTAATTACATATGACAACCCGGC GCCTACCAACAAGTGTCAGTGGCTAACCCTGAG TTTCTTACACGTCCATCCTCTTTAATTACA GTTTGGCTGGTGTGGATCGTTTGGCTGGTGTGGA TCGTTGGCTGGTGTGGATCGTTTGG GTATTAATTATTGCTAGCTGATCATACCACGTTA GTCGTTAAGCATGCATGCAGCTAGGA GTAACGTTAAGAGACTACCATTGCACATGCCCT AAGAACAGGTACAATAGAGTAGGTACA Tm /
3 (poly-l-lysine) 3 % - GOPS 95% 30 min 500 r / min 5 32 Poly-L-lysine PCR Product Purification Kit 70 ml poly-l-lysine 70 ml PBS 600 ml Sau3A PCR 500 r / min h 33 poly-l-lysine 95 5 min 95 02% 30 s s s s 72 PDITC 0% 898% min min 2 h 500 r / min % SDS 95 5 min GOPS / poly-l-lysine GOPS-PLL % SDS 0 SSC+% SDS 0 SSC 50% DMSO g / L Pixsys poly-l-lysine Agilent-2565 B GOPS-PLL 5 5 Cy3 9 mer signal-to- GenePix 00A GenPix Pro 60 noise ratio SNR DMSO 2 g / L A HPV6 HPV8 DNA DNA 50% dimlthyl Sau3A sulfoxide DMSO Pixsys ~ 000 Cartesian 250~500 GOPS-PLL B C RD- PCR BIO-RAD RD-PCR 65 mj [5] 6 22 DNA μg Sau3A μl 37 h GATC SIP SIR Sau3A T DNA Cy3 PCR 3S 5 μl DNA 2 50% Formamide 0 SSC 2 2 SSC + Array-Pro poly-l-lysine GOPS-PLL DNA 3
4 3 :HPV 23 HPV HPV DNA 23 HPV 0 GOPS-PLL HPV RD- PCR 5 HPV M 2 M M A B HPV6, 8 DNA (A) HPV6,8 DNA Sau3A ; (B) HPV6 DNA Cy3- ; (C) HPV8 DNA Cy3- Fig Agarose gel electrophoresis of digestion and amplification of HPV6 HPV8 plasmids DNA A Agarose gel electrophoresis of restricted fragments of HPV6 HPV8 plasmids DNA digested by Sau3A B Agarose gel electrophoresis of amplified products of HPV6 plasmids DNA with Cy3-labeled universal primers C Agarose gel electrophoresis of amplified products of HPV8 plasmids DNA with Cy3-labeled universal primers M DL 2000 HPV6 plasmid DNA 2 HPV8 plasmid DNA C M M HPV RD- PCR RD-PCR Fig2 Agarose gel electrophoresis of amplified HPV fragments of RD-PCR and RD-gradient PCR M D000 Lane Amplified fragments of RD-PCR Lane 2 Amplified fragments of RD-gradient PCR Fig Scanning results of optimized microarray hybridization A Sample of HPV6 B Sample of HPV C Sample of HPV6 D Sample of HPV8 E Sample of human DNA A B A ~5 H6 ~0 Positive controls A6 ~0 H ~5 Blank controls D~5 G6~0 Negative controls B~0 HPV6 Result of immobilization ratio experiment of probes C~0 D6~0 HPV probes E~0 F6~0 HPV6 probes F~5 G~5 HPV8 probes 3 Fig3 two different slides A poly-l-lysine coated slide B GOPS-PLL slide
5 HPV L Gp5 / 6 β HPV E6 E7 PCR Cy5 Cy3 Klaassen HPV [5] DNA HPV DNA 20 mer 53 PCR Hybrid Capture β DNA HPV HPV 5 HPV Systems HPV FDA HC 20 ~25 mer HPV PCR [6] HPV PCR General Primermediated PCR GP-PCR HPV HPV HPV PCR HPV HPV [7,8] HPV PCR Type-Specific PCR TS-PCR 60 mer PCR HPV Restriction Display PCR RD-PCR HPV RFLP RD Dot blotting microtiter enzyme immunoassays reverse hybridization line probe assays [9~] [6] 60 mer DNA DNA [ 2,3] HPV Biomedlab Company Seoul Korea [] 22 HPV HPV
6 3 :HPV 25 [J] J Virol Methods poly-l-lysine PDITC Microbiol RD-PCR human papillomavirus DNA in genital samples[j] Microbiol GOPS-PLL HPV RD- PCR sequencing line blotting and hybrid capture[j] HPV GOPS-PLL poly-llysine (References): Comparative analysis of human papillomavirus infections in cervical scrapes and biopsy specimens by general SPF 0 PCR and HPV genotyping [J] J Pathol [5] LI Ling MA Wen-li ZHU Ji et al A modified restriction display PCR method in sample-labelling of DNA microarray [6] CASTLE P E SCHIFFMAN M BURK R D et al Restricted cross-reactivity of hybrid capture 2 with nononcogenic human papillomavirus types[j] Cancer Epidemiol Biomarkers Prev [7] GRAVITT P E PEYTON C L ALESSI T Q et al Improved amplification of genital human papillomaviruses[j] J Clin [8] COUTLEE F GRAVITT P KORNEGAY J et al Use of PGMY primers in L consensus PCR improves detection of J Clin [9] VAN DEB BRULE A J POL R FRANSEN-DAALMEIJER N et al GP5+/6+ PCR followed by reverse line blot analysis enables rapid and high-throughput identification of human papillomavirus genotypes[j] J Clin Microbiol [0] VERNON S D UNGER E R WILLIAMS D Comparison of human papillomavirus detection and typing by cycle J Clin Microbiol [] ZERBINI M VENTUROLI S CRICCA M et al Distribution and viral load of type specific HPVs in different cervical lesions as detected by PCR-ELISA[J] J Clin Pathol 200 [2] LIU Chui-hua MA Wen-li SHI Rong et al Possibility of using DNA chip technology for diagnosis of human papillomavirus[j] J Biochem Mol Biol [3] DELRIO-LAFRENIERE S A BROWNING M K MCGLENNEN R C Low-density addressable array for the detection and [] RODEN R B LOWY D R SCHILLER J T Papillomavirus is resistant to dessication[j] J Infect Dis typing of the human papillomavirus [J] Diagn Microbiol Infect Dis [2] ADAM E BERKOVA Z DAXNEROVA Z et al [] CHO N H AN H J JEONG J K et al Genotyping of 22 Papillomavirus detection demographic and behavioral human papillomavirus types by DNA chip in Korean women characteristics influencing the identification of cervical disease [J] Am J Obstet Gynecol comparison with cytologic diagnosis [J] Am J Obstet Gynecol [3] SNIJDERS P J VAN DEN BRULE A J JACOBS M V et al [5] KLAASSEN C H PRINSEN C F DE VALK H A et al HPV DNA detection and typing in cervical scrapes [J] DNA microarray format for detection and subtyping of human Methods Mol Med papillomavirus[j] J Clin Microbiol [] QUINT W G SCHPLTE G VAN DOORN L J et al [6] [J] WEI Min MA Wen-li ZHANG Bao et al Preparation of long oligonucleotide microarray for detection and sub2typing of human papillomavirus [J] Med J Chin PLA
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Διαβάστε περισσότεραA Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Διαβάστε περισσότεραComparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότεραTABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Διαβάστε περισσότεραFENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP
38 2010 12 FENXI HUAXUE Chinese Journal of Analytical Chemistry 12 1708 ~ 1713 DOI 10. 3724 /SP. J. 1096. 2010. 01708 1 1 2 2 1 1 1 1 2 * 1 2 1 210096 2 412008 Single nucleoitide polymorphism SNP PCR Gold
Διαβάστε περισσότεραc Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Διαβάστε περισσότεραIdentification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography
BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15
Διαβάστε περισσότεραThe toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότεραER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Διαβάστε περισσότεραSupporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Διαβάστε περισσότεραElectronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
Διαβάστε περισσότεραLUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Διαβάστε περισσότεραReal-Time PCR Mycoplasma pneumoniae
148 2009 Real-Time PCR Mycoplasma pneumoniae 20 12 26 21 5 11 10 30 Mycoplasma pneumoniae real-time PCR M. pneumoniae 3 SYBR Green I Light Cycler 2.0 system (Roche) PCR 45 PCR primer M. pneumoniae 16S
Διαβάστε περισσότεραElectronic Supplementary Information (ESI)
