Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:





3 Η μεταπτυχιακή διατριβή εκπονήθηκε στο εργαστήριο Μοριακής Βιολογίας του τμήματος Βιολογίας του Πανεπιστημίου Πατρών και υπό την επίβλεψη του καθηγητή κ.κωνσταντίνου Φλυτζάνη. Θα ήθελα να ευχαριστήσω θερμά τον επιβλέποντα καθηγητή μου κ. Κωνσταντίνο Φλυτζάνη του οποίου ο ρόλος στην εκπόνηση αυτής της εργασίας αλλά και γενικότερα στην διαμόρφωση της ακαδημαϊκής μου καλλιέργειας ήταν καθοριστικός και η προσφορά του ανεκτίμητη. Κυρίως, τον ευχαριστώ για την κατανόηση που έδειξε σε όλες τις δυσκολίες μου, την ένθερμη συμπαράστασή του, αλλά και τη παροιμιώδη αισιοδοξία με την οποία αντιμετώπιζε τα προβλήματα του εργαστηρίου γεγονός που με καταστούσε πάντα ικανή να συνεχίζω. Τέλος θα ήθελα να ευχαριστήσω όλους τους καθηγητές του μεταπτυχιακού προγράμματος που συνέβαλλαν στην οικοδόμηση του απαιτούμενου θεωρητικού υπόβαθρου των σπουδών μου, αλλά και όλα τα παιδιά του εργαστηρίου που με τη φιλική τους διάθεση, την προθυμία και τη διάθεσή τους για συνεργασία διευκόλυναν την έρευνά μου. Ειδικά θα ήθελα να αναφέρω τις προπτυχιακές φοιτήτριες Κωνσταντίνα Κουμή και Αικατερίνη Νταή με τις οποίες και σε συνεργασία καταφέραμε να περατώσουμε κάποια πολύ σημαντικά τμήματα της ερευνητικής μας εργασίας. Επιδεικνύοντας ανάλογο ζήλο κατάφερναν συστηματικά να ενισχύουν τη διάθεσή μου και τελικά να βοηθούν στην ουσιαστική πρόοδο των αναζητήσεών μου.


5 Σε αυτούς που είναι πάντα δίπλα μου

6 ΠΕΡΙΕΧΟΜΕΝΑ Α. ΕΙΣΑΓΩΓΗ Α1.Υποδοχείς και μεταγραφικοί παράγοντες Α1.1. Ο υποδοχέας σα ζωτικό στοιχείο της επικοινωνίας του κυττάρου.σελ.7-10 Α1.2. Ευκαρυωτικοί οργανισμοί και μεταγραφή..σελ Α1.3 Ευκαρυωτικοί οργανισμοί και μετάφραση... σελ Α1.4. Υπεροικογένεια των υποδοχέων των στεροειδών θυρεοειδών ορμονών.σελ Α1.5. Η υποοικογένεια των COUP υποδοχέων.. σελ Α Τα στοιχεία απόκρισης των υποδοχέων...σελ Α Μοριακοί μηχανισμοί δράσης των COUP-TFs σελ Α1.6. Ο φυσιολογικός ρόλος των COUP-TFs... σελ Α2.Εχινόδερμα και ο ρόλος του COUP-TF. σελ Α2.1. Εισαγωγή στα εχινοειδή. σελ Α2.2. Η εμβρυϊκή ανάπτυξη του αχινού... σελ Α2.3. Ο αχινός ως πειραματικό υλικό... σελ.37 Α2.4. Sp.COUP-TF... σελ Α3. COUP-TF και άλλοι οργανισμοί.. Α3.1. COUP-TF και M.musculus σελ Α3.2. COUP-TF και D.rerio..σελ Α3.3. COUP-TF και D.melanogaster σελ.48-49

7 Α4. Ρύθμιση του COUP-TF. Α4.1. Ρύθμιση από την οικογένεια των Ets παραγόντων.σελ.50 Α4.2. Ρύθμιση από το sonic hedgehog σελ.50 Α4.3. Ρύθμιση από τα ρετινοειδή. σελ A5. Carboxyl Terminal Extention (CTE) της DBD - σύγχρονες προεκτάσεις σελ Α6. Οργανισμοί και οργανικά εκχυλίσματα ως πειραματικό υλικό Α6.1. Το βακτήριο E.coli και ο ρόλος του ως πειραματικό υλικό..σελ Α6.2. Συστήματα ελεύθερα-κυττάρων..σελ Α7. Αρχές λειτουργίας μηχανημάτων ανάλυσης. Α7.1. Μικροσκόπιο φθορισμού σελ Α7.2. Συνεστιακό μικροσκόπιο.σελ Α7.3. PHOSPHORIMAGER σελ Α8. Σκοπός της διατριβής..σελ.62 Β. Υλικά και μέθοδοι B1. IN VITRO προσέγγιση. Β1.1. Συλλογή αχινών...σελ.63 Β1.2 Πρόκληση ωορρηξίας σε αχινό P.lividus... σελ Β1.3. Απομόνωση ολικού RNA από αχινό P.lividus με τη μέθοδο Holmes- Bonner...σελ Β1.4. Σχεδιασμός primers για ολόκληρη την κωδική περιοχή του Pl COUP-TF...

8 ... σελ Β1.5. RT-PCR με το πλήρες σύστημα αντιδραστηρίων One step RT-PCR (Qiagen) σε συνθήκες κλιμακούμενης θερμοκρασίας (gradient RT-PCR)...σελ Β1.6. Έλεγχος των αποτελεσμάτων της RT-PCR με ηλεκτροφόρηση των προϊόντων σε πήκτωμα αγαρόζης... σελ Β1.7. Καθαρισμός των προϊόντων με το QIAquick PCR Purification Kit σελ Β1.8. Αντίδραση λιγάσης... σελ Β1.9. Μετασχηματισμός βακτηριακών κυττάρων με πλασμιδιακό DNA σελ Β1.10. Στερεή καλλιέργεια βακτηρίων E.coli... σελ.75 Β1.11. Διαλογή μετασχηματισμένων βακτηρίων και ανακαλλιέργεια τους σε υγρό θρεπτικό υλικό... σελ.75 Β1.12. Απομόνωση πλασμιδιακού DNA... B1.12α) μικρής κλίμακας απομόνωση (mini prep)... σελ Β1.12β) μεγάλης κλίμακας απομόνωση (midi prep)... σελ Β1.13.Ποσοτικός και ποιοτικός προσδιορισμός του πλασμιδιακού DNA σελ Β1.14. Πέψη με ενδονουκλεάσες περιορισμού και ανάλυση των αποτελεσμάτων σε πήκτωμα αγαρόζης... σελ Β1.15. Νουκλεοτιδική ανάλυση των διαφόρων κλώνων(sequencing) σελ.83 Β1.16. Αποθήκευση κλώνων για μακροπρόθεσμη χρήση... σελ.83 Β1.17. Καθαρισμός DNA(phenol extraction)...σελ Β1.18. In vitro μεταγραφή με το πλήρες σύστημα μεταγραφής mmessage mmachine Large Scale In Vitro Transcription Kits for Synthesis of Capped RNAs (Ambion)... σελ Β1.19. In vitro μεταγραφή με τη χρήση της Τ7 RNA πολυμεράσης (NEBiolabs, TAKARA)... σελ Β1.20. Ανάλυση των RNA-προϊόντων σε πήκτωμα αγαρόζης(rna-gel) σελ.88-90

9 Β1.21. Καθαρισμός των RNA-products B1.22α) phenol extraction... σελ.90 Β1.22β) με κολωνίτσες από Sephadex (G50)... σελ Β1.22. Ποσοτικός και ποιοτικός προσδιορισμός των in vitro παραγόμενων RNAs σελ Β1.23. In vitro σύνθεση πρωτεϊνών Β1.23α) Retic Lysate IVT Untreated Retic Lysate kit (ραδιενεργών και μη) σελ Β1.23β) Wheat Germ IVT kit...σελ Β1.24. Ανάλυση των ραδιενεργά σημασμένων πρωτεϊνών με ηλεκτροφόρηση πολυακρυλαμιδίου (PAGE)... σελ.95 Β1.24α) Ηλεκτροφόρηση με αποδιατακτικούς παράγοντες (SDS-PAGE)......σελ Β1.24β)Αυτοραδιογραφία σελ Β1.25.Western ανάλυση......σελ.99 Β1.25α) SDS-page ηλεκτροφόρηση... σελ Β1.25β) μεταφορά πρωτεϊνών σε μεμβράνη νιτροκυτταρίνης(pvdf) σελ Β1.25γ) Σχεδιασμός, επιλογή και παραγωγή κατάλληλων αντισωμάτων σελ Β1.25δ) ανοσοτύπωμα( immunoblot)... σελ Β1.26. EMSA (Electrophoretic Mobility Shift Assay)...σελ Β1.26α) Υβριδοποίηση μονόκλωνων τμημάτων του στοιχείου απόκρισης......σελ Β1.26β) Αντίδραση κινάσης- Σήμανση με 32 P-γ-ΑΤΡ... σελ Β1.26γ) Αντιδράσεις πρωτεϊνών-ραδιενεργά σημασμένων στοιχείων απόκρισης....σελ Β1.26δ) Ηλεκτροφόρηση πολυακρυλαμιδίου (μη αποδιατακτικό gel)....σελ Β1.26ε) Αυτοραδιογραφία σελ.115 Β1.26στ). Ανάλυση με phosphorimager σελ

10 Β1.27. PCR- δημιουργία ελλειματικών κλώνων....σελ Β1.28. Πέψεις με ένζυμα περιορισμού και αποθήκευση των επιλεγμένων μικρών- μεγάλων ελλειμματικών κλώνων σελ B2. IN VITRO- IN VIVO πειραματικές διαδικασίες... Β2.1. Καλλιέργεια εμβρύων αχινού P.lividus και S. granularis... B2.1α) Πρόκληση εκσπερμάτωσης και ωορηξίας.... σελ.119 Β2.1β) Γονιμοποίηση σελ Β2.1γ) Συλλογή και καθαρισμός εμβρύων διαφόρων αναπτυξιακών σταδίων σελ.121 Β2.1δ) Απομόνωση κυτταροπλασματικών πρωτεϊνών από ωάρια και έμβρυα των αχινών P.lividus και S.granularis σελ.121 Β2.2. Western ανάλυση των κυτταροπλασματικών πρωτεϊνών... σελ Β2.3. Έλεγχος της ποιότητας της απομόνωσης αλλά και του ποσοστού μεταφοράς των πρωτεϊνών σε μεμβράνη βαφή πηκτώματος με Coommasie..... σελ.122 Β2.4. Ανοσοκατακρήμνιση (με χρήση UltraLink Immobilazed Protein A/G) σελ B3. IN VIVO προσέγγιση... Β3.1. Μονιμοποίηση εμβρύων σελ.124 Β3.2.Whole Mount Immunofluorescence..... σελ Β3.3. Ενέσεις σε έμβρυα αχινών σελ Β3.4. Παρατήρηση εμβρύων σε μικροσκόπιο φθορισμού και συνεστιακό μικροσκόπιο......σελ.129 Β3.5. Λογισμικά πακέτα ανάλυσης DNA και πρωτεϊνικών αλληλουχιών.. σελ

11 Γ. Αποτελέσματα.. Γ1. Ανάλυση του προτύπου έκφρασης του PlCOUP-TF σελ Γ2. Κλωνοποίηση ολόκληρης της κωδικής περιοχής του PlCOUP-TF... σελ Γ3. Αποκάλυψη της πλήρους νουκλεοτιδικής αλληλουχίας των δύο ισομορφών του COUP-TF σελ Γ4. In vitro μεταγραφή των δύο κλώνων σελ Γ5. In vitro σύνθεση των δύο πρωτεϊνών σελ Γ6. Παραγωγή ειδικού αντισώματος έναντι του ενθέματος στη καρβοξυτελική επέκταση της περιοχής πρόσδεσης του DNA της μεγάλης ισομορφής του COUP- TF σελ Γ7. Οι in vitro συντιθέμενες πρωτεΐνες διαφοροποιούνται αναφορικά με το πρότυπο πρόσδεσης τους σε COUP-στοιχεία. Η μικρή ισομορφή δένει στο DNA ειδικά και με έναν COUP-element εξαρτώμενο τρόπο, όχι όμως και η μεγάλη ισομορφή σελ Γ8. Η μικρή COUP-TF ισομορφή μπορεί να δένει σε ευθείες και παλινδρομικές επαναλήψεις των GGTCA μοτίβων με διάφορες αποστάσεις όχι όμως και η μεγάλη......σελ Γ9. Η μικρή COUP-TF ισομορφή εμφανίζει δέσιμο και στο στοιχείο 432 της 5 UTR περιοχής του ίδιου του COUP-TF σελ.158

12 Γ10. Η μεγάλη πρωτεΐνη φαίνεται όχι απλά να μην προσδένει στο DNA αλλά να παρεμποδίζει και τη πρόσδεση της μικρής πρωτεΐνης όταν ετεροδιμεριστεί με αυτήν σελ Γ11. Οι δύο COUP-TF ισομορφές εναποτίθονται στο αυγό σαν μητρικές πρωτεΐνες......σελ Γ12.Αναζήτηση της ενδοκυτταρικής θέσης της μεγάλης πρωτεΐνης και σύγκρισής της με το ήδη γνωστό πρότυπο της μικρής στον S.purpuratus σελ Γ13. Μελέτη του ρόλου των δύο πρωτεϊνών κατά την ανάπτυξη μετά από υπερέκφραση των δύο πρωτεϊνών σε έμβρυα P.lividus σελ Δ. ΣΥΖΗΤΗΣΗ.. Δ1. Απομόνωση και χαρακτηρισμός των δύο c-dnas ισομορφών του γονιδίου PlCOUP- TF σελ Δ2. In vitro σύνθεση των δύο πρωτεϊνών σελ Δ3. Τα ιδιαίτερα χαρακτηριστικά πρόσδεσης των δύο πρωτεϊνών στο DNA σελ Δ4. Οι δύο PlCOUP-TF ισομορφές αποθηκεύονται στο αυγό σα μητρικές πρωτεΐνες......σελ Δ5. Ενδοκυτταρική κατανομή της μεγάλης ισομορφής του PlCOUP-TF στα κύτταρα εμβρύων αχινών......σελ

13 Δ6. Μελέτη των επιδράσεων από την υπερέκφραση των δύο PlCOUP-TF ισομορφών στην ανάπτυξη του αχινού σελ Ε. ΒΙΒΛΙΟΓΡΑΦΙΑ σελ ΣΤ. ΠΑΡΑΡΤΗΜΑ..σελ

14 Α1.Υποδοχείς και μεταγραφικοί παράγοντες Α1.1. Ο υποδοχέας σα ζωτικό στοιχείο της επικοινωνίας του κυττάρου Σημαντικό στοιχείο των κυτταρικών αλληλεπιδράσεων είναι η κυτταρική επικοινωνία. Αυτή επηρεάζει όλες σχεδόν τις δραστηριότητες του κυττάρου, γι αυτό και η μελέτη της είναι σημαντική. Με τον όρο κυτταρική επικοινωνία εννοούμε το σύνολο των ερεθισμάτων (μηνυματοφόρων μορίων πληροφοριών) που δέχεται ένα κύτταρο από το περιβάλλον και την κατάλληλη απόκριση του κυττάρου στα εξωγενή μηνύματα. Το ερέθισμα που δέχεται ένα κύτταρο μπορεί να ναι από άλλο κύτταρο που βρίσκεται σε μεγάλη απόσταση. Μπορεί όμως το ερέθισμα να είναι ένα μηνυματοφόρο μόριο που προέρχεται από ένα γειτονικό κύτταρο, από το ίδιο το κύτταρο ή ακόμη να προέρχεται από μη κυτταρική επιφάνεια (βασικό έλασμα). Για να αντιδράσει το κύτταρο σ ένα μηνυματοφόρο μόριο, θα πρέπει οπωσδήποτε να έχει τον κατάλληλο υποδοχέα γι αυτό το μόριο. Επειδή όμως ένα κύτταρο παράγει περιορισμένο αριθμό υποδοχέων, είναι προφανές ότι αντιδρά και σε περιορισμένο αριθμό ερεθισμάτων. Παρόλα αυτά τα ερεθίσματα που δέχεται ένα κύτταρο είναι επαρκή για τον έλεγχο της συμπεριφοράς του, μια διαδικασία αρκετά πολύπλοκη. Θα πρέπει να σημειωθεί ότι : (α) ένα μηνυματοφόρο μόριο μπορεί να προκαλεί ποικίλες διεργασίες σε διαφορετικά κύτταρα, με αποτέλεσμα το ίδιο μηνυματοφόρο μόριο να προκαλεί διαφορετικές αποκρίσεις των κυττάρων. (β) Παρότι ο αριθμός των υποδοχέων είναι περιορισμένος, το κύτταρο αντιδρά σα να δεχόταν πολλαπλάσια σήματα γιατί το ενδοκυτταρικό σύστημα επικοινωνίας αλληλεπιδρά έτσι ώστε η παρουσία ενός σήματος να τροποποιεί την απόκριση ενός άλλου σήματος κ.ο.κ. Πρόκειται συνεπώς για αλυσιδωτές αντιδράσεις. ένας συνδυασμός σημάτων επιτρέπει στο κύτταρο να επιβιώνει, άλλος να διαφοροποιείται, άλλος να διαιρείται. Τα μηνυματοφόρα μόρια διακρίνονται : i Στα εξωγενή μόρια, που δεσμεύονται σε υποδοχείς της κυτταρικής επιφάνειας. i Στα εξωγενή μόρια που διαχέονται διαμέσου της πλασματικής μεμβράνης. i Στα μόρια της πλασματικής μεμβράνης που ενεργοποιούνται με την επαφή τους με άλλες κυτταρικές ή όχι επιφάνειες.

15 Εισαγωγή Ανάμεσα στις αποκρίσεις των κυττάρων στα μηνυματοφόρα μόρια διακρίνουμε : i ενεργοποίηση ενζύμων i αλλαγή κυτταροσκελετού i αλλαγή διαπερατότητας ιόντων i ενεργοποίηση σύνθεσης DNA i ενεργοποίησης σύνθεσης RNA Αναφορικά με τη ρύθμιση συγκεκριμένων γονιδίων, η μεταγωγή σήματος είναι ικανή να επηρεάζει το επίπεδο το DNA (μεθυλίωση, γονιδιακή επέκταση, αναδιάταξη), το μεταγραφικό επίπεδο (ωρίμανση σταθεροποίηση mrna), το μεταφραστικό αλλά και μετα-μεταφραστικό επίπεδο. Τα μηνυματοφόρα μόρια διακρίνονται επίσης σε ορμόνες, νευροδιαβιβαστές και τοπικούς μεσολαβητές (local mediators). 1. Ορμόνες : μηνυματοφόρα μόρια που εκκρίνονται κατευθείαν στο κυκλοφορικό σύστημα από εξειδικευμένα κύτταρα (ενδοκρινή). Με βάση τη χημική σύστασή τους διακρίνονται σε πρωτεϊνικές 80% των ορμονών στα σπονδυλωτά -, στεροειδείς που συνθέτονται από το λείο ενδοπλασματικό δίκτυο από την χοληστερίνη και παράγωγα αμινοξέων παράγωγα τυροσίνης. 2. Νευροδιαβιβαστές : απελευθερώνονται από εξειδικευμένες περιοχές των νευρικών κυττάρων, τις συνάφες, και διαχέονται σε μικρή απόσταση μέχρι κύτταρο στόχο. Σχήμα1 Διέγερση των κυττάρων-αυτοκρινής, ενδοκρινής, παρακρινής διέγερση 3. Τοπικοί μεσολαβητές : παράγονται από διάφορα κύτταρα, ελευθερώνονται στον εξωκυτταρικό χώρο και δρουν στα γειτονικά κύτταρα, αλλά και στο ίδιο κύτταρο (παρακρινής αυτοκρινής διέγερση αντίστοιχα, σχήμα1). Στην κατηγορία αυτή ανήκουν αυξητικοί παράγοντες (ρύθμιση αύξησης και διαίρεσης) και οι λεμφοκίνες 8

16 Εισαγωγή (έλεγχος ανάπτυξης και συμπεριφοράς κυττάρων) καθώς και παράγωγα αμινοξέων και λιπαρών οξέων. Επικοινωνία μέσω υποδοχέων Τα περισσότερα μηνυματοφόρα μόρια είναι υδρόφιλα και δρουν αφού δεσμευτούν σε υποδοχείς της πλασματικής μεμβράνης. Μετά τη δέσμευση δεν εισέρχονται στα κύτταρα, ενώ εκείνο που μεταφέρεται είναι η πληροφορία. Η μεταγωγή της πληροφορίας είναι μια πολύπλοκη διαδικασία στην οποία συμμετέχουν πολλές διακριτές πρωτεΐνες κάθε μια από τις οποίες αλλάζει τη στερεοδιαμόρφωση της γειτονικής της (μεταγωγή πληροφορίας). Οι υποδοχείς διακρίνονται σε αυτούς που συνδέονται με G-πρωτεΐνες, σε αυτούς που συνδέονται με κινάσες τυροσίνης και τέλος σ αυτούς που δημιουργούν ιοντικούς διαύλους.(σχήμα2) Σχήμα 2. Τύποι μεμβρανικών υποδοχέων Επικοινωνία με μόρια που διαπερνούν την πλασματική μεμβράνη Όλο και περισσότερα βιολογικώς ενεργά μόρια διαπιστώνονται να περνούν τη πλασματική μεμβράνη και να δρουν στο DNA ή ως επαγωγείς δεύτερων μηνυμάτων. Ιδιαίτερο ενδιαφέρον παρουσιάζουν οι στεροειδείς ορμόνες και το μονοξείδιο του αζώτου (NO). Στεροειδές ορμόνες. 9

17 Εισαγωγή Οι στεροειδείς ορμόνες, αλλά και οι θυρεοειδείς, τα ρετινοειδή και η βιταμίνη D, διαπερνούν τη πλασματική μεμβράνη. Αδιάλυτες στο νερό, κυκλοφορούν στα υγρά του σώματος δεσμευμένες σε ειδικές πρωτεϊνες μεταφορείς. Μετά την αναγνώριση των κυττάρων στόχων, οι στεροειδείς ορμόνες απελευθερώνονται από την πρωτεϊνη μεταφορέα και εισέρχονται στο κύτταρο, όπου και δεσμεύονται στον υποδοχέα τους, είτε στο κυτταρόπλασμα, είτε στον πυρήνα, με ταυτόχρονη αλλαγή της διαμόρφωσής τους. Το γεγονός αυτό ενεργοποιεί τον υποδοχέα, ο οποίος δρώντας ως μεταγραφικός παράγοντας, δεσμεύεται στην ή στις ρυθμιστικές αλληλουχίες του DNA γονιδίων στόχων όπου διεγείρει ή καταστέλλει τη μεταγραφή τους. NO : σημαντικό ενδοκυτταρικό σήμα, πολλοί πιστεύουν ότι είναι ο σπουδαιότερος παράγοντας καθορισμού της αρτηριακής πίεσης στον άνθρωπο (Μαρμάρας,Β.Κ 4 η εκδ). Α1.2. Ευκαρυωτικοί οργανισμοί και μεταγραφή Το πρώτο βήμα της έκφρασης των γονιδίων είναι η μεταγραφή. Δηλαδή, η διαδικασία εκείνη με την οποία από ένα συγκεκριμένο τμήμα DNA συντίθεται ενζυμικά ένα μόριο RNA. Η διεργασία της μεταγραφής χαρακτηρίζεται από την ακρίβεια του σημείου έναρξης και λήξης της, καθώς και από τη μεγάλη ποσότητα του παραγόμενου μορίου. Τα υπεύθυνα για τη μεταγραφή του DNA σε προκαρυωτικά και ευκαρυωτικά κύτταρα ένζυμα καλούνται RNA πολυμεράσες. Τα ευκαρυωτικά κύτταρα διαθέτουν τρεις διαφορετικές πολυμεράσες στον πυρήνα που χαρακτηρίζονται με τα σύμβολα I, II, III. Αυτές είναι αρκετά πολύπλοκα μόρια που συγκροτούνται από δύο μεγάλες και μικρότερες υπομονάδες. Οι τρεις από τις υπομονάδες είναι κοινές και για τις 3 πολυμεράσες. Η μεταγραφή του γονιδιώματος των ευκαρυωτικών κυττάρων γίνεται κυρίως από την RNA πολυμεράση ΙΙ (απαντά στο πυρηνόπλασμα και είναι πολύ ευαίσθητη στην α-αμανιτίνη). Η έναρξη, όμως, της μεταγραφής απαιτεί και βοηθητικούς παράγοντες (που σε αντίθεση με τα βακτήρια, παράγοντας σ) δεν είναι συνδεδεμένοι με τη πολυμεράση. Οι παράγοντες αυτοί έναρξης είναι εξειδικευμένες πρωτεϊνες, γνωστές ως μεταγραφικοί παράγοντες. Υπεύθυνοι κυρίως για την αναγνώριση του υποκινητή, μπορούν ν αναγνωρίζουν ειδικές αλληλουχίες ανοδικά ή καθοδικά του σημείου έναρξης της μεταγραφής, να ενεργοποιούνται χρόνο ή ιστό ειδικά κ.α. Αυτοί μαζί 10

18 Εισαγωγή με την RNA πολυμεράση συνιστούν τη βασική μεταγραφική μηχανή (σχήμα3) και σχηματίζουν σύμπλοκο γύρω από το σημείο έναρξης. Οι μεταγραφικοί παράγοντες διακρίνονται σε δύο τύπους (α) στους γενικούς, που συμμετέχουν στη μεταγραφή όλων των υποκινητών της RNA πολυμεράσης ΙΙ και (β) στους μεταγραφικούς παράγοντες που δεσμεύονται σε αλληλουχίες του DNA που ελέγχουν την έκφραση συγκεκριμένων γονιδίων και επομένως είναι υπεύθυνοι για τη ρύθμιση της έκφρασης των γονιδίων. Σχήμα3 Το γράφημα παριστάνει τη μεταγραφική μηχανή σαν καρδιά που δένει στο TATA-box ανοδικά του υποκινητή του γονιδίου ενεργοποιώντας το γονίδιο. Κάθε έγχρωμη σταγόνα αντικατοπτρίζει ένα σύμπλοκο πρωτεϊνών που λειτουργούν συνεργατικά για τη μεταγραφή του γονιδίου σε αγγελιαφόρο RNA(mRNA). Scientific American image Η σύνθεση του RNA αρχίζει με την αναγνώριση και την πρόσδεση της RNA πολυμεράσης στο επιλεγμένο σημείο του DNA. Ακολουθεί η επιμήκυνση και η λήξη της σύνθεσης του RNA και η απελευθέρωσή του από το DNA. Η γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής πραγματοποιείται ποικιλοτρόπως και ελέγχεται από διάφορες περιοχές του γονιδίου. Οι βασικές αρχές της ρύθμισης είναι ίδιες με αυτές στα προκαρυωτικά κύτταρα. Έτσι εντοπίζουμε την ορμονική ρύθμιση και τους γονιδιακούς υποκινητές και ενισχυτές. Βεβαίως στα ευκαρυωτικά κύτταρα υπάρχουν και άλλα επίπεδα ρύθμισης, όπως η συσπείρωση της χρωματίνης και η μεθυλίωσή της. 11

19 Εισαγωγή Αναλυτικότερα iορμονική ρύθμιση : Οι ορμόνες μεταφέρονται στα κύτταρα στόχους, όπου δρουν ως παράγοντες μεταγραφής (προσδεδεμένες σε ειδικούς υποδοχείς). Αλληλεπιδρούν με υποκινητές συγκεκριμένων γονιδίων και ρυθμίζουν τη μεταγραφή τους. i Γονιδιακοί υποκινητές : Υποκινητής. Περιοχή του DNA που εμπλέκεται στην πρόσδεση της RNA πολυμεράσης. Μερικά ευκαριωτικά γονίδια φέρουν περισσότερους του ενός υποκινητές που δρουν σε διαφορετικούς τύπους κυττάρων (οπότε δημιουργούνται διαφορετικά pre-mrnas με την ίδια κωδική περιοχή). i Γονιδιακοί ενισχυτές : Αλληλουχίες που διαπιστώθηκαν από τους Walter και Schaffner (1981) και οι οποίες αν και βρίσκονται μακριά από το σημείο έναρξης της μεταγραφής (>10 Kb) ρυθμίζουν την έκφραση των περισσοτέρων γονιδίων. Λειτουργούν δεσμεύοντας μεταγραφικούς παράγοντες και μπορεί να βρίσκονται ανοδικά (upstream) της θέσης έναρξης συνήθως ή καθοδικά σπανιότερα ή ακόμη και μέσα στο γονίδιο. Στην περίπτωση που η απόσταση που τους χωρίζει (με την πολυμεράση) είναι μεγάλη, γίνεται καμπύλωση του παρεμβαλλόμενου DNA. Οι ενισχυτές συμμετέχουν στη ρύθμιση της έκφρασης των γονιδίων κατά την ανάπτυξη και τη διαφοροποίηση καθώς και σε απόκριση ορμονών και αυξητικών παραγόντων Ενεργοποιητές Καταστολείς μεταγραφής Οι πρώτοι είναι μεταγραφικοί παράγοντες που δεσμεύονται στις ρυθμιστικές αλληλουχίες του DNA και διεγείρουν τη μεταγραφή (μέσω αλληλοεπίδρασης με άλλες πρωτεϊνες). Οι δεύτεροι είναι ρυθμιστικές πρωτεϊνες που παρεμποδίζουν με τη δέσμευσή τους τη μεταγραφή. Ορισμένοι δεσμεύονται σε ειδικές αλληλουχίες του υποκινητή και εμποδίζουν συγκρότηση συμπλόκου έναρξης μεταγραφής, ενώ άλλοι εμποδίζουν τη δέσμευση ή λειτουργία απαραίτητων ενεργοποιητών (Lewin, GENES VII). Α1.3 Ευκαρυωτικοί οργανισμοί και μετάφραση Η γενετική πληροφορία μεταφέρεται από τα γονίδια στα mrna μέσω της μεταγραφής και ακολούθως από τα mrna στις πρωτεΐνες μέσω της μετάφρασης. 12

20 Εισαγωγή Οι πρωτεΐνες αποτελούν τα κυρίαρχα μακρομόρια των κυττάρων. Η μετάφραση αποτελεί ποσοτικά την κύρια λειτουργία του κυττάρου και περίπου το 90% της χημικής ενέργειας του κυττάρου (ATP) καταναλώνεται για τη σύνθεση των πρωτεϊνών. Οι θέσεις παραγωγής των πρωτεϊνών είναι τα ριβοσώματα που αποτελούνται από δύο υπομονάδες. Στους ευκαρυωτικούς οργανισμούς τα ριβοσώματα εμφανίζουν δομή παρόμοια με αυτή των προκαρυωτικών με τη μεγάλη όμως υπομονάδα να περιλαμβάνει τρία ριβοσωματικά RNAs (28S, 18S και 5S). Τα t-rnas είναι μικρά μόρια [74-95 νουκλεοτίδια]. Το 3 άκρο τους καταλήγει σε μονόκλωνη αλυσίδα (NCCA) που αποτελεί θέση πρόσδεσης των αμινοξέων. Κάθε αμινοξύ προσδένεται στο αντίστοιχο t-rna με ομοιοπολικό δεσμό μεταξύ της καρβοξυλομάδας του αμινοξέως και του 2 OH ή 3 ΟΗ του νουκλεοτιδίου της αδενίνης σχηματίζοντας έτσι το αμινοάκυλο~ trna. Στη δευτεροταγή τους δομή τα t-rnas διαθέτουν 4 σταθερές δίκλωνες περιοχές (βραχίονες), ένα μεταβλητό βραχίονα και τρεις σταθερές μονόκλωνες περιοχές (θηλιές). Η δεύτερη θηλιά από το 5 άκρο είναι υπεύθυνη για την πρόσδεση του αμινοάκυλο-~trna στο mrna και φέρει τρία νουκλεοτίδια συμπληρωματικά του κωδικού (αντικωδικό). Στην τριτοταγή τους δομή τα t-rnas έχουν σχήμα Γ. Η θέση πρόσδεσης του αμινοξέος και το αντικωδικό βρίσκονται στα άκρα του Γ. Στους ευκαρυωτικούς οργανισμούς τα mrnas είναι μονοσιστρονικά. Στο 5 άκρο τους περιέχουν τη δομή cap και την 5 UTR. Ακολουθεί η κωδική περιοχή και στο 3 άκρο τους περιέχουν την 3 UTR και την πολύ-α ουρά. Τα μηνύματα αυτά είναι πολύ σταθερά (χρόνος ημιζωής: 4-24 ώρες). Ένα μέσο πολύσωμα ευκαρυωτικού mrna περιέχει περίπου 8 ριβοσώματα. Η αποδόμηση του mrna αρχίζει με την αποδόμηση του μεγαλύτερου μέρους της πολύ-α ουράς. Όμως η αποαδενυλίωση είναι απαραίτητη προϋπόθεση για την απομάκρυνση του cap από το 5 άκρο από το ένζυμο Dcp1. Οι PBP πρωτεΐνες που συνδέονται στο πολύ-α εμποδίζουν τη δράση της Dcp1 γεγονός που υποδηλώνει ότι συνδέουν τα δύο άκρα του mrna. Στάδια της μετάφρασης Έναρξη Επιμήκυνση Λήξη (σχήμα 4) 13

21 Εισαγωγή Η σύνδεση του αμινοξέος με το αντίστοιχο t-rna πρέπει να είναι πολύ ακριβής γιατί καθορίζει τη πιστότητα της μετάφρασης που είναι περίπου Μετά το σχηματισμό του αμινοάκυλο~ t-rna, τα πιθανά λάθη δε διορθώνονται. Έναρξη της μετάφρασης Η 40S υπομονάδα προσδένεται στο cap μέσω παραγόντων έναρξης και ακολούθως μετακινείται προς το 3 άκρο έως ότου βρει το κωδικό έναρξης το οποίο είναι συνήθως το πρώτο AUG από το 5 άκρο του mrna. Για την έναρξη (παύση της μετακίνησης της 40S) απαιτείται το κωδικό έναρξης να βρίσκεται μέσα σε μία συντηρητική αλληλουχία (GCCPuCCAUGG) όπου μια Pu (3Nt πριν από το AUG) και μία G (1Nt μετά το AUG) είναι τα πλέον σημαντικά και συντηρημένα νουκλεοτίδια. Σε περιπτώσεις που η 5 UTR είναι μεγάλη, περισσότερες από μια 40S βρίσκονται συνδεδεμένες σε διάφορες θέσεις της 5 UTR. Σχήμα 4. Τα στάδια της μετάφρασης Σχηματισμός εναρκτήριου συμπλόκου μετάφρασης Ο παράγοντας έναρξης 4Ε προσδένεται στη θέση cap και μέσω αυτού προσδένονται στην περιοχή εν σειρά οι παράγοντες 4G και 4B που αποδιατάσσουν την 5 UTR. Ο παράγοντας elf-3 διατηρεί την 40S υπομονάδα σε μονομερή μορφή. Παράλληλα ο παράγοντας elf-2 προσδένει ένα μόριο GTP και ακολούθως το αμινοάκυλο~ t-rna έναρξης (Met~tRNA met ). Σε συνέχεια το σύμπλοκο προσδένεται στη 40S ριβοσωματική υπομονάδα και ακολούθως (μέσω του elf-3) το τεταρτοταγές σύμπλοκο προσδένεται στο 5 άκρο του mrna. Στη συνέχεια το σύμπλοκο 14

22 Εισαγωγή μετακινείται εώς ότου φτάσει στο κωδικό έναρξης. Ακολουθεί υδρόλυση του GTP (παρουσία 60S), απομάκρυνση των παραγόντων έναρξης και ο σχηματισμός του συμπλόκου Met-tRNA met στη θέση P και την A θέση κενή. Πρόσδεση των αμινοάκυλο-~trnas στην Α θέση των ριβοσωμάτων Ο παράγοντας επιμήκυνσης EF-Tu δεσμεύει ένα μόριο GTP και ένα μόριο αμινοάκυλο~ t-rna και τα μεταφέρει στην A θέση. Ακολούθως υδρόλυση του GTP από μία ATPάση του ριβοσώματος είναι απαραίτητη για την απομάκρυνση του παράγοντα EF-Tu. Η διαδικασία της υδρόλυσης είναι αργή, όπως και αυτή της απομάκρυνσης του EF-Tu επιτρέποντας έτσι τη σωστή επιλογή του αμινοάκυλο~ trna σύμφωνα με το κωδικό που υπάρχει στην A θέση. Η απομάκρυνση του EF-Tu εμποδίζει τα επόμενα βήματα δεδομένου ότι κρατά το αμινοάκυλο~ trna σε μη σωστή θέση. Το αντιβιοτικό κηρομυκίνη προσδένεται στον EF-Tu και εμποδίζει την υδρόλυση του GTP. Αυτό έχει σαν αποτέλεσμα το σύμπλοκο EF-Tu/ αμινοάκυλο~ trna να προσδένεται στην Α θέση και η μετάφραση να σταματά σε αυτό το σημείο. Ακολούθως ο EF-Tu ανακυκλώνεται μέσω του παράγοντα EF-Ts. Σχηματισμός πεπτιδικού δεσμού Ένα ζεύγος ηλεκτρονίων από την αμινομάδα του αμινοάκυλο~ trna της θέσης Α προσβάλλει τον πεπτιδύλο~trna δεσμό στην P θέση με αποτέλεσμα το σχηματισμό του πεπτιδικού δεσμού. Το ένζυμο που καταλύει αυτή την αντίδραση είναι η πεπτιδυλική τρανσφεράση που αποτελείται από αρκετές ριβοσωματικές πρωτείνες της μεγάλης ριβοσωματικής υπομονάδας. Στη δραστικότητα του ενζύμου πολύ σημαντικό ρόλο, ίσως τον καταλυτικότερο, παίζει μια περιοχή του 23S ή 28S rrna. Μετάθεση του πεπτιδύλου~trna Μετά το σχηματισμό του πεπτιδικού δεσμού, το πεπτιδύλο~trna μεταφέρεται από την Α θέση στην P. Η αντίδραση καταλύεται από την πεπτιδυλική τρανσφεράση και απαιτεί υδρόλυση ενός μορίου GTP το οποίο μεταφέρεται από τον παράγοντα EF-G στη θέση A. Για τη μετάθεση έχουν προταθεί δύο μοντέλα. Σύμφωνα με το πρώτο μοντέλο, το πεπτιδύλο~trna μετατοπίζεται σε δύο βήματα προς τα αριστερά μεταφέροντας στο δεύτερο βήμα το mrna κατά 3Nt. Σύμφωνα με το δεύτερο μοντέλο, οι δύο υπομονάδες του ριβοσώματος ολισθαίνουν σε δύο στάδια 15

23 Εισαγωγή δημιουργώντας υβριδικές θέσεις A και P στο πρώτο στάδιο. Το ελέυθερο trna απομακρύνεται από τη θέση E. Λήξη μετάφρασης Για τη λήξη της μετάφρασης απαιτούνται τα κωδικά λήξης (UAA,UAG,UGA) και τρεις παράγοντες απελευθέρωσης (RF1/2 και RF3). Οι RF1/2 εισέρχονται σε ελεύθερη θέση A όταν στην P θέση υπάρχει πεπτίδυλο~ trna και προκαλούν λήξη με μία αντίδραση παρόμοια του πεπτιδικού δεσμού με δότη ηλεκτρονίων H 2 O. Ο παράγων RF3 προσδένεται με GTP και ακολούθως απομακρύνει τον RF1/2 από την A θέση. Οι EF-Tu/ αμινοάκυλο~ trna, EF-G, RF1/2/3 μοιάζουν στη δομή και εισέρχονται διαδοχικά στη θέση A (Lewin, Genes VIII). Α1.4. Υπεροικογένεια των υποδοχέων των στεροειδών θυρεοειδών ορμονών Πρόκειται για πρωτεϊνες που απαντώνται στο κυτταρόπλασμα ή τον πυρήνα των ευκαρυωτικών κυττάρων και οι οποίες προσδενόμενες στο DNA ρυθμίζουν τη μεταγραφή του (υπό τον έλεγχο ορμονών). Οι σημαντικές δομικές και λειτουργικές ομοιότητές τους τις κατατάσσει σε μια υπεροικογένεια. Σ αυτή συναντάμε τους υποδοχείς της οιστραδιόλης (ER), της κορτιζόλης (CR), της προγεστερόνης (PR), των θυρεοειδών (T3R), των ανδρογόνων (AR), της αλδοστερόνης (MR), της δεϋδρόξυ-βιταμίνης D (VDR) καθώς και δυο κατηγοριών υποδοχέων ρετινοϊκού οξέος (RAR και RXR). Τέλος στην παραπάνω οικογένεια συμπεριλαμβάνονται και πολλοί υποδοχείς που παρουσιάζουν μεγάλη δομική ομολογία με τα παραπάνω μέλη, δεν έχει βρεθεί όμως κάποιο πρόσδεμα για αυτούς, για το λόγο αυτό και χαρακτηρίζονται ως ορφανοί υποδοχείς. Η εκπληκτική συντηρητικότητα που εμφανίζουν αποκαλύπτει τη σημαντικότητά τους, ενώ ταυτόχρονα στηρίζει την άποψη ότι εξελίχθηκαν πριν το διαχωρισμό των δύο κλάδων που έδωσαν σπονδυλωτά και ασπόνδυλα. Οι στεροειδείς και θυρεοειδείς ορμόνες, η βιταμίνη D και το ρετινοϊκό οξύ είναι μικρά υδρόφοβα μόρια που μπορούν και περνούν την κυτταρική μεμβράνη και να αλληλεπιδρούν με τον υποδοχέα στόχο τους. Η χοληστερόλη είναι υπεύθυνη για τη σύνθεση 5 κατηγοριών στεροειδών ορμονών : τα προγεσταγόνα, τα γλυκοκορτικοειδή, τα αλατοκορτικοειδή, τα ανδρογόνα και 16

24 Εισαγωγή οιστρογόνα. Υδροξυλιώσεις με οξειδάσες μικτής λειτουργίας οι οποίες χρησιμοποιούν NADPH και Ο2 παίζουν ένα ιδιαίτερο ρόλο στη σύνθεση των στεροειδών ορμονών από τη χοληστερόλη. Η προγνενολόνη (C21), ένα ενδιάμεσο κλειδί στη σύνθεση των στεροειδών ορμονών παράγεται με απομάκρυνση του μεγαλύτερου μέρους της πλευρικής αλυσίδας της χοληστερόλης. Η προγεστερόνη (C21) που συντίθεται από την προγνενολόνη είναι το πρόδρομο της κορτιζόλης και της αλδοστερόνης. Υδροξυλίωση της προγεστερόνης και διάσπαση της πλευρικής της αλυσίδας δίνει ανδροστενεδιόνη, ένα ανδρογόνο (C 19 ). Τα οιστρογόνα (C 18 ) συντίθενται από τα ανδρογόνο με την απώλεια μιας γωνιακής μεθυλομάδας και το σχηματισμό αρωματικού δακτυλίου Α. Η βιταμίνη D, η οποία παίζει σημαντικό ρόλο στον έλεγχο του μεταβολισμού του ασβεστίου και του φωσφόρου, συντίθεται από ένα παράγωγο της χοληστερόλης με τη δράση του φωτός. Η κύρια δράση των στεροειδών ορμονών όπως της οιστραδιόλης, της προγεστερόνης και της κορτιζόνης είναι στη γονιδιακή έκφραση και όχι στην ενζυμική δραστικότητα ή στις διεργασίες μεταφοράς. Οι ορμόνες αυτές σε αντιδιαστολή με άλλες όπως η επινεφρίνη για να εξασκήσουν τη δράση τους θα πρέπει να εισέλθουν στα κύτταρα στόχους. Επιπλέον το κύριο σημείο δράσης τους είναι ο κυτταρικός πυρήνας και όχι η μεμβράνη. Η δράση αυτών των στεροειδών επιτυγχάνεται εντός ωρών, αντί λεπτών, επειδή οι βιολογικές τους δράσεις εξαρτώνται από τη σύνθεση νέων πρωτεϊνών. Η ακτινομυκίνη D αναστέλλει τη δράση των στεροειδών αυτών ορμονών, παρατήρηση που δείχνει ότι απαιτείται η σύνθεση νέου αγγελιαφόρου RNA για τη δράση τους. Το πρώτο στάδιο της διέγερσης της αύξησης του ενδομητρίου από την 17β- οιστραδιόλη είναι η δέσμευσή της με έναν ειδικό κυτταροπλασματικό υποδοχέα των κυττάρων του ενδομητρίου. Η δέσμευση είναι πολύ σθεναρή (K~10-9 M). Το σύμπλοκο ορμόνης υποδοχέα μεταναστεύει κατόπιν στον πυρήνα του κυττάρου όπου δεσμεύεται σε ειδικές θέσεις στο DNA. Με τον τρόπο αυτό ενεργούν και άλλες στεροειδείς ορμόνες. Οι υποδοχείς για τα οιστρογόνα, την προγεστερόνη και τα γλυκοκορτικοειδή έχουν καθαριστεί, χάρη στην υψηλή συγγένεια των ορμονών για τους υποδοχείς τους. Αντισώματα ειδικά γι αυτούς τους υποδοχείς έχουν χρησιμοποιηθεί για τον εντοπισμό πρωτεϊνών που εκφράζονται από μια βιβλιοθήκη κλώνων cdna και απομόνωση των κλώνων αυτών. Ο προσδιορισμός της αλληλουχίας και της έκφρασης αυτών των cdnas υπήρξε πολύ αποδοτικός. Έδειξε ότι οι υποδοχείς των 17

25 Εισαγωγή στεροειδών περιέχουν μια περιοχή που δεσμεύεται με το DNA και είναι πλούσια σε κατάλοιπα κυστεϊνης, αργινίνης και λυσίνης. Ακόμη πιο ενδιαφέρον είναι ότι η περιοχή αυτή έχει δακτύλους του τύπου Cys 2 - Cys 2 που δεσμεύουν μέταλλα. Τέτοιοι δάκτυλοι είναι κατάλληλοι για τη δέσμευση της πρωτεΐνης σε ειδικές αλληλουχίες του DNA. Μάλιστα στεροειδείς ορμόνες δεσμευόμενες με τους υποδοχείς τους δρουν ως ενισχυτές της μεταγραφής. Μεταλλάξεις του υποδοχέα των γλυκοκορτικοειδών που περιέχουν παρεμβολές που διαταράσσουν το μοτίβο Cys-X2-Cys δεσμεύουν την ορμόνη αλλά δεν ενεργοποιούν τη μεταγραφή. Οι περιοχές δέσμευσης της ορμόνης αυτών των υποδοχέων έχουν παρόμοιες αλληλουχίες, παρατήρηση που δείχνει ότι προήλθαν από ένα κοινό προγονικό υποδοχέα.(σχήμα 5) Σχήμα 5. Γραφική απεικόνιση μεταλλοκορτικοειδών και γλυκοκορτικοειδών υποδοχέων Περαιτέρω κατανόηση σχετικά με τους ορμονικούς υποδοχείς που επιδρούν στο DNA προσφέρουν οι μελέτες του ογκογονιδίου v-erb-a του ιού ερυθροβλαστώσεως πτηνών και του C-erb-A που ναι το κυτταρικό του ανάλογο. Το γονίδιο C-erb-A κωδικοποιεί έναν υποδοχέα για τις θυρεοειδικές ορμόνες. Το προιόν του γονιδίου αυτού δεσμεύεται με την τριιωδοθυρονίνη (Τ3). Ο υποδοχέας περιέχει μια περιοχή που δεσμεύεται με το DNA με πιθανούς μεταλλοδεσμευτικούς δακτυλίους, παρόμοιοι με αυτούς των υποδοχέων των στεροειδών ορμονών. Αυτή η μη αναμενόμενη ανακάλυψη έχει φέρει στην επιφάνεια ένα κοινό υπόβαθρο της δράσης 18

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής

Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Κ Ε Φ Α Λ Α Ι Ο 22 : Η ενεργοποίηση της µεταγραφής Εικόνα 22.1 Η γονιδιακή έκφραση ελέγχεται κυρίως κατά την έναρξη της µεταγραφής και σπάνια στα επόµενα στάδια της γονιδιακής έκφρασης, παρόλο που ο έλεγχος

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς

Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Κεφάλαιο 20 Η ρύθμιση της γονιδιακής έκφρασης στους ευκαρυωτικούς οργανισμούς Πυρίνας ανθρώπινου μεσοφασικού κυττάρου στον οποίο παρατηρούμε, με ανοσοφθορισμό, τη διάστικτη κατανομή της απακετυλάσης των

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ 11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Στον ανθρώπινο οργανισμό υπάρχουν δύο είδη αδένων, οι εξωκρινείς και οι ενδοκρινείς. Οι εξωκρινείς (ιδρωτοποιοί αδένες, σμηγματογόνοι αδένες κ.ά.) εκκρίνουν το προϊόν τους στην επιφάνεια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα


11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ 11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Στον ανθρώπινο οργανισμό υπάρχουν δύο είδη αδένων, οι εξωκρινείς και οι ενδοκρινείς. Οι εξωκρινείς (ιδρωτοποιοί αδένες, σμηγματογόνοι αδένες κ.ά.) εκκρίνουν το προϊόν τους στην επιφάνεια

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ )

Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ ) Κεφάλαιο 10 ΤΟ ΟΠΕΡΟΝΙΟ (σελ. 387-417) Ένα ρυθμιστικό γονίδιο κωδικοποιεί μια πρωτεΐνη που δρα σε μια θέση-στόχο πάνω στο DNA και ρυθμίζει την έκφραση ενός άλλου γονιδίου. Στον αρνητικό έλεγχο, μία trans-δραστική

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Βασικοί μηχανισμοί προσαρμογής

Βασικοί μηχανισμοί προσαρμογής ΣΥΓΚΡΙΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΖΩΩΝ 23-24, 18/4/2016 Π.Παπαζαφείρη Βασικοί μηχανισμοί προσαρμογής Προσαρμογή σε μοριακό και γονιδιακό επίπεδο Επίπεδα ελέγχου 1. Πρωτεïνική δράση 2. Πρωτεïνοσύνθεση 3. Ρύθμιση της

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος

Ρύθµιση κυτταρικής λειτουργίας. Μεταγωγή σήµατος Ρύθµιση κυτταρικής λειτουργίας Μεταγωγή σήµατος 1 Εισαγωγή Η διαδικασία εξέλιξης των πολυκύτταρων οργανισµών (πρίν 2.5 δις χρόνια) άρχισε πολύ πιο αργά από την ύπαρξη των µονοκύτταρων οργανισµών (πρίν

Διαβάστε περισσότερα

ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ. Οι ρυθμιστές του οργανισμού

ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ. Οι ρυθμιστές του οργανισμού ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Οι ρυθμιστές του οργανισμού Είδη αδένων στον άνθρωπο o Εξωκρινείς αδένες: εκκρίνουν το προϊόν τους μέσω εκφορητικού πόρου είτε στην επιφάνεια του σώματος (π.χ. ιδρωτοποιοί και σμηγματογόνοι

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα


Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Κεφάλαιο 28 ΣΥΝΘΕΣΗ ΚΑΙ ΜΑΤΙΣΜΑ ΤΟΥ RNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ) Η διαδικασία της μεταγραφής απαιτεί τη δράση του

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση:

KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου. Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: KΕΦΑΛΑΙΟ 1ο Χημική σύσταση του κυττάρου Ενότητα 1.1: Χημεία της ζωής Ενότητα 2.1: Μακρομόρια Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση: 1. Για ποιο λόγο θεωρείται αναγκαία η σταθερότητα

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα



Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015

ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. (Γενετικό γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 ΓΕΝΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ (Γενετικό υλικό των βακτηρίων ρύθμιση της γονιδιακής έκφρασης) Μαντώ Κυριακού 2015 Γενετικό υλικό των βακτηρίων Αποτελείται από ένα μόριο DNA σε υπερελιγμένη μορφή και τα άκρα του

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 27 5 2016 Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Σχολ. βιβλίο σελ. 20 με την παλιά έκδοση ή σελ. 24 με τη νέα έκδοση : «Τα

Διαβάστε περισσότερα


ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές

Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Κ Ε Φ Α Λ Α Ι Ο 21 : Υποκινητές και Ενισχυτές Εικόνα 21.1 Ένα τυπικό γονίδιο που µεταγράφεται από την RNA πολυµεράση ΙΙ έχει έναν υποκινητή ο οποίος εκτείνεται ανοδικά από τη θέση έναρξης της µεταγραφής.

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος

Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Κυτταρα ζυμομύκητα αποκρίνονται σε σήμα ζευγαρώματος Στους πολυκύτταρους οργανισμούς οι θεμελιώδεις κυτταρικές λειτουργίες εξαρτώνται από σύνθετα σηματοδοτικά μονοπάτια Κυτταρική επικοινωνία Τύποι επικοινωνίας

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα


3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Όλοι οι οργανισμοί προκειμένου να επιβιώσουν και να επιτελέσουν τις λειτουργίες τους χρειάζονται ενέργεια. Οι φυτικοί οργανισμοί μετατρέπουν την ηλιακή ενέργεια με τη διαδικασία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)]

DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] DNA και δομή χρωμοσωμάτων [κεφ. 6 και 8(σελ. 285-295)] Μεταβίβαση γενετικής πληροφορίας Η Γενετική πληροφορία βρίσκεται στο DNA (Λεία) (Αδρά) Αντικείμενα του μαθήματος Διαιώνιση/ Εξέλιξη της πληροφορίας

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 (+ κεφάλαιο 15 Hartwell) Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. igenetics 2

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

14ο Πυρηνικοί υποδοχείς 1. Προσδέτες των πυρηνικών υποδοχέων

14ο Πυρηνικοί υποδοχείς 1. Προσδέτες των πυρηνικών υποδοχέων 14 ο Πυρηνικοί υποδοχείς 1. Προσδέτες των πυρηνικών υποδοχέων Σχηματισμός και έκκριση ορμονών Διαθεσιμότητα των ορμονών στο κυτταρόπλασμα Τροποποιήσεις της ορμόνης στον ιστό-στόχο 2. Αρχές της σηματοδότησης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα