Shiraia sp. Slf14 III

Transcript

1 39 4 Vol 39 No Journal of Jiangxi Normal University Natural Science Jul Shiraia sp Slf14 III * Polyketide synthase PKS Shiraia sp Slf14 III RT-PCR RNA pet-22b + -PKSIII Ni-NTA BL21 DE3 SDS-PAGE 43 kda III Q A DOI /j cnki issn III PKS Hypocrellins Shiraia sp Slf14 PKS 1-3 Polyketide synthase PKS PKS Shiraia sp Slf14 Shiraia sp Slf > 98% NCBI AXZN Shiraia sp Slf14 3 I PKS modular III PKS RT-PCR II PKS iterative 2 KS α KS β 1 III PKS 2 PKS ACP 1 1 -CoA -CoA E coli DH5α E coli BL BAB GJJ13211 YRD

2 4 Shiraia sp Slf14 III 431 DE3 Shiraia sp Slf14 pet- 22b T-vector PMD19 simple TaKaRa LB g L ph min Shiraia sp Slf14 RNA DNA 1% RNA KOD DNA RNAiso Plus T4 RNA - 20 RNA DNA PrimeScript TM reagent Kit with gdna Eraser QuickCut Nde I BamH I Not I PrimeScript cdna DNA Ladder Marker pmd TM III PKS 19-T Vector Cloning Kit TaKaRa E Z N A cycle-pure kit Plasmid Mini Kit I Gel Extraction Kit OMEGA PCR BIO- RAD UV μl 10 Buffer 5 0 μl dntps 2 5 mmol L μl pksiii-ndei-f pksiii-bamhi-6his-r 1 5 μl KOD-Plus-Neo 1 μl cdna 1 μl ddh 2 O Heraeus DYY-8C DNA 50 μl PCR 94 2 min Shiraia sp Slf14 RNA cdna 1 DEPC 2-80 RNAiso Plus RNAiso Plus III PKS Primer 5 III PKS pksiii-ndei-f pksi- II-BamHI-6His-R 1 cdna III PKS NdeI BamHI 10 s s s min 4 1% pksiii-ndei-f pksiii-bamhi-6his-r GGAATTCCATATGTCCCACGTGGCTAACAC CGCGGATCCTTAGTGGTGGTGGTGGTGGTGACCTGTTCGTACAGTGTGCCAG Gel Nde I Bam HI Extraction Kit PCR 1% pmd TM 19-T Vector Cloning Kit DNA min T-vector pmd19 simple E coli 22 IPTG 1 mmol L DH5α PCR 200 rpm 8 h 50 ml μl TaKaRa rpm III PKS 5 min 20 ml TE Nde I Bam HI pet-22b + LB rpm 2 h OD 600 Buffer 5 min 1 1 1% 4 Gel Extraction Kit PCR 10 ml Buffer A T4 DNA 20% 3 s 5 s 4 10 min 100 μl BL21 DE rpm 15 min SDS-PAGE Ni-NTA PCR 12% SDS-PAGE

3 a Shiraia sp Slf14 III PKS 1 b 2 1 III PKS pmd19-t Nde I Bam HI 1 3 kb Shiraia sp Slf14 pmd19-t 2 RNA RT-PCR 1 3 kb 1 a pksiii-nde I-F pksiii-bam HI-6His-R RT-PCR 2 Nde I Bam HI b RT-PCR 2 2 III PKS 2 α β III α 3 β PKS III PKS 4 3 III PKS

4 4 Shiraia sp Slf14 III III PKS / 2 3 III PKS PCR III PKS Nde I Bam HI Nde I Bam HI pet-22b + pet-22b + -PKSIII 5 pet-22b + -PKSIII III PKS SDS-PAGE kda Ni-NTA 5 pet-22b + -PKSIII 3 6 SDS-PAGE Shiraia sp Slf14 III PKS III III

5 PKS J III J III J J 11 III J Deng Hong Xie Jie Zhao Jingquan Drug-delivery and 1-14 multifunction possibilities of hypocrellin photosensitizers 12 III J Journal of Innovative Optical Health Sciences Jiang Yuan Albert Wingnang Leung Wang Xinna et al Effect of photodynamic therapy with hypocrellin B on apoptosis adhesion and migration of cancer cells J International Journal of Radiation Biology J J J Li Jingni Luo Yunzi Lee Jung-Kul et al Cloning and characterization of a type III polyketide synthase from Aspergillusniger J Bioorganic & Medicinal Chemistry Letters J J J Frank Gross Nora Luniak Olena Perlova et al Bacterial type III polyketide synthases phylogenetic analysis and potential for the production of novel secondary metabolites by heterologous expression in pseudomonads J Arch Microbiol J The Prokaryotic Expression Purification and Bioinformatics of Type III Polyketide Synthase from Shiraia sp Slf14 Which Is an Endophytic Fungus of Huperzia serrata PENG Silu 1 YANG Huilin 1 2 LI Erhan 1 WANG Xiaolan 1 ZHU Du 1 2* 1 Key Lab of Protection and Utilization of Subtropic Plant Resources Jiangxi Normal University Nanchang Jiangxi China 2 Jiangxi Science & Technology Normal University Jiangxi Key Laboratory of Bioprocess Nanchang Jiangxi China Abstract The hypocrellins are a unique class of perylenequinones characterized by a pentacyclic conjugated chromophore giving rise to photoactivity One type III PKS gene was obtained from Shiraia sp Slf14 which is the key synthase in the product process of the hypocrellin The total RNA as the template to amplify the type III PKS fragment was used and then was cloned into pmd TM 19-T vector After identify type III PKS gene was ligated into pet- 22b + to obtain recombinant expressing vector pet-22b + -PKSIII The expression vector into Escherichia coli BL21 DE3 and cultured positive colonies of E coli in liquid LB medium were introduced Then the objective protein were obtained and isolated for purification using a Ni-NTA affinity chromatography It can lay the foundation for the catalytic activity of type III polyketide synthase Key words endophytic fungus polyketide synthase hypocrellin cloning and expression