Electronic Supplementary Information (ESI) Lanthanide metal-organic frameworks constructed by asymmetric 2-nitro-biphenyl-4,4 -dicarboxylate ligand: syntheses, structures, luminescence and magnetic investigations
Διαβάστε περισσότερα,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Διαβάστε περισσότερα1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Διαβάστε περισσότεραsvari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Διαβάστε περισσότεραOptimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Διαβάστε περισσότεραNov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Διαβάστε περισσότεραResurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Διαβάστε περισσότερα[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Διαβάστε περισσότεραMSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Διαβάστε περισσότεραComparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
Διαβάστε περισσότερα2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Διαβάστε περισσότεραSupporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Διαβάστε περισσότεραProgress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR
1277 HBV DNA* 1 2 3 2 1 1 210029 2 210002 3 200001 5' 10 min 15 33 HBsAg PCR 250 copies/ml PCR 100% PCR DNA R446.5 B 1673-6273 2011 07-1277-05 Development of a sensitive, visual nucleic acid dipstick assay
Διαβάστε περισσότεραJournal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Διαβάστε περισσότεραPetros Karakitsos MD, PhD. Professor, Director Department of Cytopathology Medical School, University of Athens University General Hospital ATTIKON
Petros Karakitsos MD, PhD Professor, Director Department of Cytopathology Medical School, University of Athens University General Hospital ATTIKON Human Papilloma Virus (HPV) Αναδιπλασιασμός των HPV στο
Διαβάστε περισσότεραAccumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Διαβάστε περισσότεραDifferences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Διαβάστε περισσότεραComparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 2 1* 1 3 2 1 100101 2 430070 3 100089 3 95 2% ~ 98 2% 99 2% ~ 101 3% 60 mg / kg 12 6% ~ 37 6% X508 A 0250-3301 2011 03-0842-07 Comparative Study
Διαβάστε περισσότεραStudy on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
Διαβάστε περισσότεραΜελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότερα1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
Διαβάστε περισσότεραPCR 2BS A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening
297 DNA PCR 100191 DNA PCR population doublings PDs 2BS DNA DNA PCR 1 μg DNA 4 ~ 5 μg DNA 150 bp PCR 300 ~ 400 bp 2 PDs 2BS 5 PDs PCR 10% DNA 2. 5% P < 0. 001 DNA PCR DNA R342. 3 doi 10. 3969 /j. issn.
Διαβάστε περισσότεραCorrection of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Διαβάστε περισσότερα, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Διαβάστε περισσότεραSalmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Διαβάστε περισσότεραCellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Διαβάστε περισσότεραRapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Διαβάστε περισσότεραCorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Διαβάστε περισσότεραPCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Διαβάστε περισσότεραSupporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene
Supporting information Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene M. N. Chan 1, J. D. Surratt 2,*, A. W. H. Chan 2,**, K. Schilling 2, J.
Διαβάστε περισσότεραApplication of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy
37 6 2004 6 Journal of Tianjin University Vol. 37 No. 6 Jun. 2004 Ξ 1,2, 1,2, 3 (1., 300072 ; 2. 2, 300072 ; 3., 300072) :,,,.,,(RMSEP) 53 %58 %.. : ; ; : O657. 33 : A : 04932 2137 (2004) 062 05352 05
Διαβάστε περισσότεραDOI: /j.cnki.bingduxuebao
33 1 2017 1 CHINESEJOURNALOF VIROLOGY Vol.33 No.1 January 2017 PCR! ( 102206) : PCR(DigitalPCRdPCR) (InfluenzaAvi- rusflua) dpcr dpcr 64.4 ; FluA dpcr FluA 37.7~8.22 " 10 4 /#L 3.77 / dpcr R 2 = 0.9988
Διαβάστε περισσότεραΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ
ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ Εναλλακτικές τεχνικές - δευτερογενής πρόληψη σε HPV test Χριστίνα Κοτταρίδη, Βιολόγος MSc, PhD 20-10-2014 Παγκόσμια γεωγραφική κατανομή της επίπτωσης
Διαβάστε περισσότεραSupporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
Διαβάστε περισσότεραGro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Διαβάστε περισσότεραDevelopment of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Διαβάστε περισσότεραAntimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Διαβάστε περισσότερα1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Διαβάστε περισσότεραCapillary Gel Electrophoresis for Ligase Detection Reaction Products
THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko
Διαβάστε περισσότεραSUPPORTING INFORMATION
SUPPORTING INFORMATION Trichodermides A E: New Peptaibols isolated from Australian Termite Nestderived Fungus Trichoderma virens CMB-TN16 Wei-Hua Jiao,, Zeinab Khalil, Pradeep Dewapriya, Angela A. Salim,
Διαβάστε περισσότεραFood Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR
Food Research And Development 2011 9 32 9 69 Ara h1 * 518060 Ara h1 GenBank Ara h1 DNA AF432231 2 SYBR Green -CT 2 8 Ara h1 SYBR Green 3 10 2 3 10 8 copies R 2 0.993 5 3 10 3 copies 2 8 2 Ara h1 Ara h1
Διαβάστε περισσότερα8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Διαβάστε περισσότερα; +302 ; +313; +320,.
1.,,*+, - +./ +/2 +, -. ; +, - +* cm : Key words: snow-water content, surface soil, snow type, water permeability, water retention +,**. +,,**/.. +30- +302 ; +302 ; +313; +320,. + *+, *2// + -.*, **. **+.,
Διαβάστε περισσότεραΔιπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ:ΗΛΕΚΤΡΟΝΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΩΝ ΕΦΑΡΜΟΓΩΝ Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων
Διαβάστε περισσότεραFree Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Διαβάστε περισσότερα1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW
2014 6 33 6 779 * 1 1 2 3 1 2 1. 100050 2. 277500 3. 100050 DSC HPLC 99. 5 ± 0. 4 % k 2 P 0. 95 GBW09587 R978. 7 R927. 1 A 1004-0781 2014 06-0779 - 06 Purity Determination and Uncertainty Evaluation of
Διαβάστε περισσότεραRapid Raman spectra identification and determination of levofloxacin hydrochloride injection *
DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin
Διαβάστε περισσότεραMonday 26 January2015
Πρόγραμμα Monday 26 January2015 09:30 10:00 Arrival of participants, Registration 10:00 10:30 Welcome and Introduction: Presentation of the Institution and group activities V. Georgoulias, D. Mavroudis
Διαβάστε περισσότεραBGP TRACP-5b BGP TRACP-5b P 0.05
()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF
Διαβάστε περισσότεραGS3. A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured
J. Jpn. Soc. Soil Phys. No. 130, p.19 25 (2015) GS3 1 2 A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured Shoichi MITSUISHI 1 and Masaru MIZOGUCHI
Διαβάστε περισσότερα206 5 (5μm,4.6mm 50 mm),, 276nm, 20 μl,, 30,, 0.8mL/min, ( 2080,585,090) (patulin) (2) : AltimaTM C8 (5μm, 4.6mm 50mm),, 276nm, 20μL 30, [2], 090, (.0
32 5 206 5 Vol.32,No.5 May2 0 6 DOI:0.3652/j.issn.003-5788.206.05.02 HPLC OptimizationonHPLCdetectionandpre-treatment conditionsofpatulininfreshapple SUN Li-hua CHEN Ji-luan 2,3 QIAN Hui-ping LI Zhi-wen
Διαβάστε περισσότεραPNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Διαβάστε περισσότεραΕΝΑΛΛΑΚΤΙΚΕΣ ΜΕΘΟΔΟΙ HPV DNA TESTING: α. ΜΕ ΑΥΤΟΛΗΨΗ ΚΟΛΠΟΤΡΑΧΗΛΙΚΟΥ ΥΛΙΚΟΥ (self sampling) β. HPV DNA TEST ΣΤΑ ΟΥΡΑ. Καθηγητής Αλέξανδρος Ι.
ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Πιστοποιημένο Ευρωπαϊκό Κέντρο Εκπαίδευσης στη Μαιευτική και Γυναικολογία από το Ευρωπαϊκό Κολέγιο Μαιευτικής και Γυναικολογίας
Διαβάστε περισσότεραNucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Διαβάστε περισσότεραExperimental Study of Dielectric Properties on Human Lung Tissue
32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021
Διαβάστε περισσότερα3: A convolution-pooling layer in PS-CNN 1: Partially Shared Deep Neural Network 2.2 Partially Shared Convolutional Neural Network 2: A hidden layer o
Sound Source Identification based on Deep Learning with Partially-Shared Architecture 1 2 1 1,3 Takayuki MORITO 1, Osamu SUGIYAMA 2, Ryosuke KOJIMA 1, Kazuhiro NAKADAI 1,3 1 2 ( ) 3 Tokyo Institute of
Διαβάστε περισσότεραApplication of Statistical Process Control in Pretreatment Production Process of Gardenia jasminoides
DOI:0.3422/j.cnki.syfjx.202..02 8 202 6 Vol. 8 No. Jun. 202 3 2 2* 2*. 0002 2. 0002 3. 0300 Shewhart EWMA SPE Shewhart EWMA R283. 6 A 005-9903 202-006-05 Application of Statistical Process Control in Pretreatment
Διαβάστε περισσότεραD-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Διαβάστε περισσότεραMotion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
Διαβάστε περισσότεραCopper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Διαβάστε περισσότεραA new ent-kaurane diterpene from Euphorbia stracheyi Boiss
SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory
Διαβάστε περισσότεραΔιαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών
Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών Επιστημονικοί Υπεύθυνοι έργου: A. Τσερέπη Ινστιτούτο Μικροηλεκτρονικής Π. Σ. Πέτρου Ινστιτούτο Ραδιοϊσοτόπων
Διαβάστε περισσότεραDevelopment of a basic motion analysis system using a sensor KINECT
KINECT 1,a) 2 3,b) KINECT KINECT ( ( Development of a basic motion analysis system using a sensor KINECT Abstract: We developed a basic motion analysis system using a sensor KINECT. Our system estimates
Διαβάστε περισσότεραΔιπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης
Διπλωματική Εργασία Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική Αντωνίου Φάνης Επιβλέπουσες: Θεοδώρα Παπαδοπούλου, Ομότιμη Καθηγήτρια ΕΜΠ Ζάννη-Βλαστού Ρόζα, Καθηγήτρια
Διαβάστε περισσότερα2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t.
