ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών"

Transcript

1 Ιστονικές Ποικιλοµορφίες και Μεταφραστικές Τροποποιήσεις των ιστονών: Βασικοί Παράγοντες για την Στερεοδιαµόρφωση της Χρωµατίνης κατά την Γήρανση και Απόπτωση ρ. Θ. Σουρλίγκα Εργαστήριο Βιοχηµείας Ιστονών

2 ΜΕΤΑΒΟΛΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΑΛΛΑΓΕΣ ΣΤΗΝ ΓΟΝΙ ΙΑΚΗ ΕΚΦΡΑΣΗ ΑΝΑΠΤΥΞΗ ΙΑΦΟΡΟΠΟΙΗΣΗ ΓΗΡΑΝΣΗ ΑΠΟΠΤΩΣΗ

3 ΑΛΛΑΓΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΚΑΤΑ ΤΗΝ ΓΗΡΑΝΣΗ: Αναδιοργανώνεται η δοµή τηςχρωµατίνης. Αλλάζουν δυναµικά περιοχές της ετεροχρωµατίνης. ηλαδή γίνεται µια αναδιοργάνωση ευ- και ετερο-χρωµατινικών περιοχών. Σταδιακή µείωση του µήκους των τελοµερών. ΚΑΤA ΤΗΝ ΑΠΟΠΤΩΣΗ: Συµπύκνωση του DNA (αποπτωτικά σωµάτια) Κατακερµατισµός του DNA

4 REORGANIZATION OF EU- AND HETEROCHROMATIN DOMAINS

5

6 Fig. 1. Apoptotic changes. T-cells undergoing apoptosis in vitro and in the thymus after activation. A: Blebbing (left) and nuclear condensation (right). B: Oligonucleosomal DNA fragmentation in apoptotic T-cells is apparent in the right lane (left lane, DNA from untreated, viable cells).

7 Τι είναι όµως αυτές οι αλλαγές Μπορεί να είναι τοπικές για την µεταγραφή συγκεκριµένων γονιδίων Ή global εκτεταµένες αλλαγές όπως είδαµε πιο πάνω µε το παράδειγµα της γήρανσης και απόπτωσης

8 ΕΥΧΡΩΜΑΤΙΝΗ -EΤΕΡΟΧΡΩΜΑΤΙΝΗ ΕΝΕΡΓΗ ΑΝΕΝΕΡΓΗ ΧΡΩΜΑΤΙΝΗ

9 Ετεροχρωµατίνη: Χρωµοσωµικές περιοχές που παραµένουν συµπυκνωµένες κατά την µεσόφαση Περιέχουν επαναλαµβανόµενες ακολουθίες DNA που είναι µεταγραφικά ανενεργείς και είναι εντοπισµένες κυρίως στα κεντροµερίδια και τα τελοµερή Μεταγράφονται αργά στο τέλος της S-φάσης και είναι πλούσιες σε Α-Τ ακολουθίες Βρίσκονται εντοπισµένες στην περιφέρεια του πυρήνα Έχουν διαφορετικό πρότυπο ακετυλίωσης, χαµηλή ακετυλίωση έως καθόλου (π.χ. ανενεργές Χ χρωµατόσωµα) Η µετατόπιση γονιδίου ενεργού στην περιοχή της ανενεργού ετεροχρωµατίνης συνεπάγεται απενεργοποίηση του ενεργού γονιδίου (φαινόµενα αποσιώπησης (silencing), φαινόµενο επίδρασης θέσης (position effect).

10 Ευχρωµατίνη Περιοχές χρωµατίνης που εµφανίζουν χαλαρή δοµή και περιλαµβάνουν µεταγραφόµενα γονίδια Χαρακτηρίζονται από θέσεις υπερευαίσθητες στην δράση της DNAασης Ι Η νουκλεοσωµατική τους σύσταση έχει ορισµένα χαρακτηριστικά που αφορούν σε ορισµένες ποικιλοµορφίες και µετα-µεταγραφικές τροποποιήσεις (ακετυλιώσεις, ουβικιτίνωση, κτλ.) Ενδιάµεσες µορφές (Facultative Heterochromatin) Περιοχές χρωµατίνης που δεν ανήκουν στην κατηγορία της κλασικής ετεροχρωµατίνης και περιέχουν γονίδια που δεν µεταγράφονται την δεδοµένη στιγµή, αλλά έχουν το δυναµικό να µεταγραφούν Οι περιοχές αυτές συχνά χαρακτηρίζονται από την ύπαρξη υπερευαίσθητων σε DNAαση Ι θέσεων

