HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "HPV. Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus"

Transcript

1 3 3 Vol3 No Life Science Research June HPV *,, 2,, 3, : HPV(Human papillomavirus) HPV (6 6 8 ), (Tm) ~60 mer,, HPV,, HPV,, : (HPV); ; ; :R372 :A : (2009) Development and Optimization of Oligonucleotide Microarray for Detection and Sub-typing of Human Papillomavirus WEI Min MA Wen-li * SUN Zhao-hui 2 ZHANG Jin-fang LI Ling ZHENG Wen-ling 3 Institute of Genetic Enginerring Southern Medical University Guangzhou 5055 Guangdong China 2Clinical Laboratory General Hospital of Guangzhou Command Guangzhou 5055 Guangdong China 3 Southern China Genomics Research Center Guangzhou Guangdong China Abstract: An oligonucleotide microarray assay for detection and sub-typing of human papillomavirus HPV was developed and optimized Biological softwares Arraydesigner 20 and BLAST program were applied to analyze the whole genome of four different HPV types 6 6 and 8 to design ~ 60 mer oligonucleotide probes with high specificity and similar melting temperature Tm The cultured HPV samples were labeled with fluorescence dyes Cy3 using a method of restriction display PCR RD-PCR The labeled samples were hybridized with the oligo microarray HPV DNA samples were hybridized specifically with multiple spots correspondingly to show positive signals and the corresponding HPV subtypes were recognized as well while no signals were detected of all the negative and blank controls With optimization of glass slide treatment and fluorescence labeling method the hybrid specificity and fluorescence signal intensity of oligo microarray were heightened Key words human papillomavirus oligonucleotide microarray RD-PCR detection Life Science Research ~25 : : : D WSTJJ : 978- Tel weimin78@26com * 96- Tel Fax wenli668@gmailcom

2 3 :HPV 2 HPV / [] HPV HPV HPV HPV [2] HPV HPV6 HPV HPV6 HPV8 39% HPV De Villier EM 2 2 HPV 3 5 [3,] HPV Taq T DNA TaKaRa 5 -GTTTGGCTGGTCTCCATC-3 SIP 5 -CCAGCCAAACCCA-3 SIR 5 - HPV GGTTTGGCTGGTGTG-3 ABI 3900 Cy3 U 5 -Cy3- UGTTTGGCTGGTCTCCATC-3 Cy3 9 HPV mer Trilink 60~ pmd-8 T Sau3A 70 mer 2 GenBank HPV6 HPV HPV6 HPV8 DNA Array Designer 20 BLAST HPV HPV Tm HPV 0 Table HPV specific, positive and negative control oligonucleotide probes of microarray Target Probe No Region Sequence 5-3 HPV6 HPV HPV6 HPV8 Positive probes Negative probes Negative probes E2 E6 L E6 L E2 CCCAACCACCCGTGGAGGCTAATGGACATATATT AATTTCTGCACCCACTATAACGTCACACCCT GGCACTGGGCCTCCTCAAAGGCACCACATAAAC ATGCCATTGTAACTGTAACATATCATAGTGAG ATGCCTATAAGAACCTAAAGGTTGTGTGGCGAG ACAACTTTCCCTTTGCAGCGTGTGCCTGTTGCT AACAAGTTTGCATTACCTGATTCATCCCTGTTTG ACCCCACTACACAGCGTTTAGTATGG TGCTGAACCATTTGACCCTATCCCTGACCCTGTC CAACATTCTGTTACACAGTCTTATCTTACCTCCA GCAATGTTTCAGGACCCACAGGAGCGACCCAGA AAGTTACCACAGTTATGCACAGAGCTG ACATTAGGAAAACGAAAAGCTACACCCACCACC TCATCTACCTCTACAACTGCTAAACGCA CCTGCCACACCACTAAGTTGTTGCACAGAGACT CAGTGGACAGTGCTCCAATCCTCACTGCATT AGTGGCTAACCCTGAGTTTCTTACACGTCCATC CTCTTTAATTACATATGACAACCCGGC GCCTACCAACAAGTGTCAGTGGCTAACCCTGAG TTTCTTACACGTCCATCCTCTTTAATTACA GTTTGGCTGGTGTGGATCGTTTGGCTGGTGTGGA TCGTTGGCTGGTGTGGATCGTTTGG GTATTAATTATTGCTAGCTGATCATACCACGTTA GTCGTTAAGCATGCATGCAGCTAGGA GTAACGTTAAGAGACTACCATTGCACATGCCCT AAGAACAGGTACAATAGAGTAGGTACA Tm /

3 (poly-l-lysine) 3 % - GOPS 95% 30 min 500 r / min 5 32 Poly-L-lysine PCR Product Purification Kit 70 ml poly-l-lysine 70 ml PBS 600 ml Sau3A PCR 500 r / min h 33 poly-l-lysine 95 5 min 95 02% 30 s s s s 72 PDITC 0% 898% min min 2 h 500 r / min % SDS 95 5 min GOPS / poly-l-lysine GOPS-PLL % SDS 0 SSC+% SDS 0 SSC 50% DMSO g / L Pixsys poly-l-lysine Agilent-2565 B GOPS-PLL 5 5 Cy3 9 mer signal-to- GenePix 00A GenPix Pro 60 noise ratio SNR DMSO 2 g / L A HPV6 HPV8 DNA DNA 50% dimlthyl Sau3A sulfoxide DMSO Pixsys ~ 000 Cartesian 250~500 GOPS-PLL B C RD- PCR BIO-RAD RD-PCR 65 mj [5] 6 22 DNA μg Sau3A μl 37 h GATC SIP SIR Sau3A T DNA Cy3 PCR 3S 5 μl DNA 2 50% Formamide 0 SSC 2 2 SSC + Array-Pro poly-l-lysine GOPS-PLL DNA 3

4 3 :HPV 23 HPV HPV DNA 23 HPV 0 GOPS-PLL HPV RD- PCR 5 HPV M 2 M M A B HPV6, 8 DNA (A) HPV6,8 DNA Sau3A ; (B) HPV6 DNA Cy3- ; (C) HPV8 DNA Cy3- Fig Agarose gel electrophoresis of digestion and amplification of HPV6 HPV8 plasmids DNA A Agarose gel electrophoresis of restricted fragments of HPV6 HPV8 plasmids DNA digested by Sau3A B Agarose gel electrophoresis of amplified products of HPV6 plasmids DNA with Cy3-labeled universal primers C Agarose gel electrophoresis of amplified products of HPV8 plasmids DNA with Cy3-labeled universal primers M DL 2000 HPV6 plasmid DNA 2 HPV8 plasmid DNA C M M HPV RD- PCR RD-PCR Fig2 Agarose gel electrophoresis of amplified HPV fragments of RD-PCR and RD-gradient PCR M D000 Lane Amplified fragments of RD-PCR Lane 2 Amplified fragments of RD-gradient PCR Fig Scanning results of optimized microarray hybridization A Sample of HPV6 B Sample of HPV C Sample of HPV6 D Sample of HPV8 E Sample of human DNA A B A ~5 H6 ~0 Positive controls A6 ~0 H ~5 Blank controls D~5 G6~0 Negative controls B~0 HPV6 Result of immobilization ratio experiment of probes C~0 D6~0 HPV probes E~0 F6~0 HPV6 probes F~5 G~5 HPV8 probes 3 Fig3 two different slides A poly-l-lysine coated slide B GOPS-PLL slide

5 HPV L Gp5 / 6 β HPV E6 E7 PCR Cy5 Cy3 Klaassen HPV [5] DNA HPV DNA 20 mer 53 PCR Hybrid Capture β DNA HPV HPV 5 HPV Systems HPV FDA HC 20 ~25 mer HPV PCR [6] HPV PCR General Primermediated PCR GP-PCR HPV HPV HPV PCR HPV HPV [7,8] HPV PCR Type-Specific PCR TS-PCR 60 mer PCR HPV Restriction Display PCR RD-PCR HPV RFLP RD Dot blotting microtiter enzyme immunoassays reverse hybridization line probe assays [9~] [6] 60 mer DNA DNA [ 2,3] HPV Biomedlab Company Seoul Korea [] 22 HPV HPV

6 3 :HPV 25 [J] J Virol Methods poly-l-lysine PDITC Microbiol RD-PCR human papillomavirus DNA in genital samples[j] Microbiol GOPS-PLL HPV RD- PCR sequencing line blotting and hybrid capture[j] HPV GOPS-PLL poly-llysine (References): Comparative analysis of human papillomavirus infections in cervical scrapes and biopsy specimens by general SPF 0 PCR and HPV genotyping [J] J Pathol [5] LI Ling MA Wen-li ZHU Ji et al A modified restriction display PCR method in sample-labelling of DNA microarray [6] CASTLE P E SCHIFFMAN M BURK R D et al Restricted cross-reactivity of hybrid capture 2 with nononcogenic human papillomavirus types[j] Cancer Epidemiol Biomarkers Prev [7] GRAVITT P E PEYTON C L ALESSI T Q et al Improved amplification of genital human papillomaviruses[j] J Clin [8] COUTLEE F GRAVITT P KORNEGAY J et al Use of PGMY primers in L consensus PCR improves detection of J Clin [9] VAN DEB BRULE A J POL R FRANSEN-DAALMEIJER N et al GP5+/6+ PCR followed by reverse line blot analysis enables rapid and high-throughput identification of human papillomavirus genotypes[j] J Clin Microbiol [0] VERNON S D UNGER E R WILLIAMS D Comparison of human papillomavirus detection and typing by cycle J Clin Microbiol [] ZERBINI M VENTUROLI S CRICCA M et al Distribution and viral load of type specific HPVs in different cervical lesions as detected by PCR-ELISA[J] J Clin Pathol 200 [2] LIU Chui-hua MA Wen-li SHI Rong et al Possibility of using DNA chip technology for diagnosis of human papillomavirus[j] J Biochem Mol Biol [3] DELRIO-LAFRENIERE S A BROWNING M K MCGLENNEN R C Low-density addressable array for the detection and [] RODEN R B LOWY D R SCHILLER J T Papillomavirus is resistant to dessication[j] J Infect Dis typing of the human papillomavirus [J] Diagn Microbiol Infect Dis [2] ADAM E BERKOVA Z DAXNEROVA Z et al [] CHO N H AN H J JEONG J K et al Genotyping of 22 Papillomavirus detection demographic and behavioral human papillomavirus types by DNA chip in Korean women characteristics influencing the identification of cervical disease [J] Am J Obstet Gynecol comparison with cytologic diagnosis [J] Am J Obstet Gynecol [3] SNIJDERS P J VAN DEN BRULE A J JACOBS M V et al [5] KLAASSEN C H PRINSEN C F DE VALK H A et al HPV DNA detection and typing in cervical scrapes [J] DNA microarray format for detection and subtyping of human Methods Mol Med papillomavirus[j] J Clin Microbiol [] QUINT W G SCHPLTE G VAN DOORN L J et al [6] [J] WEI Min MA Wen-li ZHANG Bao et al Preparation of long oligonucleotide microarray for detection and sub2typing of human papillomavirus [J] Med J Chin PLA

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ

ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ - - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ

Διαβάστε περισσότερα

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn 56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)

Διαβάστε περισσότερα

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis

Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus

Διαβάστε περισσότερα

Identification of Fish Species using DNA Method

Identification of Fish Species using DNA Method 5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,

Διαβάστε περισσότερα

TABLE OF CONTENTS Page

TABLE OF CONTENTS Page TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...

Διαβάστε περισσότερα

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP 38 2010 12 FENXI HUAXUE Chinese Journal of Analytical Chemistry 12 1708 ~ 1713 DOI 10. 3724 /SP. J. 1096. 2010. 01708 1 1 2 2 1 1 1 1 2 * 1 2 1 210096 2 412008 Single nucleoitide polymorphism SNP PCR Gold

Διαβάστε περισσότερα

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No

c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No 2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:

Διαβάστε περισσότερα

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography

Identification of Salmonella,Campylobacter jejuni and Enterohemorrhagic E.coli by Denaturing High-performance Liquid Chromatography BIOTECHNOLOGY BULLETIN 2009 3 116015 PCR multiplex PCR mpcr denaturing high-performance liquid chromatography DHPLC O157 H7 fimy gyra O157 H7 rfbe 3 O157 H7 PCR 284 159 499 bp PCR O157 H7 1.5 CFU/ ml 15

Διαβάστε περισσότερα

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea 2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity

Διαβάστε περισσότερα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.

Διαβάστε περισσότερα

ER-Tree (Extended R*-Tree)

ER-Tree (Extended R*-Tree) 1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley

Διαβάστε περισσότερα

Supporting Information

Supporting Information Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang

Διαβάστε περισσότερα

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates

Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,

Διαβάστε περισσότερα

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing 2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin

Διαβάστε περισσότερα

Real-Time PCR Mycoplasma pneumoniae

Real-Time PCR Mycoplasma pneumoniae 148 2009 Real-Time PCR Mycoplasma pneumoniae 20 12 26 21 5 11 10 30 Mycoplasma pneumoniae real-time PCR M. pneumoniae 3 SYBR Green I Light Cycler 2.0 system (Roche) PCR 45 PCR primer M. pneumoniae 16S

Διαβάστε περισσότερα

Electronic Supplementary Information (ESI)

Electronic Supplementary Information (ESI) Electronic Supplementary Information (ESI) Lanthanide metal-organic frameworks constructed by asymmetric 2-nitro-biphenyl-4,4 -dicarboxylate ligand: syntheses, structures, luminescence and magnetic investigations

Διαβάστε περισσότερα

,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -

,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; - 25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731

Διαβάστε περισσότερα

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein

1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein 21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid

Διαβάστε περισσότερα

svari Real-time RT-PCR RSV

svari Real-time RT-PCR RSV 19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV

Διαβάστε περισσότερα

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology 2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing

Διαβάστε περισσότερα

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn

Nov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn 2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10

Διαβάστε περισσότερα

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.

Διαβάστε περισσότερα

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13, in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro

Διαβάστε περισσότερα

MSM Men who have Sex with Men HIV -

MSM Men who have Sex with Men HIV - ,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men

Διαβάστε περισσότερα

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity

Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan

Διαβάστε περισσότερα

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _

2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _ 41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb

Διαβάστε περισσότερα

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid

Διαβάστε περισσότερα

Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR

Progress in Modern Biomedicine Vol.11 NO.7 APR ' 10 min PCR 250 copies/ml PCR 1277 HBV DNA* 1 2 3 2 1 1 210029 2 210002 3 200001 5' 10 min 15 33 HBsAg PCR 250 copies/ml PCR 100% PCR DNA R446.5 B 1673-6273 2011 07-1277-05 Development of a sensitive, visual nucleic acid dipstick assay

Διαβάστε περισσότερα

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > % 33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1

Διαβάστε περισσότερα

Petros Karakitsos MD, PhD. Professor, Director Department of Cytopathology Medical School, University of Athens University General Hospital ATTIKON

Petros Karakitsos MD, PhD. Professor, Director Department of Cytopathology Medical School, University of Athens University General Hospital ATTIKON Petros Karakitsos MD, PhD Professor, Director Department of Cytopathology Medical School, University of Athens University General Hospital ATTIKON Human Papilloma Virus (HPV) Αναδιπλασιασμός των HPV στο

Διαβάστε περισσότερα

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk 32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO

Διαβάστε περισσότερα

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns

Differences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns 2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in

Διαβάστε περισσότερα

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites

Comparative Study on Determinations of BTEX in Soils from Industrial Contaminated Sites 32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 2 1* 1 3 2 1 100101 2 430070 3 100089 3 95 2% ~ 98 2% 99 2% ~ 101 3% 60 mg / kg 12 6% ~ 37 6% X508 A 0250-3301 2011 03-0842-07 Comparative Study

Διαβάστε περισσότερα

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium

Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical

Διαβάστε περισσότερα

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου

Διαβάστε περισσότερα

30s 56 60s 72 60s dntp cm s s s 23

30s 56 60s 72 60s dntp cm s s s 23 31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN

Διαβάστε περισσότερα

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]

1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4] 212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis

Διαβάστε περισσότερα

PCR 2BS A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening

PCR 2BS A X Comparison of Southern blotting and Real-time PCR in measuring telomere shortening 297 DNA PCR 100191 DNA PCR population doublings PDs 2BS DNA DNA PCR 1 μg DNA 4 ~ 5 μg DNA 150 bp PCR 300 ~ 400 bp 2 PDs 2BS 5 PDs PCR 10% DNA 2. 5% P < 0. 001 DNA PCR DNA R342. 3 doi 10. 3969 /j. issn.

Διαβάστε περισσότερα

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements 5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration

Διαβάστε περισσότερα

, DYY-8B, ; : Centrifuge 11 R. min

, DYY-8B, ; : Centrifuge 11 R. min 40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06

Διαβάστε περισσότερα

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,

Διαβάστε περισσότερα

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:

Διαβάστε περισσότερα

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application 31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection

Διαβάστε περισσότερα

CorV CVAC. CorV TU317. 1

CorV CVAC. CorV TU317. 1 30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI

Διαβάστε περισσότερα

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector

PCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector 13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,

Διαβάστε περισσότερα

Supporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene

Supporting information. Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene Supporting information Influence of Aerosol Acidity on the Chemical Composition of Secondary Organic Aerosol from β caryophyllene M. N. Chan 1, J. D. Surratt 2,*, A. W. H. Chan 2,**, K. Schilling 2, J.

Διαβάστε περισσότερα

Application of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy

Application of Wavelet Transform in Fundamental Study of Measurement of Blood Glucose Concentration with Near2Infrared Spectroscopy 37 6 2004 6 Journal of Tianjin University Vol. 37 No. 6 Jun. 2004 Ξ 1,2, 1,2, 3 (1., 300072 ; 2. 2, 300072 ; 3., 300072) :,,,.,,(RMSEP) 53 %58 %.. : ; ; : O657. 33 : A : 04932 2137 (2004) 062 05352 05

Διαβάστε περισσότερα

DOI: /j.cnki.bingduxuebao

DOI: /j.cnki.bingduxuebao 33 1 2017 1 CHINESEJOURNALOF VIROLOGY Vol.33 No.1 January 2017 PCR! ( 102206) : PCR(DigitalPCRdPCR) (InfluenzaAvi- rusflua) dpcr dpcr 64.4 ; FluA dpcr FluA 37.7~8.22 " 10 4 /#L 3.77 / dpcr R 2 = 0.9988

Διαβάστε περισσότερα

ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ

ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ ΤΙ ΝΕΟΤΕΡΟ ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΡΑΧΗΛΟΥ ΜΗΤΡΑΣ Εναλλακτικές τεχνικές - δευτερογενής πρόληψη σε HPV test Χριστίνα Κοτταρίδη, Βιολόγος MSc, PhD 20-10-2014 Παγκόσμια γεωγραφική κατανομή της επίπτωσης

Διαβάστε περισσότερα

Supporting Information

Supporting Information Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,

Διαβάστε περισσότερα

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water 31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A

Διαβάστε περισσότερα

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the

Διαβάστε περισσότερα

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene 2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A

Διαβάστε περισσότερα

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.

1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No. 2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%

Διαβάστε περισσότερα

Capillary Gel Electrophoresis for Ligase Detection Reaction Products

Capillary Gel Electrophoresis for Ligase Detection Reaction Products THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko

Διαβάστε περισσότερα

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Trichodermides A E: New Peptaibols isolated from Australian Termite Nestderived Fungus Trichoderma virens CMB-TN16 Wei-Hua Jiao,, Zeinab Khalil, Pradeep Dewapriya, Angela A. Salim,

Διαβάστε περισσότερα

Food Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR

Food Research And Development. Ara h1 GenBank PCR PCR -CT PCR PCR Food Research And Development 2011 9 32 9 69 Ara h1 * 518060 Ara h1 GenBank Ara h1 DNA AF432231 2 SYBR Green -CT 2 8 Ara h1 SYBR Green 3 10 2 3 10 8 copies R 2 0.993 5 3 10 3 copies 2 8 2 Ara h1 Ara h1

Διαβάστε περισσότερα

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson, 31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =

Διαβάστε περισσότερα

; +302 ; +313; +320,.

; +302 ; +313; +320,. 1.,,*+, - +./ +/2 +, -. ; +, - +* cm : Key words: snow-water content, surface soil, snow type, water permeability, water retention +,**. +,,**/.. +30- +302 ; +302 ; +313; +320,. + *+, *2// + -.*, **. **+.,

Διαβάστε περισσότερα

Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών

Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων Μηχανικών και Τεχνολογίας Υπολογιστών της Πολυτεχνικής Σχολής του Πανεπιστημίου Πατρών ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ:ΗΛΕΚΤΡΟΝΙΚΗΣ ΚΑΙ ΥΠΟΛΟΓΙΣΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΗΛΕΚΤΡΟΝΙΚΩΝ ΕΦΑΡΜΟΓΩΝ Διπλωματική Εργασία του φοιτητή του Τμήματος Ηλεκτρολόγων

Διαβάστε περισσότερα

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2

Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2 Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan

Διαβάστε περισσότερα

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW

1-4 certified reference material CRM. DSC HPLC ± 0. 4 % k = 2 P = GBW 2014 6 33 6 779 * 1 1 2 3 1 2 1. 100050 2. 277500 3. 100050 DSC HPLC 99. 5 ± 0. 4 % k 2 P 0. 95 GBW09587 R978. 7 R927. 1 A 1004-0781 2014 06-0779 - 06 Purity Determination and Uncertainty Evaluation of

Διαβάστε περισσότερα

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection *

Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * DOI:0.655/j.0254-793.20.09.039 75 * 2 2 3. 200435 2. 20203 3. 20000 ph R97 A 0254-793 20 09-75 - 05 Rapid Raman spectra identification and determination of levofloxacin hydrochloride injection * CHEN Bin

Διαβάστε περισσότερα

Monday 26 January2015

Monday 26 January2015 Πρόγραμμα Monday 26 January2015 09:30 10:00 Arrival of participants, Registration 10:00 10:30 Welcome and Introduction: Presentation of the Institution and group activities V. Georgoulias, D. Mavroudis

Διαβάστε περισσότερα

BGP TRACP-5b BGP TRACP-5b P 0.05

BGP TRACP-5b BGP TRACP-5b P 0.05 ()2014 10 8 20 Chin J Clinicians(Electronic Edition),October 15,2014,Vol.8,No.20 3615 OP 2011 1 2013 6 120 OP 3 40 37 40 38 40 38 BMD BGP-5b TRACP-5b OP 1 4 L1 4NFTH BMD BGP TRACP-5b P 0.05 OP L1 4 NF

Διαβάστε περισσότερα

GS3. A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured

GS3. A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured J. Jpn. Soc. Soil Phys. No. 130, p.19 25 (2015) GS3 1 2 A liner offset equation of the volumetric water content that capacitance type GS3 soil moisture sensor measured Shoichi MITSUISHI 1 and Masaru MIZOGUCHI

Διαβάστε περισσότερα

206 5 (5μm,4.6mm 50 mm),, 276nm, 20 μl,, 30,, 0.8mL/min, ( 2080,585,090) (patulin) (2) : AltimaTM C8 (5μm, 4.6mm 50mm),, 276nm, 20μL 30, [2], 090, (.0

206 5 (5μm,4.6mm 50 mm),, 276nm, 20 μl,, 30,, 0.8mL/min, ( 2080,585,090) (patulin) (2) : AltimaTM C8 (5μm, 4.6mm 50mm),, 276nm, 20μL 30, [2], 090, (.0 32 5 206 5 Vol.32,No.5 May2 0 6 DOI:0.3652/j.issn.003-5788.206.05.02 HPLC OptimizationonHPLCdetectionandpre-treatment conditionsofpatulininfreshapple SUN Li-hua CHEN Ji-luan 2,3 QIAN Hui-ping LI Zhi-wen

Διαβάστε περισσότερα

PNS mg kg - 1. Rb 1

PNS mg kg - 1. Rb 1 94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±

Διαβάστε περισσότερα

ΕΝΑΛΛΑΚΤΙΚΕΣ ΜΕΘΟΔΟΙ HPV DNA TESTING: α. ΜΕ ΑΥΤΟΛΗΨΗ ΚΟΛΠΟΤΡΑΧΗΛΙΚΟΥ ΥΛΙΚΟΥ (self sampling) β. HPV DNA TEST ΣΤΑ ΟΥΡΑ. Καθηγητής Αλέξανδρος Ι.

ΕΝΑΛΛΑΚΤΙΚΕΣ ΜΕΘΟΔΟΙ HPV DNA TESTING: α. ΜΕ ΑΥΤΟΛΗΨΗ ΚΟΛΠΟΤΡΑΧΗΛΙΚΟΥ ΥΛΙΚΟΥ (self sampling) β. HPV DNA TEST ΣΤΑ ΟΥΡΑ. Καθηγητής Αλέξανδρος Ι. ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΜΑΙΕΥΤΙΚΗ ΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Πιστοποιημένο Ευρωπαϊκό Κέντρο Εκπαίδευσης στη Μαιευτική και Γυναικολογία από το Ευρωπαϊκό Κολέγιο Μαιευτικής και Γυναικολογίας

Διαβάστε περισσότερα

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95

Διαβάστε περισσότερα

Experimental Study of Dielectric Properties on Human Lung Tissue

Experimental Study of Dielectric Properties on Human Lung Tissue 32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021

Διαβάστε περισσότερα

3: A convolution-pooling layer in PS-CNN 1: Partially Shared Deep Neural Network 2.2 Partially Shared Convolutional Neural Network 2: A hidden layer o

3: A convolution-pooling layer in PS-CNN 1: Partially Shared Deep Neural Network 2.2 Partially Shared Convolutional Neural Network 2: A hidden layer o Sound Source Identification based on Deep Learning with Partially-Shared Architecture 1 2 1 1,3 Takayuki MORITO 1, Osamu SUGIYAMA 2, Ryosuke KOJIMA 1, Kazuhiro NAKADAI 1,3 1 2 ( ) 3 Tokyo Institute of

Διαβάστε περισσότερα

Application of Statistical Process Control in Pretreatment Production Process of Gardenia jasminoides

Application of Statistical Process Control in Pretreatment Production Process of Gardenia jasminoides DOI:0.3422/j.cnki.syfjx.202..02 8 202 6 Vol. 8 No. Jun. 202 3 2 2* 2*. 0002 2. 0002 3. 0300 Shewhart EWMA SPE Shewhart EWMA R283. 6 A 005-9903 202-006-05 Application of Statistical Process Control in Pretreatment

Διαβάστε περισσότερα

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical

Διαβάστε περισσότερα

Motion analysis and simulation of a stratospheric airship

Motion analysis and simulation of a stratospheric airship 32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric

Διαβάστε περισσότερα

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide

Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic

Διαβάστε περισσότερα

A new ent-kaurane diterpene from Euphorbia stracheyi Boiss

A new ent-kaurane diterpene from Euphorbia stracheyi Boiss SUPPLEMENTARY MATERIAL A new ent-kaurane diterpene from Euphorbia stracheyi Boiss Tie Liu a, Qian Liang a,b, Na-Na Xiong a, Lin-Feng Dai a, Jun-Ming Wang a,b, Xiao-Hui Ji c, Wen-Hui Xu a, * a Key Laboratory

Διαβάστε περισσότερα

Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών

Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών Διαμόρφωση υποστρωμάτων στη μικροκαι νανο-κλίμακα για την δημιουργία πρωτεϊνικών μικροσυστοιχιών Επιστημονικοί Υπεύθυνοι έργου: A. Τσερέπη Ινστιτούτο Μικροηλεκτρονικής Π. Σ. Πέτρου Ινστιτούτο Ραδιοϊσοτόπων

Διαβάστε περισσότερα

Development of a basic motion analysis system using a sensor KINECT

Development of a basic motion analysis system using a sensor KINECT KINECT 1,a) 2 3,b) KINECT KINECT ( ( Development of a basic motion analysis system using a sensor KINECT Abstract: We developed a basic motion analysis system using a sensor KINECT. Our system estimates

Διαβάστε περισσότερα

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης

Διπλωματική Εργασία. Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική. Αντωνίου Φάνης Διπλωματική Εργασία Μελέτη των μηχανικών ιδιοτήτων των stents που χρησιμοποιούνται στην Ιατρική Αντωνίου Φάνης Επιβλέπουσες: Θεοδώρα Παπαδοπούλου, Ομότιμη Καθηγήτρια ΕΜΠ Ζάννη-Βλαστού Ρόζα, Καθηγήτρια

Διαβάστε περισσότερα

2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t.

2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t. 36 2010 8 8 Vol 36 No 8 JOURNAL OF BEIJING UNIVERSITY OF TECHNOLOGY Aug 2010 Ⅰ 100124 TB 534 + 2TP 273 A 0254-0037201008 - 1091-08 20 Hz 2 ~ 8 Hz 1988 Blondet 1 Trombetti 2-4 Symans 5 2 2 1 1 1b 6 M p

Διαβάστε περισσότερα

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***

* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA*** J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through

Διαβάστε περισσότερα

Quick algorithm f or computing core attribute

Quick algorithm f or computing core attribute 24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute

Διαβάστε περισσότερα

Supporting Information

Supporting Information Supporting Information Lewis acid catalyzed ring-opening reactions of methylenecyclopropanes with diphenylphosphine oxide in the presence of sulfur or selenium Min Shi,* Min Jiang and Le-Ping Liu State

Διαβάστε περισσότερα

Sampling Basics (1B) Young Won Lim 9/21/13

Sampling Basics (1B) Young Won Lim 9/21/13 Sampling Basics (1B) Copyright (c) 2009-2013 Young W. Lim. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any

Διαβάστε περισσότερα

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long

Διαβάστε περισσότερα

Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography

Determination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography 2010 10 October 2010 ROCK AND MINERAL ANALYSIS Vol. 29 No. 5 503 ~ 507 0254 5357 2010 05 0503 05-1 2 3 1 1 1. 100037 2. 710021 3. 100083 13 Carb Rtx - OPP2-0. 67 ~ 1. 50 ng /ml 0. 67 ~ 600 ng /ml 0. 999

Διαβάστε περισσότερα

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human

Διαβάστε περισσότερα

30.00% 3/ % 2/10 HHV-6 OLP 12.50% 2/16

30.00% 3/ % 2/10 HHV-6 OLP 12.50% 2/16 386 37 4 2010 7 www.gjkqyxzz.cn -5~8 1 2 1 1 2 1 1 2 (1. 116027; 2. 116600) [ ] HHV -5~8 OLP 36 OLP 43 HHV-5 OLP 50.00% 8/16 25.00% 4/16 80.00% 4/5 50.00% 8/16 18.75% 3/16 30.00% 3/10 20.00% 2/10 HHV-6

Διαβάστε περισσότερα

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPRTING INFRMATIN Per(-guanidino--deoxy)cyclodextrins: Synthesis, characterisation and binding behaviour toward selected small molecules and DNA. Nikolaos Mourtzis, a Kyriaki Eliadou, a Chrysie Aggelidou,

Διαβάστε περισσότερα

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte

Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with

Διαβάστε περισσότερα

ΠΡΟΚΗΡΥΞΗ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ

ΠΡΟΚΗΡΥΞΗ ΠΡΟΧΕΙΡΟΥ ΜΕΙΟΔΟΤΙΚΟΥ ΔΙΑΓΩΝΙΣΜΟΥ ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

The optimization of EV powertrain s efficiency control strategy under dynamic operation condition

The optimization of EV powertrain s efficiency control strategy under dynamic operation condition 16 3 2012 3 ELECTRI C MACHINES AND CONTROL Vol. 16 No. 3 Mar. 2012 1 1 1 2 2 3 1. 250061 2. 250014 3. 251010 3. 3% U 469. 72 A 1007-449X 2012 03-0053- 07 The optimization of EV powertrain s efficiency

Διαβάστε περισσότερα

TGFp FSH INH INH

TGFp FSH INH INH (210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH

Διαβάστε περισσότερα

2001/10/26 NSC B

2001/10/26 NSC B NSC892323B006006 90 10 26 1 HRP acridinium ester ELISA validation pattern AFP PMMA Keywordstumor marker, immunoassay, microchip, chemiluminescence Cancer is the first leading cause of death in Taiwan.

Διαβάστε περισσότερα

GF GF 3 1,2) KP PP KP Photo 1 GF PP GF PP 3) KP ULultra-light 2.KP 2.1KP KP Fig. 1 PET GF PP 4) 2.2KP KP GF 2 3 KP Olefin film Stampable sheet

GF GF 3 1,2) KP PP KP Photo 1 GF PP GF PP 3) KP ULultra-light 2.KP 2.1KP KP Fig. 1 PET GF PP 4) 2.2KP KP GF 2 3 KP Olefin film Stampable sheet JFE No. 4 20045 p 82 Composite Material for Automotive Headliners Expandable Stampable Sheet with Light Weight and High Stiffness A JFE SUZU JFE HA KP 50 mass 30 UL 800 g/m 2 7.2 N/mm Abstract: KP-Sheet

Διαβάστε περισσότερα

HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1

HPLC- ESI-MS HPLC-ESI-MS HPLC-ESI-MS HPLC 11 HPLC HPLC-ESI-MS. Asterias rollestoni Bell. LC- MS. Vol.11 No.1 HPLC- ESI-MS * 200 Vol.11 No.1 ** 266061 266061 361005 266003 - HPLC-ESI-MS HPLC-ESI-MS HPLC HPLC-ESI-MS 11 HPLC - Asterias rollestoni Bell. [1~7] [1] [5~7] - - [8~] LC- MS * ** 173 2008-11-04 200-01-06

Διαβάστε περισσότερα

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )

VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , ) 22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL

Διαβάστε περισσότερα

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.

FENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700. 38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300

Διαβάστε περισσότερα

BD OptEIA ELISA Sets ELISA

BD OptEIA ELISA Sets ELISA BD OptEIA ELISA Sets ELISA BD OptEIA ELISA Sets ELISA CaptureDetection Detection 9620 170,000 ELISAEnzymed-Linked ImmunoSorbent Assay CaptureDetection BD OptEIA ELISA Set 2 BD OptEIA ELISA Set BD OptEIA

Διαβάστε περισσότερα