Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer"

Φωτινή Αρβανίτης
5 χρόνια πριν
Προβολές:

1 4 Vol No Life Science Research ug 009 *,, 08 :,,, SYBR Green I,,,, β Ivs--654 (C T) CD7 ( T) : ; ; SYBR Green I; :Q9 : : (009) Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer MENG Xiang-xian HUNG Jian-hua TN Yong-jun * Institute of Biological Technology State Key Laboratory of Chemo / Biosensing and Chemometrics Hunan University Changsha 08 Hunan China bstract n approach has been developed to genotype point mutations using ligase-mediated induced fluorescence resonance energy transfer FRET When two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex Duplex inseting dye insects into duplex strands to form induced FRET When there is a mismatch among probes and template FRET can not be induced Using this method the homozygotes and heterozygotes were scored accurately and conveniently This method has been validated with the genotyping of two common point mutations Ivs--654 C T and CD7 T and of β-globin gene in thalassemia disease Key words ligase induced fluorescence resonance energy transfer SYBR Green I thalassemia Life Science Research ~87 [5] [6] [8] [9] [~] DSH [] DSH [4] DSH Howell [] 999 [5~] DN : : : SK085 : 97- * ytan@yahoocom Tel

2 [] Jobs [] DSH- [] N N 69 β- Ivs--654 [] N N N X- ROX N4 N 5 N5 N6 CD7 SYBR Green I T4 DN ligase 0 T4 DN ligase buffer Taq TakaRa Ex tag 0 ExTaq buffer dntp TP MgCl mresco Solon OH β- Ivs--654 CD7 LS-55 Perkin Elmer mersham Name Template N Template N Probe Ivs--654 N Probe Ivs--654 N4 Probe CD7 N5 Probe CD7 N6 Table Oligonucleotides Sequence 5 5 tctaaagaataacagtgataatttctgggttaaggtaatagcaatatttctgcatataaatatttctgc 5 tctaaagaataacagtgataatttctgggttaaggcaatagcaatatttctgcatataaatatttctgc ROX-GTTGCTTT p-ccttccc ROX-CTTCCCT p-gcccccg U T4 DN ligase 0 mol / L Tris-HCl ph 76 0 mmol / L MgCl 0 μl 95 5 min 0 5 s 7 % 0 % ImageMaster VDS-CL mersh- 0 mmol / L DTT 0 mmol / L TP mmol / L am spermidine SYBR Green I 50 μl 7 LS nmol / L N/N PCR Perkin Elmer 7 00 nmol / L 5 nmol / L 5 nm T4 DN [8] 5 min 0 min 85 5 min 4 s 49 nm

3 4 : 85 SYBR Green I ROX 5 nm CCTTCTCC- PCR 49 nm 500 nm 700 nm 4 RDB DN PCR - -0 [5] [4] Reverse Dot Blot RDB β-globin Ivs--654 C T CD7 T DN 5 PCR PCR PCR 50 μl 05 U TakaRa Ex Taq Ex Taq Buffer mmol / L MgCl 0 mmol / L dntp Mixture 50 ng DN 0 nmol / L 0 nmol / L Ivs TCTG TCGTG- 5 - GCGTT TTTTGC- CD7 5 -GTCTGCC GTTCTGCCCTG- 5 - TCCCC 94 5 min 94 0 s 50 for Ivs for CD7 5 s 70 0 s % SYBR Green I SYBR Green I ROX SGI,, SYBR Green I, Fig Schematic diagram of the assay When the two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex SYBR Green I dye insects into duplex strands to form induced FRET 50 nm N [] SYBR N N Ivs--654 Green I ROX N N 5 nm 50% 50 nm SYBR Green I N 5 nm ROX 50 nm 5 min ~ N N/N ROX N 5 nm ROX

86 009 0 00 0 50 5 0 500 550 0 650 700 wavelength / nm -654 CD7 4 4 Ivs--654 5 nm 4 SYBR Green I ROX : N+ ; : N/N+ ; : N+ Fig Fluorescence spectra of point mutation detection using ligase-mediated

4 wavelength / nm -654 CD7 4 4 Ivs nm 4 SYBR Green I ROX : N+ ; : N/N+ ; : N+ Fig Fluorescence spectra of point mutation detection using ligase-mediated induced FRET Curve N+probes Curve N / N+probes Curve N+probes 4B CD7 5 nm 4 ~ ~ 0 N Marker 0 DN 0 DN 0 DN DN 0 0: N+ ( ); : N+ ; : N / N+ ; : N+ 4 Fig Denaturing polyacrylamide gel electrophoresis Ivs- 0 N+probes without ligase N+probes N / N+ probes N+probes t t / s 4 β Ivs--654 () CD7 (B) ~ Fig4 Detection of Ivs--654 CD7 B point mutations Curve is mutant homozygote curve is heterozygote curve is wild-type homozygote B t t / s

5 4 : 87 logy [7] CHEN X LIVK K J KWOK P Y homogeneous ligase- mediated DN diagnostic test[j] using DN ligase[j] Talanta (References): [] COOPER D N SMITH B COOKE H J et al n estimate of unique DN sequence heterozygosity in the human genome[j] Hum Genet [] CHRISTIE N J CHRISTOPHER IJ WILLIM et al Disease-causing point mutation in human mitochondrial trnmet results in trn misfolding leading to defects in translational initiation and elongation[j] J Biol Chem [] MURIZI D P SUSN M DOMCHEK J S et al The relative contribution of point mutations and genomic rearrangements in BRC and BRC in high-risk breast cancer families[j] Cancer Res [4] FODDE R LOSEKOOT M Mutation detection by denaturing gradient gel electrophoresis DGGE [J] Human Mutation [5] SYVNEN C LTOSRTL K HRJU L et al primer-guided nucleotide incorporation assay in the genotyping of apolipo protein E[J] Genomics [6] OSIOWY C Sensitive detection of HBsg mutants by a gap ligase chain reaction assay[j] Journal of Clinical Microbio- Genome Res [8] MENG X X LI H M WNG K M et al Fidelity genotyping of point mutation by enhanced melting point difference [9 ] TYGI S BRTU D P KRMER F R Multicolor molecular beacons for allele discrimination[j] Nat Biotechnol 998 [0] WLLCE R B SHFFER J MURPHY R F et al Hybridization of synthetic oligodeoxyribonucleotides tophix74 DN The effect of single base pair mismatch[j] Nucl cids Res [] HOWELL W M JOB M GYLLENSTEN U et al Dynamic allele-specific hybridization new method for scoring single nucleotide polymorphisms[j] Nat Biotechnol [] PRINCE J FRUK L HOWELLW M et al Robust and accurate single nucleotide polymorphism genotyping by dynamic allele-specific hybridization DSH Design criteria and assay validation[j] Genome Res [] JOBS M HOWELL W M STROMQVIST L et al DSH Flexible low cost and high-throughput SNP genotyping by dynamic allele-specific hybridization on membrane arrays [J] Genome Res [4] MO Q H ZHU H LI L Y et al Reliable and high throughout mutation screening for beta thalassemia by single base extension/ fluorescence polanization assay[j] Genet Testing [5] [M] HUNG P T translation Molecular Cloning Laboratory Manual rd ed [M] Beijing Science Press

Σχετικά έγγραφα

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing 2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin