Θέματα Πανελλαδικών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Θέματα Πανελλαδικών 2000-2013"



2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα που συμπληρώνει σωστά Το είδος του RNA που μεταφέρει την πληροφορία για τη σύνθεση της πρωτεΐνης στο ριβόσωμα είναι: Μονάδες 3 α) το ριβοσωμικό RNA (rrna) β) το μικρό πυρηνικό RNA (snrna) γ) το αγγελιαφόρο RNA (mrna) δ) το μεταφορικό RNA (trna) 5. Ο γενετικός κώδικας είναι : Μονάδες 3 α) το σύνολο των χρωμοσωμάτων του κυττάρου β) η αντιστοίχιση τριπλετών βάσεων σε αμινοξέα γ) μια συνεχής αλληλουχία αμινοξέων δ) ο τρόπος ελέγχου της ενζυμικής δράσης στο κύτταρο 2001 Β. 2. Να αναφέρετε τις ειδικές θέσεις που έχει κάθε μόριο trna και να εξηγήσετε το ρόλο των trna στην πρωτεϊνοσύνθεση. Μονάδες 5 Α. 1. Ένα ελεύθερο μόριο trna μπορεί να συνδεθεί με: Μονάδες 2 α. ένα μόνο ειδικό αμινοξύ β. οποιοδήποτε διαθέσιμο αμινοξύ γ. τρία διαφορετικά αμινοξέα. Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 Α. 3. Η σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την: Μονάδες 2 α. αντιγραφή β. μεταγραφή γ. μετάφραση. Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 Α. Σωστές απαντήσεις : Μονάδες 5 1. Ποια είναι (ονομαστικά) τα 4 είδη RNA; Α. Γράψτε τον αριθμό της ερώτησης και δίπλα το σωστό γράμμα. 2. Κάθε μεταφορικό RNA (trna): Μονάδες 2 α. μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα; β. μεταφέρει ενέργεια στα ριβοσώματα; γ. μεταφέρει τη γενετική πληροφορία; Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 Πανελλαδικές Β. Πιτσιλαδής

3 2002 Β. Να οριστούν οι παρακάτω έννοιες: 1. Ανοικτό πλαίσιο ανάγνωσης. Μονάδες 7 2. Τη γονιδιακή έκφραση αποτελούν οι διαδικασίες: Μονάδες 5 α. αντιγραφής και μετάφρασης β. αντιγραφής και μεταγραφής γ. μεταγραφής και μετάφρασης. Α.1. Οι DNA πολυμεράσες που συμμετέχουν στην αντιγραφή του DNA μπορούν να ξεκινήσουν τη διαδικασία της αντιγραφής, αν βοηθηθούν από Μονάδες 5 α. τα ένζυμα που διορθώνουν τα λάθη της αντιγραφής. β. το πριμόσωμα. γ. τη DNA δεσμάση. δ. το κωδικόνιο. Α. Γράψτε τον αριθμό της πρότασης και δίπλα το σωστό γράμμα. 2. Το πρόδρομο mrna στα ευκαρυωτικά κύτταρα είναι : Μονάδες 2 α. ίσο σε μέγεθος με το ώριμο mrna β. μεγαλύτερο σε μέγεθος από το ώριμο mrna γ. μικρότερο σε μέγεθος από το ώριμο mrna. Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 3. Η DNA ελικάση : Μονάδες 2 α. σπάει τους υδρογονικούς δεσμούς στο δίκλωνο μόριο του DNA β. τοποθετεί νουκλεοτίδια γ. επιδιορθώνει λάθη της αντιγραφής Να δικαιολογήσετε την απάντησή σας. Μονάδες Α. Σωστό ή Λάθος 1. Ο καταστολέας κωδικοποιείται από ένα ρυθμιστικό γονίδιο, που βρίσκεται μπροστά από τον υποκινητή. Μονάδες 2 Α. Σωστό ή Λάθος Μονάδες 2 2. Οι DNA πολυμεράσες είναι ένζυμα που συμμετέχουν στην αντιγραφή των μορίων DNA. Β. 2. Η διαδικασία μεταγραφής οδηγεί στο σχηματισμό μορίων : Μονάδες 5 α. DNA β. c DNA γ. RNA δ. πρωτεϊνών. Πανελλαδικές Β. Πιτσιλαδής

4 Β. 3. Η RNA πολυμεράση προσδένεται : Μονάδες 5 α. στον υποκινητή β. στην 3 αμετάφραστη περιοχή γ. στα εσώνια δ. στις αλληλουχίες λήξης. 3. Ο γενετικός κώδικας είναι Μονάδες 5 α. ο αριθμός των γονιδίων του κυττάρου. β. η αντιστοίχιση τριπλετών βάσεων σε αμινοξέα. γ. το σύνολο των ενζύμων ενός κυττάρου. δ. ο τρόπος αντιστοίχισης των νουκλεοτιδίων μεταξύ τους. 5. Το είδος του RNA που μεταφέρει στα ριβοσώματα την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας είναι το Μονάδες 5 α. ριβοσωμικό RNA (rrna). β. μικρό πυρηνικό RNA (snrna). γ. αγγελιαφόρο RNA (mrna). δ. μεταφορικό RNA (trna) Κατά τη μεταγραφή του DNA συντίθεται ένα Μονάδες 5 α. δίκλωνο μόριο DNA. β. μονόκλωνο μόριο DNA. γ. δίκλωνο RNA. δ. μονόκλωνο RNA. 5. Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι Μονάδες 5 α. DNA ελικάσες και DNA δεσμάση. β. RNA πολυμεράσες και πριμόσωμα. γ. DNA δεσμάση και επιδιορθωτικά ένζυμα. δ. DNA πολυμεράσες και επιδιορθωτικά ένζυμα. 1. Το γεγονός ότι κάθε νουκλεοτίδιο του γενετικού κώδικα ανήκει σε ένα μόνο κωδικόνιο οδηγεί στο χαρακτηρισμό του κώδικα ως Μονάδες 5 α. συνεχούς. β. μη επικαλυπτόμενου. γ. εκφυλισμένου. δ. σχεδόν καθολικού. 2. Η αντιγραφή του DNA αρχίζει με το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων με τη βοήθεια ενζύμων που ονομάζονται Μονάδες 5 α. DNA πολυμεράσες. β. DNA ελικάσες. γ. DNA δεσμάσες. δ. RNA πολυμεράσες. Πανελλαδικές Β. Πιτσιλαδής

5 Οι DNA πολυμεράσες, μεταξύ άλλων, Μονάδες 3 α. καταλύουν την ωρίμανση του πρόδρομου mrna. β. αρχίζουν την αντιγραφή του DNA. γ. επιδιορθώνουν λάθη που συμβαίνουν στην αντιγραφή του DNA. δ. συνδέουν τα κομμάτια της ασυνεχούς αλυσίδας του DNA. 5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται Μονάδες 5 α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο Η ωρίμανση του RNA είναι μια διαδικασία η οποία Μονάδες 5 α. οδηγεί στη δημιουργία m-rna χωρίς εξώνια. β. καταλύεται από το ένζυμο DNA ελικάση. γ. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. δ. συμβαίνει μόνο στους ευκαρυωτικούς οργανισμούς. 1. Πολύσωμα είναι Μονάδες 5 α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. το σύνολο των εξωνίων ενός ώριμου mrna. δ. το σύμπλεγμα πολλών ριβοσωμάτων με το mrna. Α.1. H μεταγραφή του DNA καταλύεται από την Μονάδες 3 α. DNA πολυμεράση. β. RNA πολυμεράση. γ. DNA δεσμάση και DNA πολυμεράση. δ. DNA πολυμεράση και RNA πολυμεράση. B. Ποια είναι τα τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή και ποιος ο ρόλος του καθενός από αυτά; Μονάδες Πολύσωμα είναι Μονάδες 5 α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. το σύνολο των εξωνίων του ώριμου mrna. δ. το σύμπλεγμα πολλών ριβοσωμάτων με το mrna. Πανελλαδικές Β. Πιτσιλαδής

6 Τα πρωταρχικά τμήματα κατά την αντιγραφή του DNA συντίθενται από Μονάδες 5 α. την DNA πολυμεράση. β. την DNA δεσμάση. γ. το πριμόσωμα. δ. το πολύσωμα. 1. Από RNA αποτελούνται Μονάδες 5 α. τα πρωταρχικά τμήματα. β. οι υποκινητές. γ. οι μεταγραφικοί παράγοντες. δ. τα πριμοσώματα. Α. 1. Το κωδικόνιο είναι Μονάδες 3 α. μία τριάδα νουκλεοτιδίων. β. μία τριάδα αμινοξέων. γ. έξι νουκλεοτίδια συνδεδεμένα με δεσμούς υδρογόνου. δ. το αμινοξύ μεθειονίνη. Α. 2. Κάθε μεταφορικό RNA Μονάδες 3 α. σχηματίζει το ριβόσωμα. β. περιέχει θυμίνη. γ. καταλύει την ωρίμανση του mrna. δ. μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα. B. Να αναφέρετε ονομαστικά τα ένζυμα της αντιγραφής του DNA. Μονάδες Η DNA δεσμάση Μονάδες 5 α. ενώνει τα κομμάτια της αλυσίδας DNA που αντιγράφεται ασυνεχώς. β. είναι το ένζυμο με το οποίο σχηματίζονται τα πρωταρχικά τμήματα. γ. είναι το κύριο ένζυμο της αντιγραφής. δ. επιδιορθώνει τα λάθη της αντιγραφής Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται: Μονάδες 5 α. στον πυρήνα. β. στο κυτταρόπλασμα. γ. στα μιτοχόνδρια. δ. στο κυτταρικό τοίχωμα. 5. Η ωρίμανση του mrna Μονάδες 5 α. είναι μια διαδικασία που καταλύεται από DNA ελικάσες. β. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. γ. συμβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων. δ. είναι μία διαδικασία στην οποία παραμένουν για μετάφραση τα εσώνια. Πανελλαδικές Β. Πιτσιλαδής

7 2. Το αντικωδικόνιο συνδέεται με το κωδικόνιο κατά τη διαδικασία Μονάδες 5 α. της αντιγραφής του DNA. β. της ωρίμανσης του πρόδρομου m-rna. γ. της μεταγραφής του DNA. δ. της μετάφρασης του m-rna Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται Μονάδες 5 α. χειριστής β. υποκινητής γ. snrna δ. δομικά γονίδια 2. Η DNA δεσμάση Μονάδες 5 α. επιδιορθώνει λάθη της αντιγραφής. β. συνδέει το αμινοξύ με το trna. γ. συνδέει τμήματα DNA. δ. μεταγράφει την πολυνουκλεοτιδική αλυσίδα. 5. Το κωδικόνιο έναρξης της μετάφρασης του mrna σε όλους τους οργανισμούς είναι το α. ΑUG. Μονάδες 5 β. UUU. γ. CAA. δ. UAA. 1. Πολύσωμα ονομάζεται Μονάδες 5 α. το σύμπλεγμα του DNA με τις ιστόνες. β. η τρισωμία του 21 χρωμοσώματος. γ. το σύμπλεγμα των ριβοσωμάτων με το mrna. δ. το ειδικό σύμπλοκο που συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA Α3. Τα πρωταρχικά τμήματα RNA συντίθενται από Μονάδες 5 α. το πριμόσωμα β. το νουκλεόσωμα γ. την DΝΑ ελικάση δ. την DΝΑ δεσμάση Α5. Στο οπερόνιο της λακτόζης, όταν απουσιάζει η λακτόζη, η πρωτεΐνη καταστολέας συνδέεται με Μονάδες 5 α. τον υποκινητή β. το ρυθμιστικό γονίδιο γ. τον χειριστή δ. την RNA-πολυμεράση Πανελλαδικές Β. Πιτσιλαδής

8 Α1. Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι Μονάδες 5 α. η DNA δεσμάση και τα επιδιορθωτικά ένζυμα β. οι DNA πολυμεράσες και τα επιδιορθωτικά ένζυμα γ. οι DNA ελικάσες και η DNA δεσμάση δ. η RNA πολυμεράση και το πριμόσωμα Β2. Συμπληρώστε. Μονάδες Τα ένζυμα που διασπούν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων του DNA ονομάζονται Α4. Το γεγονός ότι κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο σημαίνει ότι ο γενετικός κώδικας είναι Μονάδες 5 α. συνεχής. β. μη επικαλυπτόμενος. γ. εκφυλισμένος. δ. σχεδόν καθολικός. + ΕΣΠΕΡΙΝΩΝ Α3. Από RNA αποτελούνται Μονάδες 5 α. οι υποκινητές. β. οι μεταγραφικοί παράγοντες. γ. τα πρωταρχικά τμήματα. δ. οι RNA πολυμεράσες. A5. Κατά την αντιγραφή του DNΑ, στην κατασκευή των πρωταρχικών τμημάτων συμμετέχει το α. ριβόσωμα. Μονάδες 5 β. πολύσωμα. γ. νουκλεόσωμα. δ. πριμόσωμα Α1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη μεταγραφή από το ένζυμο Μονάδες 5 α. RNA πολυμεράση β. DNA πολυμεράση γ. DNA ελικάση δ. DNA δεσμάση. Α4. Σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την Μονάδες 5 α. αντιγραφή β. μετάφραση γ. μεταγραφή δ. αντίστροφη μεταγραφή. Πανελλαδικές Β. Πιτσιλαδής

9 Α2. Επιδιορθωτικά ένζυμα χρησιμοποιούνται από το κύτταρο κατά Μονάδες 5 α. τη μεταγραφή β. την αντιγραφή γ. την ωρίμανση δ. τη μετάφραση Α3. Το ένζυμο που προκαλεί τη διάσπαση των δεσμών υδρογόνου στη θέση έναρξης της αντιγραφής είναι Μονάδες 5 α. η DNA ελικάση β. η RNA πολυμεράση γ. η DNA δεσμάση δ. το πριμόσωμα ΘΕΜΑ 2 ο 2000 Α. Η διαδικασία της αντιγραφής του DNA χαρακτηρίζεται από μεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύμων και συμπλόκων ενζύμων. 1. Ποια από τα παρακάτω συμμετέχουν στην αντιγραφή του DNA: DNA πολυμεράσες, DNA ελικάσες, περιοριστικές ενδονουκλεάσες, πριμόσωμα, επιδιορθωτικά ένζυμα, DNA δεσμάση; Μονάδες 5 2. Να γράψετε ονομαστικά τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA Μονάδες 5 Β. 2. Τι είναι το πολύσωμα; Μονάδες 5 Β. 3. Ποια κωδικόνια ονομάζονται συνώνυμα; Μονάδες 5 Α. Σωστό ή Λάθος Μονάδες 4 1. Τα δύο θυγατρικά μόρια που προκύπτουν από το διπλασιασμό του DNA είναι πανομοιότυπα μεταξύ τους. 4. Κατά τη μετάφραση της γενετικής πληροφορίας παράγονται πρωτεΐνες, λίπη και σάκχαρα. Β. Συμπληρώστε τα κενά. Μονάδες 6 4. Ο Γενετικός Κώδικας είναι μη, δηλαδή κάθε νουκλεοτίδιο ανήκει σ ένα μόνο κωδικόνιο. 5. Το ένζυμο που υπάρχει σε ορισμένους ιούς χρησιμοποιεί ως καλούπι το RNA, για να συνθέσει DNA Ένας πληθυσμός βακτηρίων Ε. coli αναπτύσσεται σε θρεπτικό υλικό που περιέχει τη λακτόζη ως πηγή άνθρακα. Όταν η λακτόζη εξαντληθεί προσθέτουμε γλυκόζη. Να περιγράψετε τον τρόπο λειτουργίας του οπερονίου της λακτόζης πριν και μετά την προσθήκη της γλυκόζης. Μονάδες Πώς ρυθμίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα; Μονάδες 10 Β. Συμπλήρωση κενών. Μονάδες 6 Πανελλαδικές Β. Πιτσιλαδής

10 Β.1. Η αλληλουχία των στο μόριο ενός mrna καθορίζει την αλληλουχία των αμινοξέων της αντίστοιχης. Β.2. Ο γενετικός κώδικας είναι, δηλαδή το mrna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο A. Συμπληρώσετε τα κενά. Μονάδες 3 A.2. Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της..., κατά την οποία τα... κόβονται από μικρά ριβονουκλεοπρωτεϊνικά σωματίδια και απομακρύνονται. Β.3. Τι είναι το πολύσωμα; Μονάδες Α. Συμπληρώσετε τα κενά. Μονάδες 5 Α.1. Κάθε μόριο trna έχει μια ειδική τριπλέτα νουκλεοτιδίων, το, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο του mrna. Β.2. Τι είναι το κωδικόνιο έναρξης και τι τα συνώνυμα κωδικόνια; Μονάδες 5 Β. Τι ονομάζεται πολύσωμα; Μονάδες Ποια είδη RNA παράγονται κατά τη μεταγραφή του DNA προκαρυωτικού κυττάρου (μονάδες 3) και ποιος είναι ο ρόλος τους (μονάδες 6); 1. Ποιες λειτουργίες επιτελούν τα ένζυμα DNA πολυμεράσες κατά την αντιγραφή του DNA; Μονάδες Β. Σωστό ή λάθος. 1. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος, δηλαδή κάθε κωδικόνιο ανήκει σε ένα μόνο νουκλεοτίδιο. Μονάδες 3 3. Ποια είναι τα είδη του RNA και ποιος είναι ο ρόλος κάθε είδους; Μονάδες Τι είναι το πριμόσωμα και ποιος είναι ο ρόλος του στην αντιγραφή του DNA; Μονάδες 4 Β. Σωστό ή Λάθος. 4. Οι DNA ελικάσες σπάνε τους δεσμούς υδρογόνου μεταξύ δύο πολυνουκλεοτιδικών αλυσίδων RNA. Μονάδες Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται; Μονάδες 12 Πανελλαδικές Β. Πιτσιλαδής

11 Πώς σχηματίζεται το ώριμο mrna στα ευκαρυωτικά κύτταρα; Μονάδες 8 3. Ποιες ονομάζονται θέσεις έναρξης της αντιγραφής του DNA (μονάδες 3), και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα; (μονάδες 4) 3. Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάζεται ημισυντηρητικός; Μονάδες 8 2. Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάστηκε ημισυντηρητικός. Μονάδες Ποια γονίδια οργανώνονται σε οπερόνια; (μονάδες 3) Πώς επιτυγχάνεται η καταστολή στο οπερόνιο της λακτόζης; (μονάδες 6) 2010 Β3. Τι είναι το πολύσωμα; Μονάδες 5 Β3. Τι είναι το μικρό πυρηνικό RNΑ (snrnα) και ποιός είναι ο ρόλος του; Μονάδες Γ1. Μια πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από μια πολυπεπτιδική αλυσίδα 100 αμινοξέων. Το γονίδιο από το οποίο κωδικοποιήθηκε η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς. Μονάδες Β3. Με ποιους τρόπους περιορίζεται ο αριθμός των λαθών κατά την αντιγραφή του DNA στους ευκαρυωτικούς οργανισμούς; Μονάδες 8 Β3. Να εξηγήσετε γιατί η αντιγραφή του DNA έχει προσανατολισμό 5 προς 3. Μονάδες Β4. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Μονάδες 5 ΘΕΜΑ 3 ο Να αναφέρετε τα βασικά χαρακτηριστικά του γενετικού κώδικα και να τα περιγράψετε. Μονάδες Να περιγράψετε τη διαδικασία σχηματισμού "ώριμου" mrna. Μονάδες Πανελλαδικές Β. Πιτσιλαδής

12 2. Δίνεται το παρακάτω πολυπεπτίδιο, που παράγεται σε βακτηριακό κύτταρο: ΗΟΟC-Μεθειονίνη -Λυσίνη -Θρεονίνη -Προλίνη - Λευκίνη -Σερίνη -Βαλίνη -Αλανίνη -Βαλίνη - Mεθειoνίνη- ΝΗ 2 α. Να γράψετε τη μη κωδική αλυσίδα του γονιδίου που κωδικοποιεί αυτό το πολυπεπτίδιο. Μονάδες 6 β. Να ορίσετε τα άκρα 3 και 5 της παραπάνω αλυσίδας. Μονάδες 2 Να αιτιολογήσετε την απάντησή σας. Μονάδες 7 Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων: ΑΜΙΝΟΞΕΑ ΚΩΔΙΚΟΝΙΑ ΑΜΙΝΟΞΕΑ ΚΩΔΙΚΟΝΙΑ Αλανίνη GCU Λυσίνη AAG Βαλίνη GUG Μεθειονίνη AUG Θρεονίνη ACU Προλίνη CCG Λευκίνη CUA Σερίνη UCG 2. Να περιγράψετε πώς ρυθμίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα. Μονάδες Α. Σε μια θέση έναρξης αντιγραφής του DNA, η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται στο παρακάτω σχήμα: α. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε σ αυτό όλες τις νεοσυντιθέμενες αλυσίδες του DNA και να σημειώσετε τον προσανατολισμό τους, γράφοντας τα 3 και 5 άκρα. Μονάδες 5 β. Η σύνθεση των νέων αλυσίδων του DNA γίνεται είτε με συνεχή είτε με ασυνεχή τρόπο. Γιατί συμβαίνει αυτό; Μονάδες Β. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. 1. Τι σημαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός»; Μονάδες 5 2. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Μονάδες Δίνεται το παρακάτω τμήμα μορίου βακτηριακού mrna. 5...Α G A U G A A A G C C A C G G A G C C C U G A G C A A...3 Από τη μετάφραση αυτού του mrna προκύπτει μία πεπτιδική αλυσίδα. Πανελλαδικές Β. Πιτσιλαδής

13 1. Ποιος είναι ο αριθμός των αμινοξέων που αποτελούν αυτή την πεπτιδική αλυσίδα; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 8) 2. Να περιγράψετε το στάδιο έναρξης της πρωτεϊνοσύνθεσης. Μονάδες 8 3. Να περιγράψετε το δεσμό με τον οποίο ενώνονται μεταξύ τους δύο διαδοχικά νουκλεοτίδια σε ένα μόριο mrna. Μονάδες Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη. 1. Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων; Μονάδες 5 2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού, όπως τα νευρικά και τα μυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη μορφή και τη λειτουργία. Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ; Μονάδες 8 3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA, ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών; Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ Γ3. Ποιος είναι ο ρόλος του πριμοσώματος στην αντιγραφή του DNA; Μονάδες 5 ΘΕΜΑ 4 ο 2000 Γ. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων: 5 - ΤCΑ CGG AAT TTC TAG CAT Με δεδομένο ότι δε μεσολαβεί στάδιο ωρίμανσης, να γράψετε το m-rna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA, σημειώνοντας ταυτόχρονα τη θέση του 5 και 3 άκρου του m-rna. Μονάδες 3 2. Να γραφούν τα αντικωδικόνια των t-rna με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω m-rna. Μονάδες 7 Δίνεται τμήμα διπλής έλικας DNA -TAC-AGT-GGA-GAA-GCT-ATT- (αλυσίδα 1) -ATG-TCA- CCT- CTT- CGA-TAA- (αλυσίδα 2) α) Ποια από τις δυο αλυσίδες είναι αυτή που μεταγράφεται και γιατί; Μονάδες 8 β) Ποιο είναι το mrna που προκύπτει από τη μεταγραφή της αλυσίδας αυτής; Μονάδες 8 γ) Δεδομένου ότι το mrna που προκύπτει από τη συγκεκριμένη μεταγραφή δεν υφίσταται διαδικασία ωρίμανσης, να δώσετε τον αριθμό των αμινοξέων που θα έχει το πεπτίδιο που θα συντεθεί κατά τη μετάφραση αυτού του mrna και να εξηγήσετε πώς προκύπτει ο αριθμός αυτός. Μονάδες Δίνεται τυχαίο τμήμα ενός μορίου mrna: - AUU - UCA - CCU - CUU - CGA - CAA - 1. Δεδομένου ότι το mrna αυτό δεν υπέστη διαδικασία ωρίμανσης, να γράψετε στο τετράδιό σας το δίκλωνο μόριο του DNA απ' το οποίο προήλθε. Μονάδες 10 Πανελλαδικές Β. Πιτσιλαδής

14 2. Πόσα αμινοξέα κωδικοποιεί το τμήμα αυτό; Μονάδες Στο αρχικό DNA ποιο ζευγάρι βάσεων συμμετέχει σε ποσοστό μεγαλύτερο του 50%; Μονάδες 5 Δίνεται τμήμα διπλής έλικας του DNA : 2002 α) Ποια από τις δύο αλυσίδες έχει προσανατολισμό 3 5 και ποια 5 3 ; Ποια από τις δύο αλυσίδες είναι η μεταγραφόμενη και γιατί; Μονάδες 8 β) Ποιο είναι το mrna που θα προκύψει από τη μεταγραφόμενη αλυσίδα; Μονάδες 8 γ) Το mrna που προκύπτει από τη συγκεκριμένη μεταγραφόμενη αλυσίδα δεν υφίσταται διαδικασία ωρίμανσης. Να γράψετε στο τετράδιό σας τα trna που θα πάρουν μέρος στη μετάφραση. Μονάδες #1 (Κεφάλαιο 1) Δίνονται τα παρακάτω αμινοξέα και, δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αμινοξέα αυτά: τυροσίνη (tyr) UAU, φαινυλαλανίνη (phe) UUU, προλίνη (pro) CCC α) Αξιοποιώντας τις παραπάνω πληροφορίες να δώσετε το mrna που κωδικοποιεί το ακόλουθο τμήμα πολυπεπτιδικής αλυσίδας: Μονάδες phe phe pro tyr tyr pro -... β) Να γράψετε την κωδική αλυσίδα του DNA και τη συμπληρωματική της, προσδιορίζοντας το 3 και 5 άκρο καθεμιάς απ αυτές. Μονάδες 15 γ) Πόσοι είναι οι δεσμοί υδρογόνου που σταθεροποιούν τις δύο πολυνουκλεοτιδικές αλυσίδες #1 στο παραπάνω μόριο του DNA; Μονάδες 5 Δίδεται το παρακάτω τμήμα μορίου προκαρυωτικού DNA, στο οποίο κωδικοποιείται η γενετική πληροφορία για τη σύνθεση μικρής αλυσίδας αμινοξέων: α. Σε ποια από τις αλυσίδες, (Ι) ή (ΙΙ), βρίσκεται η γενετική πληροφορία και γιατί; Μονάδες 10 β. Να γράψετε το μόριο του m-rna το οποίο σχηματίζεται κατά τη μεταγραφή του παραπάνω DNA και να ορίσετε το 3 και το 5 άκρο του μορίου αυτού. Μονάδες 5 γ. Πόσα αμινοξέα έχει η αλυσίδα που σχηματίζεται και γιατί; Μονάδες 5 δ. Να γράψετε τα αντικωδικόνια των t-rna που συμμετέχουν στη μετάφραση του παραπάνω μορίου m-rna. Μονάδες Η αλληλουχία των βάσεων ενός βακτηριακού mrna είναι: A U G A A A U U U C C C G G G G A U U G A U A A 1. Να γράψετε στο τετράδιό σας την αλληλουχία των βάσεων του δίκλωνου μορίου DNA από το οποίο προήλθε. Μονάδες 8 2. Πόσα αμινοξέα συγκροτούν την ολιγοπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του παραπάνω μορίου mrna; Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 Πανελλαδικές Β. Πιτσιλαδής

15 3. Να γράψετε στο τετράδιό σας το μόριο του mrna επισημαίνοντας το 5 και το 3 άκρο της αλυσίδας του. Μονάδες 2 4. Στο μόριο του mrna που σας δόθηκε υπάρχει μία τριπλέτα η οποία, σύμφωνα με το γενετικό κώδικα, απαντάται σε κάθε μόριο mrna. Ποια είναι αυτή, πώς ονομάζεται και ποιο αμινοξύ κωδικοποιεί; Μονάδες Δίνεται το πεπτίδιο H 2 N - Μεθειονίνη - Αλανίνη - Τυροσίνη - Προλίνη - Σερίνη - COOH, που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαρυωτικού κυττάρου: 5 C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 3 G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 Να γράψετε την αλληλουχία του πρόδρομου mrna, την αλληλουχία του ώριμου mrna που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντησή σας (μονάδες 9). Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τμήμα του μορίου DNA (μονάδες 8). Να περιγράψετε τη διαδικασία ωρίμανσης του πρόδρομου mrna (μονάδες 8). Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα: Αλανίνη GCC Μεθειονίνη AUG Προλίνη CCC Σερίνη AGC Τυροσίνη UAU 2007 #1 (Κεφάλαιο 1) Δίνονται πέντε αμινοξέα και δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αμινοξέα αυτά: τυροσίνη (tyr) UAU φαινυλαλανίνη (phe) UUU προλίνη (pro) CCC μεθειονίνη (met) AUG γλυκίνη (gly) GGG Τα πέντε παραπάνω αμινοξέα συγκροτούν ολιγοπεπτίδιο κάποιου βακτηριακού κυττάρου. α. Να γράψετε στο τετράδιό σας ποιο είναι το πρώτο (αρχικό) και ποιο το τέταρτο αμινοξύ του ολιγοπεπτιδίου. Μονάδες 4 phe pro gly β. Να γράψετε μία αλληλουχία νουκλεοτιδίων του mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Μονάδες 6 γ. Να γράψετε την αλληλουχία των νουκλεοτιδίων της κωδικής αλυσίδας του DNA (μονάδες 6) και να σημειώσετε το 5 και το 3 άκρο της (μονάδες 3). δ. Πόσα άτομα φωσφόρου υπάρχουν στη διπλή έλικα του DNA που κωδικοποιεί αυτό το ολιγοπεπτίδιο; Δικαιολογείστε την απάντησή σας. #1 Μονάδες 6 Δίνεται το παρακάτω τμήμα μορίου βακτηριακού DNA που κωδικοποιεί ένα πεπτίδιο με έξι αμινοξέα: 5... CCGΑTGACCAAACCTCACGCCTAGACC GGCTACTGGTTTGGAGTGCGGATCTGG... 5 Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η μη κωδική; (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Να γράψετε την αλληλουχία του mrna που προκύπτει από τη μεταγραφή του παραπάνω τμήματος DNA. Μονάδες 3 Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που προκύπτει από τη μετάφραση του παραπάνω mrna. Μονάδες 3 Να γράψετε τα αντικωδικόνια των trna με τη σειρά που θα πάρουν μέρος στη μετάφραση του παραπάνω mrna. Μονάδες 6 Πανελλαδικές Β. Πιτσιλαδής

16 Δίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: AUG Μεθειονίνη ACC Θρεονίνη AAA Λυσίνη CCU Προλίνη CAC Ιστιδίνη GCC Αλανίνη 2009 Δίνεται το παρακάτω τμήμα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αμινοξέα μιας πολυπεπτιδικής αλυσίδας. Η κατεύθυνση στην οποία κινείται η RNA πολυμεράση κατά τη μεταγραφή υποδεικνύεται από το βέλος. α. Ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η μη κωδική; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 7) β. Να γράψετε την αλληλουχία του mrna, που προκύπτει από τη μεταγραφή του παραπάνω DNA. Μονάδες 3 γ. Να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του trna, που μεταφέρει το 2 ο αμινοξύ της πολυπεπτιδικής αλυσίδας. Μονάδες 5 δ. Τι είναι το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (μονάδες 5) και ποια είναι η μετέπειτα πορεία του trna, που συμμετέχει σε αυτό; (μονάδες 3) Δίνεται το παρακάτω τμήμα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής: 1. Στις θέσεις Α, Β, Γ, Δ, Ε, Ζ να αντιστοιχίσετε τις ενδείξεις 3 ή 5 ώστε να φαίνεται ο προσανατολισμός των αρχικών και των νεοσυντιθέμενων αλυσίδων. Μονάδες 6 2. Τι είναι τα πρωταρχικά τμήματα, πως δημιουργούνται και πως επιμηκύνονται; Μονάδες 9 3. Εξηγήστε γιατί πρέπει, στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυμο DNA δεσμάση και πώς θα δράσει αυτό; Μονάδες 6 4. Ποια ένζυμα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής; Μονάδες Δίνεται τμήμα μορίου DNA ευκαρυωτικού κυττάρου που περιέχει το ασυνεχές γονίδιο το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου: H 2 N- μεθειονίνη αλανίνη λευκίνη ασπαραγίνη COOH Δ1. Να γράψετε την κωδική και τη μη κωδική αλυσίδα του γονιδίου. (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6) Μονάδες 10 Δ2.Να γράψετε το πρόδρομο mrna, το ώριμο mrna, το εσώνιο του γονιδίου (μονάδες 6) και να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Μονάδες 15 Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων: Aλανίνη = GCU Πανελλαδικές Β. Πιτσιλαδής

17 Λευκίνη = UUG Ασπαραγίνη = AAU 2011 Δίδεται το παραπάνω τμήμα DNA, το οποίο αντιγράφεται. Στον κλώνο ΖΗ η αντιγραφή γίνεται με ασυνεχή τρόπο. Τα σημεία Δ και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. Δ1. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε τα συνεχή και ασυνεχή τμήματα των νέων κλώνων με βέλη υποδεικνύοντας τους προσανατολισμούς των νέων και των μητρικών κλώνων (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Στον κλώνο που αντιγράφεται με συνεχή τρόπο να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του πρωταρχικού τμήματος, το οποίο αποτελείται από 8 (οκτώ) νουκλεοτίδια (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 3). Δίνεται το παρακάτω τμήμα μορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. 5 -TACATGTCGCGATGCAAGTTCTAATCTCAATAΤCTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTATΑGAA-5 Δ3. Να γράψετε τα κωδικόνια του DNA που κωδικοποιούν το πεπτίδιο αυτό. Μονάδες 2 Δ4. Μετά την επίδραση ακτινοβολίας το παραπάνω τμήμα DNA σπάει στα σημεία που υποδεικνύονται από τα βέλη. Να γράψετε το τμήμα του DNA που αποκόπηκε και να σημειώσετε τον προσανατολισμό του. Μονάδες 2 Δ5. Το τμήμα του DNA που αποκόπηκε, επανασυνδέεται στα ίδια σημεία κοπής μετά από αναστροφή. Να γράψετε ολόκληρο το μόριο του DNA που προκύπτει μετά την αναστροφή (μονάδες 4). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Να γράψετε τα κωδικόνια του μορίου DNA που κωδικοποιούν το νέο πεπτίδιο. (μονάδες 2) + ΕΣΠΕΡΙΝΩΝ Στο παρακάτω τμήμα δίκλωνου μορίου DNA, μεταξύ των σημείων Κ και Λ περιέχεται ένα γονίδιο. Στο διάγραμμα υποδεικνύεται η θέση του υποκινητή του γονιδίου. Να μεταφέρετε το σχήμα στο τετράδιό σας. Δ1. Να σημειώσετε στο σχήμα τους προσανατολισμούς των κλώνων του μορίου (μονάδες 2) και να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Δ2. Να τοποθετήσετε στο σχήμα και στις κατάλληλες θέσεις το κωδικόνιο έναρξης του γονιδίου και ένα από τα κωδικόνια λήξης (της επιλογής σας). (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Δ3. Να εξηγήσετε τι γίνεται κατά την έναρξη της μεταγραφής ενός γονιδίου. Μονάδες 6 Σ ένα μόριο DNA ευκαρυωτικού Πανελλαδικές Β. Πιτσιλαδής

18 κυττάρου υπάρχουν δύο γονίδια Α και Β, όπως φαίνεται στο σχήμα: Δ1. Να μεταφέρετε το σχήμα στο τετράδιό σας και να ορίσετε τους προσανατολισμούς των αλυσίδων του DNA (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Τα γονίδια Α και Β μεταγράφονται σε RNA. Να ορίσετε τους προσανατολισμούς του RNA (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ3. Ποια είναι η κωδική αλυσίδα για το γονίδιο Α και ποια για το Β (μονάδες 2); Να αιτιολογήσετε την απάντησή σας (μονάδες 5). Δ4. Τι είναι ο υποκινητής (μονάδες 2); Να ορίσετε τη θέση του υποκινητή για κάθε γονίδιο με ένα βέλος (μονάδες 4) Δίνεται το παρακάτω τμήμα DNA το οποίο αντιγράφεται. Τα σημεία Α και Γ υποδεικνύουν τη θέση έναρξης της αντιγραφής. Δ1. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα και να σημειώσετε πάνω σ αυτό τους προσανατολισμούς των μητρικών αλυσίδων (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ2. Να σχεδιάσετε στο ίδιο σχήμα τα ασυνεχή και τα συνεχή τμήματα των δύο νέων αλυσίδων με βέλη και να σημειώσετε πάνω σ αυτά τους προσανατολισμούς τους (Μονάδες 3). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ3. Η μητρική αλυσίδα του DNA που αντιγράφεται με συνεχή τρόπο, αμέσως μετά μεταγράφεται. Να γράψετε το τμήμα του RNA που σχηματίζεται κατά τη μεταγραφή και να σημειώσετε τον προσανατολισμό του (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ4. Ποια είναι η δράση της RNA πολυμεράσης μετά την πρόσδεσή της στον υποκινητή ενός γονιδίου; Μονάδες 6 Πανελλαδικές Β. Πιτσιλαδής

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2


Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα