Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer

Transcript

1 ACTA CHIMICA SINICA Vol No a b a a Ξ a a Ξ ( a ) ( b ) 5 PCR PCR PCR amol/ L R 2 = PCR (PCR) Real2time Quantitative Assay of Telomerase Product Using the Duplex Scorpion Primer HUANG Yan2Ping a b KONG De2Ming a ZHANG Xiao2Bin a SHEN Han2Xi Ξ a MI Huai2Feng a ( a State Key Laboratory of Functional Polymer Materials for Adsorption and Separation Chemical School Nankai University Tianjin ) ( b College of Pharmacy Tianjin Medical University Tianjin ) Abstract To specific target sequence of telomerase product a fluorogenic duplex scorpion primer has been designed A probe element attached at the 5 2end of it can specifically detect target gene A PCR blocker carbon chain with C 3 group whose length is as the same as a base pair is joined between the primer sequence and the probe in the duplex scorpion primer A fluorescence signal is only produced when the probe sequence is hybridized with the target gene in the extended duplex scorpion primer Using this technology a novel method has been developed for quantitative assay of telomerase product by real2time PCR Accurate quantitative assay can be achieved with sample detected within amol/ L under fast cycling conditions The linear correlation factor R 2 = The method is specific simple and without post2pcr manipulation Keywords duplex scorpion primer telomerase real2time assay polymerase chain reaction (PCR) ( Telemetric repeat ( TTAGGG) amplification protocol TRAP) [2] (10 50 kb) TRAP (Polymerase chain reaction PCR) RNA [1] ; PCR Ξ E2mail : com Received September ; revised December ; accepted January (No )

2 No 3 : TRAP PCR PCR 2 5 L 10 TRAP [ 200 [3] mmol/ L Tris2HCl (ph = 8 3) 10 mmol/ L EGTA 630 mmol/ L [4] [5] [6] KCl 0 05 % Tween220 1 mg/ ml BSA ] 0113 L dntps [7] PCR (datp dttp dctp dgtp 10 mmol/ L) 2U Taq PCR 1 5 L MgCl 2 (25 mmol/ L) 1 4 L (75 g/ ml) PCR 0 5 L PP/ 2 5 L QP (25 mol/ L) 2 8 L (36 g/ ml) 2 L R5 25 L :95 3 min 1 ;94 30 s s (real2time) 27 PCR PCR 25 L PCR 12 % TRAP ( 130 V) 2 3 h PCR (ethidium bromide) PCR ( ) L TRAP PP QP MgCl 2 ( 1 3 1) PCR :95 15 s s min (TaqMan2 [8] [9] ) (Duplex scorpion primer DSP) PCR 2 1 PCR Kim [10] TRAP DSP ( R5) DSP R GeneAmp R 5700 PCR ( ABI ) DF2D ( ) [ CCCTAA] [11] 3 ( UVI tec ) RF2540 ( PCR (PCR2blocker) ( ) F2Q210 ( Starna Brand) ) PCR 1 2 DSP ( Probe Primer PP ) : FAM PCR DSP PP 5 FAM ; QP DABCYL PP DSP [ CCCTAA] 3 2 2AATCCGTCGAGCAGAGTT23 ( ( 1 A) PCR ) ( 1 B) (Quencher probe QP) : 5 2[ TTAGGG] DABCYL DSP Taq : 5 2 ( 1 C) PCR DSP AATCCGTCGAGCAGAGTT23 : 5 2GCGCGG [ CT T2 ACC] 3 CTAACC23 ( ( 1 D) Michael Zuker mfold( PCR 3 1) [12] ) [10] ( ) R5 : 5 2 AATCCGTCGAGCAGAGTTAG[ GGTTAG] 4 23 (molecularbeacon) PP

3 276 Vol QP PCR PCR T m PP QP DSP 2 3 PP QP DSP PP DSP FAM 495 nm ; QP DABCYL 479 nm DSP PP QP [13] DSP DABCYL FAM 1 DSP Figure 1 Assay principle of DSP 2 2 DSP 2 DSP QP 3 DSP Figure 3 Absorption spectra of DSP 1 PP ; 2 QP ; 3 DSP PP 2 4 QP PP DSP T m = mmol/ L MgCl 2 TRAP PP 0 3 mol/ L QP 95 5 min : E ff = [ 1 - ( F q - F b ) / ( F uq - F b ) ] 100 % [14] F uq F q F b PP PP QP ( 1) QP PP > 1 97 % PCR QP QP PP 5 1 PP QP DSP 2 DSP (1) (2) 2 5 DSP Figure 2 Fluorescence melting curve (1) and the derivative curve (2) DSP TRAP of DSP

4 No 3 : 277 c (QP) c (PP) 1 DSP Table 1 Quenching efficiencies of DSP PCR :95 3 min s 45 3 s 40 E ff PCR R5 DSP PCR ( 4) DSP DSP ; (50bp 56bp R ) [10] DSP 5 DSP R5 (amol/ L) DSP DSP Figure 5 Amplification plots using DSP for quantitative assay of R5 18 DSP (amol/ L) 2 7 PCR R amol/ L DSP PCR amol/ L R5 C T ( 6) R ; 0 15 amol/ L 4 (1 4) DSP (5 8) ; R5 Figure 4 Gel electrophoresis of PCR products using upstream primer (1 4) or DSP (5 8) water as reference ; R5 as template 2 6 PCR DSP 1 s [14] ( 94 6 DSP TRAP R5 0 s 0 s 3 s 100 ) Figure 6 Standard curve for detection of R5 using the DSP by TRAP PCR 60 [10] assay ( ) PCR 45 PCR PCR ( 5) 3 Whitcombe [15 16] PCR ( C T ) PCR PP TaqMan 40 C T Solinas [17] 40

5 278 Vol Uehara H ; Nardone G ; Nazarenko I ; Hohman R J Biotechniques PCR ( HEG) 6 Szatmari I ; Tokes S ; Dunn C B ; Bardos T J ; Aradi C 3 (DABCYL) J Anal Biochem DSP PCR PCR 7 Xu S ; He M ; Yu H ; Cai X ; Tan X ; Lu B ; Shu B Anal Biochem Kong D2M ; Gu L ; Shen H2X ; Mi H2F Acta Chim Sinica (in Chinese) ( ) 9 Kong D2M ; Shen H2X Chin J Chem Kim N W ; Wu F Nucleic Acids Res Hultdin M ; Grgnlund E ; Norrback K F ; Eriksson2 References 1 Granger M P ; Wright W E ; Shay J W Crit Rev Oncology/ Hematology Kim N W ; Piatyszek M A ; Prowse K R ; Harley C B ; West M D ; Ho P L ; Coviello G M ; Wright W E ; Weinrich S L ; Shay J W Science Hirose M ; Abe2Hashimoto J ; Ogura K ; Tahara H ; Ide T ; Yoshimura T J Cancer Res Clin Oncol Gelmini S ; Caldini A ; Becherini L ; Capaccioli S ; Pazzagli M ; Orlando C Clin Chem Lindstrgm E ; Just T ; Roos G Nucleic Acids Res http :/ / www bioinfo rpi edu/ applications/ mfold/ old/ dna/ form1 cgi 13 Fang X H ; Li J J ; Perlette J ; Tan W H ; Wang K M Anal Chem A 14 Tyagi S ; Kramer F R Nat Biotechnol Whitcombe D ; Theaker J ; Guy S P ; Brown T ; Little S Nat Biotechnol Thelwell N ; Millington S ; Solinas A ; Booth J ; Brown T Nucleic Acid Res Solinas A ; Brown L J ; McKeen C ; Mellor J M ; Nicol J T G ; Thelwell N ; Brown T Nucleic Acids Res e96 (A PAN B F ; FAN Y Y )