ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών"

Transcript

1 Ιστονικές Ποικιλοµορφίες και Μεταφραστικές Τροποποιήσεις των ιστονών: Βασικοί Παράγοντες για την Στερεοδιαµόρφωση της Χρωµατίνης κατά την Γήρανση και Απόπτωση ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

2 ΜΕΤΑΒΟΛΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΑΛΛΑΓΕΣ ΣΤΗΝ ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ ΑΝΑΠΤΥΞΗ ΙΑΦΟΡΟΠΟΙΗΣΗ ΓΗΡΑΝΣΗ ΑΠΟΠΤΩΣΗ

3 ΑΛΛΑΓΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΚΑΤΑ ΤΗΝ ΓΗΡΑΝΣΗ: Αναδιοργανώνεται η δοµή τηςχρωµατίνης. Αλλάζουν δυναµικά περιοχές της ετεροχρωµατίνης. ηλαδή γίνεται µια αναδιοργάνωση ευ- και ετερο-χρωµατινικών περιοχών. Σταδιακή µείωση του µήκους των τελοµερών. ΚΑΤA ΤΗΝ ΑΠΟΠΤΩΣΗ: Συµπύκνωση του DNA (αποπτωτικά σωµάτια) Κατακερµατισµός του DNA

4 REORGANIZATION OF EU- AND HETEROCHROMATIN DOMAINS

5

6 Fig. 1. Apoptotic changes. T-cells undergoing apoptosis in vitro and in the thymus after activation. A: Blebbing (left) and nuclear condensation (right). B: Oligonucleosomal DNA fragmentation in apoptotic T-cells is apparent in the right lane (left lane, DNA from untreated, viable cells).

7 Τι είναι όµως αυτές οι αλλαγές Μπορεί να είναι τοπικές για την µεταγραφή συγκεκριµένων γονιδίων Ή global εκτεταµένες αλλαγές όπως είδαµε πιο πάνω µε το παράδειγµα της γήρανσης και απόπτωσης

8 ΕΥΧΡΩΜΑΤΙΝΗ -EΤΕΡΟΧΡΩΜΑΤΙΝΗ ΕΝΕΡΓΗ ΑΝΕΝΕΡΓΗ ΧΡΩΜΑΤΙΝΗ

9 Ετεροχρωµατίνη: Χρωµοσωµικές περιοχές που παραµένουν συµπυκνωµένες κατά την µεσόφαση Περιέχουν επαναλαµβανόµενες ακολουθίες DNA που είναι µεταγραφικά ανενεργείς και είναι εντοπισµένες κυρίως στα κεντροµερίδια και τα τελοµερή Μεταγράφονται αργά στο τέλος της S-φάσης και είναι πλούσιες σε Α-Τ ακολουθίες Βρίσκονται εντοπισµένες στην περιφέρεια του πυρήνα Έχουν διαφορετικό πρότυπο ακετυλίωσης, χαµηλή ακετυλίωση έως καθόλου (π.χ. ανενεργές Χ χρωµατόσωµα) Η µετατόπιση γονιδίου ενεργού στην περιοχή της ανενεργού ετεροχρωµατίνης συνεπάγεται απενεργοποίηση του ενεργού γονιδίου (φαινόµενα αποσιώπησης (silencing), φαινόµενο επίδρασης θέσης (position effect).

10 Ευχρωµατίνη Περιοχές χρωµατίνης που εµφανίζουν χαλαρή δοµή και περιλαµβάνουν µεταγραφόµενα γονίδια Χαρακτηρίζονται από θέσεις υπερευαίσθητες στην δράση της DNAασης Ι Η νουκλεοσωµατική τους σύσταση έχει ορισµένα χαρακτηριστικά που αφορούν σε ορισµένες ποικιλοµορφίες και µετα-µεταγραφικές τροποποιήσεις (ακετυλιώσεις, ουβικιτίνωση, κτλ.) Ενδιάµεσες µορφές (Facultative Heterochromatin) Περιοχές χρωµατίνης που δεν ανήκουν στην κατηγορία της κλασικής ετεροχρωµατίνης και περιέχουν γονίδια που δεν µεταγράφονται την δεδοµένη στιγµή, αλλά έχουν το δυναµικό να µεταγραφούν Οι περιοχές αυτές συχνά χαρακτηρίζονται από την ύπαρξη υπερευαίσθητων σε DNAαση Ι θέσεων

11 ΜΕΤΑΜΕΤΑΦΡΑΣΤΙΚΕΣ ΤΡΟΠΟΠΟΙΗΣΕΙΣ ΙΣΤΟΝΩΝ ΑΚΕΤΥΛΙΩΣΗ ΙΣΤΟΝΩΝ ΕΝΑΡΞΗ ΜΕΤΑΓΡΑΦΗΣ ΑΛΛΑΓΕΣ ΣΤΟ ΠΡΟΤΥΠΟ ΤΩΝ ΙΣΤΟΝΙΚΩΝ ΠΟΙΚΙΛΟΜΟΡΦΙΩΝ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΑΛΛΑΓΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ

12 Είναι µικρές βασικές πρωτείνες. Τι είναι οι ιστόνες? Υπάρχουν 5 τάξεις ιστονών: H2A, H2B, H3, H4 και Η1. Οι πρώτες 4 ανά 2 συνιστούν το οκταµερές του πυρήνα του νουκλεοσώµατος. Η Η1 βρίσκεται στο συνδέτη DNA µεταξύ των νουκλεοσωµάτων και σταθεροποιεί την είσοδο και έξοδο του DNA από τα νουκλεοσώµατα. Ολες έχουν διαειδικές ποικιλοµορφίες και εκτός από την Η4 οι υπόλοιπες έχουν και ενδοειδικές ποικιλοµορφίες. Οι ποικιλοµορφίες ή υπότυποι είναι ξεχωριστές πρωτείνες της κάθε τάξης (κωδικοποιούνται από µη αλληλόµορφα γονίδια), οι οποίες µπορεί να έχουν µεγάλη έως και πολύ µικρή οµολογία µεταξύ τους. ηλαδή µπορεί να έχουν λίγες έως και πολλές αµινο οξικές αντικαταστάσεις κυρίως στο καρβοξυλικό άκρο τους. Παρ ολα αυτά, εξελικτικά, θεωρούνται από τις πιο συντηρηµένες πρωτείνες.

13 Τα γονιδιά τους βρίσκονται σε πολλαπλά αντίγραφα. Η έκφραση διαφόρων ποικιλοµορφιών είναι προγραµµατισµένη κατά την ανάπτυξη, τις φάσεις του κυτταρικού κύκλου, την διαφοροποίηση, την κυτταρική γήρανση. Aποτελούν το κύριο κλάσµα των πρωτεινών της χρωµατίνης και πακετάρουν περίπου 2 µέτρα DNA σε συµπαγές δοµές έτσι ώστε να χωράει στον πυρήνα του κυττάρου.

14

15 Επίσης οι ιστόνες είναι µια οµάδα πρωτεινών που υπόκεινται στις περισσότερες µετα-µεταφραστικές τροποποιήσεις. Ακετυλιώση, φωσφορυλίωση, µεθυλίωση, ουβικιτίνωση και ADP-ριβοσυλίωση. Αυτές οι τροποποιήσεις λαµβάνουν χώρα σε συγκεκριµένα αµινο οξικά κατάλοιπα στα αµινοτερµατικά άκρα των ουρών των ιστονών του οκταµερούς, οι οποίες ουρές προεξέχουν από το νουκλεόσωµα. Σήµερα οι αλληλεπιδράσεις µεταξύ αυτών των τροποποιήσεων, ονοµάζονται «ΙΣΤΟΝΙΚΟΣ ΚΩ ΙΚΑΣ» και ενδέχεται, µεταξύ άλλων, να ευθύνονται για λειτουργικές αλλαγές στην δοµή τηςχρωµατίνης.

16

17 ΜΕΓΑΛΗ ΕΤΕΡΟΓΕΝΕΙΑ ΝΟΥΚΛΕΟΣΩΜΑΤΩΝ Υπαρξη ποικιλοµορφιών ιστονών Υπαρξη µετα-µεταφραστικών τροποποιήσεων ιστονών

18

19 Συγκρότηση του Οκταµερούς

20 ΟΜΗ ΝΟΥΚΛΕΟΣΩΜΑΤΟΣ 1 ¾ στροφές DNA = 146 ζβ

21 Χρωµατόσωµα = ζβ = νουκλεόσωµα + συνδέτη DNA + H1 H H1 «σφραγίζει» 2 πλήρη στροφές DNA 1ος βαθµός Συµπύκνωσης = 10 nm ίνα

22 ASSEMBLY OF HIGHER-ORDER CHROMATIN STRUCTURES AND CHROMATIN CONDENSATION

23 Ποικιλοµορφίες Ιστονών του Πυρήνα του Νουκλεοσώµατος DNA εξαρτώµενες = συντίθενται κατά την S φάση (Major histone variants). Είναιοικύριοιυπότυποιτωνιστονών. εν έχουν εσώνια. εν είναι πολυαδενυλιοµένα στο 3 άκρο τους. Αντ αυτού έχουν µια εσωτερική δοµή θηλειάς. Τα γονίδια τους έχουν πολλαπλά αντίγραφα (10) βρίσκονται συγκεντρωµένα σε τουλάχιστον 2 οµάδες σε διαφορετικά χρωµοσώµατα. Είναι τα µοναδικά γονίδια που έχουν αυτά τα χαρακτηριστικά και αυτό για να γίνεται πολύ γρήγορα η σύνθεσή τους κατά τη S φάση ταυτόχρονα µε τοdna για την συγκρότηση των χρωµατίνης.

24 Η S-φάση εξαρτώµενες ποικιλοµορφίες των ιστονών του πυρήνα του νουκλεοσώµατος είναι: H2A.1 H2A.2 H3.1 H3.2 H2B.1 H2B.2 H4

25 Οι DNA µη-εξαρτώµενες ιστονικές ποικιλοµορφίες των ιστονών του πυρήνα του νουκλεοσώµατος συντίθενται σε όλες τις φάσεις του κυτταρικού κύκλου και το mrna τους δεν έχει κανένα από τα χαρακτηριστικά των κύριων ιστονικών µορφών. Είναι κανονικά mrna όπως έχουν όλες οι πρωτείνες γιατί η σύνθεση τους δεν είναι συντονισµένη µε την σύνθεση του DNA. Επίσης τα γονίδιά τους δεν είναι οµαδοποιηµένα. Ονοµάζονται βασικές ιστονικές ποικιλοµορφίες (basal histone variants) ή ιστονικές ποικιλοµορφίες αντικατάστασης (replacement variants) γιατί αντικαθιστούν τις κύριες µορφές κατά τις υπόλοιπες φάσεις του κκ.

26 Ποιος ο λόγος γι αυτές τις αντικαταστάσεις? Επιφέρουν αλλαγές στην στερεοδιαµόρφωση των νουλεοσωµάτων και κατά συνέπεια διευκολύνεται ο γονιδιακός ανα-προγραµµατισµός. Ηνουκλεοσωµική ετερογένεια που προκύπτει εξυπηρετεί τις διάφορες αλλαγές της κυτταρικής λειτουργίας κατά τις διάφορες βιολογικές διεργασίες όπως κατά την ανάπτυξη, διαφοροποίηση, γήρανση, απόπτωση.

27 H2A H2A.X H2A.Z MacroH2A H2ABbD H3 H3.3 CENH3

28

29

30 Οι ποικιλοµορφίες της Η1 Τάξης των Ιστονών του Συνδέτου DNA H1.1 H1.2 ΣΩΜΑΤΙΚΟΙ YΠΟΤΥΠΟΙ ΤΩΝ ΟΠΟΙΩΝ H1.3 Η ΣΥΝΘΕΣΗ ΕΞΑΡΤΑΤΑΙ ΑΠΟ ΤΟΝ H1.4 ΑΝΑ ΙΠΛΑΣΙΑΣΜΟ ΤΟΥ DNA H1.5 H1o ΥΠΟΤΥΠΟΣ ΑΝΤΙΚΑΤΑΣΤΑΣΗΣ, ΣΥΝΤΙΘΕΤΑΙ ΣΕ ΟΛΕΣ ΤΙΣ ΦΑΣΕΙΣ ΤΟΥ Κ.Κ. Η1t, ιστόνη των σπερµατοκυττάρων

