Γυναίκες βιολόγοι, χηµικοί και φυσικοί. Έρευνα-επιλογή υλικού: Μαρτίνα Λόος Μετάφραση και επιµέλεια: Βασιλική Καντζάρα. Βιολόγοι

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Γυναίκες βιολόγοι, χηµικοί και φυσικοί. Έρευνα-επιλογή υλικού: Μαρτίνα Λόος Μετάφραση και επιµέλεια: Βασιλική Καντζάρα. Βιολόγοι"

Transcript

1 Γυναίκες βιολόγοι, χηµικοί και φυσικοί Έρευνα-επιλογή υλικού: Μαρτίνα Λόος Μετάφραση και επιµέλεια: Βασιλική Καντζάρα Βιολόγοι ATKINS, ANNA (Άτκινς, Άννα) Μεγάλη Βρετανία - βοτανολόγος Η Άννα Άτκινς ήταν βοτανολόγος και µια από τις πρώτες φωτογράφους. Έζησε σε εποχές που οι γυναίκες δεν ενθαρρύνονταν να ασχοληθούν µε την επιστήµη. Η βοτανική όµως ήταν µια αποδεκτή επιστήµη για τις γυναίκες. Ως βοτανολόγος η Άννα διείδε γρήγορα τις δυνατότητες της φωτογραφίας στην κατάταξη των ειδών. Ο πατέρας της ήταν επίσης ένας 1

2 επιφανής επιστήµονας, που εργάστηκε σε διάφορες υπεύθυνες θέσεις στο νεοϊδρυθέν Βρετανικό Μουσείο, στο οποίο εκτίθενται πολλά από τα σχέδια της Άννας. Τον Οκτώβριο του 1843 η Άννα ήταν η πρώτη στην ιστορία που τύπωσε βιβλίο, το οποίο περιείχε εκτός από κείµενο και 424 φωτογραφίες. Ο τίτλος του βιβλίου είναι "British Algae: Cyanotype Impressions", εκδόθηκε σε συνέχειες σε περίοδο 10 χρόνων. 2

3 BRITTON, ELIZABETH KNIGHT (Μπρίττον, Ελίζαµπεθ Νάιτ) Μεγάλη Βρετανία - Βοτανολόγος Αποφοίτησε από το κολλέγιο, που τώρα ονοµάζεται Hunter College στην πόλη της Νέας Υόρκης. Συνέβαλε κατά πολύ στη γνώση µας για mosses και διετέλεσε υπεύθυνη of mosses στο Κολούµπια Κόλλετζ. ηµοσίευσε 346 επιστηµονικά άρθρα από το 1881 µέχρι το 1930, ένα εκπληκτικό αριθµό για κάθε επιστήµονα. Ήταν επίσης η πρώτη που πρότεινε την ίδρυση των βοτανικών κήπων στη Νέα Υόρκη. Αργότερα συµµετείχε στην ίδρυση της ένωσης για τη διατήρης των άγριων λουλουδιών στην Αµερική και βοήθησε να θεσπιστούν µέτρα για τη διατήρηση της φύσης στη Νέα Υόρκη. εκαπέντε διαφορετικά είδη φυτών φέρουν το όνοµά της. 3

4 CLAPP, CORNELIA M. (Κλαπ, Κορνηλία Μ.) ΗΠΑ βιολόγος, ναυτικό βιολογικό εργαστήριο Το 1874, η Κορνήλια Κλαπ ήταν µια νέα δασκάλα θετικών επιστηµών. Η παρουσία της δρ. Κορνήλιας Κλαπ στο Marine Biological Laboratory ήταν πολύ θετική από την ηµέρα που άνοιξε το Στην πρώτη ετήσια έκθεση το όνοµά της αναφέρεται ως ερευνήτρια. Από τότε µέχρι το θάνατό της το 1934, έλειψε ελάχιστα από την εργασία της. Ο ενθουσιασµός της, η πιστή της αφοσίωση, το χιούµορ, η σεµνότητα και η σοφία της έφτιαχναν µια µοναδική προσωπικότητα, που ήταν σεβαστή και αγαπητή σε όλες και όλους τις/τους συνεργάτες της. Η Κορνήλια Κλαπ υποστήριζε νέες γυναίκες στην επιστηµονική τους καριέρα και εργάστηκε µαζί µε αρκετές γυναίκες στο εργαστήριο του ναυτικού. 4

5 LANCEFIELD, REBECCA CRAIGHILL (Λάνσφιλντ, Ρεµπέκα, Κρέιγκχιλ) ΗΠΑ βιολόγος Η Craighill Lancefield γεννήθηκε σε οικογένεια στρατιωτικών και ενδιαφέρθηκε για τις θετικές επιστήµες όταν ήταν φοιτήτρια στο Κολλέγιο Wellesley. Το 1920 το ονοµά της αναφέρεται στη λίστα των επιστηµόνων ως µια «νεαρή ερευνήτρια» στην ζωολογία. Το 1926, ήταν µια «ανεξάρτητη ερευνήτρια» στη ζωολογία. Η διδακτορική της διατριβή ήταν στην ανοσιολογία και την βακτηριολογία. Εργαζόταν παράλληλα στο Πανεπιστήµιο Columbia και στο Ινστιτούτο Rockefeller, αργότερα γνωστό ως Πανεπιστήµιο Rockefeller. Σ αυτό το Ινστιτούτο έγινε καθηγήτρια της µικροβιολογίας. Η βασική της έρευνας στράφηκε γύρω από τις µολύνσεις από στρεπτοκόκκους και η εργασία της είναι σήµερα γνωστή ως το σύστηµα ταξινόµησης Lancefield για τέτοιες µολύνσεις. 5

6 MCCLINTOCK, BARBARA (Μάκλιντοκ, Μπάρµπαρα) ΗΠΑ επιστήµονας στη γενετική Η Barbara McClintock έδειξε ότι τα γονίδια µπορούσαν να «µεταµορφωθούν» σε χρωµοσώµατα, και ότι µπορούσαν να κινούνται (τα επωνοµαζόµενα "jumping genes"). Η έρευνα έγινε στη γενετική κατασκευή του καλαµποκιύ µέσω προσεκτικής υβριδιοποίησης. Η εργασία της στη γενετική εµφανίστηκα µόνο 21 χρόνια µετά την επανα-ανακάλυψη των αρχών του Mendel για την κληρονοµικότητα, σε µια εποχή που η αποδοχή γενικών αρχών δεν ήταν διαδεδοµένη. Με συνέπεια, η εργασία της, που σήµερα µοιάζει να έχει παραγνωριστεί όταν πρωτοεµφανίστηκε ήταν στην πραγµατικότητα πολύ πρωτοποριακή, για να γίνει τότε κατανοητή. Βραβεύθηκε µε το Νόµπελ της ιατρικής το

7 MENTEN, MAUD (Μέντεν, Μοντ) Καναδάς -Βιολόγος 1913 Η Μέντεν ήταν µια από τις βιολόγους τπου στις αρχές του 20 ου αιώνα εργαζόταν στην κινητική των ενζύµων στο Τορόντο του Καναδά. Ανέπτυξε µια µέθοδο, που ονοµάζεται Michealis-Menten Kinetics και είναι µια τεχνική που χρησιµοποιείται µέχρι σήµερα. Η Maude Menton δουλεύονται µε τη Leonor Michaelis έφτιαξαν ένα µαθηµατικό µοντέλο για τον τρόπο, που τα ένζυµα αντιδρούν. Η δουλειά των Michaelis και της γερµανικής καταγωγής Maude Menten κατέστησαν δυνατό σε µεταγενέστερες γενιές βιοχηµικών να αξιολογήσουν σωστά τη φύση και τα βήµατα σηµαντικών ενζύµων στο µεταβολισµό του κυττάρου. Η κοινή τους εργασία οδήγησε στην εξίσωση Michaelis-Menten, που αναφέραµε πιο πάνω. 7

8 STEVENS, NETTIE (Στήβενς, Νέττι) ΗΠΑ Βιολόγος βλαστική γενετική (cytogeneticist) Κατέκτησε το διδακτορικό της δίπλωµα από το Bryn Mawr το 1903 και µετά συνέχισε τις σπουδές της στην Ευρώπη. Ανακάλυψε ότι τα χρωµατοσώµατα Χ και Υ είναι αυτά που ορίζουν το φύλο των παιδιών και δηµοσίευσε περίπου 38 επιστηµονικές εργασίες. 8

9 2. Χηµικοί FRANKLIN, ROSALIND ELSIE (Φράνκλιν, Ρόζαλιντ Έλσι) Μεγάλη Βρετανία Μικροβιολόγος, χηµικός Η Ρόζαλιντ Franklin πήρε το δίπλωµά της στη Χηµεία το 1951 από το Πανεπιστήµιο του Cambridge. Ήταν η πρώτη που δουλεύοντας ως βοηθός ερευνήτρια του James Randall στο King's College αναγνώρισε την ελικοειδή µορφή του DNA. Η δουλειά της πέρασε στα χέρια των James Watson και Francis Crick, που µαζί µε το Maurice Wilkins, ένα συνάδελφο της Rosalind, µοιράστηκαν το βραβειο Νόµπελ φυσιολογίας και ιατρικής για την ανακάλυψη του διπλού έλικα. Η εργασία της µαζί µε την εργασία των συναδέλφων της απετέλεσε τη βάση της λεπτοµερούς περιγραφής του DNA από τον Watson και τον Crick. εν της αναγνωρίστηκε επισήµως όµως η συµβολή της σ αυτήν την ανακάλυψη. Συνέβαλε επίσης σε µελέτες για ιούς σε φυτά. Απεβίωσε σε ηλικία 37 χρονών από καρκίνο. Πηγές: 9

10 HODGKIN, DOROTHY CROWFOOT (Χότζκιν, Ντόροθυ Κράουφουτ) ΗΠΑ - Χηµικός Βραβεύθηκε µε το Νόµπελ στη Χηµεία το 1964 για την ανακάλυψη µε την τεχνική της ακτινογραφίας της δοµής βιολογικά σηµαντικών κυττάρων. 10

11 3. Φυσικοί MAYER, MARIA GOEPPERT (Μέιγιερ, Μαρία Γκούππερτ) ΗΠΑ - Φυσικός Κέρδισε το βραβείο Νόµπελ στη Φυσική για την πρωτοποριακή της δουλειά στα µοντέλα του πυρήνα του ατόµου. Ήταν η πρώτη αµερικανίδα που βραβεύτηκε µε το Νόµπελ στη φυστική (η πρώτη που κέρδισε βραβείο Νόµπελ στη φυσική ήταν η γνωστή Marie Curie). Μοιράστηκε το βραβείο µε τους J.H.D. Jensen και Eugene Wigner του Πρίνστον αν και δούλεψε ανεξάρτητα απ αυτούς. Γεννήθηκε στο Κάτοβιτς της Πολωνίας και το 1930 πήρε το διδακτορικό της δίπλωµα από το Πανεπιστήµιο του Gottingen στη Γερµανία Μετανάστευσε στις ΗΠΑ και εργάστηκε στα Πανεπιστήµια Johns Hopkins, Columbia και το Πανεπιστήµιο του Chicago. Ανακηρύχθηκε καθηγήτρια πανεπιστηµίου στο Chicago το

12 MEITNER, LISE (Μέιτνερ, Λιζ) Αυστρία - Φυσικός Ήταν µια φυσικός που έπαιξε σηµαντικό ρόλο την ανάπτυξη της πυρηνικής τήξης. Αλλά όταν έδωσε µια διάλεξη στο κοινό στο Βερολίνο για τα προβλήµατα της κοσµικής φυσικής ("Problems of Cosmic Physics") οι εφηµερίδες έγραψαν ότι µίλησε για τα προβλήµατα της φυσικής των καλλυντικών ("Problems of Cosmetic Physics"), µπερδεύοντας προφανώς το Cosmic µε το Cosmetic. Αναρωτιέται κανείς αν σκέφτηκαν ότι η φυσική από µόνη της είναι κάτι για τα καλλυντικά ή αν οι γυναίκες µπορούσαν να ασχοληθούν µόνο µε καλλυντική φυσική. Το στοιχείο Meitnerium, (ένα transuranian στοιχείο) φέρει το όνοµά της. 12

13 WU, CHIEN SHIUNG (Γου, Σιεν Σιουνγκ) Κίνα/ΗΠΑ - Φυσικός Γεννήθηκε στην Κίνα και µετανάστευσε στις Ηνωµένες Πολιτείες µετά την αποφοίτησή της από το Πανεπιστήµιο Nanking Central το Έλαβε το διδακτορικό της δίπλωµα από το Πανεπιστήµιο της Καλιφόρνια στο Μπέρκλεϊ. ίδαξε στο Κολλέγιο Smith College και στο Πρίνστον πριν πάρει µια θέση στο Πανεπιστήµιο της Κολούµπια. Το 1957, ενόσω ήταν στο Πανεπιστήµιο της Columbia απέδειξε ότι δεν ισχύει ο νόµος διατήρησης των ίσων που ήταν ένα από τα βασικά αξιώµατα στη φυσική. Έφτιαξε το πείραµα που επιβεβαίωσε µια θεωρία που προτάθηκε από τους δρ.. T. D. Lee και C. N. Yang. Οι Lee και Yang κέρδισαν για τη δουλειά τους το βραβείο Νόµπελ, αλλά όχι και η Σιέν Σιούνγκ Γου. Παρ όλα αυτά κέρδισε πολλές άλλες τιµές, ανάµεσα στις οποίες το σηµαντικό βραβείο Comstock της Εθνικής Ακαδηµίας των Επιστηµών το 1964 και ήταν η πρώτη γυναίκα που κέρδισε αυτό το βραβείο. Μετά πέρασε στην ιατρική έρευνα για την αναιµία. Η Σιεν Σιούνγκ πίστευε ότι η βασική έρευνα, µπορεί να προσφέρει πολλά στους ανθρώπους. *** 13

Εκπαιδευτικοί και ακτιβίστριες Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ

Εκπαιδευτικοί και ακτιβίστριες Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ Εκπαιδευτικοί και ακτιβίστριες Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ http://www.infoplease.com DAVIES, EMILY (Ντέιβις, Έµιλυ) Μ. Βρετανία - Εκπαιδευτικός, εκδότρια, αγωνίστρια

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΟΙ. Έρευνα-επιλογή: Μαρτίνα Λόος Μετάφραση-επιµέλεια: Βασιλική Καντζάρα

ΜΑΘΗΜΑΤΙΚΟΙ. Έρευνα-επιλογή: Μαρτίνα Λόος Μετάφραση-επιµέλεια: Βασιλική Καντζάρα Έρευνα-επιλογή: Μαρτίνα Λόος Μετάφραση-επιµέλεια: Βασιλική Καντζάρα ΜΑΘΗΜΑΤΙΚΟΙ Εισαγωγή Το παρόν κείµενο περιλαµβάνει ορισµένα µόνο ονόµατα γνωστών µαθηµατικών από την ιστορία της επιστήµης. Η έρευνα

Διαβάστε περισσότερα

Κρυσταλλογραφία Ακτίνων Χ

Κρυσταλλογραφία Ακτίνων Χ Κρυσταλλογραφία Ακτίνων Χ Τι είναι η κρυσταλλογραφία ακτίνων Χ; Η µελέτη του κρυσταλλικού πλέγµατος, µέσω της χρήσης ακτίνων Χ. Αποκαλύπτει τη διάταξη των δομικών μερών τα οποία συγκροτούν τον κρύσταλλο

Διαβάστε περισσότερα

ΓΥΝΑΙΚΕΣ ΑΝΘΡΩΠΟΛΟΓΟΙ. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ. http://www.google.images

ΓΥΝΑΙΚΕΣ ΑΝΘΡΩΠΟΛΟΓΟΙ. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ. http://www.google.images ΓΥΝΑΙΚΕΣ ΑΝΘΡΩΠΟΛΟΓΟΙ Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ http://www.google.images Bell, Getrude Margaret Lowthian (Μπελλ, Γερτρούδη Mαργαρίτα Λόουθιαν) Μ. Βρετανία Aνθρωπολόγος,

Διαβάστε περισσότερα

Εφευρέτριες, κατασκευάστριες και µηχανικοί. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ. http://www. google.

Εφευρέτριες, κατασκευάστριες και µηχανικοί. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ. http://www. google. Εφευρέτριες, κατασκευάστριες και µηχανικοί Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια : Β. ΚΑΝΤΖΑΡΑ http://www. google.image BEECH, OLIVE ANN (Μπιτς, Όλιβ Aνν) ΗΠΑ Εργοστασιάρχης κατασκευής

Διαβάστε περισσότερα

Κοινωνιολόγοι, κοινωνικοί επιστήµονες και κοινωνικοί λειτουργοί

Κοινωνιολόγοι, κοινωνικοί επιστήµονες και κοινωνικοί λειτουργοί Κοινωνιολόγοι, κοινωνικοί επιστήµονες και κοινωνικοί λειτουργοί Εισαγωγή Τα παραδείγµατα γυναικών επιστηµόνων, που ακολουθούν, επιλέχθηκαν µετά από έρευνα στο διαδίκτυο. Ο κατάλογος δεν είναι φυσικά πλήρης,

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα

Τ Α Π Ρ Ο Σ Ω Π Α Τ Η Σ Ε Π Ι Σ Τ Η Μ Η Σ Τ Ο Υ Μ Ε Λ Λ Ο Ν Τ Ο Σ

Τ Α Π Ρ Ο Σ Ω Π Α Τ Η Σ Ε Π Ι Σ Τ Η Μ Η Σ Τ Ο Υ Μ Ε Λ Λ Ο Ν Τ Ο Σ Δρ. Γεωργία Σαλαντή Δρ. Ελένη Μακαρώνα Δρ. Χριστίνα Πιπέρη Τ Α Π Ρ Ο Σ Ω Π Α Τ Η Σ Ε Π Ι Σ Τ Η Μ Η Σ Τ Ο Υ Μ Ε Λ Λ Ο Ν Τ Ο Σ ΜΙΑ ΕΞΑΙΡΕΤΙΚΑ ΔΡΑΣΤΗΡΙΑ ΔΙΑΔΙΚΤΥΑΚΗ ΚΟΙΝΟΤΗΤΑ Χάρη στο Διαδίκτυο, η κοινότητα

Διαβάστε περισσότερα

ΔΕΛΤΙΟ ΤΥΠΟΥ. Το θέλαμε πολύ και τελικά το καταφέραμε. «Διακτινιστήκαμε» στο CERN!Μαζί μας έξι ακόμα γυμνάσια και λύκεια απ όλη την Ελλάδα.

ΔΕΛΤΙΟ ΤΥΠΟΥ. Το θέλαμε πολύ και τελικά το καταφέραμε. «Διακτινιστήκαμε» στο CERN!Μαζί μας έξι ακόμα γυμνάσια και λύκεια απ όλη την Ελλάδα. ΔΕΛΤΙΟ ΤΥΠΟΥ 2 ου ΓΥΜΝΑΣΙΟΥ ΚΗΦΙΣΙΑΣ Το θέλαμε πολύ και τελικά το καταφέραμε. «Διακτινιστήκαμε» στο CERN!Μαζί μας έξι ακόμα γυμνάσια και λύκεια απ όλη την Ελλάδα. Μέχρι πριν από κάποια χρόνια αυτό θα ήταν

Διαβάστε περισσότερα

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική

Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Ο μαγικός κόσμος της έρευνας στη Βιολογία και Βιοϊατρική Χρυσούλα Πιτσούλη, Ph.D. Τμήμα Βιολογικών Επιστημών Πανεπιστήμιο Κύπρου (pitsouli@ucy.ac.cy) Η Βιολογία μελετά τη ζωή Η Βιοϊατρική αποτελεί εφαρμογή

Διαβάστε περισσότερα

13 ο Συνέδριο Ιατρικής Χημείας

13 ο Συνέδριο Ιατρικής Χημείας ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑΤΑ ΧΗΜΕΙΑΣ, ΦΑΡΜΑΚΕΥΤΙΚΗΣ, ΙΑΤΡΙΚΗΣ ΣΥΜΜΕΤΟΧΗ: ΦΙΛΟΛΟΓΙΑΣ & ΦΙΛΟΣΟΦΙΑΣ 13 ο Συνέδριο Ιατρικής Χημείας ΙΑΤΡΙΚΗ ΧΗΜΕΙΑ: Σχεδιασμός και Ανάπτυξη Φαρμακευτικών Προϊόντων & 1 ο FP7-7-SEE-DRUG

Διαβάστε περισσότερα

ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ

ΣΧΟΛΗ ΕΠΑΓΓΕΛΜΑΤΩΝ ΥΓΕΙΑΣ ΚΑΙ ΠΡΟΝΟΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ Το Τμήμα Ιατρικών Εργαστηρίων εκπαιδεύει μελλοντικούς επιστήμονες που θα στελεχώσουν τα εργαστήρια Νοσοκομείων & Ιατρικών Κέντρων & θα πραγματοποιούν όλες τις εξετάσεις Έτσι, στα Νοσοκομεία, επανδρώνουν

Διαβάστε περισσότερα

Πέμπτη 10 Απριλίου 2014, ώρα 11:30 Αμφιθέατρο Συνεδριακού και Πολιτιστικού Κέντρου Πανεπιστημίου Πατρών

Πέμπτη 10 Απριλίου 2014, ώρα 11:30 Αμφιθέατρο Συνεδριακού και Πολιτιστικού Κέντρου Πανεπιστημίου Πατρών ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΔΙΑΤΜΗΜΑΤΙΚΟ ΜΕΤΑΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΙΑΤΡΙΚΗ ΧΗΜΕΙΑ: ΣΧΕΔΙΑΣΜΟΣ ΚΑΙ ΑΝΑΠΤΥΞΗ ΦΑΡΜΑΚΕΥΤΙΚΩΝ ΠΡΟΪΟΝΤΩΝ ΤΜΗΜΑΤΑ ΧΗΜΕΙΑΣ, ΙΑΤΡΙΚΗΣ, ΦΑΡΜΑΚΕΥΤΙΚΗΣ (1997-2014) 15 ο ΣΥΝΕΔΡΙΟ ΙΑΤΡΙΚΗΣ

Διαβάστε περισσότερα

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου

Σταδιοδρομία 2014. Κωνσταντίνος Βοσκαρίδης 30-11-2014. Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου Επάγγελμα: Γενετιστής - Μοριακός Βιολόγος Σταδιοδρομία 2014 Κωνσταντίνος Βοσκαρίδης Τμήμα Βιολογικών Επιστημών & Κέντρο Ερευνών Μοριακής Ιατρικής Πανεπιστήμιο Κύπρου 30-11-2014 20 Νοεμβρίου, 2010 ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΙΝΣΤΙΤΙ ΒΙΟΛΟΓΙΑ. γενικής ηαιεείας. Β'τόξης ενιαίου (ΙυΗείου ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΟΣ ΑΙΔΑΚΤΙΚΟΝ BIBA1QN ΑΘΗΝΑ

ΙΝΣΤΙΤΙ ΒΙΟΛΟΓΙΑ. γενικής ηαιεείας. Β'τόξης ενιαίου (ΙυΗείου ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΟΣ ΑΙΔΑΚΤΙΚΟΝ BIBA1QN ΑΘΗΝΑ ΓΕΙΟΕ ΑΙ ΚΑ ΙΝΣΤΙΤΙ ΒΙΟΛΟΓΙΑ γενικής ηαιεείας Β'τόξης ενιαίου (ΙυΗείου ΟΡΓΑΝΙΣΜΟΣ ΕΚΔΟΣΕΟΣ ΑΙΔΑΚΤΙΚΟΝ BIBA1QN ΑΘΗΝΑ ΒΙΟΛΟΓΙΑ Γενικής Παιδείας Β' ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΒΛΙΟ ΚΑΘΗΓΗΤΗ ΟΜΑΔΑ ΣΥΓΓΡΑΦΗΣ ΑΘΑΝΑΣΙΟΣ

Διαβάστε περισσότερα

ΡΑΔΙΟΧΗΜΕΙΑ ΚΕΦΑΛΑΙΟ 5. ΤΟΞΙΚΟΤΗΤΑ ΤΩΝ ΡΑΔΙΕΝΕΡΓΩΝ ΣΤΟΙΧΕΙΩΝ ΔΙΑΧΕΙΡΙΣΗ ΡΑΔΙΕΝΕΡΓΩΝ ΑΠΟΒΛΗΤΩΝ ΤΟΞΙΚΟΤΗΤΑ ΡΑΔΙΕΝΕΡΓΩΝ ΙΣΟΤΟΠΩΝ. Τμήμα Χημικών Μηχανικών

ΡΑΔΙΟΧΗΜΕΙΑ ΚΕΦΑΛΑΙΟ 5. ΤΟΞΙΚΟΤΗΤΑ ΤΩΝ ΡΑΔΙΕΝΕΡΓΩΝ ΣΤΟΙΧΕΙΩΝ ΔΙΑΧΕΙΡΙΣΗ ΡΑΔΙΕΝΕΡΓΩΝ ΑΠΟΒΛΗΤΩΝ ΤΟΞΙΚΟΤΗΤΑ ΡΑΔΙΕΝΕΡΓΩΝ ΙΣΟΤΟΠΩΝ. Τμήμα Χημικών Μηχανικών ΡΑΔΙΟΧΗΜΕΙΑ ΔΙΑΧΕΙΡΙΣΗ ΡΑΔΙΕΝΕΡΓΩΝ ΑΠΟΒΛΗΤΩΝ ΤΟΞΙΚΟΤΗΤΑ ΡΑΔΙΕΝΕΡΓΩΝ ΙΣΟΤΟΠΩΝ Τμήμα Χημικών Μηχανικών Ιωάννα Δ. Αναστασοπούλου Βασιλική Δρίτσα ΚΕΦΑΛΑΙΟ 5. ΤΟΞΙΚΟΤΗΤΑ ΤΩΝ ΡΑΔΙΕΝΕΡΓΩΝ ΣΤΟΙΧΕΙΩΝ 2. ΤΡΙΤΙΟ,

Διαβάστε περισσότερα

ΙΚΜΠΑΛ ΜΑΛΑΛΑ ΕΝΑ ΓΕΝΝΑΙΟ ΑΓΟΡΙ ΕΝΑ ΓΕΝΝΑΙΟ ΚΟΡΙΤΣΙ JEANETTE WINTER JEANETTE WINTER. Βραβείο. ΕΚΔΟΣΕΙΣ ΠΑΠΑΔΟΠΟΥΛΟΣ www.epbooks.gr

ΙΚΜΠΑΛ ΜΑΛΑΛΑ ΕΝΑ ΓΕΝΝΑΙΟ ΑΓΟΡΙ ΕΝΑ ΓΕΝΝΑΙΟ ΚΟΡΙΤΣΙ JEANETTE WINTER JEANETTE WINTER. Βραβείο. ΕΚΔΟΣΕΙΣ ΠΑΠΑΔΟΠΟΥΛΟΣ www.epbooks.gr JEANETTE WINTER ΙΚΜΠΑΛ ΕΝΑ ΓΕΝΝΑΙΟ ΑΓΟΡΙ JEANETTE WINTER ΜΑΛΑΛΑ ΕΝΑ ΓΕΝΝΑΙΟ ΚΟΡΙΤΣΙ Βραβείο ΜΑΛΑΛΑ ΓΙΟΥΣΑΦΖΑΪ ΝΟΜΠΕΛ ΕΙΡΗΝΗΣ ISBN 978-960-569-305-3 Κωδ. μηχ/σης 12.263 ΕΚΔΟΣΕΙΣ ΠΑΠΑΔΟΠΟΥΛΟΣ www.epbooks.gr

Διαβάστε περισσότερα

ΚΩΣΤΑΣ Λ. ΖΩΡΑΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ

ΚΩΣΤΑΣ Λ. ΖΩΡΑΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΚΩΣΤΑΣ Λ. ΖΩΡΑΣ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Ι. ΒΙΟΓΡΑΦΙΚΑ ΣΤΟΙΧΕΙΑ Γεννήθηκα στην Αθήνα στις 21 Αυγούστου 1950. Γονείς μου είναι ο Λύσανδρος Κ. Ζώρας και η Λήδα Ζώρα το γένος Ο. Λαμπροπούλου. ΙΙ. ΣΠΟΥΔΕΣ Α. Μέση

Διαβάστε περισσότερα

ΘΕΡΑΠΕΙΑ ΜΕ ΡΑΔΙΟΦΑΡΜΑΚΑ - Η ΑΞΙΑ ΤΗΣ ΔΟΣΙΜΕΤΡΙΑΣ-

ΘΕΡΑΠΕΙΑ ΜΕ ΡΑΔΙΟΦΑΡΜΑΚΑ - Η ΑΞΙΑ ΤΗΣ ΔΟΣΙΜΕΤΡΙΑΣ- ΘΕΡΑΠΕΙΑ ΜΕ ΡΑΔΙΟΦΑΡΜΑΚΑ - Η ΑΞΙΑ ΤΗΣ ΔΟΣΙΜΕΤΡΙΑΣ- Μαρία Λύρα Γεωργοσοπούλου, Αν. Καθ. Ακτινοφυσικός Μονάδα Ακτινοφυσικής, Α Εργαστήριο Ακτινολογίας, Πανεπιστήμιο Αθηνών 1896 Henri Becquerel ανακαλύπτει

Διαβάστε περισσότερα

Σύναψη µεταξύ της απόληξης του νευράξονα ενός νευρώνα και του δενδρίτη ενός άλλου νευρώνα.

Σύναψη µεταξύ της απόληξης του νευράξονα ενός νευρώνα και του δενδρίτη ενός άλλου νευρώνα. ΟΙ ΝΕΥΡΩΝΕΣ ΕΠΙΚΟΙΝΩΝΟΥΝ ΜΕΣΩ ΤΗΣ ΣΥΝΑΨΗΣ Άντα Μητσάκου Αναπληρώτρια Καθηγήτρια, Ιατρική Σχολή, Πανεπιστήµιο Πατρών Γνωρίζουµε ότι είµαστε ικανοί να εκτελούµε σύνθετες νοητικές διεργασίες εξαιτίας της

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕ.ΠΑ.Κ. Πρακτικά ΗΜΕΡΙΔΑΣ. με θέμα Υδροπονική Καλλιέργεια στην Κύπρο Παρόν και Μέλλον

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕ.ΠΑ.Κ. Πρακτικά ΗΜΕΡΙΔΑΣ. με θέμα Υδροπονική Καλλιέργεια στην Κύπρο Παρόν και Μέλλον ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕ.ΠΑ.Κ. Πρακτικά ΗΜΕΡΙΔΑΣ με θέμα Υδροπονική Καλλιέργεια στην Κύπρο Παρόν και Μέλλον «HYDROFLIES: Ορθολογική Διαχείριση Βιοτικών και Αβιοτικών Παραμέτρων σε Υδροπονική

Διαβάστε περισσότερα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα

ΟΜΑΔΑ Λ. Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΟΜΑΔΑ Λ Αναστασίου Κωνσταντίνος Δεληγιάννη Ισαβέλλα Ζωγοπούλου Άννα Κουκάκης Γιώργος Σταθάκη Αρετιάννα ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ Τι είναι η βιοπληροφορική; Αποκαλείται ο επιστημονικός κλάδος ο οποίος προέκυψε από

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ. «Εφαρμοσμένη Διαιτολογία Διατροφή»

ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ. «Εφαρμοσμένη Διαιτολογία Διατροφή» ΧΑΡΟΚΟΠΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Σχολή Επιστημών Υγείας & Αγωγής Τμήμα Επιστήμης Διαιτολογίας Διατροφής ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Εφαρμοσμένη Διαιτολογία Διατροφή» 2015 Κλινική Διατροφή Διατροφή & Άσκηση

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες

κληρονοµικότητα Πληροφορίες για Ασθενείς και Οικογένειες 12 Φυλοσύνδετη στο Χ Ή την τοπική σας κλινική γενετικής διάγνωσης: κληρονοµικότητα Εργαστήριο Ιατρικής Γενετικής Πανεπιστήµιο Αθηνών Νοσοκοµείο Παίδων " Αγία Σοφία" Αθήνα Τηλ: +210 7795553 http://iatriki-genetiki.med.uoa.gr

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ

ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ ΠΡΟΣΩΠΙΚΑ ΣΤΟΙΧΕΙΑ ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Επώνυµο: ΚΕΣΙ ΗΣ Όνοµα: ΑΝΑΣΤΑΣΙΟΣ Όνοµα πατέρα: Ιωάννης Έτος γεννήσεως: 1961 /νση επικοινωνίας : Τέρµα Κοντοπούλου, Φλώρινα, 53100 Τηλ: 238554646 e-mail: tkesidis@gmail.com

Διαβάστε περισσότερα

Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη

Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη Είμαστε σίγουροι πως έχετε ακούσει πολλές φορές ότι τα παιδιά παίρνουν από 7 γενιές. Αυτό αποτέλεσε αφετηρία για την παρουσίαση μας με θέμα τη κληρονομικότητα στον άνθρωπο. 1 Καταρχήν, η πρώτη επιστημονική

Διαβάστε περισσότερα

Οι εκπαιδευτικές και επαγγελματικές επιλογές επηρεάζονται από μια σειρά παραγόντων, που ονομάζονται ατομικοί. Σε αυτούς συγκαταλέγονται τα

Οι εκπαιδευτικές και επαγγελματικές επιλογές επηρεάζονται από μια σειρά παραγόντων, που ονομάζονται ατομικοί. Σε αυτούς συγκαταλέγονται τα Οι εκπαιδευτικές και επαγγελματικές επιλογές επηρεάζονται από μια σειρά παραγόντων, που ονομάζονται ατομικοί. Σε αυτούς συγκαταλέγονται τα ενδιαφέροντα του ατόμου, οι ικανότητες και τις δεξιότητές του,

Διαβάστε περισσότερα

«Εφαρμοσμένη Διαιτολογία Διατροφή»

«Εφαρμοσμένη Διαιτολογία Διατροφή» ΧΑΡΟΚΟΠΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Τμήμα Επιστήμης Διαιτολογίας Διατροφής ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ «Εφαρμοσμένη Διαιτολογία Διατροφή» Κλινική Διατροφή Διατροφή & Άσκηση Διατροφή & Δημόσια Υγεία [2012] Ε Λ.

Διαβάστε περισσότερα

Οι πέντε κορυφαίες Γυναίκες της ΕΠΙΣΤΗΜΗΣ

Οι πέντε κορυφαίες Γυναίκες της ΕΠΙΣΤΗΜΗΣ Το ΒΗΜΑ, 05/03/2006 Οι πέντε κορυφαίες Γυναίκες της ΕΠΙΣΤΗΜΗΣ Την περασµένη Πέµπτη απονεµήθηκαν στο Παρίσι τα βραβεία «L'Oréal - UNESCO για τις Γυναίκες στην Επιστήµη» σε γυναίκες που διακρίθηκαν στην

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

H Στατιστική είναι συναρπαστικό αντικείµενο µελέτης

H Στατιστική είναι συναρπαστικό αντικείµενο µελέτης ΤΑ ΝΕΑ, 21/03/2005 ANOIXTO MBA GRΑCΙΕLΑ CΗΙCΗΙLΝΙSΚΥ H Στατιστική είναι συναρπαστικό αντικείµενο µελέτης H ΚΑΘHΓHTPIA MAΘHMATIKΩN KAI ΣTATIΣTIKHΣ ΣTΟ CΟLUΜΒΙΑ UΝΙVΕRSΙΤΥ, ΜIΛAEI ΣTA «NEA» Του ΦΑΙ ΩΝΑ Γ.

Διαβάστε περισσότερα

δεκατομο ιστορικο εργο ΓΕΩΡΓΙΟΣ ΠΑΠΑΝΙΚΟΛΑΟΥ της κωνσταντιασ ζαχου

δεκατομο ιστορικο εργο ΓΕΩΡΓΙΟΣ ΠΑΠΑΝΙΚΟΛΑΟΥ της κωνσταντιασ ζαχου δεκατομο ιστορικο εργο ΓΕΩΡΓΙΟΣ ΠΑΠΑΝΙΚΟΛΑΟΥ ΔΕΚΑΤΟΣ τομοσ της κωνσταντιασ ζαχου ellines_papanikolaoy.indd 7 23/4/2009 2:12:58 μμ περιεχομενα Πρόλογος έκδοσης - 13 Εισαγωγή βιβλίου - 15-30 1 2 3 Πρόλογος

Διαβάστε περισσότερα

Στις 13 Αύγουστου τοϋ 2011, στο νοσοκομείο Ροϋζβελτ

Στις 13 Αύγουστου τοϋ 2011, στο νοσοκομείο Ροϋζβελτ ΝΕΚΡΟΛΟΓΙΑ ΧΑΡΑΛΑΜΠΟΣ (ΧΑΡΗΣ) ΨωΜΙΑΔΗΣ (1928-2011) τοϋ Σταύρου Θ. Άνεστίδη Στις 13 Αύγουστου τοϋ 2011, στο νοσοκομείο Ροϋζβελτ της ΝέαςΎόρκης, άπεβίωσε ό καδηγητής Χαράλαμπος (Χάρης) Ψωμιάδης, ιδρυτής

Διαβάστε περισσότερα

Παραγωγή και τρόπος δράσης των αντιβιοτικών

Παραγωγή και τρόπος δράσης των αντιβιοτικών Γυμνάσιο Κερατέας Κόλλια Γεωργία Παραγωγή και τρόπος δράσης των αντιβιοτικών 1 Τι είναι το αντιβιοτικό; Αρχικά, ως Αντιβιοτικά ορίστηκαν τα Χημειοθεραπευτικά φάρμακα που παράγονται με βιοσυνθετική μέθοδο

Διαβάστε περισσότερα

#VresXrono για το βιβλίο της εβδομάδας

#VresXrono για το βιβλίο της εβδομάδας Ημερομηνία 29/06/2015 Μέσο Συντάκτης Link athensvoice.gr AV Team http://goo.gl/azhlca 29/06/2015-13:00 0 Σχόλια #VresXrono για το βιβλίο της εβδομάδας «Τελευταίο αίνιγμα», Marisha Pessl, εκδ. Διόπτρα Υπάρχουν

Διαβάστε περισσότερα

Ολογραφία. Ιστορία, χρήση και µέλλον της ολογραφίας

Ολογραφία. Ιστορία, χρήση και µέλλον της ολογραφίας Ολογραφία Ιστορία, χρήση και µέλλον της ολογραφίας Σπουδαστική Οµάδα: Κότσιαρη Αγγελική Μαϊµάρης Ανδρέας Μπουγουλιά Ειρήνη Παπαβασιλείου Ζέτα Σφύρα Κατερίνα Φωτογραφία-Ολογραφία : δύο απόψεις του ίδιου

Διαβάστε περισσότερα

H πρώτη Ακαδημία Κλινικής Αρωματοθεραπείας στην Ελλάδα

H πρώτη Ακαδημία Κλινικής Αρωματοθεραπείας στην Ελλάδα H πρώτη Ακαδημία Κλινικής Αρωματοθεραπείας στην Ελλάδα Αποκτήστε πιστοποιημένο δίπλωμα με το πιο έγκυρο πρόγραμμα σπουδών Satelitte School of Penny Price Academy IFPA CERTIFIED H πρώτη Ακαδημία Κλινικής

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες

Χρωµοσωµικές Αλλαγές. Πληροφορίες για Ασθενείς και Οικογένειες 12 Orphanet Ιστοσελίδα ελεύθερης πρόσβασης που παρέχει πληροφορίες για τις σπάνιες παθήσεις, τα κλινικά πειράµατα, τα φάρµακα και συνδέσµους για οµάδες υποστήριξης σε ολόκληρη την Ευρώπη. Ιστοσελίδα: www.orpha.net

Διαβάστε περισσότερα

Καταγραφή Εντυπώσεων από τη Συμμετοχή μου. στο Πρόγραμμα Erasmus Placement

Καταγραφή Εντυπώσεων από τη Συμμετοχή μου. στο Πρόγραμμα Erasmus Placement Καταγραφή Εντυπώσεων από τη Συμμετοχή μου στο Πρόγραμμα Erasmus Placement Όνομα - Επώνυμο : Κωνσταντίνος Βλαχόπουλος Email: kostisvlachopoulos@gmail.com Ίδρυμα που πήγα (δώσε και ιστοσελίδα): Queen s University

Διαβάστε περισσότερα

Πανεπιστήμια με Κλάδους Διατροφολογίας Διαιτολογίας

Πανεπιστήμια με Κλάδους Διατροφολογίας Διαιτολογίας Πανεπιστήμια με Κλάδους Διατροφολογίας Διαιτολογίας Ερευνητική Εργασία B 3 2 ο Γενικό Λύκειο Θεσσαλονίκης Εμμανουέλλα Στρογγύλη-Τσιότσου Λάζαρος Τράικος Ελένη Φαρμάκη Η Διαιτολογία Η Διαιτολογία είναι

Διαβάστε περισσότερα

Harald zur Hausen Βιογραφία

Harald zur Hausen Βιογραφία ΒΙΟΓΡΑΦΙΑ Τη Δευτέρα 27 Ιανουαρίου 2014 αναγορεύθηκε Επίτιμος Διδάκτορας του Πανεπιστημίου Αθηνών ο Καθηγητής Harald zur Hausen, κάτοχος του βραβείου Nobel Ιατρικής 2008 για την ανακάλυψη του ρόλου των

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Λουκάς Βλάχος Καθηγητής αστροφυσικής. http://www.physics.auth.gr valhos@astro.auth.gr

Λουκάς Βλάχος Καθηγητής αστροφυσικής. http://www.physics.auth.gr valhos@astro.auth.gr Λουκάς Βλάχος Καθηγητής αστροφυσικής http://www.physics.auth.gr valhos@astro.auth.gr Εισαγωγή Δεξιότητες του σύγχρονου φυσικού Οι τομείς και οι κατευθύνσεις στο Τμήμα φυσικής Τα μεταπτυχιακά Γιατί να σπουδάσω

Διαβάστε περισσότερα

ΣΥΓΓΡΑΦΕΙΣ Κώστας Θεριανός Δέσποινα Καρακατσάνη Μανώλης Κουτούζης

ΣΥΓΓΡΑΦΕΙΣ Κώστας Θεριανός Δέσποινα Καρακατσάνη Μανώλης Κουτούζης ΣΥΓΓΡΑΦΕΙΣ Ο Κώστας Θεριανός είναι κοινωνιολόγος και Διδάκτωρ των Επιστημών της Αγωγής. Εργάζεται στην δευτεροβάθμια εκπαίδευση και τα ενδιαφέροντα του εστιάζονται στην Κοινωνιολογία της Εκπαίδευσης και

Διαβάστε περισσότερα

Τεχνολογικό Εκπαιδευτικό Ίδρυμα Καβάλας. Ερωτηματολόγιο για τις μαθήτριες

Τεχνολογικό Εκπαιδευτικό Ίδρυμα Καβάλας. Ερωτηματολόγιο για τις μαθήτριες Τεχνολογικό Εκπαιδευτικό Ίδρυμα Καβάλας Ερωτηματολόγιο για τις μαθήτριες Τίτλος πράξης: Κατηγορία Πράξης: Ενέργεια: Μέτρο: Επιστ. Υπεύθυνος: "Επιμόρφωση - Πιστοποίηση Γυναικών Αρχικής Επαγγελματικής Εκπαίδευσης

Διαβάστε περισσότερα

ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ ΤΑΞΗ ΣΤ

ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ ΤΑΞΗ ΣΤ ΠΕΙΡΑΜΑΤΙΚΟ ΟΛΟΗΜΕΡΟ ΔΗΜΟΤΙΚΟ ΣΧΟΛΕΙΟ ΠΟΡΤΑΡΙΑΣ ΤΑΞΗ ΣΤ Στα πλαίσια του προγράμματος «Οικολογικά σπίτια» οι μαθητές Ανδρεάδης Γαβριήλ και Ταγκρασούλης Ορέστης ανέλαβαν να συγκεντρώσουν, από διάφορες πηγές,

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

Γυναίκες Αστρονόµοι. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ. Aγλαονίκη 5 ος αιώνας π.χ. Ελλάδα - αστρονόµος

Γυναίκες Αστρονόµοι. Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ. Aγλαονίκη 5 ος αιώνας π.χ. Ελλάδα - αστρονόµος Γυναίκες Αστρονόµοι Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ Aγλαονίκη 5 ος αιώνας π.χ. Ελλάδα - αστρονόµος Η αστρονοµία έχει µεγάλη παράδοση στην αποδοχή γυναικών ως επιστηµόνων.πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΒΡΑΒΕΊΟ ΕΞΑΊΡΕΤΗΣ ΠΑΝΕΠΙΣΤΗΜΙΑΚΉΣ ΔΙΔΑΣΚΑΛΊΑΣ «ΣΤΈΛΙΟΥ ΠΗΧΩΡΊΔΗ»

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΒΡΑΒΕΊΟ ΕΞΑΊΡΕΤΗΣ ΠΑΝΕΠΙΣΤΗΜΙΑΚΉΣ ΔΙΔΑΣΚΑΛΊΑΣ «ΣΤΈΛΙΟΥ ΠΗΧΩΡΊΔΗ» ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΒΡΑΒΕΊΟ ΕΞΑΊΡΕΤΗΣ ΠΑΝΕΠΙΣΤΗΜΙΑΚΉΣ ΔΙΔΑΣΚΑΛΊΑΣ «ΣΤΈΛΙΟΥ ΠΗΧΩΡΊΔΗ» 2012 2013 Α. ΙΣΤΟΡΙΚΌ ΣΚΟΠΌΣ Το βραβείο θεσπίστηκε από τη Σύγκλητο του Πανεπιστημίου Κρήτης το έτος 1999 προς τιμήν

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΣΤΗ ΔΥΣΗ ΟΙ ΠΡΩΤΕΣ ΕΝΤΥΠΕΣ ΕΚΔΟΣΕΙΣ ΤΟΥ ΕΛΛΗΝΙΚΟΥ ΚΕΙΜΕΝΟΥ ΤΗΣ ΚΑΙΝΗΣ ΔΙΑΘΗΚΗΣ (16 Ο αι.)

ΣΤΗ ΔΥΣΗ ΟΙ ΠΡΩΤΕΣ ΕΝΤΥΠΕΣ ΕΚΔΟΣΕΙΣ ΤΟΥ ΕΛΛΗΝΙΚΟΥ ΚΕΙΜΕΝΟΥ ΤΗΣ ΚΑΙΝΗΣ ΔΙΑΘΗΚΗΣ (16 Ο αι.) ΣΤΗ ΔΥΣΗ ΟΙ ΠΡΩΤΕΣ ΕΝΤΥΠΕΣ ΕΚΔΟΣΕΙΣ ΤΟΥ ΕΛΛΗΝΙΚΟΥ ΚΕΙΜΕΝΟΥ ΤΗΣ ΚΑΙΝΗΣ ΔΙΑΘΗΚΗΣ (16 Ο αι.) 1. Από τον Έρασμο στο Textus Receptus Πρώτη έκδοση του ελληνικού κειμένου της Αγ. Γραφής η πολύγλωσση Κομπλουτιανή

Διαβάστε περισσότερα

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ

Συνδεδεµένα Γονίδια. Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ 8η ιάλεξη Συνδεδεµένα Γονίδια Γενετικός Ανασυνδυασµός Κλασσική Γενετική Χαρτογράφηση ΑΘΑΝΑΣΙΟΣ ΜΑΥΡΟΜΑΤΗΣ - ΤΑΝΙΑ ΜΑΡΚΟΠΟΥΛΟΥ Εργαστήριο Γενετικής & Βελτίωσης φυτών Κύρια σηµεία - Ορισµοί Συνταινικά =

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

Η επαγγελµατική αποκατάσταση των αποφοίτων γεωγράφων στην ελληνική αγορά εργασίας (2011)

Η επαγγελµατική αποκατάσταση των αποφοίτων γεωγράφων στην ελληνική αγορά εργασίας (2011) Η επαγγελµατική αποκατάσταση των αποφοίτων γεωγράφων στην ελληνική αγορά εργασίας (2011) ΤΑΥΤΟΤΗΤΑ ΕΡΕΥΝΑΣ Φορέας υλοποίησης Παρατηρητήριο Απασχόλησης της Ένωση Γεωγράφων Ελλάδας (Ε.ΓΕΩ.) Περίοδος συλλογής

Διαβάστε περισσότερα

ΠΡΕΣΒΕΥΤΗΣ ΕΘΕΛΟΝΤΙΣΜΟΥ

ΠΡΕΣΒΕΥΤΗΣ ΕΘΕΛΟΝΤΙΣΜΟΥ ΜΙΧΑΛΗΣ ΧΑΤΖΗΜΙΧΑΗΛ Μήνυμα Μιχάλη Χατζημιχαήλ για τον εθελοντισμό Όταν ένας συνάνθρωπος μας ή μια ομάδα ανθρώπων γύρω μας χρειάζεται βοήθεια κι εμείς αρνηθούμε, τότε οι λέξεις αλληλεγγύη, ανιδιοτέλεια,

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα

Μελέτη απορρόφησης αποφοίτων του Α.Π.Θ. στην αγορά εργασίας

Μελέτη απορρόφησης αποφοίτων του Α.Π.Θ. στην αγορά εργασίας Μελέτη απορρόφησης του Α.Π.Θ. στην αγορά εργασίας Επιστημονικός Κλάδος: Θετικών Επιστημών 1 Ιδρυματικά Υπεύθυνη Γραφείου Διασύνδεσης Α.Π.Θ.: Νόρμα Βαβάτση - Χριστάκη, καθηγήτρια Ιατρικής Σχολής Ερευνητής:

Διαβάστε περισσότερα

Βιολογία Α' Λυκείου Λύκειο Επισκοπής

Βιολογία Α' Λυκείου Λύκειο Επισκοπής Βιολογία Α' Λυκείου Λύκειο Επισκοπής Κεφάλαιο 12ο Αναπαραγωγή Ανάπτυξη Μαυροματάκης Γιώργος- Βιολόγος σχολική χρονιά 2011-2012 1ο Μάθημα Κεφ. 12 Οι ζωντανοί οργανισμοί, ανεξάρτητα εάν ανήκουν στα Βακτήρια,

Διαβάστε περισσότερα

1. Ο μαγικός καθρέπτης: μια απλή ιστορία για την εισαγωγή της έννοιας των μικροσυστοιχιών στην τάξη

1. Ο μαγικός καθρέπτης: μια απλή ιστορία για την εισαγωγή της έννοιας των μικροσυστοιχιών στην τάξη ΣΤΗΝ ΤΑΞΗ 1. Ο μαγικός καθρέπτης: μια απλή ιστορία για την εισαγωγή της έννοιας των μικροσυστοιχιών στην τάξη 2. Η ροή της πληροφορίας από το DNA στις πρωτεΐνες. 3. Ανάλυση γονιδιακής έκφρασης 4. Πως να

Διαβάστε περισσότερα

εκποµπής (σαν δακτυλικό αποτύπωµα)

εκποµπής (σαν δακτυλικό αποτύπωµα) Το πρότυπο του Bοhr για το άτοµο του υδρογόνου (α) (β) (γ) (α): Συνεχές φάσµα λευκού φωτός (β): Γραµµικό φάσµα εκποµπής αερίου (γ): Φάσµα απορρόφησης αερίου Κάθε αέριο έχει το δικό του φάσµα εκποµπής (σαν

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

Αυτά συμβαίνουν σε επίπεδο αισθητού δηλαδή ύλης, τι γίνεται όμως σε επίπεδο νοητού, δηλαδή καταστάσεων, γεγονότων κτλ;

Αυτά συμβαίνουν σε επίπεδο αισθητού δηλαδή ύλης, τι γίνεται όμως σε επίπεδο νοητού, δηλαδή καταστάσεων, γεγονότων κτλ; Όλοι έχουμε ακούσει για το συνειδητό και το υποσυνείδητο. Το υποσυνείδητο είναι μια αποθήκη πληροφοριών από την οποία αντλούμε εικόνες ήχους κτλ για να αποκωδικοποιήσουμε κάτι. Π.χ. σπάει ένα γυαλί, τα

Διαβάστε περισσότερα

Γυναίκες αεροπόροι-πιλότοι και εξερευνήτριες. 1. Aεροπόροι-πιλότοι. COCHRAN, JACQUELINE ("Jackie") (Κόχραν, Ζακλίν (Τζάκυ))

Γυναίκες αεροπόροι-πιλότοι και εξερευνήτριες. 1. Aεροπόροι-πιλότοι. COCHRAN, JACQUELINE (Jackie) (Κόχραν, Ζακλίν (Τζάκυ)) Γυναίκες αεροπόροι-πιλότοι και εξερευνήτριες Έρευνα-επιλογή: Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ 1. Aεροπόροι-πιλότοι COCHRAN, JACQUELINE ("Jackie") (Κόχραν, Ζακλίν (Τζάκυ)) ΗΠΑ πιλότος

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΣΥΝΕΠΕΙΕΣ

ΓΕΝΕΤΙΚΗ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΣΥΝΕΠΕΙΕΣ ΕΞΕΛΙΚΤΙΚΗ ΠΟΡΕΙΑ ΓΕΝΕΤΙΚΗ Ένας επιστημονικός κλάδος που με τα επιτεύγματά του προκάλεσε έντονες συζήσεις στο τέλος του 20 ου αιώνα και αναμένεται να απασχολήσει εξίσου έντονα, αν όχι να μονοπωλήσει το

Διαβάστε περισσότερα

Εργαστηριακή Παραγωγή Biodiesel

Εργαστηριακή Παραγωγή Biodiesel Λύκειο Αποστόλων Πέτρου και Παύλου Λεμεσού «Πρόγραμμα Καινοτόμων Σχολείων και Εκπαιδευτικών πυρήνων για την ενσωμάτωση των Τεχνολογιών Πληροφορίας και Επικοινωνίας (ΤΠΕ) στη σχολική μονάδα» ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ

Διαβάστε περισσότερα

Aφιέρωμα στο διεθνές έτος Χημείας. Εθνικό Ίδρυμα Ερευνών. a n. m o x e i

Aφιέρωμα στο διεθνές έτος Χημείας. Εθνικό Ίδρυμα Ερευνών. a n. m o x e i g. a m o x i p w. Στο σχεδιασμό και στη διοργάνωση συμμετέχουν επίσης το Μουσείο της Ελληνικής Συλλογής Νόμπελ, το Bitish Coucil, το Διαπανεπιστημιακό, Διατμητατικό Πρόγραμμα Μεταπτυχιακών Σπουδών ΔιΧηΝΕΤ

Διαβάστε περισσότερα

Bachelor in Computer Engineering Mnxανικός Η/Υ

Bachelor in Computer Engineering Mnxανικός Η/Υ Bachelor in Computer Engineering Mnxανικός Η/Υ The Best and Brightest World-class education It s closer than you think Bachelor in Computer Engineering Mnxανικός Η/Υ www.ait.gr/bsc Σκέψου από τώρα... Τις

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Μήνυμα από Αναπληρωτή Κοσμήτορα ΣΘΕΕ Βραβεία Πρωτευσάντων Φοιτητών 2011

Μήνυμα από Αναπληρωτή Κοσμήτορα ΣΘΕΕ Βραβεία Πρωτευσάντων Φοιτητών 2011 Αγαπητέ κύριε Αντιπρύτανη, Αγαπητοί Πρόεδροι των Τμημάτων της ΣΘΕΕ, Αγαπητοί Γονείς, Θα ήθελα αρχίζοντας αυτό το σύντομο χαιρετισμό μου να απευθυνθώ πρώτα στους αγαπητούς τελειόφοιτους και αριστεύσαντες

Διαβάστε περισσότερα

Μελέτη απορρόφησης αποφοίτων του Α.Π.Θ. στην αγορά εργασίας

Μελέτη απορρόφησης αποφοίτων του Α.Π.Θ. στην αγορά εργασίας Μελέτη απορρόφησης του ΑΠΘ στην αγορά εργασίας των ετών 2005 & 2006 Μελέτη απορρόφησης του Α.Π.Θ. στην αγορά εργασίας Επιστημονικός Κλάδος: Χημικοί Τμήμα Χημικών Μηχανικών 1 Μελέτη απορρόφησης του ΑΠΘ

Διαβάστε περισσότερα

ΕΠΙΣΤΗΜΟΝΕΣ ΠΟΥ ΣΥΝΕΒΑΛΑΝ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. ΣΥΝΤΟΜΑ ΒΙΟΓΡΑΦΙΚΑ ΣΤΟΙΧΕΙΑ Άβερι, Όσβαλντ (Osvald T. Avery)

ΕΠΙΣΤΗΜΟΝΕΣ ΠΟΥ ΣΥΝΕΒΑΛΑΝ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. ΣΥΝΤΟΜΑ ΒΙΟΓΡΑΦΙΚΑ ΣΤΟΙΧΕΙΑ Άβερι, Όσβαλντ (Osvald T. Avery) ΕΠΙΣΤΗΜΟΝΕΣ ΠΟΥ ΣΥΝΕΒΑΛΑΝ ΣΤΗΝ ΑΝΑΠΤΥΞΗ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΣΥΝΤΟΜΑ ΒΙΟΓΡΑΦΙΚΑ ΣΤΟΙΧΕΙΑ Άβερι, Όσβαλντ (Osvald T. Avery) Αµερικανός βιολόγος (1877-1955) Απέδειξε ότι το µόριο του DNA είναι εκείνο που ευθύνεται

Διαβάστε περισσότερα

Γυναίκες πολεµίστριες και ηρωίδες. Έρευνα-επιλογή:Μ. Λόος Μετάφραση: Μ. Σκόµπα Επιµέλεια: Β. Καντζάρα

Γυναίκες πολεµίστριες και ηρωίδες. Έρευνα-επιλογή:Μ. Λόος Μετάφραση: Μ. Σκόµπα Επιµέλεια: Β. Καντζάρα Γυναίκες πολεµίστριες και ηρωίδες Έρευνα-επιλογή:Μ. Λόος Μετάφραση: Μ. Σκόµπα Επιµέλεια: Β. Καντζάρα Cleopatra (Κλεοπάτρα) 69 30 π.χ. Αίγυπτος Βασίλισσα Η Κλεοπάτρα γεννήθηκε το 69 π.x και βασίλεψε στην

Διαβάστε περισσότερα

ΔΟΥΛΕΨΕ ΣΥΜΜΕΤΕΙΧΕ ΤΑ ΔΙΚΑΙΩΜΑΤΑ ΓΙΝΕ ΕΘΕΛΟΝΤΗΣ ΔΗΜΙΟΥΡΓΗΣΕ

ΔΟΥΛΕΨΕ ΣΥΜΜΕΤΕΙΧΕ ΤΑ ΔΙΚΑΙΩΜΑΤΑ ΓΙΝΕ ΕΘΕΛΟΝΤΗΣ ΔΗΜΙΟΥΡΓΗΣΕ ΣΠΟΥΔΑΣ Ε Νεολαία σε κίνηση: ΕΠΙΜΟΡΦΩΣΟΥ Η Ευρώπη στηρίζει τους νέους ΔΟΥΛΕΨΕ ΣΥΜΜΕΤΕΙΧΕ ΤΑ ΔΙΚΑΙΩΜΑΤΑ ΜΑΘΕ ΚΙΝΗΣΟΥ ΓΙΝΕ ΕΘΕΛΟΝΤΗΣ ΔΗΜΙΟΥΡΓΗΣΕ στην ΕΕ Δεν είναι υπεύθυνη ούτε η Ευρωπαϊκή Επιτροπή ούτε

Διαβάστε περισσότερα

Η θαυμαστή κοινωνία των μελισσών

Η θαυμαστή κοινωνία των μελισσών Η θαυμαστή κοινωνία των μελισσών Οι Έλληνες ανέκαθεν ήταν στενά δεμένοι με τον κόσμο των μελισσών. Ο πρώτος που ασχολήθηκε επιστημονικά με αυτές 300 χρόνια π.χ., ήταν ο Αριστοτέλης. Την εποχή εκείνη, ο

Διαβάστε περισσότερα

8 η Διημερίδα Βιολογίας Η κοινωνία συναντά τη σύγχρονη Βιολογία

8 η Διημερίδα Βιολογίας Η κοινωνία συναντά τη σύγχρονη Βιολογία ΩΡΑ 10.00 Ο υπολογιστής με εκατομμύρια χρόνια έρευνας και ανάπτυξης: Προσεγγίζοντας τον εγκέφαλο. Ευθύμιος Σκουλάκης, Επικεφαλής του Τομέα Νευροεπιστημών στο Ερευνητικό Κέντρο Βιοϊατρικών Επιστημών «Αλέξανδρος

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΤΡΙΤΗΣ ΓΥΜΝΑΣΙΟΥ ΤΩΝ ΜΑΘΗΤΩΝ: ΣΙΓΚΟΥΔΗ ΚΩΣΤΑ και ΣΓΟΡΟΥΔΗ ΘΑΝΟΥ ΜΑΘΗΜΑ: ΚΟΙΝΩΝΙΚΗ και ΠΟΛΙΤΙΚΗ ΑΓΩΓΗ ΚΑΘΗΓΗΤΗΣ: ΣΙΓΚΟΥΔΗΣ ΓΡΗΓΟΡΗΣ

ΕΡΓΑΣΙΑ ΤΡΙΤΗΣ ΓΥΜΝΑΣΙΟΥ ΤΩΝ ΜΑΘΗΤΩΝ: ΣΙΓΚΟΥΔΗ ΚΩΣΤΑ και ΣΓΟΡΟΥΔΗ ΘΑΝΟΥ ΜΑΘΗΜΑ: ΚΟΙΝΩΝΙΚΗ και ΠΟΛΙΤΙΚΗ ΑΓΩΓΗ ΚΑΘΗΓΗΤΗΣ: ΣΙΓΚΟΥΔΗΣ ΓΡΗΓΟΡΗΣ ΕΡΓΑΣΙΑ ΤΡΙΤΗΣ ΓΥΜΝΑΣΙΟΥ ΤΩΝ ΜΑΘΗΤΩΝ: ΣΙΓΚΟΥΔΗ ΚΩΣΤΑ και ΣΓΟΡΟΥΔΗ ΘΑΝΟΥ ΜΑΘΗΜΑ: ΚΟΙΝΩΝΙΚΗ και ΠΟΛΙΤΙΚΗ ΑΓΩΓΗ ΚΑΘΗΓΗΤΗΣ: ΣΙΓΚΟΥΔΗΣ ΓΡΗΓΟΡΗΣ Κάρολος Δαρβίνος Ο Κάρολος Ροβέρτος Δαρβίνος ήταν Άγγλος φυσιοδίφης

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ

ΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΤΜΗΜΑ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ΜΟΝΙΜΗ ΕΠΙΤΡΟΠΗ ΑΡΧΙΤΕΚΤΟΝΙΚΟΥ ΕΡΓΟΥ ΑΦΙΕΡΩΜΑ ΣΤΗΝ ΚΥΠΡΙΑΚΗ ΑΡΧΙΤΕΚΤΟΝΙΚΗ ΔΙΑΛΕΞΗ του Κύπριου αρχιτέκτονα Ζήνωνα Σιερεπεκλή. ΘΕΣΣΑΛΟΝΙΚΗ 07-05-2010-ΑΜΦΙΘΕΑΤΡΟ

Διαβάστε περισσότερα

«ιεθνούς Σχολείου» Ρόδου

«ιεθνούς Σχολείου» Ρόδου Πληθυσµιακή και Γλωσσική Ποικιλότητα «ιεθνούς Σχολείου» Ρόδου στη Ρόδο: Το Παράδειγµα του Κατερίνα Καλογεροπούλου, Φώτης Κοτζαµάνης, Λιάνα Κουµνάκη, Αγάπη Μπίτσκη, Βασιλική Πίνδη, Πάνος Σιώρος, Κωνσταντίνος

Διαβάστε περισσότερα

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ

ΤΜΗΜΑ ΓΕΩΠΟΝΙΚΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ Το πρόγραμμα σπουδών του τμήματος Γεωπονικής Βιοτεχνολογίας πρέπει να ανταποκρίνεται στην εξαγωγή επιστημόνων Γεωπόνων Βιοτεχνολόγων ικανών να μελετούν, να αντιμετωπίζουν και να προτείνουν

Διαβάστε περισσότερα

ΕΚΠΑΙΔΕΥΣΗ. Βιογραφικό Σημείωμα. Τεχν. Τροφίμων ΑΠΘ Μ.Sc - Θεσσαλονίκη. Προσωπικά Στοιχεία. Πόλη: Θεσσαλονίκη, Τ.Κ. 54640

ΕΚΠΑΙΔΕΥΣΗ. Βιογραφικό Σημείωμα. Τεχν. Τροφίμων ΑΠΘ Μ.Sc - Θεσσαλονίκη. Προσωπικά Στοιχεία. Πόλη: Θεσσαλονίκη, Τ.Κ. 54640 Τεχν Τροφίμων ΑΠΘ ΜSc Θεσσαλονίκη Πέμπτη, 13 Σεπτέμβριος 2012 16:53 Βιογραφικό Σημείωμα Τεχν Τροφίμων ΑΠΘ ΜSc Θεσσαλονίκη Προσωπικά Στοιχεία Πόλη: Θεσσαλονίκη, ΤΚ 54640 Τηλέφωνο: 2310835103, 6984767744

Διαβάστε περισσότερα

Προοπτικές τουρισμού γκολφ στην Ελλάδα σε σύγκριση με άλλες χώρες

Προοπτικές τουρισμού γκολφ στην Ελλάδα σε σύγκριση με άλλες χώρες Προοπτικές τουρισμού γκολφ στην Ελλάδα σε σύγκριση με άλλες χώρες Ονοματεπώνυμο: Γεωργίου Παναγιώτης 113125 Σειρά: 11 Επιβλέπων Καθηγητής: Γιωργής Κριτσωτάκης Δεκέμβριος 2014 Γκολφ - Τουρισμός Readman

Διαβάστε περισσότερα

Ιατρική και Τεχνολογία

Ιατρική και Τεχνολογία Ιατρική και Τεχνολογία Ιατρική Επιστήμη Η Ιατρική είναι επιστήμη και τέχνη που ασχολείται με την έρευνα και την εφαρμογή μεθόδων και τεχνικών για την πρόληψη, τη διάγνωση και τη θεραπεία των ασθενειών

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΧΡΗΣΗ ΤΩΝ ΥΠΟΔΙΑΙΡΕΣΕΩΝ ΣΤΙΣ ΘΕΜΑΤΙΚΕΣ ΕΠΙΚΕΦΑΛΙΔΕΣ ΤΗΣ ΒΙΒΛΙΟΘΗΚΗΣ ΤΟΥ ΚΟΓΚΡΕΣΟΥ

ΧΡΗΣΗ ΤΩΝ ΥΠΟΔΙΑΙΡΕΣΕΩΝ ΣΤΙΣ ΘΕΜΑΤΙΚΕΣ ΕΠΙΚΕΦΑΛΙΔΕΣ ΤΗΣ ΒΙΒΛΙΟΘΗΚΗΣ ΤΟΥ ΚΟΓΚΡΕΣΟΥ ΧΡΗΣΗ ΤΩΝ ΥΠΟΔΙΑΙΡΕΣΕΩΝ ΣΤΙΣ ΘΕΜΑΤΙΚΕΣ ΕΠΙΚΕΦΑΛΙΔΕΣ ΤΗΣ ΒΙΒΛΙΟΘΗΚΗΣ ΤΟΥ ΚΟΓΚΡΕΣΟΥ 0 Συλλογικός Κατάλογος των Ακαδημαϊκών Βιβλιοθηκών έφερε στην επιφάνεια τα λάθη της επεξεργασίας υλικού και την αναγκαιότητα

Διαβάστε περισσότερα

ΥΠΕΥΘΥΝΗ ΓΙΑ ΤΟ ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΠΕΡΑΚΗ ΒΑΣΙΛΙΚΗ, δρ Βιολογίας, σύμβουλος Παιδαγωγικού Ινστιτούτου.

ΥΠΕΥΘΥΝΗ ΓΙΑ ΤΟ ΠΑΙΔΑΓΩΓΙΚΟ ΙΝΣΤΙΤΟΥΤΟ ΠΕΡΑΚΗ ΒΑΣΙΛΙΚΗ, δρ Βιολογίας, σύμβουλος Παιδαγωγικού Ινστιτούτου. ΒΙΟΛΟΓΙΑ Η συγγραφή του βιβλίου είναι αποτέλεσμα συλλογικής εργασίας μελών της Πανελλήνιας Ένωσης Βιολόγων, στα πλαίσια του διαγωνισμού του Παιδαγωγικού Ινστιτούτου για τη συγγραφή διδακτικών βιβλίων Βιολογίας

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

9-10 Φεβρουαρίου 2013 Ολυμπιακό Μουσείο Θεσσαλονίκης

9-10 Φεβρουαρίου 2013 Ολυμπιακό Μουσείο Θεσσαλονίκης 27ο Μετεκπαιδευτικό Σεμινάριο Ιατρικής Βιοπαθολογίας Διοργάνωση: Εταιρεία Ιατρικής Βιοπαθολογίας Βορείου Ελλάδος 9-10 Φεβρουαρίου 2013 Ολυμπιακό Μουσείο Θεσσαλονίκης Τελικό Πρόγραμμα Χορήγηση Πιστοποιητικού

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

11. Γυναίκες πολεµίστριες και ηρωίδες

11. Γυναίκες πολεµίστριες και ηρωίδες 11. Γυναίκες πολεµίστριες και ηρωίδες Συλλογή-επιλογή:Μ. ΛΟΟΣ Μετάφραση: Μ. ΣΚΟΜΠΑ Επιµέλεια: Β. ΚΑΝΤΖΑΡΑ Κλεοπάτρα 69 30 π.χ. Αίγυπτος -Βασίλισσα Η Κλεοπάτρα γεννήθηκε το 69 π.χ. Βασίλεψε στην Αίγυπτο

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα