Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων. Η ανάπτυξη του ανοσιακού ρεπερτορίου

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων. Η ανάπτυξη του ανοσιακού ρεπερτορίου"

Transcript

1 4. Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ: Η δοµή των αντιγονικών υποδοχέων των λεµφοκυττάρων και η ανάπτυξη του ανοσιακού ρεπερτορίου Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων (TCR) Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

2 ύο σηµαντικά ερωτήµατα: Πως οι υποδοχείς των λεµφοκυττάρων αναγνωρίζουν πολύ διαφορετικά αντιγόνα αλλά µεταδίδουν κοινά σήµατα προς τα κύτταρα; Πως δηµιουργείται η τεράστια ποικιλοµορφία των υποδοχέων;

3 Αντιγονικοί υποδοχείς Εχουν τις βασικές λειτουργίες των υποδοχέων: ανιχνεύουν εξωτερικά ερεθίσµατα (αντιγόνα), και προκαλούν απαντήσεις στα κύτταρα που τους εκφράζουν. Κατανέµονται κλωνικά. ΌλαταΒήΤκύτταρααποκρίνονται µε τον ίδιο τρόπο όταν οι υποδοχείς αναγνωρίσουν αντιγόνο. ηλαδή: Προκαλούν ενεργοποίηση του λεµφοκυττάρου απελευθερώνοντας κοινά βιοχηµικά σήµατα.

4 Οι υποδοχείς των Β και Τ κυττάρων Σύµπλεγµα BCR Σύµπλεγµα TCR B κύτταρο Τκύτταρο ραστικές λειτουργίες Χ

5 Οι ιδιότητες των αντισωµάτων και των TCRs Χαρακτηριστικό ή λειτουργία Μορφές αντιγόνου που αναγνωρίζονται Ποικιλοµορφία Η αναγνώριση του αντιγόνου γίνεται µε: Η µεταβίβαση του σήµατος γίνεται από: Οι δραστικές λειτουργίες διεκπεραιώνονται από: Αντίσωµα (ανοσοσφαιρίνη) Μακροµόρια (πρωτεΐνες, πολυσακχαρίτες, λιπίδια, νουκλεϊνικά οξέα), µικρές χηµικές ενώσεις Γραµµικοί και διαµορφωτικοί επίτοποι Κάθε κλώνος: 1 ειδικότητα (δυνατότητα για >10 9 ειδικότητες) V περιοχές των Η και L αλυσίδων των µεµβρανικών Ig. (CDRs) Πρωτεΐνες συνδεδεµένες µε τη µεµβρανική Ig (:Igα και Igβ) Σταθερές περιοχές (C) των εκκρινόµενων Ig TCR Πεπτίδια που παρουσιάζονται από τα µόρια MHC των APCs Μόνο γραµµικοί επίτοποι Κάθε κλώνος: 1 ειδικότητα (δυνατότητα για >10 11 ειδικότητες) V περιοχές των α και β αλυσίδων. (CDRs) Πρωτεΐνες συνδεδεµένες µε τονtcr (:CD3 και ζ) εν υπάρχουν

6 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικίλων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

7 Ηδοµή τωναντισωµάτων

8 Ησηµασία της περιοχής άρθρωσης Αποµακρυσµένοι αντιγονικοί επίτοποι Γειτονικοί αντιγονικοί επίτοποι Άρθρωση

9 Πρωτεολυτικά και άλλα τµήµατα της IgG ισουλφιδικοί δεσµοί L αλυσίδα Ηαλυσσίδα Πέψη µε πεψίνη Πέψη µε παπαΐνη Αναγωγή µε µερκαπτοαιθανόλη Fc θραύσµατα L αλυσίδα Ηαλυσίδα

10 Υπερµεταβλητές περιοχές (CDR) της V περιοχής Ελαφριές αλυσίδες Μεταβλητότητα Αριθµός κατάλοιπου

11 Η κρυσταλλική δοµή µιας εκκρινόµενης IgG

12 Περιοχή (domain) Ig. ίπλωση Ig

13 Υπεροικογένεια ανοσοσφαιρίνης (Ig) Κοινή λειτουργία: ανίχνευση σηµάτων

14 Τα χαρακτηριστικά των κύριων ισότυπων (τάξεων) των αντισωµάτων

15 Αλληλεπιδράσεις αντιγόνουαντισώµατος (Ag-Ab)

16 Πρόσδεση ενός αντιγόνου στο αντίσωµα

17 Επίτοποι (διαµορφωτικοί, γραµµικοί) ιαµορφωτικοί Μη προσβάσιµος επίτοπος Γραµµικοί Προσβάσιµος επίτοπος Αποδιάταξη Αποδιάταξη Αποδιάταξη Ig προσδένεται σε επιτόπους αποδιαταγµένων και µη πρωτεϊνών Απώλεια επίτοπου από αποδιάταξη Ig προσδένεται σε επιτόπους αποδιαταγµένων πρωτεϊνών

18 υνάµεις έλξης Ab-Ag (ρόλος της απόστασης)

19 Συγγένεια Ab-Ag Εξαρτάται από την ποιότητα της εφαρµογής των Αb-Αg (διότι ενισχύονται οι δυνάµεις έλξης) Ab+Αg AbAg Σταθερά ισορροπίας διάστασης: Kd = [Ab][Ag]/ [AbAg] Άρα, όταν δεθούν τα µισά Ab, δηλ.: [Ab] = [AbAg], τότε: Κd = [Ag] Κd = 1/Ka (σηµαντικές Κd ~ Μ) (σηµαντικές Κa ~ Μ)

20 Συγγένεια Ab-Ag Εξαρτάται από την ποιότητα της εφαρµογής των Αb-Αg (διότι ενισχύονται οι δυνάµεις έλξης) Ab+Αg AbAg Σταθερά ισορροπίας διάστασης: Kd = [Ab][Ag]/ [AbAg] Άρα, όταν δεθούν τα µισά Ag, δηλ.: [Ag] = [AbAg], τότε: Κd = [Ab] Κd = 1/Ka (σηµαντικές Κd ~ Μ) (σηµαντικές Κa ~ Μ)

21 Συγγένεια Ab-Ag Πρωτογενής απάντηση: Kd: Μ ευτερογενής απάντηση: Kd: Μ (ωρίµανση συγγένειας)

22 Συνάφεια (avidity) = το αποτέλεσµα πολλαπλών προσδέσεων (µεγαλύτερη λειτουργική σηµασία από την συγγένεια) αντίσωµα Μέτρια Μέτρια Πολύ ισχυρή αντιγόνο αντιγόνο Μονή αντιγόνο γέφυρα αντιγόνου ιαχωρισµός Μη διαχωρισµός ς

23 ιασταυρούµενες αντιδράσεις Αb-Ag Αρχικό αντιγόνο Ένας ίδιος επίτοπος Παρόµοιος επίτοπος Χωρίς δοµική οµοιότητα ΙΑΣΤΑΥΡΟΥΜΕΝΗ ΑΝΤΙ ΡΑΣΗ ΟΧΙ ΑΝΤΙ ΡΑΣΗ

24 Σηµασία των διασταυρούµενων αντιδράσεων Αb-Ag Σε αυτοάνοσα νοσήµατα Στην παρασκευή εµβολίων

25 Μονοκλωνικά αντισώµατα

26 3

27 Αντιγόνο µε επίτοπους και αντισώµατα Αντιγόνο

28 Αντιγόνο µε επίτοπους και αντισώµατα Αντιγόνο

29 Μονοκλωνικό αντίσωµα

30 Moνοκλωνικά αντισώµατα (mabs) 1975: Köhler και Milstein τεχνολογία µονοκλωνικών αντισωµάτων (Σύντηξη Β κυττάρων ανοσοποιηµένου ζώου µε αθάνατα µυελωµατικά κύτταρα και αποµόνωση κλώνων υβριδωµάτων) Ανοσοποίηση τρωκτικού µε ένα αντιγόνο Το νεοπλασµατικό κύτταρο διαιρείται επ άπειρον αλλά δεν παράγει mabs ΣΥΝΤΗΞΗ ΤΩΝ ΥΟ ΚΥΤΤΑΡΩΝ Το Β-κύτταρο παράγει το ειδικό αντίσωµα, αλλά δεν ζει αρκετό χρόνο Το υβριδικό κύτταρο παράγει ειδικό αντίσωµα και διαιρείται επ άπειρον.

31 Χιµαιρικά και ανθρωποποιηµένα αντισώµατα Ab ποντικού Ab ανθρώπου Fv Ab χίµαιρα CDRs Ab ανθρωποποιηµένο

32 Ανάγκη για ανθρώπινα µονοκλωνικά αντισώµατα για θεραπεία. Πως µπορούν να κατασκευαστούν? 1. Κλασσική τεχνολογία των υβριδωµάτων µε ανοσοποιήσεις διαγονιδιακών «ανθρωποποιηµένων» ποντικών 2. Τεχνολογία ανασυνδυασµένων τµηµάτων των αντισωµάτων που εκφράζονται στην επιφάνεια βακτηριοφάγων (τεχνική phage-display)

33 Παραγωγή τµηµάτων ανθρώπινων αντισωµάτων µε έκθεση στην επιφάνεια φάγων (phage-display) Βιβλιοθήκη εκατοµµυρίων φάγων µε εκατοµµύρια διαφορετικών Fab Φάγος Fab Πρόσδεση του ειδικού Fab-φάγου πλύσεις Πλάκα µε ακινητοποιηµένο αντιγόνο Έκφραση του ειδικού Fab Αποµόνωση και πολ/σιασµός του ειδικού Fab-φάγου Fab

34 Χρήσεις των µονοκλωνικών αντισωµάτων Βιοϊατρική έρευνα ιάγνωση Θεραπεία (π.χ. θεραπεία όγκων µε ανοσοτοξίνες)

35

36 Antigen CD20 (B cell) HER2 CD33 CD52 CD20 (B cell) GP-R IgE TNFa CD3 IL2

37 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικίλων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

38 Ηδοµή τουtcr 3+3 CDRs 5

39 Ο TCR αναγνωρίζει το σύµπλεγµα ενός αντιγονικού πεπτιδίου (παρουσιαζόµενου από ένα µόριο MHC) ΜΑΖΙ µε το ΜΗC µόριο (περιορισµός MHC) Τκύτταρο Αντιγονοπαρουσιαστικό κύτταρο

40 Η αναγνώριση ενός συµπλέγµατος πεπτιδίου- MHC από ένα TCR Κάθε TCR αναγνωρίζει 1-3 αµινοξέα του αντιγόνου και µερικά αµινοξέα του ΜΗC

41 γδ TCR 5-10% των Τ κυττάρων εκφράζουν γδ TCR. Παρόµοιος µε τον αβ TCR, αλλά µε διαφορετική ειδικότητα. Αντιγόνα: µη πεπτιδικά(λιπίδια κλπ) που παρουσιάζονται από µη MHC µόρια (CD1). Τα γδ Τ κύτταρα είναι άφθονα στα επιθήλια. Μάλλον αναγνωρίζουν συνήθεις µικροοργανισµούς στην επιφάνεια των επιθηλίων.

42 Τα συµπλέγµατα υποδοχέων των Β και Τ κυττάρων

43 Σύµπλεγµα TCR

44 CD4 CD8

45 Τα χαρακτηριστικά της αναγνώρισης του αντιγόνου από αντισώµατα και TCR Χαρακτηριστικό Μόρια σύνδεσης αντιγόνου Ανοσοσφαιρίνη (Ig) TCR Περιοχή πρόσδεσης Αg 3 V H CDRs και 3 V L CDRs 3 V α CDRs και 3 V β CDRs οµές του αντιγόνου που αναγνωρίζονται (επίτοποι) Συγγένεια σύνδεσης του αντιγόνου Επικουρικά µόρια που συµµετέχουν στη σύνδεση Γραµµικοί και διαµορφωτικοί επίτοποι µακροµορίων και µικρών χηµικών ενώσεων K d M. Αυξάνει στις δευτερογενείς απαντήσεις Κανένα Μόνο 1-3 αµινοξέα ενός πεπτιδίου + πολυµορφικά αµινοξέα του MHC ~1000x ασθενέστερη (K d M) Το CD4 ή τοcd8

46 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Η παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

47 Ig τµήµατα στο επίπεδο πρωτεΐνης και γονιδίου Πρωτεΐνη Γονίδια V V C C J V J V D C C

48 Ig Η οργάνωση των γενετικών τόπων των αντιγονικών υποδοχέων στο γονιδίωµα

49 Η οργάνωση των γενετικών τόπων των αντιγονικών υποδοχέων στο γονιδίωµα Ig TCR

50 Ανασυνδυασµός και έκφραση των γονιδίων των ανοσοσφαιρινών

51 Ο ανασυνδυασµός των V,(D),J καταλύεται από τις ανασυνδιάσες/ρεκοµπινάσες V(D)J: RAG-1 και RAG-2 Θέση των V(D)J γονιδίων και αλληλουχίες αναγνώρισης Παρεµβολή πολλών V και J 7µερές 9µερές 9µερές 7µερές Αναγνώριση αλληλουχιών για ανασυνδιάση Η ειδική για τα ανώριµα Β(και Τ) κύτταρα ανασυνδιάση V(D)J αναγνωρίζει αλληλουχίες DNA (7µερή+9µερή) εκατέρωθεν των V, D και J.

52 Αλληλουχία βλαστικών κυττάρων Συνδετική ποικιλοµορφία (junctional diversity) Αφαίρεση νουκλεοτιδίων στις συνδέσεις Εκφρασµένες αλληλουχίες Αλληλουχία εκτός πλαισίου ανάγνωσης (δεν εκφράζεται) Αλληλουχία βλαστικών κυττάρων Εκφρασµένη αλληλουχία Προσθήκη Ν περιοχής Νουκλεοτίδια Ν περιοχής (TdT: τελική δεοξυριβονουκλεοτιδική τρανσφεράση)

53 Το αποτέλεσµα των µηχανισµών ποικιλοµορφίας των αντιγονικών υποδοχέων ~ x 1000 ~ x 600.

54 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

55 Ωρίµανση των Β και Τ κυττάρων και δηµιουργία των υποδοχέων (κοινά σηµεία) Η δηµιουργία των εκατοµµυρίων διαφορετικών υποδοχέων είναι στενά συνδεδεµένη µε τη διαδικασία ωρίµανσης των λεµφοκυττάρων

56 Τα στάδια της ωρίµανσης των Β και Τ κυττάρων - Έντονος πολλαπλασιασµός των ανώριµων κυττάρων, - Έκφραση των γονιδίων των αντιγονικών υποδοχέων, - Επιλογή των λεµφοκυττάρων που εκφράζουν χρήσιµους υποδοχείς IL-7 pro-t = Προ-προ-Τ. pre-t = Προ-Τ

57 Σήµατα για την ωρίµανση των λεµφοκυττάρων Ο πολλαπλασιασµός των προδρόµων µορφών διεγείρεται κυρίως από την IL-7 (από τα κύτταρα του στρώµατος) Όταν εκφραστούν οι υποδοχείς, αναλαµβάνουν αυτοί τη µεταβίβαση των σηµάτων = µόνο οι κλώνοι µε ακέραιους και κατάλληλους υποδοχείς θα επιζήσουν

58 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

59 Τα στάδια ωρίµανσης και επιλογής των Β κυττάρων

60 H µ και το προ-bcr σηµατοδοτούν: διακοπή των ανασυνδυασµών των H γονιδίων στο δεύτερο χρωµόσωµα (αλληλικός αποκλεισµός) = 1 κύτταρο 1 Η αλυσίδα. εκκίνηση ανασυνδυασµού των L γονιδίων (κ λ). κ(λ)+ µ IgM. Η IgM µεταβιβάζει σήµατα για επιβίωση του Β κυττάρου πολλαπλασιασµό διακοπή της παραγωγής της ανασυνδιάσης (δηλαδή των περαιτέρω ανασυνδυασµών L αλυσίδας). κάθε Β κύτταρο παράγει µία Ηκαιµία κ ή λ αλυσίδα = 1 υποδοχέα.

61 Συνέκφραση IgM + IgD για (?) ωρίµανση του B κυττάρου (Η ικανότητα των Β κυττάρων να αποκρίνονται σε αντιγόνα αναπτύσσεται ταυτόχρονα µε τησυνέκφραση των IgM και IgD) µ βαριά αλυσίδα Θέσεις πολυαδενυλίωσης δβαριά αλυσίδα Το V-D-J RNA µπορεί να συρραφεί είτε σε Cµ ήσεcδ RNA, παράγοντας ένα µ ήέναδrna

62 Αρνητική επιλογή στα Β κύτταρα Αν το Β κύτταρο συνδεθεί ισχυρά µε (αυτο)αντιγόνο στο µυελό των οστών: είτε πεθαίνει µε απόπτωση είτε κάνει επεξεργασία/διόρθωση του υποδοχέα (editing): ενεργοποιεί πάλι την ανασυνδιάση δεύτερη L αλυσίδα αλλαγή της ειδικότητας του υποδοχέα

63 Πως τα ώριµα Β κύτταρα µπορούν να αναγνωρίσουν κάθε µικροοργανισµό (και κάθε ξένη ουσία)? Φαίνεται οτι το ρεπερτόριο των Β κυττάρων: δηµιουργείται τυχαία, και επιλέγεται: θετικά (έκφραση ακέραιων υποδοχέων), και µετά αρνητικά (για µη αναγνώριση του εαυτού).

64 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

65 Τα στάδια ωρίµανσης και επιλογής των T κυττάρων. Θετική και αρνητική επιλογή Μη αναγνώριση MHC Απόπτωση Τα Τ κύτταρα επιλέγονται σε διάφορα στάδια κατά την ωρίµανσή τους ώστε να διατηρηθούν οι χρήσιµες ειδικότητες

66 Η ΑΝΑΓΝΩΡΙΣΗ ΤΟΥ ΑΝΤΙΓΟΝΟΥ ΣΤΟ ΕΠΙΚΤΗΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ Οι αντιγονικοί υποδοχείς των λεµφοκυττάρων Αντισώµατα Αντιγονικοί υποδοχείς των Τ κυττάρων Η ανάπτυξη του ανοσιακού ρεπερτορίου Παραγωγή ποικιλόµορφων αντιγονικών υποδοχέων Ωρίµανση και επιλογή των Β λεµφοκυττάρων Ωρίµανση και επιλογή των T λεµφοκυττάρων

67 Τεχνικές ανίχνευσης αντιγόνου/αντισώµατος ΕLISA RIA Western Blot Ανοσοφθορισµός

68 ELISA ή RIA στερεάς φάσης για ανίχνευση τιτλοδότηση αντισώµατος Προσθήκη αντιγόνου Προσθήκη ορού ασθενή Προσθήκη σηµασµένου αντί-ig Πλύση Πλύση Πλύση ΠΡΟΣ ΙΟ- ΡΙΣΜΟΣ ΤΙΤΛΟΥ Πλαστικός σωληνίσκος

69 ΕLISA για ανίχνευση αντιγόνου Εποµένως εδώ είχα αντιγόνο Α

70 Ανοσοαποτύπωµα/στύπωµα Western (Western blot) Μείγµα πρωτεϊνών Προσθήκη σηµασµένου αντί-α Ζώνη που αντιστοιχεί στην πρωτεΐνη Α Ηλεκτροφόρηση Ηλεκτροφορητική µεταφορά Προσθήκη σηµασµένου αντί-β Ζώνη που αντιστοιχεί στην πρωτεΐνη Β Πήκτωµα πολυακρυλαµιδίου µε SDS Μεµβράνη νιτροκυτταρίνης Αυτοραδιογραφήµατα

71 Ανοσοαποτύπωµα western (Western blot)

72 Ανοσοφθορισµός Εντόπιση αντιγόνου σε κύτταρα

7. Χυµικές ανοσοαπαντήσεις. Ενεργοποίηση των Β λεµφοκυττάρων και παραγωγή αντισωµάτων

7. Χυµικές ανοσοαπαντήσεις. Ενεργοποίηση των Β λεµφοκυττάρων και παραγωγή αντισωµάτων 7. Χυµικές ανοσοαπαντήσεις. Ενεργοποίηση των Β λεµφοκυττάρων και παραγωγή αντισωµάτων Οι φάσεις και οι τύποι των χυµικών ανοσοαπαντήσεων Η διέγερση των Β λεµφοκυττάρων από το αντιγόνο Ο ρόλος των βοηθητικών

Διαβάστε περισσότερα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα φυσική ή μη ειδική ανοσία δεν απαιτεί προηγούμενη έκθεση στο παθογόνο και δεν διαθέτει μνήμη. σε επίκτητη ή ειδική ανοσία χυμική ανοσία με παραγωγή

Διαβάστε περισσότερα

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ Στάδια μικροβιακής λοίμωξης δημιουργία αποικίας σε εξωτερική επιφάνεια διείσδυση στον οργανισμό τοπική μόλυνση συστηματική (γενικευμένη) μόλυνση H σημασία

Διαβάστε περισσότερα

οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά

οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά Ανοσολογικό σύστηµα Βασικό σύστηµα του οργανισµού Λειτουργικές µονάδες του ανοσολογικού συστήµατος Οργανωµένος λεµφικός

Διαβάστε περισσότερα

3. Η ΠΡΟΣΛΗΨΗΤΟΥ ΑΝΤΙΓΟΝΟΥ ΚΑΙ Η ΠΑΡΟΥΣΙΑΣΗ ΤΟΥ ΣΤΑ ΛΕΜΦΟΚΥΤΤΑΡΑ

3. Η ΠΡΟΣΛΗΨΗΤΟΥ ΑΝΤΙΓΟΝΟΥ ΚΑΙ Η ΠΑΡΟΥΣΙΑΣΗ ΤΟΥ ΣΤΑ ΛΕΜΦΟΚΥΤΤΑΡΑ 3. Η ΠΡΟΣΛΗΨΗΤΟΥ ΑΝΤΙΓΟΝΟΥ ΚΑΙ Η ΠΑΡΟΥΣΙΑΣΗ ΤΟΥ ΣΤΑ ΛΕΜΦΟΚΥΤΤΑΡΑ ΤΙ ΒΛΕΠΟΥΝ ΤΑ ΛΕΜΦΟΚΥΤΤΑΡΑ Τα αντιγόνα που αναγνωρίζονται από τα Τ λεµφοκύτταρα Πρόσληψη των πρωτεϊνικών αντιγόνων από τα αντιγονοπαρουσιαστικά

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Παθοφυσιολογία Ι

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Παθοφυσιολογία Ι ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Παθοφυσιολογία Ι Ανοσολογία - Ρευματολογία Υπεύθυνος μαθήματος: Καθηγητής Παθολογίας/Ρευματολογίας, Αλέξανδρος Α. Δρόσος Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ

ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ Β ΒΑΣΙΚΟ ΣΕΜΙΝΑΡΙΟ ΚΥΤΤΑΡΟΜΕΤΡΙΑΣ 2 ΦΕΒΡΟΥΑΡΙΟΥ 2013 ΑΜΦΙΘΕΑΤΡΟ ΤΟΥ ΓΕΝΙΚΟΥ ΚΡΑΤΙΚΟΥ ΑΘΗΝΩΝ «Γ. ΓΕΝΝΗΜΑΤΑΣ» IV Σχεδιασμός Πειραμάτων και Ανάπτυξη Δοκιμασιών ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ Βικεντίου

Διαβάστε περισσότερα

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010 Εξεταστική Ιανουαρίου 2010 Ποιες είναι οι διαφορές μιας πρωτογενούς από μια δευτερογενή χυμική ανοσολογική απόκριση; Περιγράψετε τους μηχανισμούς ενεργοποίησης στις δυο περιπτώσεις. ΘΕΜΑ 2 (1 μονάδα) Περιγράψετε

Διαβάστε περισσότερα

Αντιγόνα & Ανοσοσφαιρίνες

Αντιγόνα & Ανοσοσφαιρίνες Αντιγόνα & Ανοσοσφαιρίνες Ανοσολογικά χαρακτηριστικά των αντιγόνων I Τα αντιγόνα είναι ουσίες ικανές να επάγουν ειδική ανοσιακή απάντηση (ανοσογόνα) Ανοσογονικότητα (immunogenicity) ικανότητα επαγωγής

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...

ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... ΚΕΦΑΛΑΙΟ 8 ο ΚΕΦΑΛΑΙΟ 8 ο...2 I. Εφαρµογές της βιοτεχνολογίας στην ιατρική...2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...7 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ...10 1 ΚΕΦΑΛΑΙΟ 8 ο I. Εφαρµογές της βιοτεχνολογίας

Διαβάστε περισσότερα

5 Η ΠΑΡΟΥΣΙΑΣΗ. ΕΙΔΙΚΗ ΑΝΟΣΙΑ Dr.ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ

5 Η ΠΑΡΟΥΣΙΑΣΗ. ΕΙΔΙΚΗ ΑΝΟΣΙΑ Dr.ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ 5 Η ΠΑΡΟΥΣΙΑΣΗ ΕΙΔΙΚΗ ΑΝΟΣΙΑ Dr.ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ ΕΙΔΙΚΗ ΑΝΟΣΙΑ Ειδική ή επίκτητη ανοσία είναι ένα σύνολο μηχανισμών με τους οποίους επιτυγχάνεται σημαντική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Ανοσιακή απάντηση (immune response)

Ανοσιακή απάντηση (immune response) Ανοσιακή απάντηση (immune response) Το σύνολο των μηχανισμών που καθιστούν τον οργανισμό ικανό να αναγνωρίζει,να εξουδετερώνει και να απομακρύνει κάθε ξένη ουσία προς αυτόν χαρακτηρίζεται ως ανοσία. Αποτέλεσμα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ΥΒΡΙ ΩΜΑΤΑ ΚΑΙ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΚΕΦΑΛΑΙΟ 4

ΚΕΦΑΛΑΙΟ 4 ΥΒΡΙ ΩΜΑΤΑ ΚΑΙ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΚΕΦΑΛΑΙΟ 4 1 ΚΕΦΑΛΑΙΟ 4 Τα αντισώματα που περιέχονται σε έναν αντιορό, σε απόκριση χορήγησης ενός αντιγόνου, είναι πολύ ετερογενή, εξαιτίας των πολλαπλών αντιγονικών καθοριστών, που επάγουν τον πολλαπλασιασμό και

Διαβάστε περισσότερα

Αντιγόνο. ξένη) με μια σχετικά ισχυρή δύναμη σύνδεσης.

Αντιγόνο. ξένη) με μια σχετικά ισχυρή δύναμη σύνδεσης. Αντιγόνα Αντισώματα Αντιγόνο Ως αντιγόνο ορίζεται κάθε ουσία που προέρχεται από το εξωτερικό ή εσωτερικό περιβάλλον και είναι ικανή να αντιδράσει με τα προϊόντα της ανοσιακής απάντησης (αναγνωρίζεται από

Διαβάστε περισσότερα

ΑΝΤΙΓΟΝΑ. Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ

ΑΝΤΙΓΟΝΑ. Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ ΑΝΤΙΓΟΝΑ Antigens Ags Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ ΑΝΤΙΓΟΝΟ Χημική ένωση διαγείρει Β, Τ -λεμφοκύτταρα σε ειδική ανοσολογική απόκριση μέσω υποδοχέων (Igs, ΤCR) Ειδική

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Αντιγόνα & Ανοσοσφαιρίνες

Αντιγόνα & Ανοσοσφαιρίνες Ανοσολογικά χαρακτηριστικά των αντιγόνων Τα αντιγόνα είναι ουσίες ικανές να επάγουν ειδική ανοσιακή απάντηση (ανοσογόνα) Ανοσογονικότητα (immunogenicity) ικανότητα επαγωγής ανοσιακής απάντησης (χυµικής

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Ανοσολογία. Ωρίμανση Β και Τ λεμφοκυττάρων Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Ανοσολογία. Ωρίμανση Β και Τ λεμφοκυττάρων Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ανοσολογία Ωρίμανση Β και Τ λεμφοκυττάρων Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

H μοριακή βιολογία και η φαρμακολογία των μονοκλωνικών αντισωμάτων και η κλινική τους εφαρμογή στην πολλαπλή σκλήρυνση".