31

32 ΣΥΓΚΡΟΤΗΣΗ ΟΜΩΝ ΑΝΩΤΕΡΗΣ ΤΑΞΗΣ ΚΑΙ ΣΥΜΠΥΚΝΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΣΤΟΧΕΥΜΕΝΕΣ ΡΥΘΜΙΣΤΙΚΕΣ ΛΕΙΤΟΥΡΓΙΕΣ ΕΝΕΡΓΟΠΟΙΗΣΗΣ ΟΡΙΣΜΕΝΩΝ ΓΟΝΙ ΙΩΝ

33 Ενδιαφέρον παρουσιάζουν αποτελέσµατα από πρόσφατες µελέτες που υποδηλώνουν πως οι Η1 ιστόνες παίζουν ρόλο στην Γήρανση (γενικώς οι ιστόνες του συνδέτου σε µύκητες) Επιδιόρθωση του DNA (Η1.2 θηλαστικά) Απόπτωση (Η1.2 θηλαστικά) Από δουλειά του εργαστηρίου µας βρέθηκε πως ή έκφραση της Η1ο συσχετίζεται και µε την απόπτωση αλλά και µε την γήρανση

34

35

36

37

38

39

40 Global Genomic Repair Growth arrest p53 Local chromatin remodelling Transcriptional activation or repression of target genes Senescence Mitosis? Global chromatin condensation Apoptosis? Maintenance of normal cell ploidy

41 ΙΣΤΟΝΕΣ ΚΑΙ ΓΗΡΑΝΣΗ ΣΥΣΤHΜΑΤΑ ΓΗΡΑΝΣΗΣ: ΣΥΣΤΗΜΑΤΑ IN VITRO ΓΗΡΑΝΣΗΣ ΙΝΟΒΛΑΣΤΩΝ ΣΥΣΤΗΜΑΤΑ EX VIVO/IN VITRO ΓΗΡΑΝΣΗΣ ΛΕΜΦΟΚΥΤΤΑΡΩΝ ΣΚΟΠΟΙ: ΑΝΑΛΥΣΗ ΜΕΤΑΒΟΛΩΝ ΣΤΟ ΠΡΟΤΥΠΟ ΤΩΝ ΥΠΟΤΥΠΩΝ ΤΟΥ ΣΥΝ ΕΤΟΥ DNA ΜΕΣΚΟΠΟΝΑΣΥΝ ΕΘΟΥΝΜΕ ΠΑΡΑΤΗΡΟΥΜΕΝΕΣ ΑΛΛΑΓΕΣ ΣΤΗ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΚΑΤA ΤΗΝ ΓΗΡΑΝΣΗ

42 ΜΕΛΕΤΗ ΤΗΣ H1o ΙΣΤΟΝΗ ΑΝΤΙΚΑΤΑΣΤΑΣΗΣ ΒΑΣΙΚΟΙ ΛΟΓΟΙ: Χάρη στις βιοχηµικές της ιδιότητες έχει µια στενότερη σχέση µε κλειστές δοµές της χρωµατίνης (ευ- και ετεροχρωµατίνη) που όπως προανέφερα τέτοιες δοµές σχηµατίζονται και αναδιοργανώνονται κατά τη γήρανση. Επιπλέον είναι µια ιστονική ποικιλοµορφία που συσσωρεύεται κατά την τερµατική διαφοροποίηση. Η σχέσητηςµε τηνχρωµατίνη και µε κύτταρα που έχουν παύσει να διαιρούνται ενδέχεται να υποδηλώνει κάποιο ρυθµιστικό ρόλο. Η γήρανση έχει κάποια κοινά χαρακτηριστικά µε την τερµατική διαφοροποίηση. Και οι 2 διαδικασίες είναι γενετικά προγραµµατισµένες. Συµπεριλαµβάνουν την αποσιώπηση ορισµένων γονιδίων και την ενεργοποίηση άλλων.

43 ΣΥΣΤΗΜΑ:ΚΥΤΤΑΡΙΚΗ ΓΗΡΑΝΣΗ ΙΝΟΒΛΑΣΤΩΝ Η1ο mrna LEVELS OF THE DIFFERENTIATION ASSOCIATED LINKER HISTONE VARIANT H1o

44 ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ Η3 ΚΑΙ Η4, ΕΠΑΓΩΓΗ ΑΚΕΤΥΛΙΩΣΗΣ ΜΕ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ, ΕΠΑΓΩΓΗ ΤΗΣ ΙΣΤΟΝΗΣ Η1ο ΣΕ ΣΥΣΤΗΜΑΤΑ ΓΗΡΑΝΣΗΣ, ΑΠΟΠΤΩΣΗΣ ΓΙΑΤΙ ΟΙ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ ΕΊΝΑΙ ΣΗΜΑΝΤΙΚΑ ΕΡΓΑΛΕΙΑ ΣΤΗΝ ΜΕΛΕΤΗ ΤΗΣ ΓΗΡΑΝΣΗΣ ΚΑΙ ΑΠΟΠΤΩΣΗΣ ΑΝΑΛΟΓΑ ΜΕ ΤΟ ΚΥΤΤΑΡΙΚΟ ΣΥΣΤΗΜΑ ΕΠΑΓΟΥΝ ΤΗΝ ΙΑΦΟΡΟΠΟΙΗΣΗ, ΤΗΝ ΓΗΡΑΝΣΗ ΚΑΙ ΤΗΝ ΑΠΟΠΤΩΣΗ (ΓΙ ΑΥΤΌ ΤΟ ΛΟΓΟ ΧΡΗΣΙΜΟΠΟΙΟΥΝΤΑΙ ΚΑΙ ΩΣ ΑΝΤΙΚΑΡΚΙΝΙΚΑ ΦΑΡΜΑΚΑ) ΕΠΑΓΟΥΝ ΤΗΝ ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ ΚΑΙ ΤΗΝ ΕΚΦΡΑΣΗ ΤΗΣ ΙΣΤΟΝΗΣ Η1ο

45 ΛΕΜΦΟΚYΤΤΑΡΑ: ΜΕ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ ΤΩΝ ΙΣΤΟΝΩΝ ΕΧΟΥΜΕ ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ ΚΑΙ ΕΠΑΓΩΓΗ ΤΗΣ Η1ο ΚΑΘΩΣ ΚΑΙ ΑΠΟΠΤΩΣΗ

46 ΓΗΡΑΝΣΗ: ΛΕΜΦΟΚΥΤΤΑΡΑ ΑΠΟ ΟΤΕΣ ΙΑΦΟΡΩΝ ΗΛΙΚΙΩΝ ---- ΑΚΕΤΥΛΙΩΣΗ ΤΗΣ Η4 ΜΕΤΑ ΑΠΟ ΕΠΙ ΡΑΣΗ TSA ΠΡΟΤΥΠΟ ΑΚΕΤΥΛΙΩΣΗΣ Η4 ΣΕ ΥΟ ΗΛΙΚΙΕΣ absorbance H4.0 H4.1 H4.2 H4.3 H CONTROL YOUNG MID SENIOR ELDERLY NONACETYLATED H4.0 TETRA-ACETYLATED H4.4 ABSORBANCE CONTROL YOUNG MIDAGED SENIOR ELDERLY ABSORBANCE CONTROL YOUNG MIDAGED SENIOR ELDERLY

47 ΛΕΜΦΟΚΥΤΤΑΡΑ ΑΠΟ ΟΤΕΣ ΙΑΦΟΡΩΝ ΗΛΙΚΙΩΝ ΜΕΤΑ ΑΠΟ ΕΠΙ ΡΑΣΗ TSA: ΕΠΑΓΩΓΗ ΤΗΣ Η1ο ΑΝΑΛΥΣΗ WESTERN THΣ Η1ο H1o H2B

48 H1 LINKER HISTONE FRACTION OF S-PHASE LYMPHOCYTES YOUNG DONOR MID-AGED DONOR

49 H1 LINKER HISTONE FRACTION OF S-PHASE LYMPHOCYTES SENIOR DONOR ELDERLY DONOR

50 ΕΥΡΗΜΑΤΑ: ΙΝΟΒΛΑΣΤΕΣ ΚΑΙ ΓΗΡΑΝΣΗ ΠΕΡΙΛΗΠΤΙΚΑ: Η έκφραση της ιστόνης Η1ο αυξάνεται σε γηρασµένους µεταµιτωτικούς πληθυσµούς ινοβλαστών τόσο στο επίπεδο της πρωτείνης όσο και στο επίπεδο του mrna ΕΥΡΗΜΑΤΑ: ΛΕΜΦΟΚΥΤΤΑΡΑ ΚΑΙ ΓΗΡΑΝΣΗ ΠΕΡΙΛΗΠΤΙΚΑ: Ηεπαγώµενη συσσώρευση των ακετυλιώσεων των ιστονών και η έκφραση της Η1ο µετά από επίδραση µε αναστολείςτων αποακετυλασών των ιστονών, αυξάνουν σε συνάρτηση µε την αυξανόµενη ηλικία του δότη. Το πρότυπο των σωµατικών Η1 υποτύπων του συνδέτου DNA εµφανίζει σηµαντική διαφορά σε λεµφοκύτταρα υπερηλίκων και ηλικιωµένων ατόµων σε σχέση µε νεαράάτοµα

51 Συγκεκριµένα ταυτοποίηση της κορυφής έδειξε πως µειώνεται η pη1.4 και η ph1.5 κατά την γήρανση. Τι µπορεί να σηµαίνει αυτό? Αλλαγές στον κυτταρικό κύκλο κατά την γήρανση (λόγο αλλαγών επιπέδων φωσφορυλίωσης)? Ή / και αλλαγές στην αναδιοργάνωση της ετεροχρωµατίνης (λόγο Η1.4, Η1.5)? Ελπίζουµε µελλοντικές µελέτες να δώσουν κάποια απάντηση

52 ΕΠΙΣΗΣ: Μετά από επίδραση µε αναστολείς των αποακετυλασών των ιστονών, η επαγωγή της έκφρασης της Η1ο συνδέεται µε την επαγωγή της απόπτωσης σε λεµφοκύτταρα ανθρώπου.

53 Τέλος η pη2α.χ συνδέεταιµόνο µε τηναπόπτωση? Λεµφοκύτταρα από δότες αυξανόµενης ηλικίας 1,2 νέοι 3,4 µεσήλικες 5,6,7 ηλικιωµένοι 8 υπερήλικας

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα ευκαρυωτικό χρωµόσωµα και χρωµατίνη 28/02/2014 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου που

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA σε επίπεδο χρωµατίνηςνουκλεοσώµατος 09/04/2014 1 09/04/2014 2 Η καθαρά δοµική εικόνα της χρωµατίνης µας παρέχει µόνο µια στατική περιγραφή της. Δυναµική εικόνα της χρωµατίνης

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA

Δοµή και ιδιότητες του DNA Δοµή και ιδιότητες του DNA Βακτηριακό χρωµόσωµα Ευκαρυωτικό χρωµόσωµα και χρωµατίνη 10/03/2015 1 Tο βακτηριακό γονιδίωµα περιέχεται σε ένα κυκλικό DNA µήκους 1300 µm εντός του βακτηριακού κυττάρου. Στην

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 09/04/2014 2 Τόσο τα νεκρά (µε θερµική επεξεργασία) βακτήρια S όσο και τα ζωντανά βακτήρια R δεν µπορούν να θανατώσουν ποντικούς. Όµως, η ταυτόχρονη µόλυνση µε αυτά

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ. abee/biobk/biobookmeiosis.html. pdf

ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ.  abee/biobk/biobookmeiosis.html. pdf ΚΥΤΤΑΡΙΚΟΣ ΚΥΤΚΛΟΣ http://www2.estrellamountain.edu/faculty/far abee/biobk/biobookmeiosis.html pdf https://www.youtube.com/watch?v=wy3n5nczbhq http://www.youtube.com/watch?v=lf9rcqifx34&feature=related

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 03 : Δομή και οργάνωση του γενετικού υλικού Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

ΕΠΙΓΕΝΕΤΙΚΗ. Χρωμόσωμα Χ-αδρανοποίηση X-inactivation. Μπράλιου Γεωργία, PhD, Τμήμα Πληροφορικής με Εφαρμογές στη Βιοϊατρική, Πανεπιστήμιο θεσσαλίας

ΕΠΙΓΕΝΕΤΙΚΗ. Χρωμόσωμα Χ-αδρανοποίηση X-inactivation. Μπράλιου Γεωργία, PhD, Τμήμα Πληροφορικής με Εφαρμογές στη Βιοϊατρική, Πανεπιστήμιο θεσσαλίας ΕΠΙΓΕΝΕΤΙΚΗ Χρωμόσωμα Χ-αδρανοποίηση X-inactivation Μπράλιου Γεωργία, PhD, Τμήμα Πληροφορικής με Εφαρμογές στη Βιοϊατρική, Πανεπιστήμιο θεσσαλίας Η θέση της χρωματίνης στον πυρήνα είναι τυχαία ή όχι; In

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο , Μοριακή Βιολογία του γονιδίου Σελίδες

Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο , Μοριακή Βιολογία του γονιδίου Σελίδες Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο 20.1-20.14, 23.1-23.17 Μοριακή Βιολογία του γονιδίου Σελίδες 210-250 Genes VIII (Lewin) Κεφάλαιο 12 Κεφάλαιο 20.1-20.14, 23.1-23.17 Μοριακή Βιολογία του γονιδίου

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

in vivo' εύρημα που ενδέχεται να σχετίζεται όχι

in vivo' εύρημα που ενδέχεται να σχετίζεται όχι Π Ε ΡΙΠΗ ΨΗ Η απόπτωση συνοδεύεται από μεγάλες αναδιατάξεις στη στερεοδιαμόρφωση της χρωματίυης. Στις αναδιατάξεις αυτές σημαντικό ρόλο παίζουν επιγενετικές τροποποιήσεις όπως είναι η ακετυλίωση!αποακετυλίωση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

Αναδιάπλαση της Χρωματίνης. Chromatin Remodeling

Αναδιάπλαση της Χρωματίνης. Chromatin Remodeling Αναδιάπλαση της Χρωματίνης Chromatin Remodeling ομική οργάνωση του νουκλεοσώματος Η2Α Η2Β octameric histone core nucleosome 11 nm Η3 Η4 146nt DNA beads on a string chromatin Adapted from the Molecular

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες:

Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες: Ο όρος Βλαστικά κύτταρα περιλαμβάνει κυτταρα με διαφορετικές ιδιότητες: Πολυδύναμα - Pluripotent Εμβρυονικά Βλαστικά κύτταρα - Embryonic Stem Cells Ολιγοδύναμα - Multipotent Βλαστικά κύτταρα (ώριμων/εμβρυικών)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ ΑΝΑΠΑΡΑΓΩΓΗ

ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ ΑΝΑΠΑΡΑΓΩΓΗ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ ΤΕΤΑΡΤΟ 2016 2 Το συνώνυμο της αναπαραγωγής είναι ο πολλαπλασιασμός, η δημιουργία νέων ατόμων που έχουν παρόμοια χαρακτηριστικά με τους γονείς τους. Όλοι οι οργανισμοί κάποια

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ αναπαραγωγή αύξηση αριθµού κυττάρων ανάπτυξη επιδιόρθωση ιστών Κυτταρική οργάνωση του γενετικού υλικού Γονιδίωµα: Το σύνολο του γενετικού υλικού (DNA) ενός κυττάρου Στα προκαρυωτικά κύτταρα

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 23/02/ Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 23/02/2014 1 23/02/2014 2 Τόσο τα νεκρά (µε θερµική επεξεργασία) βακτήρια S όσο και τα ζωντανά βακτήρια R δεν µπορούν να θανατώσουν ποντικούς. Όµως, η ταυτόχρονη µόλυνση µε αυτά

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 20 (+ κεφ. 16, Hartwell) Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Ερώτημα Ποια είναι η αντίδραση της καρδιάς μυοκαρδίου στα επιγεννετικά

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr)

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Μίτωση - Μείωση Γαµετογένεση και Αναπαραγωγή Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Σήµερα... Ορολογία Κυτταρικός κύκλος Μίτωση Μείωση Γαµετογένεση Βιολογικοί κύκλοι ΗΓενετική είναι ο κλάδος της Βιολογίας

Διαβάστε περισσότερα

AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ

AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΜΟΡΦΟΛΟΓΙΑΣ ΦΥΤΩΝ Χ.Κ. ΚΙΤΣΑΚΗ 2008 1 Αντικείμενα της ενότητας Ορισμοί και έννοιες Σκοπός των διεργασιών της ανάπτυξης Πού και πώς πραγματοποιούνται

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΕΣ ΑΝΟΣΟΑΠΑΝΤΗΣΕΙΣ: Ενεργοποίηση των Τ κυττάρων από τους µικροοργανισµούς. Οι φάσεις των Τ κυτταρικών απαντήσεων

ΚΥΤΤΑΡΙΚΕΣ ΑΝΟΣΟΑΠΑΝΤΗΣΕΙΣ: Ενεργοποίηση των Τ κυττάρων από τους µικροοργανισµούς. Οι φάσεις των Τ κυτταρικών απαντήσεων ΚΥΤΤΑΡΙΚΕΣ ΑΝΟΣΟΑΠΑΝΤΗΣΕΙΣ: Ενεργοποίηση των Τ κυττάρων από τους µικροοργανισµούς Οι φάσεις των Τ κυτταρικών απαντήσεων Αναγνώριση του αντιγόνου και συνδιέγερση Αναγνώριση πεπτιδίων συνδεδεµένων µε το

Διαβάστε περισσότερα

Αναπαραγωγική Γήρανση Replicative Senescence

Αναπαραγωγική Γήρανση Replicative Senescence Αναπαραγωγική Γήρανση Replicative Senescence Αναπαραγωγική Γήρανση Ονομάζεται το σταμάτημα του κυτταρικού πολλαπλασιασμού μετά από περιορισμένο αριθμό κυτταρικών διαιρέσεων (π.χ. 25-50 διαιρέσεις για ινοβλάστες

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

Μοριακή Βιολογία. Ενότητα # (4): Ευκαρυωτική Μεταγραφή. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (4): Ευκαρυωτική Μεταγραφή Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΠΕΡΙΕΧΟΜΕΝΑ. 2 ΥΛΙΚΑ ΚΑΙ ΜΕΘΟ ΟΙ Αντισώµατα και πλασµιδιακοί φορείς που χρησιµοποιήθηκαν

ΠΕΡΙΕΧΟΜΕΝΑ. 2 ΥΛΙΚΑ ΚΑΙ ΜΕΘΟ ΟΙ Αντισώµατα και πλασµιδιακοί φορείς που χρησιµοποιήθηκαν ΠΕΡΙΕΧΟΜΕΝΑ Σελίδα 1. ΕΙΣΑΓΩΓΗ 5 1.1 Οργάνωση της χρωµατίνης 5 1.2 Χρωµατίνη και Ιστονικός Κώδικας 9 1.3 υναµική νουκλεοσωµάτων (Nucleosome dynamics) 14 1.3Α Εγγενής δυναµική νουκλεοσωµάτων 15 (Intrinsic

Διαβάστε περισσότερα

Ανασυνδυασμένο DNA. Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A.

Ανασυνδυασμένο DNA. Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση. Richard M. Myers Jan A. Witkowski. James D. Watson Amy A. Ανασυνδυασμένο DNA Γονίδια και Γονιδιώματα Μία Συνοπτική Παρουσίαση James D. Watson Amy A. Caudy Richard M. Myers Jan A. Witkowski Κεφάλαιο 8 Επιγενετικές τροποποιήσεις του γονιδιώματος 2 Το πρόβλημα της

Διαβάστε περισσότερα

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis imperfecta Μενδελικό Νόσημα Συχνότητα στον πληθυσμό: 1:20.000 80-95% αυτοσωμικό επικρατές 10-15% αυτοσωμικό

Διαβάστε περισσότερα

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών ANOΣΟΓΗΡΑΝΣΗ Ιωάννα Οικονοµίδου Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών Το ανοσιακό σύστηµα θεωρείται αποφασιστικός παράγοντας για την διατήρηση της υγείας και την επιβίωση στους ηλικιωµένους

Διαβάστε περισσότερα

ιαγονιδιακή τεχνολογία G. Patrinos

ιαγονιδιακή τεχνολογία G. Patrinos ιαγονιδιακή τεχνολογία Αντίστροφη γενετική Οργανισμός Γονιδίωμα ιαγονίδιο Γονίδιο Forward genetics Επαγόμενη Οργανισμός μεταλλαξογένεση Μεταλλαγμένος οργανισμός Εύρεση και μελέτη του υπεύθυνου γονιδίου

Διαβάστε περισσότερα

Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας. Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010

Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας. Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010 Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010 Το πεδίο αλλάζει Αύξηση του προσδόκιμου επιβίωσης παγκοσμίως Καλύτερη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα