272F : 56 2AGAGTTTGAT 70 %, ( Probiotics), DNA ) ; GIS22008 ( CCTGGCTCAG23,14922R : 5 2GGTTACCTTGTTACGAC. rdna,

Transcript

1 Acta Microbiologica Sinica 47 (4) : August , 1,2 3, 1, 3 ( ) ( ) : 16S rdna (RFLP) 12, 16S rdna, GenBank BLAST, : 16S rdna : (Proteobacteria) (Firmicutes), 7514 %, 94 % ; 2416 %, 98 %, ( Shewanella), ( Pantoea),Aranicola, ( Pseudomonas) ( Vibrio) : ; ; :Q939 :A : (2007) ,,,, :,,,,,, [1,2 ], ( Probiotics),,, [3 5 ],,, [6 ],, [7,8 ],,, 99 % [9 ],, DNA, 16S rdna, : (5 6gΠ ) , ( 25 28,pH , 8 % 10, 3 %, 3 : 08 :00 15 :00 22 :00) 40d, %,,, 70 % DNA :DNA ; pmd182t( PCR ) ( Af a Msp ) PCR TaKaRa ; ( Escherichia coli) DH5 PCR ( Biometra ) ; GIS22008 ( ) : 272F : 56 2AGAGTTTGAT CCTGGCTCAG23,14922R : 5 2GGTTACCTTGTTACGAC TT23 ; pmd 182T M13247 : 5 2 CGCCAGGGTTTTCCCAGTCACGAC23,RV2M : 5 2 AGC : ( ) ; (2004I023) ; ( ) 3 Tel : ; Fax : ; E2mail edu. cn : ( ),,,, E2mail : com. cn : ; : ; :

2 650 LI Ke et al. ΠActa Microbiologica Sinica (2007) 47 (4) GGATAACAATTTCACACAGG DNA Hoelzel [10 ], ( ) 1mL DNA ( 50mmo1ΠL Tris2Cl, 50mmo1ΠL EDTA2Na 2, 11 0mo1ΠL NaCI, 1 % CTAB, 1 %PVP), 5 8min 100 L DNA RNA,, (50mgΠmL),37 1h, 15min 1 DNA 100 L SDS ( 10 %), 1210 L K,,, (20mgΠmL),37 1h PCR (24 1 ),14000 g 15min,,, 115mL g 15min,, 70 % 100 L TE (10mmolΠL,pH810), S rrna PCR PCR 50 L, :94 5min ; 94 1min, 55 1min, 72 2min, 30 ; 72 8min PCR 1 %, DNA, S r DNA pmd182t [11 ] 115 PCR2RFLP 4, PCR, RV2M M PCR ; 015 L 10 PCR PCR ( 16S 272F 14922R), PCR 16S rdna, 1500bp PCR Af a Msp (RFLP), 3 % ; RFLP, 116 DNA ; DNAMAN, NCBI,,,, DNAMAN (Neighbor2joining method), (Bootstrap) S rdna GenBank EF EF DNA 1 DNA maker, DNA, 21kb, 3, 1 DNA Fig. 1 The genomic DNA of intestinal bacteria from different number of Litopenaeus vannamei. M: DNAΠEcoR + Hind ; 1. One intestine ; 2. Two intestines ; 3. Three intestines ; 4. Four intestines. 212 DNA 16S rdna PCR,, 4 16S rdna PCR,, PCR 16S rdna 2 16S rdna PCR Fig. 2 PCR amplification of 16S rdna fragment from intestinal bacteria of Litopenaeus vannamei. M: DNAΠEcoR + Hind ; 1231 The amplification results of bacterial 16 rdna from one intestine with ten, hundreds and thousands of dilution of DNA template ; 426, 729 and Corresponding results of two, three and four intestines respectively S rdna 176 PCR

3 :.Π (2007) 47 (4) 651 PCR 117 kb 126, 7116 % PCR, Af a Msp,3 %, RFLP ( 3), 16S rdna 12 RFLP (C), : C = [1 - ( n1πn) ] 100, N, n 1 16S rdna 9015 %, 9015 %, 16S rdna 3 RFLP Fig. 3 Partial results of RFLP analysis of 16S rdna library. M: GeneRuler DNA ladder ;1 16 :Clones. ( Bacillus) ( Corynebacterium) 214 ( Micrococcus) ( Flavobacterium),, ( Alcaligenes) ( Pseudomonas) GenBank BLAST,, ( Chromobacterium) ( 4) 1, [14 ] 126 GenBank 16S rdna 47, 99 %, 87 % ; 31 ( Acinetobacter) 98 %, ( Flexibacter) 8 (95, %) 94 %,, Moriarty [15 ] ( Firmicutes ) (7514 %), Long2Jawed Mudsucker,, 94 % (Proteobacteria) 2Proteobacteria (2416 %), ( Shewanella ), ( Pantoea),Aranicola, ( Vibrio) ( Pseudomonas), 5156 %, 3197 %, 7114 %, 3197 %, 3197 % 4, 1 3 [12,13 ],,,,,,,, [7 ] 111, 9515 %, 13 ( ), ( Photobacterium ) ( Vibrios ) ( Aeromonas) ( Enterobacteriaceae) ( Xanthomonas) ( Agrobacterium),, [16 18 ]

4 652 LI Ke et al. ΠActa Microbiologica Sinica (2007) 47 (4) 4 Fig. 4 Phylogenetic analysis of 16S rdna clones from the intestinal bacteria of Litopenaeus vannamei. Clones detected in this study are given in boldface. Numbers in parentheses represent the sequences accession number in GenBank. Numbers in square brackets indicate the clone number out of the total clones. Bootstrap values are indicated at the branching points. Bar, 5 % sequence divergence.,, 3 (34 ) 6 (45 ), ( Long2Jawed Mudsucker),,, [ 1 ] Weston DP. Environmental considerations in the use of antibacterial drugs in aquaculture. In : Baird D, et al. eds. Aquaculture and Water Resource Management. Oxford : Blackwell, 1996,

5 :.Π (2007) 47 (4) 653 [ 2 ] Towner KJ. The genetics of resistance. In : Greenwood D. 3 rd ed. Antimicrobial Chemotherapy. Oxford : Oxford University Press, 1995, [ 3 ] Devaraja TN, Yusoff FM, Shariff M. Changes in bacterial populations and shrimp production in ponds treated with commercial microbial products. Aquaculture, 2002, 206 : [ 4 ] Duc LH, Hong HA, Barbosa TM, et al. Characterisation of Bacillus probiotics available for human use. Appl Environ Microbiol, 2004, 70 : [ 5 ] Verscuere L, Rombaut G, Sorgeloos P, et al. Probiotic bacteria as biological control agents in aquaculture. Microbiology and Molscular Biology Reviews, 2000, 64(4) : [ 6 ] Tannock GW. Studies of the intestinal microflora : a prerequisite for the development of probiotics. Int dairy Journal, 1998, 8 : [ 7 ],,,.., 2005, 25(1) : [ 8 ],,.., 2004, 28 (5) : [ 9 ] Pace NR. A molecular view of microbialdiversity and the biosphere. Science,1997, 276 : [10] Hoelzel AR, Green A. Analysis of population2level variation by sequencing PCR2amplified DNA. In : Hoelzel AR. ed. Practical Approach Series : Molecular Genetic Analysis of Populations, vol xvii. New York : IRL Press at Oxford University Press, 1992, [11] Samlnrook J, Fritsch EF, Maniatis T..,,.. :, [12] Timmermans LPM. Early development and differentiation in fish. Sarsia, 1987, 72 : [13] Vadstein O. The use of immunostimulation in marine larviculture : possibilities and challenges. Aquaculture, 1997, 155 : [14] Wang X, Li H, Zhang X. Flora in the digestive tract of adult Penaeid Shrimp ( Penaeus chinensis). Journal of Ocean University of Qingdao, 2000, 30 (3) : [15] Moriarty DJW. Interactions of microorganisms and aquatic animals, particularly the nutritional role of the gut flora. In : Lesel R. ed. Microbiology in Poecilotherms. Amsterdam : Elsevier, 1990, [16] Sugita H, Tsunohara M, Ohkoshi T. The establishment of an intestinal microflora in developing goldfish ( Carassius auratus) of culture ponds. Microbial Ecol, 1988, (15) : [17] Sugita H, Oshima K, Tamura M. Bacterial flora in the gastrointestine of freshwater fishes in the river. Nippon Suisan Gakkaishi, 1983, (49) : [18] Yoshimizu M, Kimura T. Study on the intestinal microflora of salmonids. Fish Pathol, 1976, (10) : Bacterial community structure in intestine of the white shrimp, Litopenaeus vannamei LI Ke 1, ZHENG Tian2ling 1,2 3,TIAN Yun 1, YUAN Jian2jun 3 ( 1 Institute of Applied and Environmental Microbiology, School of Life Sciences, 2 State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen , China) ( 3 Department of Biology, Quanzhou Normal College, Quanzhou , China) Abstract : The composition of bacterial community in the intestine of the white shrimp, Litopenaeus vannamei under laboratory culture condition was determined using the 16S rdna clone library. 16s rrna gene was amplified and a library was constructed by using the genomic DNA extracted from the bacteria in the shrimp intestine as template. 12 different RFLP patterns of the clones were obtained by restriction fragment length polymorphism analysis using Af a and Msp. Compared with the published sequences in GenBank database, sequencing results of cloned 16S rdna amplicons revealed a diverse community including 2proteobacteria and Firmicutes in the intestine of artificial diet2fed shrimp. Results showed that the Firmicutes group can be a dominant component (7514 %) in the shrimp intestinal microflora and other clones belong to 2proteobacteria (2416 %) which were identified as Shewanella sp., Pantoea sp., Aranicola sp., Pseudomonas sp. and Vibrio sp., respectively. These results provide the first comprehensive description of microbial diversity of the white shrimp intestine and suggest that most of the bacteria associated with shrimp intestine are uncultured and novel species. Keywords : Litopenaeus vannamei ; intestine ; bacterial diversity Foundation item : National Science Foundation of China ( G ) ; Key Project on Sciences and Technology of Fujian Province (2004I023) ; Special Fund for PHD Program in University ( ) 3 Corresponding author. Tel : ; Fax : ; E2mail : edu. cn Received : 26 December 2006ΠAccepted : 4 April 2007ΠRevised : 29 March 2007