Μόρια-κλειδιά των ζωντανών οργανισμών καθώς περιέχουν την γενετική πληροφορία Νουκλεϊκά οξέα:

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μόρια-κλειδιά των ζωντανών οργανισμών καθώς περιέχουν την γενετική πληροφορία Νουκλεϊκά οξέα:"

Transcript

1 Μόρια-κλειδιά των ζωντανών οργανισμών καθώς περιέχουν την γενετική πληροφορία 1. Δεοξυριβονουκλεϊκό οξύ (DNA) Νουκλεϊκά οξέα: Φορέας της γενετικής πληροφορίας 2. Ριβονουκλεϊκό οξύ (RNA) Συμμετοχή στην πρωτεϊνοσύνθεση

2 Τα νουκλεϊκά οξέα είναι πολυμερή νουκλεοτιδίων Ένα νουκλεοτίδιο αποτελείται από: 1. Μία αζωτούχο βάση 2. Μία ή περισσότερες φωσφορικές ομάδες 3. Ένα σάκχαρο με πέντε άτομα άνθρακα (πεντόζη) 2-Δεοξυριβόζη (DNA) Ριβόζη (RNA)

3 ΝΟΥΚΛΕΟΤΙΔΙΑ 1. Αζωτούχες βάσεις Είναι κυκλικές ενώσεις που περιέχουν άζωτο στο δακτύλιο τους και διακρίνονται σε: Πυριμιδίνες Πουρίνες Προέρχονται από τον εξαμελή δακτύλιο της πυριμιδίνης Παράγωγα της πουρίνης και περιέχουν έναν δεύτερο πενταμελή δακτύλιο, ο οποίος είναι συμπυκνωμένος στον εξαμελή δακτύλιο

4 ΝΟΥΚΛΕΟΤΙΔΙΑ 1. Αζωτούχες βάσεις Πυριμιδίνες Ουρακίλη (U) Θυμίνη (T) Κυτοσίνη (C) Πουρίνες Αδενίνη (A) Γουανίνη (G)

5 ΝΟΥΚΛΕΟΤΙΔΙΑ 2. Φωσφορική ομάδα Η φωσφορική ομάδα συνήθως συνδέεται με το υδροξύλιο του πέμπτου ατόμου άνθρακα της πεντόζης Ο - Ο - Ρ Ο Ο C5 O C4 C1 C3 C2

6 ΝΟΥΚΛΕΟΤΙΔΙΑ 3. Πεντόζη H Χρησιμοποιείται στο Δεοξυριβονουκλεϊκό οξύ (DNA) OH Χρησιμοποιείται στο Ριβονουκλεϊκό οξύ (RNA)

7 ΝΟΥΚΛΕΟΤΙΔΙΑ Νουκλεοζίδια ή Νουκλεοζίτες: Ενώσεις αποτελούμενες από ένα σάκχαρο και μία αζωτούχο βάση, τα οποία συνδέονται μεταξύ τους με έναν Ν-γλυκοζιτικό δεσμό Πεντόζη Βάση Νουκλεοτίδια: Φωσφορικοί εστέρες των νουκλεοζιδίων Ρ Πεντόζη Βάση Η βάση συνδέεται στον πρώτο άνθρακα (C1) του πενταμελούς δακτυλίου του σακχάρου

8 Τα νουκλεϊκά οξέα είναι μακριά πολυμερή στα οποία τα νουκλεοτίδια ενώνονται μεταξύ τους ομοιοπολικά με ένα φωσφοδιεστερικό δεσμό. Ο τρόπος σύνδεσης των νουκλεοτιδίων προσδίδει στο νουκλεϊκό οξύ χημική πολικότητα. Συγκεκριμένα η 3 υδροξυλομάδα του ενός νουκλεοτιδίου συνδέεται με την 5 -φωσφορική ομάδα του επόμενου. Έτσι τα δύο άκρα κάθε κλώνου διαφέρουν καθώς το ένα φέρει μία ελεύθερη υδροξυλομάδα (3 άκρο) και το άλλο μία ελεύθερη φωσφορική ομάδα (5 άκρο). 5 άκρο 3 άκρο

9 Δομή DNA 3 Δύο αλυσίδες DNA οι οποίες έχουν αντίθετη πολικότητα και συγκρατούνται μεταξύ τους με δεσμούς Η. Οι δεσμοί αυτοί αναπτύσσονται σύμφωνα με τον κανόνα της συμπληρωματικότητας: 3 Η αδενίνη συνδέεται μόνο με θυμίνη (κι αντίστροφα) με δύο δεσμούς Η. Η κυτοσίνη συνδέεται μόνο με γουανίνη (κι αντίστροφα) με τρεις δεσμούς Η. 5 -Αδενίνη-Κυτοσίνη-Γουανίνη-Θυμίνη-3

10 Δομή DNA Εξωτερικά σχηματίζεται ένας 3 σκελετός εναλλασσόμενων μονάδων σακχάρου-φωσφορικής ομάδας-σακχάρου-φωσφορικής ομάδας Εσωτερικά βρίσκονται τα ζεύγη συμπληρωματικών βάσεων (Α-Τ, 3 C-G). 5 -Αδενίνη-Κυτοσίνη-Γουανίνη-Θυμίνη-3

11 Δομή DNA 3 Το πακετάρισμα των βάσεων γίνεται στην πιο ευνοϊκή (από ενεργειακής άποψης) διάταξη. Η διάταξη αυτή επιτρέπει στο σάκχαρο-φωσφορικό σκελετό να 3 διατηρεί ίση απόσταση κατά μήκος του μορίου DNA. 5 -Αδενίνη-Κυτοσίνη-Γουανίνη-Θυμίνη-3

12 Δομή DNA Rosalind Franklin: Χρήση της μεθόδου περίθλασης των ακτινών Χ για τη φωτογράφηση ινών DNA. Οι μελέτες της συνέβαλλαν σημαντικά στον καθορισμό της δομής του DNA καθώς αποτέλεσαν τη βάση για τη διατύπωση της υπόθεσης της διπλής έλικας του DNA από τους Watson και Crick. Οι εικόνες περίθλασης ακτίνων Χ της Rosalind Franklin επιβεβαίωσαν την ελικοειδή δομή του DNA

13 Δομή DNA Προτάθηκε το 1953 από τους James Watson και Francis Crick Μοντέλο της διπλής έλικας του DNA Το DNA παρομοιάστηκε με μία συστρεμμένη ανεμόσκαλα η οποία αποτελείται από δύο μακριές αλυσίδες που σχηματίζονται από εναλλασσόμενες μονάδες σακχάρου-φωσφορικής ομάδας. Οι αζωτούχες βάσεις λειτουργούν σαν «σκαλοπάτια» που ενώνουν τις δύο αλυσίδες.

14 Δομή DNA Μεγάλη Μείζων Οι δύο σάκχαρο-φωσφορικοί σκελετοί περιελίσσονται ο ένας γύρω από τον άλλο σχηματίζοντας μία δεξιόστροφη διπλή έλικα. Η περιστροφή του ενός κλώνου γύρω από τον άλλο δημιουργεί δύο αύλακες στη διπλή έλικα του DNA. H ευρύτερη ονομάζεται μεγάλη αύλακα κι η στενότερη, μικρή Μικρή αύλακα.

15 Δομή DNA To DNA έχει διαφορετικές στερεοδιατάξεις Βασική (Β-DNA): Δεξιόστροφη έλικα όπου σε κάθε στροφή περιλαμβάνονται περίπου 10 βάσεις. Α-DNA: Δεξιόστροφη έλικα όπου οι βάσεις παρουσιάζουν κλίση ως προς τον σκελετό κι έτσι σε κάθε στροφή περιλαμβάνονται περίπου 11 βάσεις. Ζ-DNA: Αντίστροφη κατεύθυνση περιέλιξης όπου ο σκελετός παίρνει τη μορφή ζιγκ ζαγκ. Α-DNA B-DNA Z-DNA

16 Δομή RNA 5 άκρο 3 άκρο Μονόκλωνο μόριο όπου τα νουκλεοτίδια ενώνονται μεταξύ τους ομοιοπολικά με ένα φωσφοδιεστερικό δεσμό. Όμοια με το DNA η 3 - υδροξυλομάδα του ενός νουκλεοτιδίου συνδέεται με την 5 -φωσφορική ομάδα του επόμενου, προσδίδοντας στο μόριο χημική πολικότητα.

17 Δομή RNA Το RNA μπορεί να έχει πολύπλοκες τρισδιάστατες δομές α Ένα μόριο RNA συχνά αναδιπλώνεται και σχηματίζει δίκλωνες περιοχές σε σημεία όπου υπάρχει συμπληρωματικότητα των βάσεων. β Φουρκέτα Οι συμπληρωματικές αλληλουχίες μπορεί να είναι : 1. Σε στενή γειτνίαση οπότε η ενδιάμεση μη γ Βρόγχος συμπληρωματική περιοχή προεξέχει από το δίκλωνο τμήμα του μορίου. σαν στεφάνι Θηλιά 2. Απομακρυσμένες οπότε δημιουργούνται πιο πολύπλοκες αναδιπλώσεις

18 Δομή RNA Το RNA μπορεί να έχει πολύπλοκες τεταρτοταγείς δομές Η μεγάλη ευελιξία του σκελετού του RNA, στις περιοχές όπου δεν εμφανίζει συμπληρωματικότητα, επιτρέπει στο μόριο να αναδιπλωθεί και να σχηματίσει τεταρτοταγείς δομές (π.χ. trna). Οι δομές αυτές περιλαμβάνουν μη συμβατικά ζεύγη βάσεων όπως για παράδειγμα το ζευγάρωμα U:A:U

19 Διαφορές DNA-RNA Δομή Σύσταση Λειτουργία Εντοπισμός DNA Δίκλωνο μόριο Α, Τ, C, G Δεοξυριβόζη Φορέας γενετικής πληροφορίας Πυρήνας/Μιτοχόνδριο/ Χλωροπλάστες Μονόκλωνο μόριο Α, U, C, G Ριβόζη RNA Συμμετοχή στην πρωτεϊνοσύνθεση Σε όλο το κύτταρο

20 ΛΕΙΤΟΥΡΓΙΑ Τα κληρονομικά χαρακτηριστικά κάθε ζωντανού οργανισμού καθορίζονται από το γονιδίωμα του, το οποίο αποτελείται από μία μακριά αλυσίδα νουκλεϊκού οξέος. Λειτουργικά το γονιδίωμα μπορεί να διαιρεθεί σε γονίδια. Κάθε γονίδιο είναι ένα τμήμα της αλληλουχίας ενός νουκλεϊκού οξέος που αντιπροσωπεύει μία πρωτεΐνη. DNA: Γενετικό υλικό βακτηρίων, ιών, ζωικών και φυτικών κυττάρων RNA: Γενετικό υλικό ορισμένων ιών

21 ΛΕΙΤΟΥΡΓΙΑ DNA Η δομή της διπλής έλικας του DNA επιτρέπει τη μεταφορά (υπό χημική μορφή) και την ακριβή αντιγραφή της γενετικής πληροφορίας, καθιστώντας το συγκεκριμένο μόριο ιδανικό φορέα των γενετικών πληροφοριών.

22 Πείραμα Ιογενές S-στέλεχος βακτηριών Μη ιογενές R- στέλεχος βακτηριών ΛΕΙΤΟΥΡΓΙΑ DNA Πείραμα Griffith Απενεργοποίηση με θέρμανση των ιογενών S βακτηριών Ανάμειξη των νεκρών S-βακτηριών και των ζωντανών μη ιογενών R- βακτηριών ΣΥΜΠΕΡΑΣΜΑ Μετασχηματισμός των ζωντανών κυττάρων από ένα χημικό συστατικό των νεκρών Θέρμανση: Μετουσίωση κι απενεργοποίηση των πρωτεϊνών Αποτέλεσμα 1 Θάνατος ποντικιών Αποτέλεσμα 2 Ζωντανά κύτταρα των S βακτηριών βρέθηκαν στην καρδιά Επιβίωση ποντικιών Δεν βρέθηκαν βακτηριακά κύτταρα στην καρδιά Επιβίωση ποντικιών Δεν βρέθηκαν βακτηριακά κύτταρα στην καρδιά Θάνατος ποντικιών Ζωντανά κύτταρα των S βακτηριών βρέθηκαν στην καρδιά Οι πρωτεΐνες δεν μπορεί να είναι ο παράγοντας μετασχηματισμού

23 ΛΕΙΤΟΥΡΓΙΑ DNA Επανάληψη του πειράματος Griffith από τους Avery, McCarty, and MacLeod για τον προσδιορισμό του παράγοντα μετασχηματισμού, ο οποίος είναι υπεύθυνος για τη μεταφορά των κληρονομικών πληροφοριών. Επιβεβαίωση ότι το DNA είναι το γενετικό υλικό Νεκρά S κύτταρα Λιπίδια Υδρογονάνθρακες Απομάκρυνση των λιπιδίων και των υδατανθράκων από το διάλυμα των νεκρών S-κυττάρων. Απομένουν οι πρωτεΐνες, το RNA και το DNA. Πρωτεϊνάση Όχι πρωτεΐνη Ριβονουκλεάση Όχι RNA Δεοξυριβο νουκλεάση Όχι DNA Προσθήκη ενζύμων για την απομάκρυνση πρωτεϊνών ή RNA ή DNA R κύτταρα R κύτταρα R κύτταρα Προσθήκη ζωντανών R κυττάρων. S κύτταρα Μετασχηματισμός Απουσία S κυττάρων Όχι Μετασχηματισμός Απουσία DNA δεν γίνεται ο μετασχηματισμός των κυττάρων άρα το DNA είναι το γενετικό υλικό

24 Ανίχνευση ραδιοενεργότητας 35S στο υλικό καλλιέργειας και 32S στο εσωτερικό των βακτηριακών κυττάρων ΣΥΜΠΕΡΑΣΜΑ: Καθώς οι ιοί πρέπει να εισάγουν το γενετικό τους υλικό στον ξενιστή προκειμένου να πολλαπλασιαστούν, το DNA είναι το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΑ DNA Παρόμοια πειράματα αποκάλυψαν ότι το DNA είναι το γενετικό υλικό των ευκαρυωτικών κυττάρων καθώς και πολλών ιών. Πρωτεϊνική κάψα σημασμένη με 35S Ιικό DNA σημασμένο με 32S Σήμανση βακτηριοφάγων Τ2 με ραδιενεργά ισότοπα Μόλυνση βακτηριακών κυττάρων με τους βακτηριοφάγους Απομάκρυνση της πρωτεϊνικής κάψας από τα βακτηριακά κύτταρα

25 ΛΕΙΤΟΥΡΓΙΑ RNA Μόριο με πολλαπλές δράσεις μέσα στο κύτταρο: Πολυπεπτίδιο Ριβόσωμα (rrna +πρωτεΐνες) MicroRNA (mirna) mrna Αναστολή μετάφρασης Μη σύνθεση πρωτεΐνης 1. Συμμετοχή στην πρωτεϊνόσυνθεση (mrna, trna, rrna ) 2. Ρύθμιση γονιδιακής έκφρασης (ncrnas) 3. Ενζυμική δράση Ριβοένζυμα (π.χ. Ριβόσωμα)

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής

ΚΕΦΑΛΑΙΟ 5. Διατήρηση και συνέχεια της ζωής ΚΕΑΛΑΙΟ 5 ιατήρηση και συνέχεια της ζωής 5.2 H ροή της γενετικής πληροφορίας 3 Πώς βρέθηκε η δομή του DNA στο χώρο; Η ανακάλυψη της δομής του DNA πραγματοποιήθηκε το 1953 από τους Watson και Crick. Από

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χηµεία. Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χηµεία Κεφάλαιο 29: Βιοµόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει µόνο άτοµα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα

Οργανική Χημεία. Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα Οργανική Χημεία Κεφάλαιο 29: Βιομόρια: ετεροκυκλικές ενώσεις και νουκλεϊκά οξέα 1. Γενικά-ιδιότητες Κυκλικές οργανικές ενώσεις: καρβοκυκλικές (δακτύλιος περιέχει μόνο άτομα C) και ετεροκυκλικές (δακτύλιος

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Οι δευτερογενείς µεταβολίτες

Οι δευτερογενείς µεταβολίτες Οι δευτερογενείς µεταβολίτες Είναιταπροϊόνταδευτερογενούςµεταβολισµού. Μερικοί γνωστοί δευτερογενείς µεταβολίτες είναι η µορφίνη, ήκαφεΐνη, το καουτσούκ κ.ά. Ο ρόλος τους φαίνεται να είναι οικολογικής

Διαβάστε περισσότερα

Οργά νωση Γενετικού Υλικού

Οργά νωση Γενετικού Υλικού Βιολογία Γ Γυμνασίου: Διατήρηση και Συνέχεια της Ζωής Οργά νωση Γενετικού Υλικού Γονίδιο: Η μονάδα της κληρονομικότητας. Ουσιαστικά είναι ένα κομμάτι από το DNA που αποθηκεύει πληροφορίες για κάποιο συγκεκριμένο

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. 2. Δομή νουκλεϊκών οξέων. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 2. Δομή νουκλεϊκών οξέων ΝΟΥΚΛΕΪΚΑ ΟΞΕΑ ΣΥΣΤΑΣΗ ΟΡΓΑΝΙΣΜΩΝ ΣΕ ΟΡΓΑΝΙΚΕΣ ΕΝΩΣΕΙΣ ΜΙΚΡΟΜΟΡΙΑ ΜΑΚΡΟΜΟΡΙΑ 1. Αμινοξέα πρωτεϊνες

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι:

Οι αζωτούχες βάσεις των νουκλεοτιδίων είναι: 1 ΑΣΚΗΣΕΙΣ ΝΟΥΚΛΕΙΚΩΝ ΟΞΕΩΝ ΑΣΚΗΣΗ 1 Ποια είναι η δομή των νουκλεοτιδίων; Τα νουκλεοτίδια προέρχονται από τη σύνδεση με ομοιοπολικό δεσμό, τριών διαφορετικών μορίων. Μιας πεντόζης (σάκχαρο με πέντε άτομα

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01%

ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός

Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Απομόνωση ανθρώπινου DNA γονιδιώματος & ποιοτικός και ποσοτικός προσδιορισμός Ευαγγελία - Ειρήνη Τσερμπίνι 1. Σκοπός Σκοπός της παρούσας άσκησης είναι η απομόνωση ανθρώπινου DNA γονιδιώματος από δείγμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΚΠΑΙΔΕΥΤΗΡΙΑ ΣΥΓΧΡΟΝΗ ΠΑΙΔΕΙΑ ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΠΙΜΕΛΕΙΑ:Ν.ΠΑΠΑΓΙΑΝΝΗΣ 2 Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ 3 1. Ποια είναι τα επίπεδα οργάνωσης της ζωής και ποια τα χημικά χαρακτηριστικά της; Στην

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

Φίλη μαθήτρια, φίλε μαθητή,

Φίλη μαθήτρια, φίλε μαθητή, Φίλη μαθήτρια, φίλε μαθητή, Το βιβλίο αυτό φιλοδοξεί να σε βοηθήσει στην κατανόηση των σύγχρονων δεδομένων της Μοριακής Βιολογίας και της Βιοτεχνολογίας, να αποτελέσει σύμμαχό σου στη μελέτη και να προκαλέσει

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Τύποι νουκλεϊκών οξέων

Τύποι νουκλεϊκών οξέων Τύποι νουκλεϊκών οξέων DNA ένας τύπος, μια λειτουργία RNA - 4 τύποι, 4 λειτουργίες Ριβοσωμικό RNA Αγγελιαφόρο RNA Μεταφορικό RNA Καταλυτικό RNA Βιοχημεία Ι Δ-1 Βιοχημεία Ι Δ-2 3 5 φωσφοδιεστερικός δεσμός

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ.-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Τοποθετείστε στο διάγραμμα που ακολουθεί, τους όρους: σύνθεση, υδρόλυση, μακρομόριο, μονομερή. Ερμηνεύστε το διάγραμμα. Η -Q-

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA

Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Δομή και χημεία Νουκλεοτιδίων και Νουκλεϊκών οξέων DNA/RNA Χρήστος Κρούπης, MSc, PhD Επίκουρος Καθηγητής Κλινικής Βιοχημείας Ιατρική Σχολή Πανεπιστημίου Αθηνών Αττικόν Πανεπιστημιακό Νοσοκομείο Lehninger

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ. Τα χημικά μόρια που οικοδομούν τους οργανισμούς ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ Τα χημικά μόρια που οικοδομούν τους οργανισμούς Μελέτη φαινομένου της ζωής o Η μελέτη του φαινομένου της ζωής ξεκινά από το μοριακό επίπεδο δηλαδή από τα χημικά μόρια που οικοδομούν

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ Β ΤΡΙΜΗΝΟΥ Γ 4 23.1.12 ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA ΣΕ RNA ΕΡΓΑΣΤΗΚΑΝ: ΑΛΕΞΑΝΔΡΟΣ ΔΕΛΗΜΙΧΑΛΗΣ ΑΡΤΕΜΗΣ ΑΝΑΣΤΑΣΙΑΔΗΣ 1 ΕΙΣΑΓΩΓΗ Το δεοξυριβονουκλεϊκό οξύ (Deoxyribonucleic acid -

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

Κεφάλαιο 4: Ανασυνδυασμένο DNA

Κεφάλαιο 4: Ανασυνδυασμένο DNA Κεφάλαιο 4: Ανασυνδυασμένο DNA 1. Η ανάπτυξη της γενετικής μηχανικής επέτρεψε: α. την κατανόηση των μηχανισμών αντιγραφής του γενετικού υλικού β. την απομόνωση των πλασμιδίων από τα βακτήρια γ. την πραγματοποίηση

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΣΗΜΕΙΩΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗ ΣΧΟΛΙΚΟ ΕΤΟΣ 2012-2013 Σελίδα 2 από 35 Ενότητα πρώτη Η χημεία της ζωής Ενότητα πρώτη Η χημεία της ζωής Α. Σύντομη παρουσίαση της θεωρίας Χαρακτηριστικά

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΧΟΛΙΟ: Τα θέματα είναι πολύ εύκολα και αναμένονται ιδιαίτερα υψηλές βαθμολογίες από τους σωστά προετοιμασμένους υποψηφίους. ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4.

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ

Επιβίωση ποντικών 1 ζωντανά βακτήρια S ΟΧΙ 2 ζωντανά βακτήρια R ΝΑΙ ένεση σε ποντικούς 3 βακτήρια S που προηγουμένως θανατώθηκαν με θέρμανση ΝΑΙ 1. ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DA είναι το γενετικό υλικό Να περιγράψετε το πείραμα του Griffith Ο Griffith ασχολήθηκε με δύο στελέχη 1 του πνευμονόκοκκου (του βακτηρίου 2 Diplococcus pneumoniae) που είχαν τις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Β1. Β2. ΘΕΜΑ 2ο 1. 2.

Β1. Β2. ΘΕΜΑ 2ο 1. 2. 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 20 ΣΕΠΤΕΜΒΡΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: BΙΟΛΟΓΙΑ (ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο Α1.

Διαβάστε περισσότερα

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5 Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις διαγωνίσματος στο Κεφάλαιο 4 ο ΘΕΜΑ Α Α1. β Α2. β Α3. γ Α4. β Α5. β ΘΕΜΑ B B1. Ο κλώνος είναι μια ομάδα πανομοιότυπων μορίων, κυττάρων, ή οργανισμών. B2. Η υβριδοποίηση

Διαβάστε περισσότερα

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό

ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ. Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό ΙΣΤΟΡΙΚΑ ΠΕΙΡΑΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ Τα πειράματα που οδήγησαν στο συμπέρασμα ότι το DNA είναι το γενετικό υλικό Πείραμα Griffith (1928) o O Griffith ήταν Βρετανός βακτηριολόγος του οποίου το ερευνητικό ενδιαφέρον

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ

Γενική Μικροβιολογία. Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Γενική Μικροβιολογία Ενότητα 12 η ΕΙΣΑΓΩΓΗ ΣΤΗΝ ΙΟΛΟΓΙΑ Όνομα καθηγητή: Δ. ΓΕΩΡΓΑΚΟΠΟΥΛΟΣ Όνομα καθηγητή: Γ. ΖΕΡΒΑΚΗΣ Όνομα καθηγητή: ΑΝ. ΤΑΜΠΑΚΑΚΗ Τμήμα: ΕΠΙΣΤΗΜΗΣ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΣΤΟΧΟΙ ΤΟΥ ΜΑΘΗΜΑΤΟΣ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης Το γενετικό υλικό κεφάλαιο Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης To DNA είναι το γενετικό υλικό Η απάντηση δόθηκε το 1944, όταν οι Avery, Mac-Leod και

Διαβάστε περισσότερα