36 2010 8 8 Vol 36 No 8 JOURNAL OF BEIJING UNIVERSITY OF TECHNOLOGY Aug 2010 Ⅰ 100124 TB 534 + 2TP 273 A 0254-0037201008 - 1091-08 20 Hz 2 ~ 8 Hz 1988 Blondet 1 Trombetti 2-4 Symans 5 2 2 1 1 1b 6 M p
Διαβάστε περισσότερα* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Διαβάστε περισσότεραQuick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Διαβάστε περισσότεραSupporting Information
Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State
Διαβάστε περισσότεραSampling Basics (1B) Young Won Lim 9/21/13
Sampling Basics (1B) Copyright (c) 2009-2013 Young W. Lim. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any
Διαβάστε περισσότεραSupporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Διαβάστε περισσότεραDetermination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography
2010 10 October 2010 ROCK AND MINERAL ANALYSIS Vol. 29 No. 5 503 ~ 507 0254 5357 2010 05 0503 05-1 2 3 1 1 1. 100037 2. 710021 3. 100083 13 Carb Rtx - OPP2-0. 67 ~ 1. 50 ng /ml 0. 67 ~ 600 ng /ml 0. 999
Διαβάστε περισσότεραhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Διαβάστε περισσότερα30.00% 3/ % 2/10 HHV-6 OLP 12.50% 2/16
386 37 4 2010 7 www.gjkqyxzz.cn -5~8 1 2 1 1 2 1 1 2 (1. 116027; 2. 116600) [ ] HHV -5~8 OLP 36 OLP 43 HHV-5 OLP 50.00% 8/16 25.00% 4/16 80.00% 4/5 50.00% 8/16 18.75% 3/16 30.00% 3/10 20.00% 2/10 HHV-6
Διαβάστε περισσότεραSUPPORTING INFORMATION
SUPPRTING INFRMATIN Per(-guanidino--deoxy)cyclodextrins: Synthesis, characterisation and binding behaviour toward selected small molecules and DNA. Nikolaos Mourtzis, a Kyriaki Eliadou, a Chrysie Aggelidou,
Διαβάστε περισσότεραQuantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Διαβάστε περισσότεραΠΡΟΚΗΡΥΞΗ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.
Διαβάστε περισσότεραThe optimization of EV powertrain s efficiency control strategy under dynamic operation condition
16 3 2012 3 ELECTRI C MACHINES AND CONTROL Vol. 16 No. 3 Mar. 2012 1 1 1 2 2 3 1. 250061 2. 250014 3. 251010 3. 3% U 469. 72 A 1007-449X 2012 03-0053- 07 The optimization of EV powertrain s efficiency
Διαβάστε περισσότεραTGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Διαβάστε περισσότερα2001/10/26 NSC B
NSC892323B006006 90 10 26 1 HRP acridinium ester ELISA validation pattern AFP PMMA Keywordstumor marker, immunoassay, microchip, chemiluminescence Cancer is the first leading cause of death in Taiwan.
Διαβάστε περισσότεραGF GF 3 1,2) KP PP KP Photo 1 GF PP GF PP 3) KP ULultra-light 2.KP 2.1KP KP Fig. 1 PET GF PP 4) 2.2KP KP GF 2 3 KP Olefin film Stampable sheet
JFE No. 4 20045 p 82 Composite Material for Automotive Headliners Expandable Stampable Sheet with Light Weight and High Stiffness A JFE SUZU JFE HA KP 50 mass 30 UL 800 g/m 2 7.2 N/mm Abstract: KP-Sheet
Διαβάστε περισσότεραHPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1
HPLC- ESI-MS * 200 Vol.11 No.1 ** 266061 266061 361005 266003 - HPLC-ESI-MS HPLC-ESI-MS HPLC HPLC-ESI-MS 11 HPLC - Asterias rollestoni Bell. [1~7] [1] [5~7] - - [8~] LC- MS * ** 173 2008-11-04 200-01-06
Διαβάστε περισσότεραVSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )
22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL
Διαβάστε περισσότεραFENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Διαβάστε περισσότεραBD OptEIA ELISA Sets ELISA
BD OptEIA ELISA Sets ELISA BD OptEIA ELISA Sets ELISA CaptureDetection Detection 9620 170,000 ELISAEnzymed-Linked ImmunoSorbent Assay CaptureDetection BD OptEIA ELISA Set 2 BD OptEIA ELISA Set BD OptEIA
Διαβάστε περισσότερα