Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer
|
|
- Φωτινή Αρβανίτης
- 6 χρόνια πριν
- Προβολές:
Transcript
1 4 Vol No Life Science Research ug 009 *,, 08 :,,, SYBR Green I,,,, β Ivs--654 (C T) CD7 ( T) : ; ; SYBR Green I; :Q9 : : (009) Point Mutation Detection Using Ligase-mediated Induced Fluorescence Resonance Energy Transfer MENG Xiang-xian HUNG Jian-hua TN Yong-jun * Institute of Biological Technology State Key Laboratory of Chemo / Biosensing and Chemometrics Hunan University Changsha 08 Hunan China bstract n approach has been developed to genotype point mutations using ligase-mediated induced fluorescence resonance energy transfer FRET When two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex Duplex inseting dye insects into duplex strands to form induced FRET When there is a mismatch among probes and template FRET can not be induced Using this method the homozygotes and heterozygotes were scored accurately and conveniently This method has been validated with the genotyping of two common point mutations Ivs--654 C T and CD7 T and of β-globin gene in thalassemia disease Key words ligase induced fluorescence resonance energy transfer SYBR Green I thalassemia Life Science Research ~87 [5] [6] [8] [9] [~] DSH [] DSH [4] DSH Howell [] 999 [5~] DN : : : SK085 : 97- * ytan@yahoocom Tel
2 [] Jobs [] DSH- [] N N 69 β- Ivs--654 [] N N N X- ROX N4 N 5 N5 N6 CD7 SYBR Green I T4 DN ligase 0 T4 DN ligase buffer Taq TakaRa Ex tag 0 ExTaq buffer dntp TP MgCl mresco Solon OH β- Ivs--654 CD7 LS-55 Perkin Elmer mersham Name Template N Template N Probe Ivs--654 N Probe Ivs--654 N4 Probe CD7 N5 Probe CD7 N6 Table Oligonucleotides Sequence 5 5 tctaaagaataacagtgataatttctgggttaaggtaatagcaatatttctgcatataaatatttctgc 5 tctaaagaataacagtgataatttctgggttaaggcaatagcaatatttctgcatataaatatttctgc ROX-GTTGCTTT p-ccttccc ROX-CTTCCCT p-gcccccg U T4 DN ligase 0 mol / L Tris-HCl ph 76 0 mmol / L MgCl 0 μl 95 5 min 0 5 s 7 % 0 % ImageMaster VDS-CL mersh- 0 mmol / L DTT 0 mmol / L TP mmol / L am spermidine SYBR Green I 50 μl 7 LS nmol / L N/N PCR Perkin Elmer 7 00 nmol / L 5 nmol / L 5 nm T4 DN [8] 5 min 0 min 85 5 min 4 s 49 nm
3 4 : 85 SYBR Green I ROX 5 nm CCTTCTCC- PCR 49 nm 500 nm 700 nm 4 RDB DN PCR - -0 [5] [4] Reverse Dot Blot RDB β-globin Ivs--654 C T CD7 T DN 5 PCR PCR PCR 50 μl 05 U TakaRa Ex Taq Ex Taq Buffer mmol / L MgCl 0 mmol / L dntp Mixture 50 ng DN 0 nmol / L 0 nmol / L Ivs TCTG TCGTG- 5 - GCGTT TTTTGC- CD7 5 -GTCTGCC GTTCTGCCCTG- 5 - TCCCC 94 5 min 94 0 s 50 for Ivs for CD7 5 s 70 0 s % SYBR Green I SYBR Green I ROX SGI,, SYBR Green I, Fig Schematic diagram of the assay When the two ligated probes are complementary to template ligase covalently joins the leak of two probes to form a long duplex SYBR Green I dye insects into duplex strands to form induced FRET 50 nm N [] SYBR N N Ivs--654 Green I ROX N N 5 nm 50% 50 nm SYBR Green I N 5 nm ROX 50 nm 5 min ~ N N/N ROX N 5 nm ROX
4 wavelength / nm -654 CD7 4 4 Ivs nm 4 SYBR Green I ROX : N+ ; : N/N+ ; : N+ Fig Fluorescence spectra of point mutation detection using ligase-mediated induced FRET Curve N+probes Curve N / N+probes Curve N+probes 4B CD7 5 nm 4 ~ ~ 0 N Marker 0 DN 0 DN 0 DN DN 0 0: N+ ( ); : N+ ; : N / N+ ; : N+ 4 Fig Denaturing polyacrylamide gel electrophoresis Ivs- 0 N+probes without ligase N+probes N / N+ probes N+probes t t / s 4 β Ivs--654 () CD7 (B) ~ Fig4 Detection of Ivs--654 CD7 B point mutations Curve is mutant homozygote curve is heterozygote curve is wild-type homozygote B t t / s
5 4 : 87 logy [7] CHEN X LIVK K J KWOK P Y homogeneous ligase- mediated DN diagnostic test[j] using DN ligase[j] Talanta (References): [] COOPER D N SMITH B COOKE H J et al n estimate of unique DN sequence heterozygosity in the human genome[j] Hum Genet [] CHRISTIE N J CHRISTOPHER IJ WILLIM et al Disease-causing point mutation in human mitochondrial trnmet results in trn misfolding leading to defects in translational initiation and elongation[j] J Biol Chem [] MURIZI D P SUSN M DOMCHEK J S et al The relative contribution of point mutations and genomic rearrangements in BRC and BRC in high-risk breast cancer families[j] Cancer Res [4] FODDE R LOSEKOOT M Mutation detection by denaturing gradient gel electrophoresis DGGE [J] Human Mutation [5] SYVNEN C LTOSRTL K HRJU L et al primer-guided nucleotide incorporation assay in the genotyping of apolipo protein E[J] Genomics [6] OSIOWY C Sensitive detection of HBsg mutants by a gap ligase chain reaction assay[j] Journal of Clinical Microbio- Genome Res [8] MENG X X LI H M WNG K M et al Fidelity genotyping of point mutation by enhanced melting point difference [9 ] TYGI S BRTU D P KRMER F R Multicolor molecular beacons for allele discrimination[j] Nat Biotechnol 998 [0] WLLCE R B SHFFER J MURPHY R F et al Hybridization of synthetic oligodeoxyribonucleotides tophix74 DN The effect of single base pair mismatch[j] Nucl cids Res [] HOWELL W M JOB M GYLLENSTEN U et al Dynamic allele-specific hybridization new method for scoring single nucleotide polymorphisms[j] Nat Biotechnol [] PRINCE J FRUK L HOWELLW M et al Robust and accurate single nucleotide polymorphism genotyping by dynamic allele-specific hybridization DSH Design criteria and assay validation[j] Genome Res [] JOBS M HOWELL W M STROMQVIST L et al DSH Flexible low cost and high-throughput SNP genotyping by dynamic allele-specific hybridization on membrane arrays [J] Genome Res [4] MO Q H ZHU H LI L Y et al Reliable and high throughout mutation screening for beta thalassemia by single base extension/ fluorescence polanization assay[j] Genet Testing [5] [M] HUNG P T translation Molecular Cloning Laboratory Manual rd ed [M] Beijing Science Press
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Capillary Gel Electrophoresis for Ligase Detection Reaction Products
THE SCIENCE AND ENGINEERING REVIEW OF DOSHISHA UNIVERSITY, VOL. 50, NO. 4 January 2010 Capillary Gel Electrophoresis for Ligase Detection Reaction Products Masahiko HASHIMOTO*, Jun KAMIGORI** and Kazuhiko
A Novel Fluorescence Assay for the Activity of Restriction Endonuclease Based on Molecular Beacon
13 1 Vol13 No1 29 2 Life Science Research Feb 29 29 *,,,,, 4182 :,, (Molecular Beacon, MB),,,, 5~5 U / ml, 5 U / ml, Alu : ; ; : Q55 : A : 17-7847(29)1-6-5 A Novel Fluorescence Assay for the Activity of
Methodology Research on Loss of Heterozygosity of APC Gene Detection Exon 11 of Gastric Cancer by Capillary Electrophoresis
30 5 2011 5 FENXI CESHI XUEBAO Journal of Instrumental Analysis Vol. 30 No. 5 498 ~ 502 APC 1 2 1 2 2 1 2 3 2 2 1. 730000 2. 730050 3. 730070 PCR APC 96 RsaⅠ CE - SS- CP CE - RFLP PAGE - SSCP PAGE 15%
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Metallurgical Analysis. qu) 2 BPB, 1 Table 1 Spectrophotometric determination of copper. / 10 4 (L mol - 1 cm - 1 )
23 6 2003 12 Metallurgical Analysis :1000-7571(2003) 06-0024 - 09 3, (, 130022) : (19982001), 147 :; :O657132 :A,,Cu 2 + 4,22 2, ph10 Cu + 2,2 2 (Bi2qu) (BPB) Cu(Bi2 qu) 2 BPB,, [13 ] BPB (19982001) Cu
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
FENXI HUAXUE Chinese Journal of Analytical Chemistry. Single nucleoitide polymorphism SNP. PCR Gold magnetic nanoparticles GMNPs ssdna-gmnps SNP
38 2010 12 FENXI HUAXUE Chinese Journal of Analytical Chemistry 12 1708 ~ 1713 DOI 10. 3724 /SP. J. 1096. 2010. 01708 1 1 2 2 1 1 1 1 2 * 1 2 1 210096 2 412008 Single nucleoitide polymorphism SNP PCR Gold
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
SUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Supplementary Information
Electronic upplementary Material (EI) for Photochemical & Photobiological ciences. This journal is The Royal ociety of Chemistry and wner ocieties 214 upplementary Information elective and sensitive fluorescence-shift
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
Evolution of Novel Studies on Thermofluid Dynamics with Combustion
MEMOIRS OF SHONAN INSTITUTE OF TECHNOLOGY Vol. 42, No. 1, 2008 * Evolution of Novel Studies on Thermofluid Dynamics with Combustion Hiroyuki SATO* This paper mentions the recent development of combustion
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based polymers and their boron nitride analogues
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Computational study of the structure, UV-vis absorption spectra and conductivity of biphenylene-based
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Electronic Supplementary Information
Electronic Supplementary Information Unprecedented Carbon-Carbon Bond Cleavage in Nucleophilic Aziridine Ring Opening Reaction, Efficient Ring Transformation of Aziridines to Imidazolidin-4-ones Jin-Yuan
Real-Time PCR Mycoplasma pneumoniae
148 2009 Real-Time PCR Mycoplasma pneumoniae 20 12 26 21 5 11 10 30 Mycoplasma pneumoniae real-time PCR M. pneumoniae 3 SYBR Green I Light Cycler 2.0 system (Roche) PCR 45 PCR primer M. pneumoniae 16S
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity
Comparison of carbon-sulfur and carbon-amine bond in therapeutic drug: -S-aromatic heterocyclic podophyllum derivatives display antitumor activity Jian-Long Li 1,a, Wei Zhao 1,a, Chen Zhou 1,a, Ya-Xuan
DNA G7444A, 2. Study on a new point mutation of nt7444 G A in the mitochondrial DNA in a type 2 diabetes mellitus family
HEREDITAS (Beijing) 2007 4, 29(4): 433 437 ISSN 0253-9772 www.chinagene.cn DOI: 10.1360/yc-007-0433 2 DNA G7444A,,,,,,,, 350005 : PCR-RFLP 2 DNA G7444A,, 27, 11 DNA G7444A, 11 2 5, 1,, DNA G7444A, 2 :
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΠΩΣ Η ΚΑΤΑΝΑΛΩΣΗ ΦΡΟΥΤΩΝ ΚΑΙ ΛΑΧΑΝΙΚΩΝ ΕΠΗΡΕΑΖΕΙ ΤΗΝ ΠΡΟΛΗΨΗ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ Όνομα φοιτήτριας ΚΑΛΑΠΟΔΑ ΜΑΡΚΕΛΛΑ
Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer
2004 62 3 274 278 ACTA CHIMICA SINICA Vol 62 2004 No 3 274 278 a b a a Ξ a a Ξ ( a 300071) ( b 300070) 5 PCR PCR PCR 0 15 1 50 10 3 amol/ L R 2 = 0 9992 PCR (PCR) Real2time Quantitative Assay of Telomerase
A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A facile and general route to 3-((trifluoromethyl)thio)benzofurans and 3-((trifluoromethyl)thio)benzothiophenes
Conjoint. The Problems of Price Attribute by Conjoint Analysis. Akihiko SHIMAZAKI * Nobuyuki OTAKE
Conjoint Conjoint The Problems of Price Attribute by Conjoint Analysis Akihiko SHIMAZAKI * Nobuyuki OTAKE +, Conjoint - Conjoint. / 0 PSM Price Sensitivity Measurement Conjoint 1 2 + Conjoint Luce and
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Engineering Tunable Single and Dual Optical. Emission from Ru(II)-Polypyridyl Complexes. Through Excited State Design
Engineering Tunable Single and Dual Optical Emission from Ru(II)-Polypyridyl Complexes Through Excited State Design Supplementary Information Julia Romanova 1, Yousif Sadik 1, M. R. Ranga Prabhath 1,,
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
DOI: /j.cnki.bingduxuebao
33 1 2017 1 CHINESEJOURNALOF VIROLOGY Vol.33 No.1 January 2017 PCR! ( 102206) : PCR(DigitalPCRdPCR) (InfluenzaAvi- rusflua) dpcr dpcr 64.4 ; FluA dpcr FluA 37.7~8.22 " 10 4 /#L 3.77 / dpcr R 2 = 0.9988
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
katoh@kuraka.co.jp okaken@kuraka.co.jp mineot@fukuoka-u.ac.jp 4 35 3 Normalized stress σ/g 25 2 15 1 5 Breaking test Theory 1 2 Shear tests Failure tests Compressive tests 1 2 3 4 5 6 Fig.1. Relation between
, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Supporting Information. Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 16 Supporting Information Introduction of a α,β-unsaturated carbonyl conjugated pyrene-lactose hybrid
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα
9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer catalysts
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 9-amino-(9-deoxy)cinchona alkaloids-derived novel chiral phase-transfer
Fused Bis-Benzothiadiazoles as Electron Acceptors
Fused Bis-Benzothiadiazoles as Electron Acceptors Debin Xia, a,b Xiao-Ye Wang, b Xin Guo, c Martin Baumgarten,*,b Mengmeng Li, b and Klaus Müllen*,b a MIIT Key Laboratory of ritical Materials Technology
Περίπτωση ήπιου μεσογειακού συνδρόμου λόγω αλληλεπίδρασης Hb Adana με ετερόζυγη α+ μεσογειακή αναιμία
ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 10 Περίπτωση ήπιου μεσογειακού συνδρόμου λόγω αλληλεπίδρασης Hb Adana με ετερόζυγη α+ μεσογειακή αναιμία Ελένη Παπαδοπούλου Μαρίνα Οικονόμου Εισαγωγή Η α-μεσογειακή
VBA Microsoft Excel. J. Comput. Chem. Jpn., Vol. 5, No. 1, pp (2006)
J. Comput. Chem. Jpn., Vol. 5, No. 1, pp. 29 38 (2006) Microsoft Excel, 184-8588 2-24-16 e-mail: yosimura@cc.tuat.ac.jp (Received: July 28, 2005; Accepted for publication: October 24, 2005; Published on
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Study on Purification Technology and Antioxidant Activity of Total Flavonoid from Eriobotryae Folium
Interleukin-1beta causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung [J]. Am J Respir Cell Mol Biol, 2005, 32(4): 311-318. [10] FAN C H, LI S Y, LI M, et al. The clinical
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
MnZn. MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer. Abstract:
MnZn JFE No. 8 5 6 p. 32 37 MnZn Ferrites with Low Loss and High Flux Density for Power Supply Transformer FUJITA Akira JFE Ph. D. FUKUDA Yutaka JFE NISHIZAWA Keitarou JFE TOGAWA Jirou MnZn Fe2O3 1 C NiO
2 ~ 8 Hz Hz. Blondet 1 Trombetti 2-4 Symans 5. = - M p. M p. s 2 x p. s 2 x t x t. + C p. sx p. + K p. x p. C p. s 2. x tp x t.
36 2010 8 8 Vol 36 No 8 JOURNAL OF BEIJING UNIVERSITY OF TECHNOLOGY Aug 2010 Ⅰ 100124 TB 534 + 2TP 273 A 0254-0037201008 - 1091-08 20 Hz 2 ~ 8 Hz 1988 Blondet 1 Trombetti 2-4 Symans 5 2 2 1 1 1b 6 M p
ACTA MATHEMATICAE APPLICATAE SINICA Nov., ( µ ) ( (
35 Þ 6 Ð Å Vol. 35 No. 6 2012 11 ACTA MATHEMATICAE APPLICATAE SINICA Nov., 2012 È ÄÎ Ç ÓÑ ( µ 266590) (E-mail: jgzhu980@yahoo.com.cn) Ð ( Æ (Í ), µ 266555) (E-mail: bbhao981@yahoo.com.cn) Þ» ½ α- Ð Æ Ä
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
N 2 O 15 N NH + NH 3 Rittenberg mg mmol L - 1 CuSO mg. 10 mol L. Pre-Concentration device PreCon
50 1 Vol. 50 No. 1 2013 1 ACTA PEDOLOGICA SINICA Jan. 2013 N 2 O * N 210008 N 2 O N 2 O N N 2 O N N 5 ~ 20 μg N N 2 O N S8. 3 A N N 2 O N N N NO - 3 NO - 2 N N N MgO NH 3 Rittenberg 1 Dumas N 1 2 N N 2
Research on the Environmental Impact Factors of Electromagnetic Radiation from High - speed Railway
2013 8 8 179 JOURNAL OF RAILWAY ENGINEERING SOCIETY Aug 2013 NO. 8 Ser. 179 1006-2106 2013 08-0088 - 06 430063 1 2 3 4 X5 A Research on the Environmental Impact Factors of Electromagnetic Radiation from
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
VSC STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL OF VSC2HVDC SYSTEM VSC (1. , ; 2. , )
22 1 2002 1 Vol. 22 No. 1 Jan. 2002 Proceedings of the CSEE ν 2002 Chin. Soc. for Elec. Eng. :025828013 (2002) 0120017206 VSC 1, 1 2, (1., 310027 ; 2., 250061) STEADY2STATE MOD EL AND ITS NONL INEAR CONTROL
Supporting Information One-Pot Approach to Chiral Chromenes via Enantioselective Organocatalytic Domino Oxa-Michael-Aldol Reaction
Supporting Information ne-pot Approach to Chiral Chromenes via Enantioselective rganocatalytic Domino xa-michael-aldol Reaction Hao Li, Jian Wang, Timiyin E-Nunu, Liansuo Zu, Wei Jiang, Shaohua Wei, *
Single-site association results for 136 SCARB1 genotyped variants with HDL-C.
Table S9. Single-site association results for 136 SCARB1 genotyped variants with HDL-C. SNP Name a SNP ID b Chr12 Position c Location Amino Acid Change RegDB Score d MA, MAF Genotype Genotype Count Adjusted
Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. No ,**1
No. +- 0 +3,**1 Technical Research Report, Earthquake Research Institute, the University of Tokyo, No. +-, pp. 0 +3,,**1. * Construction of the General Observation System for Strong Motion in Earthquake
MOTROL. COMMISSION OF MOTORIZATION AND ENERGETICS IN AGRICULTURE 2014, Vol. 16, No. 5,
MOTROL. COMMISSION OF MOTORIZATION AND ENERGETICS IN AGRICULTURE 2014, Vol. 16, No. 5, 3 14 -, :., 83, 66404 e-mail: chupinvr@istu.irk.ru...,,., -,.,. :,,,,,, -, - [1].,.., [2, 3].,.,,,.,,, [4, 5].,..1.
Supporting Information
Supporting Information for Lewis acid-catalyzed redox-neutral amination of 2-(3-pyrroline-1-yl)benzaldehydes via intramolecular [1,5]-hydride shift/isomerization reaction Chun-Huan Jiang, Xiantao Lei,
Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes
Supporting Information for Lewis Acid Catalyzed Propargylation of Arenes with O-Propargyl Trichloroacetimidate: Synthesis of 1,3-Diarylpropynes Changkun Li and Jianbo Wang* Beijing National Laboratory
Retrieval of Seismic Data Recorded on Open-reel-type Magnetic Tapes (MT) by Using Existing Devices
No. 3 + 1,**- Technical Research Report, Earthquake Research Institute, University of Tokyo, No. 3, pp. + 1,,**-. MT * ** *** Retrieval of Seismic Data Recorded on Open-reel-type Magnetic Tapes (MT) by
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Motion analysis and simulation of a stratospheric airship
32 11 Vol 32 11 2011 11 Journal of Harbin Engineering University Nov 2011 doi 10 3969 /j issn 1006-7043 2011 11 019 410073 3 2 V274 A 1006-7043 2011 11-1501-08 Motion analysis and simulation of a stratospheric
Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική. ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ
Ελαφρές κυψελωτές πλάκες - ένα νέο προϊόν για την επιπλοποιία και ξυλουργική ΒΑΣΙΛΕΙΟΥ ΒΑΣΙΛΕΙΟΣ και ΜΠΑΡΜΠΟΥΤΗΣ ΙΩΑΝΝΗΣ Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Σχολή ασολογίας και Φυσικού Περιβάλλοντος,
Approximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Analysis of energy consumption of telecommunications network and application of energy-saving techniques
40 2 ( ) Vol.40 No.2 2009 4 Journal of Central South University (Science and Technology) Apr. 2009 1, 2 (1. 430074 2. 410015) TN915 A 1672 7207(2009)02 0464 07 Analysis of energy consumption of telecommunications
Table of Contents 1 Supplementary Data MCD
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting Information for Magnetic circular dichroism and density functional theory
Reading Order Detection for Text Layout Excluded by Image
19 5 JOURNAL OF CHINESE INFORMATION PROCESSING Vol119 No15 :1003-0077 - (2005) 05-0067 - 09 1, 1, 2 (11, 100871 ; 21IBM, 100027) :,,, PMRegion,, : ; ; ; ; :TP391112 :A Reading Order Detection for Text
Study on the Electrochemical Behaviors of Vincristine and the Interaction of Vincristine with Tubulin
2004 62 2, 137 141 ACTA CHIMICA SINICA Vol 62, 2004 No 2, 137 141 a, b Ξ, a a a Ξ ( a 100875) ( b 100080) 0105 mol/ L Tris, 0115 mol/ L NaCl, (VCR) - 1168 V (vs Ag/ AgCl), 110 10-8 210 10-7 mol/ L VCR,
Diagnosing X-linked Ichthyosis by Monoplast Single-round Duplex PCR
13 4 Vol13 No4 2009 8 Life Science Research Aug 2009 2009 PCR X- *,,,,,,,, 410078 : X- (X-linked ichthyosis, XLI), XLI, XLI (preimplantation genetic diagnosis, PGD) PCR amelogenin (Amel), 958% 909%, 15%;
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans. Supporting Information
Novel and Selective Palladium-Catalyzed Annulation of 2-Alkynylphenols to Form 2-Substituted 3-Halobenzo[b]furans Liang Yun, Shi Tang, Xu-Dong Zhang, Li-Qiu Mao, Ye-Xiang Xie and Jin-Heng Li* Key Laboratory
Τεχνικές Μοριακής Ενδοκρινολογίας. Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής
Τεχνικές Μοριακής Ενδοκρινολογίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της Παιδιατρικής
Experimental Study of Dielectric Properties on Human Lung Tissue
32 2 2013 4 Chinese Journal of Biomedical Engineering Vol. 32 No. 2 April 2013 1 1* 2 1 300072 2 300052 Agilent 4294A 100 Hz ~ 100 MHz Cole-Cole 3 ~ 5 1. 6 ~ 3. 3 R α τ f c P < 0. 05 EIT R318 A 0258-8021
Analysis of monosaccharides in the saffron corm glycoconjugate by capillary electrophoresis
2012 3 Vol. 30 No. 3 March 2012 Chinese Journal of Chromatography 304 ~ 308 DOI 10. 3724 /SP. J. 1123. 2011. 11015 * 210009 9. 5% v /v 80 2 h 234 nm 60 cm 50 cm 50 μm 25 20 kv 350 mmol /L ph 10. 21 3.
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)
«Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου
Tunable Diode Lasers. Turning Laser Diodes into Diode Lasers. Mode selection. Laser diodes
Tunable Diode Lasers Turning Laser Diodes into Diode Lasers Laser diodes Mode selection FP diodes high power at low cost AR diodes for best performance Compact and robust Littrow setup Highest power from
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Quantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with