11 ΜΕΤΑΜΕΤΑΦΡΑΣΤΙΚΕΣ ΤΡΟΠΟΠΟΙΗΣΕΙΣ ΙΣΤΟΝΩΝ ΑΚΕΤΥΛΙΩΣΗ ΙΣΤΟΝΩΝ ΕΝΑΡΞΗ ΜΕΤΑΓΡΑΦΗΣ ΑΛΛΑΓΕΣ ΣΤΟ ΠΡΟΤΥΠΟ ΤΩΝ ΙΣΤΟΝΙΚΩΝ ΠΟΙΚΙΛΟΜΟΡΦΙΩΝ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΑΛΛΑΓΕΣ ΣΤΗΝ ΣΤΕΡΕΟ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ

12 Είναι µικρές βασικές πρωτείνες. Τι είναι οι ιστόνες? Υπάρχουν 5 τάξεις ιστονών: H2A, H2B, H3, H4 και Η1. Οι πρώτες 4 ανά 2 συνιστούν το οκταµερές του πυρήνα του νουκλεοσώµατος. Η Η1 βρίσκεται στο συνδέτη DNA µεταξύ των νουκλεοσωµάτων και σταθεροποιεί την είσοδο και έξοδο του DNA από τα νουκλεοσώµατα. Ολες έχουν διαειδικές ποικιλοµορφίες και εκτός από την Η4 οι υπόλοιπες έχουν και ενδοειδικές ποικιλοµορφίες. Οι ποικιλοµορφίες ή υπότυποι είναι ξεχωριστές πρωτείνες της κάθε τάξης (κωδικοποιούνται από µη αλληλόµορφα γονίδια), οι οποίες µπορεί να έχουν µεγάλη έως και πολύ µικρή οµολογία µεταξύ τους. ηλαδή µπορεί να έχουν λίγες έως και πολλές αµινο οξικές αντικαταστάσεις κυρίως στο καρβοξυλικό άκρο τους. Παρ ολα αυτά, εξελικτικά, θεωρούνται από τις πιο συντηρηµένες πρωτείνες.

13 Τα γονιδιά τους βρίσκονται σε πολλαπλά αντίγραφα. Η έκφραση διαφόρων ποικιλοµορφιών είναι προγραµµατισµένη κατά την ανάπτυξη, τις φάσεις του κυτταρικού κύκλου, την διαφοροποίηση, την κυτταρική γήρανση. Aποτελούν το κύριο κλάσµα των πρωτεινών της χρωµατίνης και πακετάρουν περίπου 2 µέτρα DNA σε συµπαγές δοµές έτσι ώστε να χωράει στον πυρήνα του κυττάρου.

14

15 Επίσης οι ιστόνες είναι µια οµάδα πρωτεινών που υπόκεινται στις περισσότερες µετα-µεταφραστικές τροποποιήσεις. Ακετυλιώση, φωσφορυλίωση, µεθυλίωση, ουβικιτίνωση και ADP-ριβοσυλίωση. Αυτές οι τροποποιήσεις λαµβάνουν χώρα σε συγκεκριµένα αµινο οξικά κατάλοιπα στα αµινοτερµατικά άκρα των ουρών των ιστονών του οκταµερούς, οι οποίες ουρές προεξέχουν από το νουκλεόσωµα. Σήµερα οι αλληλεπιδράσεις µεταξύ αυτών των τροποποιήσεων, ονοµάζονται «ΙΣΤΟΝΙΚΟΣ ΚΩ ΙΚΑΣ» και ενδέχεται, µεταξύ άλλων, να ευθύνονται για λειτουργικές αλλαγές στην δοµή τηςχρωµατίνης.

16

17 ΜΕΓΑΛΗ ΕΤΕΡΟΓΕΝΕΙΑ ΝΟΥΚΛΕΟΣΩΜΑΤΩΝ Υπαρξη ποικιλοµορφιών ιστονών Υπαρξη µετα-µεταφραστικών τροποποιήσεων ιστονών

18

19 Συγκρότηση του Οκταµερούς

20 ΟΜΗ ΝΟΥΚΛΕΟΣΩΜΑΤΟΣ 1 ¾ στροφές DNA = 146 ζβ

21 Χρωµατόσωµα = ζβ = νουκλεόσωµα + συνδέτη DNA + H1 H H1 «σφραγίζει» 2 πλήρη στροφές DNA 1ος βαθµός Συµπύκνωσης = 10 nm ίνα

22 ASSEMBLY OF HIGHER-ORDER CHROMATIN STRUCTURES AND CHROMATIN CONDENSATION

23 Ποικιλοµορφίες Ιστονών του Πυρήνα του Νουκλεοσώµατος DNA εξαρτώµενες = συντίθενται κατά την S φάση (Major histone variants). Είναιοικύριοιυπότυποιτωνιστονών. εν έχουν εσώνια. εν είναι πολυαδενυλιοµένα στο 3 άκρο τους. Αντ αυτού έχουν µια εσωτερική δοµή θηλειάς. Τα γονίδια τους έχουν πολλαπλά αντίγραφα (10) βρίσκονται συγκεντρωµένα σε τουλάχιστον 2 οµάδες σε διαφορετικά χρωµοσώµατα. Είναι τα µοναδικά γονίδια που έχουν αυτά τα χαρακτηριστικά και αυτό για να γίνεται πολύ γρήγορα η σύνθεσή τους κατά τη S φάση ταυτόχρονα µε τοdna για την συγκρότηση των χρωµατίνης.

24 Η S-φάση εξαρτώµενες ποικιλοµορφίες των ιστονών του πυρήνα του νουκλεοσώµατος είναι: H2A.1 H2A.2 H3.1 H3.2 H2B.1 H2B.2 H4

25 Οι DNA µη-εξαρτώµενες ιστονικές ποικιλοµορφίες των ιστονών του πυρήνα του νουκλεοσώµατος συντίθενται σε όλες τις φάσεις του κυτταρικού κύκλου και το mrna τους δεν έχει κανένα από τα χαρακτηριστικά των κύριων ιστονικών µορφών. Είναι κανονικά mrna όπως έχουν όλες οι πρωτείνες γιατί η σύνθεση τους δεν είναι συντονισµένη µε την σύνθεση του DNA. Επίσης τα γονίδιά τους δεν είναι οµαδοποιηµένα. Ονοµάζονται βασικές ιστονικές ποικιλοµορφίες (basal histone variants) ή ιστονικές ποικιλοµορφίες αντικατάστασης (replacement variants) γιατί αντικαθιστούν τις κύριες µορφές κατά τις υπόλοιπες φάσεις του κκ.

26 Ποιος ο λόγος γι αυτές τις αντικαταστάσεις? Επιφέρουν αλλαγές στην στερεοδιαµόρφωση των νουλεοσωµάτων και κατά συνέπεια διευκολύνεται ο γονιδιακός ανα-προγραµµατισµός. Ηνουκλεοσωµική ετερογένεια που προκύπτει εξυπηρετεί τις διάφορες αλλαγές της κυτταρικής λειτουργίας κατά τις διάφορες βιολογικές διεργασίες όπως κατά την ανάπτυξη, διαφοροποίηση, γήρανση, απόπτωση.

27 H2A H2A.X H2A.Z MacroH2A H2ABbD H3 H3.3 CENH3

28

29

30 Οι ποικιλοµορφίες της Η1 Τάξης των Ιστονών του Συνδέτου DNA H1.1 H1.2 ΣΩΜΑΤΙΚΟΙ YΠΟΤΥΠΟΙ ΤΩΝ ΟΠΟΙΩΝ H1.3 Η ΣΥΝΘΕΣΗ ΕΞΑΡΤΑΤΑΙ ΑΠΟ ΤΟΝ H1.4 ΑΝΑ ΙΠΛΑΣΙΑΣΜΟ ΤΟΥ DNA H1.5 H1o ΥΠΟΤΥΠΟΣ ΑΝΤΙΚΑΤΑΣΤΑΣΗΣ, ΣΥΝΤΙΘΕΤΑΙ ΣΕ ΟΛΕΣ ΤΙΣ ΦΑΣΕΙΣ ΤΟΥ Κ.Κ. Η1t, ιστόνη των σπερµατοκυττάρων

31

32 ΣΥΓΚΡΟΤΗΣΗ ΟΜΩΝ ΑΝΩΤΕΡΗΣ ΤΑΞΗΣ ΚΑΙ ΣΥΜΠΥΚΝΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΣΤΟΧΕΥΜΕΝΕΣ ΡΥΘΜΙΣΤΙΚΕΣ ΛΕΙΤΟΥΡΓΙΕΣ ΕΝΕΡΓΟΠΟΙΗΣΗΣ ΟΡΙΣΜΕΝΩΝ ΓΟΝΙ ΙΩΝ

33 Ενδιαφέρον παρουσιάζουν αποτελέσµατα από πρόσφατες µελέτες που υποδηλώνουν πως οι Η1 ιστόνες παίζουν ρόλο στην Γήρανση (γενικώς οι ιστόνες του συνδέτου σε µύκητες) Επιδιόρθωση του DNA (Η1.2 θηλαστικά) Απόπτωση (Η1.2 θηλαστικά) Από δουλειά του εργαστηρίου µας βρέθηκε πως ή έκφραση της Η1ο συσχετίζεται και µε την απόπτωση αλλά και µε την γήρανση

34

35

36

37

38

39

40 Global Genomic Repair Growth arrest p53 Local chromatin remodelling Transcriptional activation or repression of target genes Senescence Mitosis? Global chromatin condensation Apoptosis? Maintenance of normal cell ploidy

41 ΙΣΤΟΝΕΣ ΚΑΙ ΓΗΡΑΝΣΗ ΣΥΣΤHΜΑΤΑ ΓΗΡΑΝΣΗΣ: ΣΥΣΤΗΜΑΤΑ IN VITRO ΓΗΡΑΝΣΗΣ ΙΝΟΒΛΑΣΤΩΝ ΣΥΣΤΗΜΑΤΑ EX VIVO/IN VITRO ΓΗΡΑΝΣΗΣ ΛΕΜΦΟΚΥΤΤΑΡΩΝ ΣΚΟΠΟΙ: ΑΝΑΛΥΣΗ ΜΕΤΑΒΟΛΩΝ ΣΤΟ ΠΡΟΤΥΠΟ ΤΩΝ ΥΠΟΤΥΠΩΝ ΤΟΥ ΣΥΝ ΕΤΟΥ DNA ΜΕΣΚΟΠΟΝΑΣΥΝ ΕΘΟΥΝΜΕ ΠΑΡΑΤΗΡΟΥΜΕΝΕΣ ΑΛΛΑΓΕΣ ΣΤΗ ΙΑΜΟΡΦΩΣΗ ΤΗΣ ΧΡΩΜΑΤΙΝΗΣ ΚΑΤA ΤΗΝ ΓΗΡΑΝΣΗ

42 ΜΕΛΕΤΗ ΤΗΣ H1o ΙΣΤΟΝΗ ΑΝΤΙΚΑΤΑΣΤΑΣΗΣ ΒΑΣΙΚΟΙ ΛΟΓΟΙ: Χάρη στις βιοχηµικές της ιδιότητες έχει µια στενότερη σχέση µε κλειστές δοµές της χρωµατίνης (ευ- και ετεροχρωµατίνη) που όπως προανέφερα τέτοιες δοµές σχηµατίζονται και αναδιοργανώνονται κατά τη γήρανση. Επιπλέον είναι µια ιστονική ποικιλοµορφία που συσσωρεύεται κατά την τερµατική διαφοροποίηση. Η σχέσητηςµε τηνχρωµατίνη και µε κύτταρα που έχουν παύσει να διαιρούνται ενδέχεται να υποδηλώνει κάποιο ρυθµιστικό ρόλο. Η γήρανση έχει κάποια κοινά χαρακτηριστικά µε την τερµατική διαφοροποίηση. Και οι 2 διαδικασίες είναι γενετικά προγραµµατισµένες. Συµπεριλαµβάνουν την αποσιώπηση ορισµένων γονιδίων και την ενεργοποίηση άλλων.

43 ΣΥΣΤΗΜΑ:ΚΥΤΤΑΡΙΚΗ ΓΗΡΑΝΣΗ ΙΝΟΒΛΑΣΤΩΝ Η1ο mrna LEVELS OF THE DIFFERENTIATION ASSOCIATED LINKER HISTONE VARIANT H1o

44 ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ Η3 ΚΑΙ Η4, ΕΠΑΓΩΓΗ ΑΚΕΤΥΛΙΩΣΗΣ ΜΕ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ, ΕΠΑΓΩΓΗ ΤΗΣ ΙΣΤΟΝΗΣ Η1ο ΣΕ ΣΥΣΤΗΜΑΤΑ ΓΗΡΑΝΣΗΣ, ΑΠΟΠΤΩΣΗΣ ΓΙΑΤΙ ΟΙ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ ΕΊΝΑΙ ΣΗΜΑΝΤΙΚΑ ΕΡΓΑΛΕΙΑ ΣΤΗΝ ΜΕΛΕΤΗ ΤΗΣ ΓΗΡΑΝΣΗΣ ΚΑΙ ΑΠΟΠΤΩΣΗΣ ΑΝΑΛΟΓΑ ΜΕ ΤΟ ΚΥΤΤΑΡΙΚΟ ΣΥΣΤΗΜΑ ΕΠΑΓΟΥΝ ΤΗΝ ΙΑΦΟΡΟΠΟΙΗΣΗ, ΤΗΝ ΓΗΡΑΝΣΗ ΚΑΙ ΤΗΝ ΑΠΟΠΤΩΣΗ (ΓΙ ΑΥΤΌ ΤΟ ΛΟΓΟ ΧΡΗΣΙΜΟΠΟΙΟΥΝΤΑΙ ΚΑΙ ΩΣ ΑΝΤΙΚΑΡΚΙΝΙΚΑ ΦΑΡΜΑΚΑ) ΕΠΑΓΟΥΝ ΤΗΝ ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ ΚΑΙ ΤΗΝ ΕΚΦΡΑΣΗ ΤΗΣ ΙΣΤΟΝΗΣ Η1ο

45 ΛΕΜΦΟΚYΤΤΑΡΑ: ΜΕ ΑΝΑΣΤΟΛΕΙΣ ΤΩΝ ΑΠΟΑΚΕΤΥΛΑΣΩΝ ΤΩΝ ΙΣΤΟΝΩΝ ΕΧΟΥΜΕ ΑΚΕΤΥΛΙΩΣΗ ΤΩΝ ΙΣΤΟΝΩΝ ΚΑΙ ΕΠΑΓΩΓΗ ΤΗΣ Η1ο ΚΑΘΩΣ ΚΑΙ ΑΠΟΠΤΩΣΗ

46 ΓΗΡΑΝΣΗ: ΛΕΜΦΟΚΥΤΤΑΡΑ ΑΠΟ ΟΤΕΣ ΙΑΦΟΡΩΝ ΗΛΙΚΙΩΝ ---- ΑΚΕΤΥΛΙΩΣΗ ΤΗΣ Η4 ΜΕΤΑ ΑΠΟ ΕΠΙ ΡΑΣΗ TSA ΠΡΟΤΥΠΟ ΑΚΕΤΥΛΙΩΣΗΣ Η4 ΣΕ ΥΟ ΗΛΙΚΙΕΣ absorbance H4.0 H4.1 H4.2 H4.3 H CONTROL YOUNG MID SENIOR ELDERLY NONACETYLATED H4.0 TETRA-ACETYLATED H4.4 ABSORBANCE CONTROL YOUNG MIDAGED SENIOR ELDERLY ABSORBANCE CONTROL YOUNG MIDAGED SENIOR ELDERLY

47 ΛΕΜΦΟΚΥΤΤΑΡΑ ΑΠΟ ΟΤΕΣ ΙΑΦΟΡΩΝ ΗΛΙΚΙΩΝ ΜΕΤΑ ΑΠΟ ΕΠΙ ΡΑΣΗ TSA: ΕΠΑΓΩΓΗ ΤΗΣ Η1ο ΑΝΑΛΥΣΗ WESTERN THΣ Η1ο H1o H2B

48 H1 LINKER HISTONE FRACTION OF S-PHASE LYMPHOCYTES YOUNG DONOR MID-AGED DONOR

49 H1 LINKER HISTONE FRACTION OF S-PHASE LYMPHOCYTES SENIOR DONOR ELDERLY DONOR

50 ΕΥΡΗΜΑΤΑ: ΙΝΟΒΛΑΣΤΕΣ ΚΑΙ ΓΗΡΑΝΣΗ ΠΕΡΙΛΗΠΤΙΚΑ: Η έκφραση της ιστόνης Η1ο αυξάνεται σε γηρασµένους µεταµιτωτικούς πληθυσµούς ινοβλαστών τόσο στο επίπεδο της πρωτείνης όσο και στο επίπεδο του mrna ΕΥΡΗΜΑΤΑ: ΛΕΜΦΟΚΥΤΤΑΡΑ ΚΑΙ ΓΗΡΑΝΣΗ ΠΕΡΙΛΗΠΤΙΚΑ: Ηεπαγώµενη συσσώρευση των ακετυλιώσεων των ιστονών και η έκφραση της Η1ο µετά από επίδραση µε αναστολείςτων αποακετυλασών των ιστονών, αυξάνουν σε συνάρτηση µε την αυξανόµενη ηλικία του δότη. Το πρότυπο των σωµατικών Η1 υποτύπων του συνδέτου DNA εµφανίζει σηµαντική διαφορά σε λεµφοκύτταρα υπερηλίκων και ηλικιωµένων ατόµων σε σχέση µε νεαράάτοµα

51 Συγκεκριµένα ταυτοποίηση της κορυφής έδειξε πως µειώνεται η pη1.4 και η ph1.5 κατά την γήρανση. Τι µπορεί να σηµαίνει αυτό? Αλλαγές στον κυτταρικό κύκλο κατά την γήρανση (λόγο αλλαγών επιπέδων φωσφορυλίωσης)? Ή / και αλλαγές στην αναδιοργάνωση της ετεροχρωµατίνης (λόγο Η1.4, Η1.5)? Ελπίζουµε µελλοντικές µελέτες να δώσουν κάποια απάντηση

52 ΕΠΙΣΗΣ: Μετά από επίδραση µε αναστολείς των αποακετυλασών των ιστονών, η επαγωγή της έκφρασης της Η1ο συνδέεται µε την επαγωγή της απόπτωσης σε λεµφοκύτταρα ανθρώπου.

53 Τέλος η pη2α.χ συνδέεταιµόνο µε τηναπόπτωση? Λεµφοκύτταρα από δότες αυξανόµενης ηλικίας 1,2 νέοι 3,4 µεσήλικες 5,6,7 ηλικιωµένοι 8 υπερήλικας

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Αναδιάπλαση της Χρωματίνης. Chromatin Remodeling

Αναδιάπλαση της Χρωματίνης. Chromatin Remodeling Αναδιάπλαση της Χρωματίνης Chromatin Remodeling ομική οργάνωση του νουκλεοσώματος Η2Α Η2Β octameric histone core nucleosome 11 nm Η3 Η4 146nt DNA beads on a string chromatin Adapted from the Molecular

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Αναφερθείτε σε οµοιότητες και διαφορές του γενετικού υλικού µεταξύ προκαρυωτών και ευκαρυωτών. ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Μικρότερο µέγεθος Ένα µικρό κυκλικό δίκλωνο µόριο DNA στην πυρηνική

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 Α1- δ, Α2-α, Α3-γ, Α4-δ, Α5-β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Η διπλή έλικα του DN συνδέεται µε τις ιστόνες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ

ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Αναπαραγωγική Γήρανση Replicative Senescence

Αναπαραγωγική Γήρανση Replicative Senescence Αναπαραγωγική Γήρανση Replicative Senescence Αναπαραγωγική Γήρανση Ονομάζεται το σταμάτημα του κυτταρικού πολλαπλασιασμού μετά από περιορισμένο αριθμό κυτταρικών διαιρέσεων (π.χ. 25-50 διαιρέσεις για ινοβλάστες

Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Ερώτημα Ποια είναι η αντίδραση της καρδιάς μυοκαρδίου στα επιγεννετικά

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη

Διαβάστε περισσότερα

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89

Περιεχόμενα. 1 Η ιστορία της εξελικτικής βιολογίας: Εξέλιξη και Γενετική 2 Η Προέλευση της Μοριακής Βιολογίας 3 Αποδείξεις για την εξέλιξη 89 Περιεχόμενα Οι Συγγραφείς Πρόλογος της Ελληνικής Έκδοσης Πρόλογος της Αμερικανικής Έκδοσης Σκοπός και Αντικείμενο του Βιβλίου ΜΕΡΟΣ Ι ΜΙΑ ΕΠΙΣΚΟΠΗΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΒΙΟΛΟΓΙΑΣ 1 Η ιστορία της εξελικτικής

Διαβάστε περισσότερα

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr)

Μίτωση - Μείωση. Γαµετογένεση και Αναπαραγωγή. Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Μίτωση - Μείωση Γαµετογένεση και Αναπαραγωγή Πέρη Πάσχου, PhD (ppaschou@mbg.duth.gr) Σήµερα... Ορολογία Κυτταρικός κύκλος Μίτωση Μείωση Γαµετογένεση Βιολογικοί κύκλοι ΗΓενετική είναι ο κλάδος της Βιολογίας

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ

AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ AYΞΗΣΗ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ ΕΡΓΑΣΤΗΡΙΟ ΦΥΣΙΟΛΟΓΙΑΣ ΚΑΙ ΜΟΡΦΟΛΟΓΙΑΣ ΦΥΤΩΝ Χ.Κ. ΚΙΤΣΑΚΗ 2008 1 Αντικείμενα της ενότητας Ορισμοί και έννοιες Σκοπός των διεργασιών της ανάπτυξης Πού και πώς πραγματοποιούνται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ

ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ Σοφοκλέους Χριστάλενα, Μοριακή Βιολόγος Η επιγενετική αναφέρεται σε αλλαγές στην έκφραση των γονιδίων, σταθερές κατά τη διάρκεια της ζωής ενός οργανισμού,

Διαβάστε περισσότερα

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή

Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis Imperfecta (Ατελής Οστεογένεση ) Ομάδα: Πατρασκάκη Μυρτώ Τσιτσικλή Μαγδαληνή Osteogenesis imperfecta Μενδελικό Νόσημα Συχνότητα στον πληθυσμό: 1:20.000 80-95% αυτοσωμικό επικρατές 10-15% αυτοσωμικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ. Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ:ΜΕΙΩΣΗ- ΓΑΜΕΤΟΓΕΝΕΣΗ Μητρογιάννη Ευαγγελία Βαμβούνης Ιωάννης 5/3/2013 Η κυτταρική διαίρεση είναι η διαδικασία κατά την οποία ένα αρχικό κύτταρο διαιρείται σε δύο θυγατρικά. Στους πολυκύτταρους

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012. Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 22 Απριλίου 2012 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς

Διαβάστε περισσότερα

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών ANOΣΟΓΗΡΑΝΣΗ Ιωάννα Οικονοµίδου Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών Το ανοσιακό σύστηµα θεωρείται αποφασιστικός παράγοντας για την διατήρηση της υγείας και την επιβίωση στους ηλικιωµένους

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας. Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010

Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας. Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010 Η θέση της χημειοθεραπείας σε ασθενείς 3 ης ηλικίας Θωμάς Μακατσώρης Λέκτορας Παθολογίας-Ογκολογίας Πανεπιστήμιο Πατρών 23-10-2010 Το πεδίο αλλάζει Αύξηση του προσδόκιμου επιβίωσης παγκοσμίως Καλύτερη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Α. Βιοϊατρικός Κύκλος

Α. Βιοϊατρικός Κύκλος ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΗΣ ΓΝΩΣΗΣ ΑΠΟΦΟΙΤΩΝ ΑΝΩΤΕΡΩΝ ΕΚΠΑΙ ΕΥΤΙΚΩΝ Ι ΡΥΜΑΤΩΝ ΣΕ ΣΥΓΧΡΟΝΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΙΣ ΒΙΟΕΠΙΣΤΗΜΕΣ Περιεχόµενο Προγράµµατος (µαθήµατα, ώρες κλπ): Το Πρόγραµµα Σπουδών διαχωρίζεται σε δύο Κύκλους

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙ ΙΩΜΑΤΙΚΗ

ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙ ΙΩΜΑΤΙΚΗ ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙ ΙΩΜΑΤΙΚΗ ΑΝΑΣΤΡΟΦΗ ΓΕΝΕΤΙΚΗ (γονίδιο φαινότυπος) Πρόσθεση εξωγενών γονιδίων (διαγονιδιακά) Τροποποίηση ενδογενών γονιδίων Αφαίρεση γονιδίων (knockout) ΥΠΟΘΕΣΗ Στοχευμένη μεταλλαξογένεση

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα