Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %"

ÔΠοσειδῶν Αλεξίου
5 χρόνια πριν
Προβολές:

1 Journal of Ningxia Medical University BRCA BRCA PCR BRCA % 2 M2610I 2405 delt stp729 1 E2924X P = IVS21-66T /C % 20% χ 2 = P < BRCA2 BRCA2 Q754 A ± BRCA2 BRCA1 t = P > % 1 14% BRCA DNA BRCA2 5mL EDTA PCR DNA DP318 DNA BRCA2 120μL TE http / /genome. ucsc edu / BRCA2 2 2 Exon Size bp F AAGCAGTCTTCCTGCCTCAG 11A R TTTCAGGTGGCAACAGCTC 21 ~ ± F GCAATTTTAGCAGTTTCAGGAC R GGGCTTTAAAATTACCACCA ~ F TTTGTCCTGTTTAAAGCCATC R AGTGGATTTTGCTTCTCTGA E - mail c340@163. com E - mail yjjster@gmail. com 1. 4 PCR 50μL 10 PCR Buffer 5μL 10mmol L - 1 dntp 1. 2μL 25 mmol L - 1 MgCl 2 3μL Taq DNA 1U DNA 200ng 0. 33μmol L - 1 ddh 2 O

2 μL 94 3 min 94 30s s s 72 5min 4 PCR 10μL 1. 5% 110V 30min 1. 5 PCR delt 2610 G > C BIC GenBank BRCA G > T 3 2 BIC 46 5 Blast ht- 2 tp / /blast. ncbi. nlm. nih. gov /Blast. cgi 2 BRCA2 / / BIC F6 46 exon G > C MET to Ile 50 0 F10 41 exon G > T Glu to stop 45 4 F15 58 exon delt Stop F2 48 Intron C > T No coding 60 4 F13 44 exon A > G Ser to Ser S22 31 exon T > C His to His 7 S23 35 Intron G > T No coding 0 37 ~ 67 Intron T > C No coding F1 ~ F16 S1 ~ S30 GenBank BRCA2 U BIC G > C 794 IVS21-66T > C % 9 /16 MET Ile MET 20% 6 /30 χ 2 = P < G > T 2924 Glu 3 BRCA 2 13q12 ~ del T 27 mrna 11386bp BRCA1 BRCA2 3 BRCA % 10% ~ 20% BRCA2 1 0 /30 BRCA2 P = BIC % ~ 70%

3 6. 16 BRCA2 517 Wilkins % BRCA1 BRCA2 J BIC BRCA1 BRCA2 J G > C 794 MET Ile MET 5. BRCA1 BRCA2 DBC2 J BRCA2 BRCA1 BRCA2 J delt Eva Gross Norbert Arnold Katharina Pfeifer et al. I- 729 dentification of specific BRCA1 and BRCA2 variants by 53 DHPLC J. Human Mutation / Wooster R Bignell G Lancaster J et al. Identification 2 /2 of the breast cancer susceptibility gene BRCA2 J. Nature BRCA2 9 Ikeda N Miyoshi Y Yoneda K et al. Frequency of 16 9 BRCA1 and BRCA2 germline muta - tions in Japanese IVS21-66T > C breast cancer families J. Int J Cancer P < Shoei S Li L Tseng HM et al. Molecular characterization of germline mutations in the BRCA1 and mrna BRCA2 genes from breast cancer families in Taiwan J. Hum Genet BRCA2 0 /3 11 Kwong A Wong LP Wong HN et al. A BRCA2 BRCA2 founder mutation and seven novel deleterious BRCA mutations in southern Chinese women with breast and ovarian cancer J. Breast Cancer Res Treat Berchuck A Carney M Lancaster JM et al. Familial breast - ovarian cancer syndromes BRCA1 and BRCA2 J. Clin Obstet Gynecol Harris JR Lippman MG Morrow M et al. Diseases of the breast second edition M. Lippincott Williams & Jara L Ampuero S Santibanez E et al. BRCA1 and BRCA2 mutations in a south American population J. Cancer Genet Cytogenet Analysis of the Mutations of BRCA2 Gene among Patients with Familial Breast Cancer CUI Zhen 1 YANG Yun-zhen 2 YU Hui 2 ZHANG Da-qing 1 YU Jian-jun 3 1. Ningxia Medical University Yinchuan Ningxia People s Hospital Yinchuan The General Hospital of Ningxia Med. Univ. Yinchuan Abstract Objective To analyze the prevalence of BRCA2 gene mutations in patients with familial breast cancer. Methods Peripheral blood Samples were collected from 16 patients with familial breast cancer from 16 breast cancer families and 30 sporadic breast cancer patients controls. BRCA2 gene mutations were de-

4 tected by polymerase chain reaction PCR and direct sequencing. Results Three pathogenic mutations were found in these 16 familial breast cancer patients % and two of them were novel mutations missense mutation 2610 G > C and frameshift mutation 2405 del T. No pathogenic mutations were detected in 30 sporadic breast cancer patients % VS 0 P = Nine familial and six poradic breast cancer patients showed a known variation in intron 21 IVS21-66T > C. The mutation ratio of familial breast cancer patients % 9 /16 was higher than that of controls 20% 6 /30 and the difference was significant χ 2 = P < Conclusion The mutations of BRCA2 is related to Chinese familial breast cancer in Ningxia. It is necessary to give genetic test for familial breast cancer patients especially in those population with high familial risk of breast cancer. Key words breast cancer BRAC2 mutation polymorphism Park YW Zhu S Palaniappan L et al. The metabolic syndrome prevalence and associated risk factor findings in the third national health and nutrition examina- 9. tion surrey J. Arch Intern Med J J J Park YW Zhu S Palaniappan L et al. The metabolic J syndrome prevalence and associated risk factor findings in the third national health and nutrition examination surrey J. Arch Intern Med Risk Factors of Metabolic Syndrome in Han and Hui Ethnic Group of Yinchuan BAI Dan ZHU Ling - qin JI Wen - wu LIU Xiu - fang YANG Hui - fang School of Public Health Ningxia Medical University Yinchuan Abstract Objective To investigate the risk factors and its characteristics in patients with metabolic syndrome MS in Yinchuan. Methods A case - control study was performed. 200 patients were selected as case group and matched the controls according to gender age and ethnicity A questionnaire survey was conducted. The relationship between risk factors and MS was analyzed by multivariate logistic regression analysis. Results 1. Body weight BMI systolic blood pressure diastolic blood pressure were the risk factors for MS P < Analysis showed that addicted to meat OR = Hui OR = Han OR = addicted to salt OR = Hui OR = were the risk factors for MS P < Conclusion Weight hypertension and eating habits are the risk factors for MS and the MS risk factors of Hui and Han ethnic group in Yinchuan showed ethnic differences. Key words metabolic syndrome Hui nationality risk factors

Σχετικά έγγραφα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.