H μοριακή βιολογία και η φαρμακολογία των μονοκλωνικών αντισωμάτων και η κλινική τους εφαρμογή στην πολλαπλή σκλήρυνση. H μοριακή βιολογία και η φαρμακολογία των μονοκλωνικών αντισωμάτων και η κλινική τους εφαρμογή στην πολλαπλή σκλήρυνση". «Κλινική Φαρμακολογία και Θεραπευτική» 5 ος Κύκλος Επιβλέπων: Ηλιόπουλος Ιωάννης

Διαβάστε περισσότερα

Ανοσιακή απάντηση Αικατερίνη Ταράση

Ανοσιακή απάντηση Αικατερίνη Ταράση Ανοσιακή απάντηση Αικατερίνη Ταράση ιευθύντρια Τµ. Ανοσολογίας- Ιστοσυµβατότητας Γ.Ν.Α.. " Ο Ευαγγελισµός" ανοσιακή απάντηση είναι το σύνολο των πολύπλοκων διεργασιών µε τις οποίες ο οργανισµός (ξενιστής)

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Φαρµακευτική Ανοσολογία

Φαρµακευτική Ανοσολογία Φαρµακευτική Ανοσολογία 1. Εισαγωγή (κυρίως στην επίκτητη ανοσία) 2. Φυσική ανοσία ΕΠΙΚΤΗΤΗ ΑΝΟΣΙΑ ΑΝΤΙΓΟΝΟ 3. Η πρόσληψη του αντιγόνου και η παρουσίασή του στα λεµφοκύτταρα 4. Η αναγνώριση του αντιγόνου.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Παθοφυσιολογία Ι

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Παθοφυσιολογία Ι ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Παθοφυσιολογία Ι Ανοσολογία - Ρευματολογία Υπεύθυνος μαθήματος: Καθηγητής Παθολογίας/Ρευματολογίας, Αλέξανδρος Α. Δρόσος Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης

Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Επίδραση και άλλων παραγόντων στην Αλλοστερική συμπεριφορά της Αιμοσφαιρίνης Καθώς το οξυγόνο χρησιμοποιείται στους ιστούς παράγεται CO2 το οποίο πρέπει να μεταφερθεί πίσω στους πνεύμονες ή τα βράγχια

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

Μοριακή κυτταρική βιοχημεία Ανοσοποιητικό σύστημα

Μοριακή κυτταρική βιοχημεία Ανοσοποιητικό σύστημα Μοριακή κυτταρική βιοχημεία Ανοσοποιητικό σύστημα κωδικός μαθήματος: ETY-335 Χειμερινό εξάμηνο 2014 / 2015 Μαρία Χατζηνικολαΐδου mchatzin@materials.uoc.gr Έμφυτο και προσαρμοστικό ανοσοποιητικό σύστημα

Διαβάστε περισσότερα

Κεφάλαιο 4 ο ΑΙΜΑ ΜΑΡΙΑ ΣΗΦΑΚΗ ΣΤΟΙΧΕΙΑ ΑΝΑΤΟΜΙΑΣ - ΦΥΣΙΟΛΟΓΙΑΣ ΙΙ 1

Κεφάλαιο 4 ο ΑΙΜΑ ΜΑΡΙΑ ΣΗΦΑΚΗ ΣΤΟΙΧΕΙΑ ΑΝΑΤΟΜΙΑΣ - ΦΥΣΙΟΛΟΓΙΑΣ ΙΙ 1 Κεφάλαιο 4 ο ΑΙΜΑ ΜΑΡΙΑ ΣΗΦΑΚΗ ΣΤΟΙΧΕΙΑ ΑΝΑΤΟΜΙΑΣ - ΦΥΣΙΟΛΟΓΙΑΣ ΙΙ 1 Το αίμα Έχει όγκο περίπου 5 λίτρα Αποτελείται από Πλάσμα (55%) Είναι νερό και διαλυμένες ουσίες Πρωτεΐνες Ορμόνες Άλατα Άλλες θρεπτικές

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ II ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2010 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας

Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας Φυσική / επίκτητη Ανοσία Συστατικά του ΑΣ / κύτταρα του ΑΣ Φυσικη ανοσία / φλεγμονή Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ Χρειάζεται η µελέτη της ανοσολογία; Εµβόλια Άµυνα κατά µικροοργανισµών Ανοσολογικές ασθένειες Αλλεργίες - υπερευαισθησίες, αυτοανοσίες, ανοσοανεπάρκειες,

Διαβάστε περισσότερα

Βιολογία γενικής παιδείας τάξη Γ

Βιολογία γενικής παιδείας τάξη Γ Βιολογία γενικής παιδείας τάξη Γ Παραδόσεις του μαθήματος Επιμέλεια: Γιάννης Αργύρης Βιολόγος M.Sc. Καθηγητής 3 ου Γεν. Λυκ. Ηλιούπολης Κεφάλαιο 1ο Άνθρωπος και υγεία 2. Μηχανισμοί Άμυνας του Ανθρώπινου

Διαβάστε περισσότερα

ΚΥΤΤΑΡΟΜΕΤΡΙΑ ΡΟΗΣ FLOW CYTOMETRY

ΚΥΤΤΑΡΟΜΕΤΡΙΑ ΡΟΗΣ FLOW CYTOMETRY ΚΥΤΤΑΡΟΜΕΤΡΙΑ ΡΟΗΣ FLOW CYTOMETRY ΚΥΤΤΑΡΟΜΕΤΡΙΑ ΡΟΗΣ Γενικά χαρακτηριστικά Απεικόνιση των κυτταρικών πληθυσμών με βάση: το μέγεθος την κοκκίωση το φθορισμό ΚΥΤΤΑΡΟΜΕΤΡΙΑ ΡΟΗΣ Υδροδυναμική ροή Πρόσθιος

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Μαριάννα Τζανουδάκη Τμήμα Ανοσολογίας & Ιστοσυμβατότητας Γ.Ν. Παίδων «Η Αγία Σοφία»

Μαριάννα Τζανουδάκη Τμήμα Ανοσολογίας & Ιστοσυμβατότητας Γ.Ν. Παίδων «Η Αγία Σοφία» ΙΙΙβ. Τ Οξεία Λεμφοβλαστική Λευχαιμία (T ALL) και Yπολειμματική Νόσος (ΜRD) Μαριάννα Τζανουδάκη Τμήμα Ανοσολογίας & Ιστοσυμβατότητας Γ.Ν. Παίδων «Η Αγία Σοφία» Η ωρίμανση των Τ λεμφοκυττάρων Τ και Β Λεμφοκύτταρα

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ

ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΕΡΓΑΣΤΗΡΙΑΚΕΣ ΙΑΓΝΩΣΕΙΣ ΚΑΙ ΕΞΕΤΑΣΕΙΣ ΑΝΟΣΟΦΘΟΡΙΣΜΟΣ Εισαγωγή Ο ανοσοφθορισµός είναι η µέθοδος κατά την οποία χρησιµοποιούνται φθορίζοντα αντισώµατα για την ανίχνευση και εντόπιση αντιγόνου ή αντισώµατος

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2003 ÏÅÖÅ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ÈÅÌÁÔÁ 2003 ÏÅÖÅ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2003 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. 1.β 2.δ 3.γ Β. 1. ΛΑΘΟΣ (2 µονάδες) Γ. 2. ΛΑΘΟΣ (2 µονάδες) 3. ΛΑΘΟΣ (2 µονάδες) 4. ΣΩΣΤΟ (2 µονάδες) 5. ΣΩΣΤΟ (2 µονάδες) ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ. ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ

ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ. ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ ΘΕΩΡΙΑ 3 η ΠΑΡΟΥΣΙΑΣΗ ΚΥΤΤΑΡΟΚΙΝΕΣ ή ΚΥΤΤΟΚΙΝΕΣ Dr ΠΑΠΑΓΙΑΝΝΗΣ ΔΗΜΗΤΡΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΩΝ ΕΡΓΑΣΤΗΡΙΩΝ ΤΕΙ ΘΕΣΣΑΛΙΑΣ Είδαμε ότι οι ΜΗΧΑΝΙΣΜΟΙ ΜΗ ΕΙΔΙΚΗΣ ΑΝΟΣΙΑΣ είναι 1. Ανατομικοί φραγμοί - Δέρμα - Βλεννώδεις

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Α1=β,

Διαβάστε περισσότερα

των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων»

των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων» Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Διδακτορική Διατριβή «Ανάλυση των αναδιατάξεων των γονιδίων των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων» Ανδρέας

Διαβάστε περισσότερα

Αντιγόνο και ανοσογόνο

Αντιγόνο και ανοσογόνο Αντιγόνο Κάθε ουσία που ερχόμενη σε επαφή με μια ειδική κατηγορία πρωτεϊνικών μορίων, τα αντισώματα, ή με μια ειδική στερεοδομή, τον υποδοχέα του Τ-λεμφοκυττάρου, μπορεί να αντιδράσει στερεοχημικά με αυτά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Ανοσολογία. Ο Τ κυτταρικός υποδοχέας (TCR) Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ. Ανοσολογία. Ο Τ κυτταρικός υποδοχέας (TCR) Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ανοσολογία Ο Τ κυτταρικός υποδοχέας (TCR) Διδάσκων: Αναπληρωτής Καθηγητής Γεώργιος Θυφρονίτης Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΥΠΟΠΛΗΘΥΣΜΟΙ Τ ΛΕΜΦΟΚΥΤΤΑΡΩΝ. Αλεξάνδρα Φλέβα Ph.D Βιολόγος Τμήμα Ανοσολογίας-Ιστοσυμβατότητας Γ.Ν. «Παπαγεωργίου»

ΥΠΟΠΛΗΘΥΣΜΟΙ Τ ΛΕΜΦΟΚΥΤΤΑΡΩΝ. Αλεξάνδρα Φλέβα Ph.D Βιολόγος Τμήμα Ανοσολογίας-Ιστοσυμβατότητας Γ.Ν. «Παπαγεωργίου» ΥΠΟΠΛΗΘΥΣΜΟΙ Τ ΛΕΜΦΟΚΥΤΤΑΡΩΝ Αλεξάνδρα Φλέβα Ph.D Βιολόγος Τμήμα Ανοσολογίας-Ιστοσυμβατότητας Γ.Ν. «Παπαγεωργίου» Η αξιοποίηση του εύρους των δυνατοτήτων της κυτταρομετρίας ροής στην Ανοσολογία προσφέρει

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Το 1928 ο Griffith χρησιµοποίησε δύο στελέχη του βακτηρίου πνευµονιόκοκκος (Dίplococcus pneumoniae),τα οποία ξεχωρίζουν µορφολογικά, όταν καλλιεργηθούν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο 1 γ 2 δ 3 β 4 α 5 γ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ Μονάδες 25 (5Χ5) Α. ιαγονιδιακά ζώα ονοµάζονται εκείνα στα οποία το γενετικό τους υλικό έχει τροποποιηθεί µε την

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Ηλεκτροφόρηση πρωτεϊνών

Ηλεκτροφόρηση πρωτεϊνών Ηλεκτροφόρηση πρωτεϊνών Φυσιολογικές (Μη- µετουσιωτικές) Συνθήκες Μέγεθος Σχήµα Φορτίο Μετουσιωτικές Συνθήκες Μέγεθος Αρχή της Μεθόδου Κάλυµµα από µόρια SDS Πολυπεπτιδική Αλυσίδα ιάλυµα πρωτεϊνών σε SDS

Διαβάστε περισσότερα

Βιολογία. Θετικής Κατεύθυνσης

Βιολογία. Θετικής Κατεύθυνσης Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΊΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΈΝΟΥ DNA Γενετική Μηχανική 3 Είναι ο κλάδος της Βιολογίας που περιλαμβάνει τις τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΜΑΤΑ 1.Πώς οι κινητικές παράμετροι Κ m και K cat χρησιμεύουν για να συγκριθεί η ανακύκλωση διαφορετικών

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΚΛΩΝΙΚΗ ΕΠΙΛΟΓΗ ΚΥΤΤΑΡΑ ΜΝΗΜΗΣ (ΕΠΙΒΙΩΣΗ ΕΚΑΕΤΙΕΣ)

ΚΛΩΝΙΚΗ ΕΠΙΛΟΓΗ ΚΥΤΤΑΡΑ ΜΝΗΜΗΣ (ΕΠΙΒΙΩΣΗ ΕΚΑΕΤΙΕΣ) ΚΛΩΝΙΚΗ ΕΠΙΛΟΓΗ ANTIΓΟΝΟ ΑΡΧΙΚΗ ΕΞΑΜΕΝΗ ΛΕΜΦΟΚΥΤΤΑΡΩΝ (ΑΝΕΞΆΡΤΗΤΗ ΑΝΤΙΓΟΝΟΥ} ΕΠΙΛΟΓΗ ΚΛΩΝΟΥ (ΠΑΡΟΥΣΙΑ ΑΝΤΙΓΟΝΟΥ) ΑΥΞΗΣΗ ΑΡΙΘΜΟΥ ΩΡΙΜΑΝΣΗ ΑΝΤΙΣΩΜΑ ΕΚΤΕΛΕΣΤΙΚΑ ΚΥΤΤΑΡΑ (ΕΠΙΒΙΩΣΗ ΜΕΡΙΚΕΣ ΜΕΡΕΣ) ΚΥΤΤΑΡΑ ΜΝΗΜΗΣ

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Ανοσοποιητικό σύστημα Λεμφικά όργανα. Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας

Ανοσοποιητικό σύστημα Λεμφικά όργανα. Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας Ανοσοποιητικό σύστημα Λεμφικά όργανα Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας Λειτουργία ανοσοποιητικού λεμφικού συστήματος Προστασία του σώματος

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΑΝΑΔΙΑΤΑΞΕΩΝ ΤΩΝ ΓΟΝΙΔΙΩΝ ΤΗΣ. κ- ΕΛΑΦΡΙΑΣ ΑΛΥΣΙΔΑΣ ΤΩΝ ΑΝΟΣΟΣΦΑΙΡΙΝΩΝ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΧΡΟΝΙΑ ΛΕΜΦΟΚΥΤΤΑΡΙΚΗ ΛΕΥΧΑΙΜΙΑ ΚΑΙ ΠΟΛΛΑΠΛΟΥΝ ΜΥΕΛΩΜΑ

ΜΕΛΕΤΗ ΑΝΑΔΙΑΤΑΞΕΩΝ ΤΩΝ ΓΟΝΙΔΙΩΝ ΤΗΣ. κ- ΕΛΑΦΡΙΑΣ ΑΛΥΣΙΔΑΣ ΤΩΝ ΑΝΟΣΟΣΦΑΙΡΙΝΩΝ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΧΡΟΝΙΑ ΛΕΜΦΟΚΥΤΤΑΡΙΚΗ ΛΕΥΧΑΙΜΙΑ ΚΑΙ ΠΟΛΛΑΠΛΟΥΝ ΜΥΕΛΩΜΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΤΟΜΕΑΣ: Βασικών Επιστημών ΕΡΓΑΣΤΗΡΙΟ: Βιολογίας ΔΙΕΥΘΥΝΤΗΣ: Καθ. Ν.Βαμβακόπουλος ΜΕΛΕΤΗ ΑΝΑΔΙΑΤΑΞΕΩΝ ΤΩΝ ΓΟΝΙΔΙΩΝ ΤΗΣ κ- ΕΛΑΦΡΙΑΣ ΑΛΥΣΙΔΑΣ ΤΩΝ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 8 Ο ΚΕΦΑΛΑΙΟ ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ 5ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΙΛΙΟΥ 1 8. Εφαρμογές της Βιοτεχνολογίας στην Ιατρική Φαρμακευτικές πρωτεΐνες Τι είναι οι φαρμακευτικές

Διαβάστε περισσότερα

ΘΕΡΑΠΕΙΑ ΑΥΤΟΑΝΟΣΩΝ ΝΟΣΗΜΑΤΩΝ ΠΑΡΟΝ ΚΑΙ ΜΕΛΛΟΝ Αθανάσιος Γ. Τζιούφας Παθολογική Φυσιολογία Ιατρική Σχολή Παν. Αθηνών Costa Navarino 26/6/2011

ΘΕΡΑΠΕΙΑ ΑΥΤΟΑΝΟΣΩΝ ΝΟΣΗΜΑΤΩΝ ΠΑΡΟΝ ΚΑΙ ΜΕΛΛΟΝ Αθανάσιος Γ. Τζιούφας Παθολογική Φυσιολογία Ιατρική Σχολή Παν. Αθηνών Costa Navarino 26/6/2011 ά ς. ύ ς ή ί ή ή. ώ Costa Navarino 26/6/2011 ά ή : ίπ 5% ύ π ύ ά- ά ή ά ή ά ή/ ώ - ά ή : ό ή ά π ό π ί ς ό έ - π ά ά ς- έ ς ά ής π ί ς ύ- ύς ό ς ής π ί ς ς ό ύ ά ά ή ί έ ς π ύς ί ς ή ή ς ής ής Ά ώ π ή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΑΝΟΣΟΛΟΓΙΑ ΘΕΩΡΙΑ 1 Ο ΜΑΘΗΜΑ

ΑΝΟΣΟΛΟΓΙΑ ΘΕΩΡΙΑ 1 Ο ΜΑΘΗΜΑ ΑΝΟΣΟΛΟΓΙΑ ΘΕΩΡΙΑ 1 Ο ΜΑΘΗΜΑ ΑΝΟΣΙΑ Η ανοσία (α- στερητικό + νόσος) είναι η ικανότητα ενός οργανισμού να αμύνεται ενάντια σε κάποιον εξωτερικό βλαπτικό παράγοντα και να μην υφίσταται τις συνέπειές του.

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΗΤΑΛΑΣ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΗΤΑΛΑΣ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΚΕΦΑΛΑΙΟ 1.3 : ΜΗΧΑΝΙΣΜΟΙ ΑΜΥΝΑΣ ΤΟΥ ΑΝΘΡΩΠΙΝΟΥ ΟΡΓΑΝΙΣΜΟΥ ΒΑΣΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΙΑΣ ΘΕΜΑ 1 Χαρακτηρίστε τις προτάσεις ως σωστές ή λανθασµένες. 1. Οι βλεννογόνοι

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα