Αντιγόνα & Ανοσοσφαιρίνες

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Αντιγόνα & Ανοσοσφαιρίνες"

Transcript

1 Αντιγόνα & Ανοσοσφαιρίνες

2 Ανοσολογικά χαρακτηριστικά των αντιγόνων I Τα αντιγόνα είναι ουσίες ικανές να επάγουν ειδική ανοσιακή απάντηση (ανοσογόνα) Ανοσογονικότητα (immunogenicity) ικανότητα επαγωγής ανοσιακής απάντησης (χυµικής και/ή κυτταρικής) όταν εισέρχονται στον οργανισµό Η ανοσογονικότητα εξαρτάται από το ίδιο το αντιγόνο τις βιολογικές συνθήκες του συστήµατος Ιδιότητα του «ξένου» Mοριακό βάρος Χηµική δοµή υνατότητα αποδόµησης από τα ένζυµα των µακροφάγων Γενετικοί παράγοντες Η δόση & η οδός χορήγησης

3 Ανοσολογικά χαρακτηριστικά των αντιγόνων II Αντιγονικότητα (antigenicity) ικανότητα ειδικής σύνδεσης µε τα τελικά προϊόντα της ανοσιακής απάντησης, ανεξάρτητα από ανοσογονικότητα Μόρια του ανοσιακού συστήµατος που χρησιµοποιούνται για την ειδική αναγνώριση αντιγόνων: Ανοσοσφαιρίνες Μόρια του MHC Υποδοχείς των Τ λεµφοκυττάρων (TcR) Αλλεργιογονικότητα (allerogenicity) ικανότητα επαγωγής αλλεργικών αντιδράσεων Ικανότητα επαγωγής ανοσιακής ανοχής (toloerogenicity)ιδιότητα των αντιγόνων να καταστέλλουν την ειδική ανοσιακή απάντηση

4 Αντιγονικός καθοριστής (antigenic determinant) ή επίτοπος Η περιοχή του µορίου του αντιγόνου που συνδέεται µε αντισώµατα ή υποδοχείς στην επιφάνεια των λεµφοκυττάρων ιαφορετικοί επίτοποι Όµοιοι επίτοποι Πολυσθενές αντιγόνο Οι επίτοποι που αναγνωρίζονται από τα Β- λεµφοκύτταρα -αµινοξέα της επιφάνειας πρωτεϊνών -απαρτίζονται από συνεχόµενα και µη συνεχόµενα αµινοξέα της πρωτεϊνικής αλληλουχίας -είναι δυνατό να σχηµατιστούν µετά φωσφορυλλίωση ή πρωτεόλυση --ορισµένοι επίτοποι επιτυγχάνουν να είναι ανοσογονικοί κάποιοι επίτοποι ενός αντιγόνου επάγουν ισχυρότερη ανοσιακή απόκριση από τους υπόλοιπους του ίδιου µορίου: ανοσοεπικρατικοί (immunodominant)

5 Απτίνες Ουσίες που εµφανίζουν αντιγονικότητα χωρίς να είναι ανοσογόνες, αποκτούν ανοσογονικότητα όταν συνδέονται µε µακροµοριακές πρωτεϊνες (φορείς). Στο σύµπλεγµα φορέα απτίνης οι επίτοποι αποτελούνται από την απτίνη το φορέα την απτίνη και το φορέα Η σύνδεση της δινιτροφαινόλης µε πρωτεϊνικό φορέα προκαλεί την παραγωγή διαφορετικών ειδών αντισωµάτων. Πολλά από τα αντισώµατα αυτά αντιδρούν ειδικά µε την οµάδα της διντριφαινόλης

6 Ανοσοσφαιρίνες Μόρια του ανοσιακού συστήµατος που χρησιµοποιούνται για την ειδική αναγνώριση αντιγόνων: Ανοσοσφαιρίνες Μόρια του MHC Υποδοχείς των Τ λεµφοκυττάρων (TcR)

7 Οι ανοσοσφαιρίνες αναγνωρίζουν µεγάλο εύρος αντιγονικών δοµών διακρίνουν διαφορετικά αντιγόνα συνδέονται µε τα αντιγόνα µε µεγάλη ισχύ Παράγονται από τα Β λεµφοκύτταρα Μεµβρανικές και διαλυτές πρωτεΐνες Εντοπίζονται στην κυτταροπλασµατική µεµβράνη & σε συνδεόµενα µε αυτή οργανίδια στο πλάσµα & στο διάµεσο υγρό των ιστών στην επιφάνεια ανοσοδραστικών κυττάρων που έχουν υποδοχείς για αυτές σε ορισµένες εκκρίσεις

8 Κοινή δοµική µονάδα 2 ελαφρές αλυσίδες (light chains, L) 2 βαριές αλυσίδες (heavy chains, H) Η µοριακή δοµή των ανοσοσφαιρινών H 2 L 2 Ισότυποι αλυσίδων L:κ, λ H:γ, α, µ, δ, ε Ισότυποι ανοσοσφαιρινών: IgG (IgG1, IgG2, IgG3, IgG4) IgA (IgA1, IgA2) IgM IgD IgE ιδιότητες αντισωµάτων κάθε τάξης

9 Οι αλυσίδες των ανοσοσφαιρινών αποτελούνται από επαναλαµβανόµενα τµήµατα Οµόλογα τµήµατα µήκους aa (πεδία) Μεταβλητή περιοχή-v (αµινοτελικά πεδία): ποικιλοµορφία στην πρωτοταγή αµινοξική αλληλουχία Σταθερές περιοχές- C όµοια αµινοξική αλληλουχία για κάθε ισότυπο µία στις L τρεις (C H 1-3)στις γ, α, δ H αλυσίδες τέσσσερις (C H 1-4)στις µ,ε H αλυσίδες IgG Περιοχή µεταστροφής: σύνδεση V µε C- περιοχές Αρθρωτή περιοχή: εύκαµπτη περιοχή µεταξύ των πεδίων C H 1και C H 2

10 Υπερµεταβλητές Περιοχές Τρεις µικρότερες περιοχές 10aa στην µεταβλητή περιοχή Θέση σύνδεσης του αντιγόνου Η ακριβής αµινοξική αλληλουχία των έξι υπερµεταβλητών περιοχών είναι ο κυριότερος από τους παράγοντες που καθορίζουν την ειδικότητα των αντισωµάτων για συγκεκριµένα αντιγόνα

11

12 Πολυµερή Ανοσοσφαιρινών IgM IgA

13 Λειτουργικά τµήµατα ανοσοσφαιρινών Κατά την πρωτεολυτική διάσπαση της IgG προκύπτουν: Fab τµήµα:διατηρεί την ικανότητα σύνδεσης µε το αντιγόνο Fc τµήµα: µεσολαβεί τις περισσότερες από τις ανοσοδραστικές λειτουργίες

14 Η σύνδεση αντισώµατος-αντιγόνου Α. µπορεί να προκαλέσει συγκόλληση καθίζηση εξουδετέρωση λύση (άµεση επίδραση) εξουδετερωτικά αντισώµατα Βιολογική δράση των Αντισωµάτων ή Β. εκδηλώνεται µέσω της κινητοποίησης άλλων ανοσοδραστικών συστηµάτων ειδικά για κάθε τάξη και υποτάξη των ανοσοσφαιρινών υπεύθυνα είναι τα Fc-τµήµατα των αντισωµάτων (ενεργοποίηση της κλασικής οδού του συµπληρώµατος, αλληλεπίδραση µε µεµβρανικούς Fc- υποδοχείς)

15 Οι κυριότερες λειτουργίες των πέντε τάξεων των ανοσοσφαιρινών IgM IgG IgA IgE IgD Η πρώτη ανοσοσφαιρίνη που παράγεται κατά την πρωτογενή ανοσιακή απάντηση Έχει µικρή χηµική συγγένεια αλλά µεγάλη συνάφεια µε τα πολυσθενή αντιγόνα Ενεργοποιεί την κλασική οδό του συµπληρώµατος Η κύρια ανοσοσφαιρίνη του ορού Η µόνη που διέρχεται τον πλακούντα Ενεργοποιεί την κλασική οδό του συµπληρώµατος Η κύρια ανοσοσφαιρίνη των εκκρίσεων Κινητοποιεί φλεγµονώδεις αντιδράσεις, µέσω ειδικών υποδοχέων των σιτευτικών κυττάρων και των βασεόφιλων. Ενεργοποιεί ανοσοδραστικούς µηχανισµούς έναντι των εντερικών παρασίτων Ασαφής ρόλος, µεµβρανικός υποδοχέας για το αντιγόνο

16 Μεµβρανικοί Υποδοχείς για τα Fc-τµήµατα της IgG Οι Fc γ R µεσολαβούν στη φαγοκυττάρωση ανοσοσυµπλεγµάτων και οψονινοποιηµένων µε IgG σωµατίων. διευκολύνουν την προσκόλληση των αντιγονικών σωµατών στη µεµβράνη των φαγοκυττάρων στην επιφάνεια των Β-λεµφοκυττάρων συνδέονται µε IgGανοσοσυµπλέγµατα και αναστέλλουν την ενεργοποίηση τους (µεσολαβούµενη από το αντίσωµα παλίνδροµη αναστολή)

17 Μεµβρανικοί Υποδοχείς για τα Fc-τµήµατα της IgΕ Τα σιτευτικάκύτταρα και τα βασεόφιλαεκφράζουν τους υψηλής συγγένειας Fc ε RI Αντίδραση άµεσης υπερευαισθησίας Σύνδεση Fc ε RIµε IgΕ (απουσία αντιγόνου) Συνάθροιση Fc ε RIκαι IgΕ παρουσία ειδικού αντιγόνου Απελευθέρωση µεσολαβητών φλεγµονής (ισταµίνη) από τα αποθηκευτικά κοκκία των σιτευτικών κυττάρων και βασεόφιλων Σύνθεση λιπιδικής προέλευσης µεσολαβητών και κυτταροκινών

18 Μεµβρανικοί Υποδοχείς για την εκκριτική IgΑ Τοπική ανοσία των βλενογόνων: Τα επιθηλιακά κύτταρα των οργάνων που καλύπτονται από βλενογόνους (έντερο, σιελογόνοι αδένες, βρόγχοι ) εκφράζουν FcR για διµερή IgA (Fc α R-εκκριτική πρωτεΐνη) Έκκριση της IgA Σύνδεση Fc α Rµε τη διµερή IgAστη βασική επιφάνεια των επιθηλιακών κυττάρων επαφή µε αίµα Ενδοκύτοση του συµπλόκου Fc α R - IgA Μεταφορά διαµέσου του επιθηλιακού κυττάρου µε κυστίδια Απελευθέρωση στον αυλό Προηγείται: διάσπαση του µορίου της εκκριτικής πρωτεϊνης & το εκκριτικό τµήµατης παραµένει συνδεδεµένο µε το διµερές IgA που απελευθερώνεται

19 ράση της εκκριτικής IgA Καθήλωση των αντιγόνων στο βλεννογόνο και αποδόµηση από πρωτεάσες πριν εισέλθουν στα επιθηλιακά κύτταρα Ανοσιακός αποκλεισµός ( αποκλεισµός αντιγόνων από τη συστηµατική κυκλοφορία και πρόληψη βλαπτικών ανοσιακών µηχανισµών) Η IgA συντίθεται σχεδόν αποκλειστικά από πλασµατοκύτταρα στα οζίδια των βλεννογόνων Η εκκριτική πρωτεΐνη συντίθεται στα επιθηλιακά κύτταρα ανεξάρτητα από την παρουσία IgA Η περίσσεια της εκκριτικής πρωτεΐνης εκκρίνεται µε τη µορφή ελεύθερων µορίων

20 Νεογνική ανοσία Η ανάπτυξη του ανοσιακού συστήµατος του νεογνού είναι ατελής Το µητρικό γάλα παρέχει στο νεογνό χυµικούς και κυτταρικούς παράγοντες Μητρική IgG Εκατοστιαίο ποσοστό συγκέντρωσης ενηλίκου Γέννηση Ηλικία (µήνες) IgA: IgG: παράγεται από Β-κύτταρα που µεταναστεύουν στο µαστό η έκκριση µεσολαβείται από την εκκριτική πρωτεΐνη των επιθηλιακών κυττάρων του αδένα µεταφέρεται στο έντερο του νεογνού δρα µέσω ανοσιακού αποκλεισµού υψηλά επίπεδα µητρικών IgG πριν από τη γέννηση πέφτουν µετά τη γέννηση (3 µήνες) παραγωγή από το βρέφος

21 Ετερογένεια των Αντισωµάτων Τουλάχιστον 10 5 ανοσοσφαιρινικά µόρια µοναδικής αντιγονικής ειδικότητας Η τεράστια ετερογένεια των αντισωµάτων είναι αποτέλεσµα: της µοριακής δοµής των ανοσοσφαιρινών της δοµής των γονιδίων των ανοσοσφαιρινών της ικανότητας των Β-λεµφοκυττάρων να σχηµατίζουν και να τροποποιούν τα γονίδια αυτά αναδιατάσσοντας το χρωµοσωµικό τους DNA The Nobel Prize in Physiology or Medicine 1987 was awarded to Susumu Tonegawa "for his discovery of the genetic principle for generation of antibody diversity".

22 Μοριακή δοµή των ανοσοσφαιρινών Η αντιγονικήειδικότητα των αντισωµάτων καθορίζεται από την αµινοξικήαληλλουχίατων Vπεριοχών των H και L αλυσίδων. Ο συνδυασµός των H µε τις L αλυσίδες αποτελεί το πρώτο επίπεδο που εξασφαλίζει τον µεγάλο αριθµό θέσεων σύνδεσης του αντιγόνου

23 Τα γονίδια των ελαφρών αλυσίδων κ- αλυσίδες (χρωµόσωµα 2) Μη λεµφικά κύτταρα σταθερό πεδίο: 1 εξόνιο Cκ Μεταβλητό πεδίο: 2 τµήµατα µεταβλητό Vκ (περίπου 100) συνδετικό Jκ (5) Στα ενταγµένα κύτταρα της Β-σειράς: -επιλογή και σύντηξη ενός Vκ και ενός Jκ τµήµατος Μεταγραφή Συρραφή Μετάφραση λ-αλυσίδες (χρωµόσωµα 22) 6-9 Cλ εξόνια καθένα συνορεύει µε ένα Jλ τµήµα

24 Μηχανισµός αναδιάταξης του γονιδίου των κ-αλυσίδων Οι αναδιατάξεις επισυµβαίνουν σε συγκεκριµένες περιοχές (ανασυνδυαστικές αλληλουχίες) Ανάλογα µε τον προσανατολισµό των V τµηµάτων µε τα υπόλοιπα τµήµατα -εξάλειψη -αναστροφή Τα υπεύθυνα V/(D)/J αποδιατακτικά ένζυµα -υπάρχουν µόνο στα Β- και Ταλεµφοκύτταρα, Και -είναι ενεργά µόνο κατά τα πρώιµα στάδια της διαφοροποίησής τους

25 Τα γονίδια των βαριών αλυσίδων Μία περιοχή στο χρωµόσωµα 14 Οι αλληλουχίες των σταθερών περιοχών διατάσσονται σε 1 αντίγραφο καθεµία Επιπλέον : τµήµα ετερογένειας (D H ), 2-3 αµινοξέα 2 αναδιατάξεις

26 Ισοτυπική µεταστροφή των βαριών αλυσίδων Μετά την αναδιάταξη το εξόνιο V/D/J µταγράφεται µαζί µε το γειτονικό C µ εξόνιο Τα εξόνια των άλλων ισοτύπων των βαριών αλυσίδων (µε εξαίρεση το C δ ) δεν µεταγράφονται Απαιτείται διαφορετική αναδιάταξη: ισοτυπική µεταστροφή Η ισοτυπική µεταστροφή δεν επηρεάζει την αντιγονική ιδιότητα του αντισώµατος Μεταβάλλεται η βιολογική δράση Μη αναστρέψιµη διαδικασία Η επιλογή ενός νέου C Η ισότυπου επηρεάζεται από κυτταροκίνες και άλλους παράγοντες που δρουν στα Β-λεµφοκύτταρα

27 Αναδιατάξεις των γονιδίων των ανοσοσφαιρινών και οντογένεση των Β-κυττάρων Αρχικά στάδια ωρίµανσης των Β-λεµφοκυττάρων Ακολουθούν αυστηρή σειρά αναδιάταξη των γονιδίων των βαριών αλυσίδωνταυτόχρονα και στα δύο χρωµοσώµατα επίτευξη λειτουργικού γονιδίου παραγωγή µ αλυσίδων-παραµένουν στο κυτταρόπλασµα αναστολή περαιτέρω αναδιατάξεων στα γονίδια των βαρίων αλυσίδων αναδιατάξεις των ελαφρών αλυσίδων σχηµατισµός κ- ή λ- λειτουργικού γονιδίου παραγωγή ελαφρών αλυσίδων αναστολή αναδιατάξεων έκφραση στη µεµβράνη µορίων ανοσοσφαιρίνης (Β-κύτταρο) Αλληλικός αποκλεισµός- κλωνικός περιορισµόςισοτυπική µεταστροφή

28 Σφάλµατα στην αναδιάταξη των γονιδίων των ανοσοσφαιρινών Ανάπτυξη λευχαιµιών και λεµφωµάτων Λέµφωµα Burkitt το πρωτο-ογκογονίδιο c-mycµετατίθεται στον τόπο των βαριών αλυσίδων µετάθεση t(8,14) µετάθεση του c-mycστα γονίδια των ελαφρών αλυσίδων (2 ή 22) Λεµφοζιδιακό λέµφωµα το πρωτο-ογκογονίδιο bcl-2µετατίθεται στον τόπο των βαριών αλυσίδων µετάθεση t(14,18)

Αντιγόνο. ξένη) με μια σχετικά ισχυρή δύναμη σύνδεσης.

Αντιγόνο. ξένη) με μια σχετικά ισχυρή δύναμη σύνδεσης. Αντιγόνα Αντισώματα Αντιγόνο Ως αντιγόνο ορίζεται κάθε ουσία που προέρχεται από το εξωτερικό ή εσωτερικό περιβάλλον και είναι ικανή να αντιδράσει με τα προϊόντα της ανοσιακής απάντησης (αναγνωρίζεται από

Διαβάστε περισσότερα

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ

ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ. Εργαστήριο Γενετικής, ΓΠΑ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ ΕΜΒΟΛΙΑ Στάδια μικροβιακής λοίμωξης δημιουργία αποικίας σε εξωτερική επιφάνεια διείσδυση στον οργανισμό τοπική μόλυνση συστηματική (γενικευμένη) μόλυνση H σημασία

Διαβάστε περισσότερα

Ανοσιακή απάντηση Αικατερίνη Ταράση

Ανοσιακή απάντηση Αικατερίνη Ταράση Ανοσιακή απάντηση Αικατερίνη Ταράση ιευθύντρια Τµ. Ανοσολογίας- Ιστοσυµβατότητας Γ.Ν.Α.. " Ο Ευαγγελισµός" ανοσιακή απάντηση είναι το σύνολο των πολύπλοκων διεργασιών µε τις οποίες ο οργανισµός (ξενιστής)

Διαβάστε περισσότερα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα

Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα Επίκτητη Ανοσιακή Απάντηση (χυμικό σκέλος) Β λεμφοκύτταρα φυσική ή μη ειδική ανοσία δεν απαιτεί προηγούμενη έκθεση στο παθογόνο και δεν διαθέτει μνήμη. σε επίκτητη ή ειδική ανοσία χυμική ανοσία με παραγωγή

Διαβάστε περισσότερα

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010

ΑΝΟΣΟΒΙΟΛΟΓΙΑ. Εξεταστική Ιανουαρίου 2010 Εξεταστική Ιανουαρίου 2010 Ποιες είναι οι διαφορές μιας πρωτογενούς από μια δευτερογενή χυμική ανοσολογική απόκριση; Περιγράψετε τους μηχανισμούς ενεργοποίησης στις δυο περιπτώσεις. ΘΕΜΑ 2 (1 μονάδα) Περιγράψετε

Διαβάστε περισσότερα

οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά

οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά οµή Ανοσιακού Συστήµατος Ελένη Φωτιάδου-Παππά Τµήµα Ανοσολογίας Γ.Ν. Νίκαιας-Πειραιά Ανοσολογικό σύστηµα Βασικό σύστηµα του οργανισµού Λειτουργικές µονάδες του ανοσολογικού συστήµατος Οργανωµένος λεµφικός

Διαβάστε περισσότερα

Ανοσιακή απάντηση (immune response)

Ανοσιακή απάντηση (immune response) Ανοσιακή απάντηση (immune response) Το σύνολο των μηχανισμών που καθιστούν τον οργανισμό ικανό να αναγνωρίζει,να εξουδετερώνει και να απομακρύνει κάθε ξένη ουσία προς αυτόν χαρακτηρίζεται ως ανοσία. Αποτέλεσμα

Διαβάστε περισσότερα

Βιολογία γενικής παιδείας τάξη Γ

Βιολογία γενικής παιδείας τάξη Γ Βιολογία γενικής παιδείας τάξη Γ Παραδόσεις του μαθήματος Επιμέλεια: Γιάννης Αργύρης Βιολόγος M.Sc. Καθηγητής 3 ου Γεν. Λυκ. Ηλιούπολης Κεφάλαιο 1ο Άνθρωπος και υγεία 2. Μηχανισμοί Άμυνας του Ανθρώπινου

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ

ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ ΕΡΩΤΗΣΕΙΣ ΣΩΣΤΟΥ - ΛΑΘΟΥΣ. ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ 1. Η πήξη του αίματος συμβάλλει στην άμυνα του οργανισμού 2. Η φαγοκυττάρωση είναι αποτελεσματική μόνο έναντι των βακτηρίων 3. Οι ιντερφερόνες δρουν άμεσα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Συγκρίνατε την πρωτογενή µε τη δευτερογενή ανοσοβιολογική απόκριση και απεικονίστε αυτές στο ίδιο διάγραµµα αξόνων. Πρωτογενή ανοσοβιολογική απόκριση ονοµάζουµε την απόκριση του

Διαβάστε περισσότερα

ΑΝΤΙΓΟΝΑ. Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ

ΑΝΤΙΓΟΝΑ. Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ ΑΝΤΙΓΟΝΑ Antigens Ags Aπτίνες Ετερόφιλα αντιγόνα Ομάδες αίματος 18/3/2015, M.ΧΡΙΣΤΟΦΙΔΟΥ ΑΝΤΙΓΟΝΟ Χημική ένωση διαγείρει Β, Τ -λεμφοκύτταρα σε ειδική ανοσολογική απόκριση μέσω υποδοχέων (Igs, ΤCR) Ειδική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. γ 2. α 3. β 4. δ 5. δ Β. Ερωτήσεις σωστού - λάθους 1. Σωστό 2. Λάθος 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς

Μικροοργανισμοί. Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Μικροοργανισμοί Οι μικροοργανισμοί διακρίνονται σε: Μύκητες Πρωτόζωα Βακτήρια Ιούς Παθογόνοι μικροοργανισμοί Παθογόνοι μικροοργανισμοί ονομάζονται οι μικροοργανισμοί που χρησιμοποιούν τον άνθρωπο ως ξενιστή

Διαβάστε περισσότερα

Εργαστήριο Ανοσοποιητικό σύστημα Λεμφικά όργανα. Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας

Εργαστήριο Ανοσοποιητικό σύστημα Λεμφικά όργανα. Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας Εργαστήριο Ανοσοποιητικό σύστημα Λεμφικά όργανα Υπατία Δούση-Αναγνωστοπούλου, MD, PhD Αναπληρώτρια Καθηγήτρια, Εργαστήριο Ιστολογίας-Εμβρυολογίας Λειτουργία ανοσοποιητικού λεμφικού συστήματος Προστασία

Διαβάστε περισσότερα

ΛΕΜΦΟΚΥΤΤΑΡΑ. Τ λεµφοκύτταρα:

ΛΕΜΦΟΚΥΤΤΑΡΑ. Τ λεµφοκύτταρα: ΛΕΜΦΟΚΥΤΤΑΡΑ Προέλευση: µυελός των οστών. Μερικά µεταναστεύουν στο θύµο, όπου παραµένουν για ποικίλες περιόδους πριν διασκορπισθούν στο σώµα. Βίος: η ζωή τους ποικίλει. Τα µνηµοκύτταρα ζουν για πολλά χρόνια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Μεταβολικές ανάγκες ανοσοκυττάρων

Μεταβολικές ανάγκες ανοσοκυττάρων Μεταβολικές ανάγκες ανοσοκυττάρων Στέργιος Κατσιουγιάννης PhD Μεταδιδακτορικός συνεργάτης Χαροκόπειο Πανεπιστήµιο Τµήµα Επιστήµης ιαιτολογίας και ιατροφής Μεταβολισµός και Ανοσολογία Ιστορικά το καλύτερο

Διαβάστε περισσότερα

- Θεωρία- Δρ. ΠέτρουΚαρκαλούσου

- Θεωρία- Δρ. ΠέτρουΚαρκαλούσου - Θεωρία- Έκδοση2008 Πρόλογος Αγαπητοίσπουδαστέςοισημειώσειςπουκρατάτεσταχέριασαςέχουνσκοπόνασας εισαγάγουνστιςβασικέςγνώσειςμιαςαπότιςσημαντικότερεςβιοιατρικέςεπιστήμες, της ανοσολογίας. Η ανοσολογίαείναιμιασχετικάνέαεπιστήμηηοποίαεμφανίστηκεστοτέλοςτου

Διαβάστε περισσότερα

ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ

ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ Β ΒΑΣΙΚΟ ΣΕΜΙΝΑΡΙΟ ΚΥΤΤΑΡΟΜΕΤΡΙΑΣ 2 ΦΕΒΡΟΥΑΡΙΟΥ 2013 ΑΜΦΙΘΕΑΤΡΟ ΤΟΥ ΓΕΝΙΚΟΥ ΚΡΑΤΙΚΟΥ ΑΘΗΝΩΝ «Γ. ΓΕΝΝΗΜΑΤΑΣ» IV Σχεδιασμός Πειραμάτων και Ανάπτυξη Δοκιμασιών ΑΛΛΗΛΕΠΙΔΡΑΣΗ ΑΝΤΙΓΟΝΟΥ/ΑΝΤΙΣΩΜΑΤΟΣ Βικεντίου

Διαβάστε περισσότερα

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ

ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ ΑΡΧΕΣ ΑΝΟΣΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΗ ΣΤΟ ΑΝΟΣΟΠΟΙΗΤΙΚΟ ΣΥΣΤΗΜΑ Χρειάζεται η µελέτη της ανοσολογία; Εµβόλια Άµυνα κατά µικροοργανισµών Ανοσολογικές ασθένειες Αλλεργίες - υπερευαισθησίες, αυτοανοσίες, ανοσοανεπάρκειες,

Διαβάστε περισσότερα

ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ

ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ ΕΠΙΝΕΦΡΙΔΙΑ ΚΟΡΤΙΖΟΛΗ Μεταβολισμός της κορτιζόλης Η κορτιζόλη μεταβολίζεται στο ήπαρ. Στην συνέχεια οι μεταβολίτες συζευγνύνται με γλυκουρονιδικές και θειικές ομάδες, γίνονται υδατοδιαλυτά, εισέρχονται

Διαβάστε περισσότερα

Ανοσολογικό σύστημα και λοιμώξεις Μηχανισμοί άμυνας μεγαλοοργανισμού

Ανοσολογικό σύστημα και λοιμώξεις Μηχανισμοί άμυνας μεγαλοοργανισμού Ανοσολογικό σύστημα και λοιμώξεις Μηχανισμοί άμυνας μεγαλοοργανισμού Γεωργία Σ. Βρυώνη Ιατρός Βιοπαθολόγος Λέκτορας Μικροβιολογίας gvrioni@med.uoa.gr 23/01/08 Μαθήματα Ειδικευόμενων Εισαγωγή στην Ανοσολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ)

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΚΕΦΑΛΑΙΟ 1(ΥΓΕΙΑ-ΑΝΘΡΩΠΟΣ) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: 1. Οι ιοί αποτελούνται

Διαβάστε περισσότερα

Φυσική Ανοσία. Ανοσολογικοί µηχανισµοί. Κυτταροκίνες

Φυσική Ανοσία. Ανοσολογικοί µηχανισµοί. Κυτταροκίνες Ανοσολογικοί µηχανισµοί Ειδικοί ανοσολογικοί µηχανισµοί (επίκτητη ανοσία) εξαρτώνται από την ειδική αναγνώριση από τα λεµφοκύτταρα της ξένης ουσίας ή κυττάρου Φυσική Ανοσία Μηχανισµοί φυσικής (µη ειδικής)

Διαβάστε περισσότερα

11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ

11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ 11. ΕΝΔΟΚΡΙΝΕΙΣ ΑΔΕΝΕΣ Στον ανθρώπινο οργανισμό υπάρχουν δύο είδη αδένων, οι εξωκρινείς και οι ενδοκρινείς. Οι εξωκρινείς (ιδρωτοποιοί αδένες, σμηγματογόνοι αδένες κ.ά.) εκκρίνουν το προϊόν τους στην επιφάνεια

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση.

ΙΣΤΟΙ Ως προς τη µορφή και τη λειτουργία τους. Κυτταρική διαφοροποίηση. ΙΣΤΟΙ 1. Τα κύτταρα που αποτελούν τον οργανισµό µας, διακρίνονται σε διάφορους τύπους, παρά το γεγονός ότι όλα, τελικώς, προέρχονται από το ζυγωτό, δηλαδή το πρώτο κύτταρο µε το οποίο ξεκίνησε η ζωή µας.

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά.

Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Πεπτικός σωλήνας Κύρια λειτουργία του είναι η εξασφάλιση του διαρκούς ανεφοδιασμού του οργανισμού με νερό, ηλεκτρολύτες και θρεπτικά συστατικά. Στον πεπτικό σωλήνα πραγματοποιείται ο τεμαχισμός της τροφής

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ 10 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων Περιεχόμενα ΘΕΜΑ Α.... 2 Α1.... 2 Α3.... 2 Α5.... 2 ΘΕΜΑ B.... 2 Β1.... 2 Β2....

Διαβάστε περισσότερα

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία

Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ. Βιολογία Σάββατο, 25 Μαΐου 2002 Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗ ΠΑΙ ΕΙΑ Βιολογία ΘΕΜΑ 1 Στις ερωτήσεις 1 5, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο

Διαβάστε περισσότερα

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ

Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία. Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Στηρικτικά Κύτταρα και Εξωκυττάρια Ουσία Κοτσίνας Αθανάσιος Επικ. Καθηγητής Εργ. Ιστολογίας-Εμβρυολογίας Ιατρική Σχολή - ΕΚΠΑ Συνδετικός Ιστός - Ορισμός Παρέχει το: Υποστηρικτικό και Συνδετικό πλαίσιο

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι

Προβλήματα σχετιζόμενα με την τυποποίηση αντιγόνων Ι Β Προβλήματα Φαινότυπος Β(Α): ασθενής αντίδραση με αντι-α, έντονη αντίδραση με αντι-β, και ο ορός αντιδρά με ερυθρά Α₁. Ο αντιορός Α περιέχει τον κλώνο ΜΗΟ4? Επίκτητος Β φαινότυπος: έντονη αντίδραση με

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητής: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Η ρύθμιση της θερμοκρασίας του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια ΕΠΙΝΕΦΡΙΔΙΑ Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια 39 αμινοξέα Μ.Β. 4500 προοπιομελανοκορτίνη(pomc) 1. κορτικοτροπίνη (ACTH), 2. β λιποτροφίνη (β LPH), 3. γ λιποτροφίνη (γ LPH),

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΤΡΙΩΡΗΣ ΔΙΑΡΚΕΙΑΣ ΣΤΟ 1 0 ΚΕΦΑΛΑΙΟ

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΤΡΙΩΡΗΣ ΔΙΑΡΚΕΙΑΣ ΣΤΟ 1 0 ΚΕΦΑΛΑΙΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΤΡΙΩΡΗΣ ΔΙΑΡΚΕΙΑΣ ΣΤΟ 1 0 ΚΕΦΑΛΑΙΟ ΘΕΜΑ 1 0 Α. Στις ερωτήσεις 1-5 να επιλέξετε το γράμμα που αντιστοιχεί στη σωστή απάντηση: 1. Τα βακτήρια διαθέτουν: α. Μιτοχόνδρια β. Ριβοσώματα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2012 ÓÕÍÅÉÑÌÏÓ. Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΤΑΞΗ: ΜΑΘΗΜΑ: ΘΕΜΑ A Α1-δ, Α2-δ, Α3-γ, Α4-β, Α5-δ ΘΕΜΑ B Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ / ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Ηµεροµηνία: Κυριακή 1 Απριλίου 2012 ΑΠΑΝΤΗΣΕΙΣ Β1. Οι µεταβολές της θερµοκρασίας του εξωτερικού περιβάλλοντος

Διαβάστε περισσότερα

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση

Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μετα μετ βολική ενεργο ενεργο ο π ίηση Γονιμοποίηση αναγνώριση και συνένωση ωαρίου-σπερματοζωαρίου φραγμός στην πολυσπερμία μεταβολική ενεργοποίηση του αυγού ανακατατάξεις στα συστατικά του αυγού σχηματισμός του διπλοειδή πυρήνα του ζυγωτού

Διαβάστε περισσότερα

ΘΗΛΑΣΜΟΣ-ΑΛΛΕΡΓΙΑ. Π Α Ι Ο Γ Α ς Τ Ρ Ε Ν Τ Ε Ρ Ο Λ Ο Γ Ο ς

ΘΗΛΑΣΜΟΣ-ΑΛΛΕΡΓΙΑ. Π Α Ι Ο Γ Α ς Τ Ρ Ε Ν Τ Ε Ρ Ο Λ Ο Γ Ο ς ΘΗΛΑΣΜΟΣ-ΑΛΛΕΡΓΙΑ Κ Α Ρ Α Γ Κ Ι Ο Ζ Ο Γ Λ Ο Υ - Λ Α Μ Π Ο Υ Η Θ Ω Μ Α Η Π Α Ι Ο Γ Α ς Τ Ρ Ε Ν Τ Ε Ρ Ο Λ Ο Γ Ο ς Πρωτεϊνες γάλατος αγελάδος % συνόλου % Καζείνη % Λεύκωμα ορού Ειδική απάντηση % περιπτ. ΑΓΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΑΠΟΦΟΙΤΟΙ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΑΠΟΦΟΙΤΟΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 01-02-2015 ΑΠΟΦΟΙΤΟΙ ΘΕΜΑ 1Ο Α. Να επιλέξετε τη σωστή απάντηση: (Μονάδες 10) 1. Το ινώδες είναι ένα πλέγµα πρωτεϊνικής σύστασης που: α. Η δηµιουργία του σταµατά την

Διαβάστε περισσότερα

ÏÅÖÅ. 3. Ποιοι από τους παρακάτω οργανισµούς δεν παράγουν αντιβιοτικά: α. τα πρωτόζωα β. οι µύκητες γ τα φυτά δ. τα βακτήρια Μονάδες 5

ÏÅÖÅ. 3. Ποιοι από τους παρακάτω οργανισµούς δεν παράγουν αντιβιοτικά: α. τα πρωτόζωα β. οι µύκητες γ τα φυτά δ. τα βακτήρια Μονάδες 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΘΕΜΑ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συµπληρώνει

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΑΠΑΝΤΗΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 26 ΟΚΤΩΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) Θέμα Α Μονάδες 25 Α1.

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2

Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2 11/4/2009 1 Αφιερωμένο σ όλους τους μαθητές της Γ! Λυκείου! 11/4/2009 2 ΑΝΘΡΩΠΟΣ & ΥΓΕΙΑ 11/4/2009 3 ΙΣΟΡΡΟΠΙΑ 11/4/2009 4 Η ικανότητα του οργανισμού να διατηρεί σταθερές τις συνθήκες του εσωτερικού του

Διαβάστε περισσότερα

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος.

Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ. Αρχιτομία. Αγενής αναπαραγωγή. Παρατομία. Εκβλάστηση. Εγγενής αναπαραγωγή Διπλοφασικός κύκλος. Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΖΩΩΝ Αρχιτομία Αγενής αναπαραγωγή Παρατομία Εκβλάστηση Εγγενής αναπαραγωγή Απλοφασικός κύκλος Διπλοφασικός κύκλος Ισογαμία Ανισογαμία Ωογαμία Η ΑΝΑΠΑΡΑΓΩΓΗ ΚΑΙ Η ΑΝΑΠΤΥΞΗ

Διαβάστε περισσότερα

4. ΛΕΜΦΙΚΟ ΣΥΣΤΗΜΑ. περιλαμβάνονται ο σπλήνας και ο θύμος αδένας (εικ.4.1). Το λεμφικό σύστημα είναι πολύ σημαντικό γιατί:

4. ΛΕΜΦΙΚΟ ΣΥΣΤΗΜΑ. περιλαμβάνονται ο σπλήνας και ο θύμος αδένας (εικ.4.1). Το λεμφικό σύστημα είναι πολύ σημαντικό γιατί: ΚΕΦΑΛΑΙΟ 4 4. ΛΕΜΦΙΚΟ ΣΥΣΤΗΜΑ Το λεμφικό σύστημα αποτελείται από τα λεμφαγγεία, τη λέμφο και τους λεμφαδένες. Οι λεμφαδένες είναι δομές που αποτελούνται από εξειδικευμένη μορφή συνδετικού ιστού, το λεμφικό

Διαβάστε περισσότερα

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ

ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ ΤΕΙ ΠΑΤΡΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΑΝΑΤΟΜΙΑ I ΥΠΕΥΘΥΝΟΣ ΚΑΘΗΓΗΤΗΣ : Γεράσιμος Π. Βανδώρος ΒΑΣΙΚΕΣ ΔΟΜΕΣ - ΤΟ ΚΥΤΤΑΡΟ Οι βασικές δομές που εξετάζουμε στην ανατομία μπορούν ιεραρχικά να ταξινομηθούν ως εξής:

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων»

των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων» Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Διδακτορική Διατριβή «Ανάλυση των αναδιατάξεων των γονιδίων των ανοσοσφαιρινών σε νεοπλασίες των Β λεμφοκυττάρων» Ανδρέας

Διαβάστε περισσότερα

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου

ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ. Χρυσούλα Νικολάου ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΕΛΕΥΘΕΡΩΝ ΕΛΑΦΡΩΝ ΑΛΥΣΕΩΝ ΣΤΟΝ ΟΡΟ ΚΑΙ ΣΤΑ ΟΥΡΑ Χρυσούλα Νικολάου Μονοκλωνικές ελεύθερες ελαφρές αλύσεις Οι μονοκλωνικές ελεύθερες ελαφρές αλύσεις οι οποίες είναι γνωστές ως πρωτεΐνη Bence

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ιοί είναι :

Διαβάστε περισσότερα

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000

Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 Θέµατα Βιολογίας Γενική Παιδεία Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5 να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Οι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β 14 ΜΑΪΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β 14 ΜΑΪΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. α Α5. γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Γ ΛΥΚΕΙΟΥ & ΕΠΑ.Λ. Β 14 ΜΑΪΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ Β1. Σχολικό βιβλίο σελ. 131: Θεωρία του αρβίνου Στο φυλογενετικό δέντρο των καµηλοπαρδάλεων,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2. Ο ΣΠΛΗΝΑΣ ΚΑΙ ΟΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ..28

ΚΕΦΑΛΑΙΟ 2. Ο ΣΠΛΗΝΑΣ ΚΑΙ ΟΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ..28 ΠΕΡΙΕΧΟΜΕΝΑ Α. ΓΕΝΙΚΟ ΜΕΡΟ 5 ΚΕΦΑΛΑΙΟ 1. ΦΥΣΙΚΗ ΚΑΙ ΕΙ ΙΚΗ ΑΝΟΣΙΑ...6 1.1 Εισαγωγικά...6 1.2 Β λεµφοκύτταρα...8 1.2.1 ιαφοροποίηση άωρων Β κυττάρων. 8 1.3 Τ-κύτταρα... 11 1.3.1 Οι ανασυνδιασµοί του TCR..12

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ 23 10 2011 ΘΕΡΙΝΑ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Όλα τα βακτήρια: Α. διαθέτουν

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση

BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση BIO111 Μικροβιολογια ιαλεξη 7 Κυτταρικη Ρυθµιση Περιεχοµενα 1. Τι σηµαινει ρυθµιζω για την κυτταρικη µηχανη? 1. Η κυτταρικη ρυθµιση ειναι πολυεπιπεδη 2. Επιπεδο Μεταγραφης-Pύθµιση έκφρασης γονιδίων-tο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΥΠΕΡΕΥΑΙΣΘΗΣΙΑ. IgE. Αικ. Παυλίτου Τσιόντση Γ.Ν.Θ. Παπαγεωργίου

ΥΠΕΡΕΥΑΙΣΘΗΣΙΑ. IgE. Αικ. Παυλίτου Τσιόντση Γ.Ν.Θ. Παπαγεωργίου ΥΠΕΡΕΥΑΙΣΘΗΣΙΑ IgE Αικ. Παυλίτου Τσιόντση Γ.Ν.Θ. Παπαγεωργίου Ανοσιακό Σύστηµα-Ανοσιακή απόκριση Προστατεύει τον οργανισµό από παθογόνους και ξένους παράγοντες, µ ένα σύνολο µηχανισµών που αποτελούν την

Διαβάστε περισσότερα

ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ;

ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ; ΑΛΛΕΡΓΙΑ: Ο ΑΟΡΑΤΟΣ ΕΧΘΡΟΣ ΠΩΣ ΓΙΝΕΤΑΙ ΚΑΠΟΙΟΣ ΑΛΛΕΡΓΙΚΟΣ; Αλλεργία, όπως ορίζει και η λέξη, σημαίνει άλλο έργο. Είναι η μη αναμενόμενη αντίδραση του ανοσιακού συστήματος του οργανισμού εναντίον ακίνδυνων

Διαβάστε περισσότερα

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ

ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΙΑΤΡΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ (ΕΚΠΑ) ΚΑΤΑΤΑΚΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΑΚ.ΕΤΟΥΣ 2014-2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Θέματα 1. Ποια είναι η δομή και τα βασικά χαρακτηριστικά των λιπαρών οξέων 2. Πώς απομακρύνονται

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Κεφάλαιο 1 ο : Άνθρωπος και Υγεία

Βιολογία Γενικής Παιδείας Κεφάλαιο 1 ο : Άνθρωπος και Υγεία Βιολογία Γενικής Παιδείας Κεφάλαιο 1 ο : Άνθρωπος και Υγεία Ομοιόσταση: η ικανότητα του οργανισμού να διατηρεί σταθερές τις συνθήκες του εσωτερικού περιβάλλοντος (θερμοκρασία, συγκεντρώσεις διάφορων συστατικών

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Οι ομοιοστατικοί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή στη

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας

Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας Φυσική / επίκτητη Ανοσία Συστατικά του ΑΣ / κύτταρα του ΑΣ Φυσικη ανοσία / φλεγμονή Αντιγόνο / αντίσωμα Ωρίμανση λεμφοκυττάρων Ενεργοποίηση λεμφοκυττάρων Δραστικοί μηχανισμοί χυμικής/κυτταρικής ανοσίας

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ I ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2011 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ I ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2011 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ I ΕΠΑ.Λ. (ΟΜΑ Α Β ) 2011 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό κάθε µίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή στη φράση

Διαβάστε περισσότερα

Βλέννα, υδαρές υγρό. ή τοιχωματικό ή οξυπαραγωγικό = HCl + ενδογενή παράγοντα. βλέννα. ή ζυμογόνο ή πεπτικό = πεψινογόνο

Βλέννα, υδαρές υγρό. ή τοιχωματικό ή οξυπαραγωγικό = HCl + ενδογενή παράγοντα. βλέννα. ή ζυμογόνο ή πεπτικό = πεψινογόνο Στόμαχος Δομή βλεννογόνου στομάχου - Γαστρικοί αδένες Βλέννα, υδαρές υγρό ή τοιχωματικό ή οξυπαραγωγικό = HCl + ενδογενή παράγοντα βλέννα ή ζυμογόνο ή πεπτικό = πεψινογόνο Κύτταρα G = γαστρίνη Διάσπαρτα

Διαβάστε περισσότερα

ΘΕΜΑ Α. Μονάδες 5. Α2. Από νηματοειδείς δομές (υφές) αποτελούνται α. τα βακτήρια. β. τα πρωτόζωα. γ. οι μύκητες. δ. οι ιοί.

ΘΕΜΑ Α. Μονάδες 5. Α2. Από νηματοειδείς δομές (υφές) αποτελούνται α. τα βακτήρια. β. τα πρωτόζωα. γ. οι μύκητες. δ. οι ιοί. ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΣΑΒΒΑΤΟ 14 MAΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. δ A2. γ A3.

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Τεχνολογία του ανασυνδυασμένου DNA

Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία του ανασυνδυασμένου DNA Ε Ι Σ Α Γ Ω Γ Η Φώτης Καρβέλης Ιστορική αναδρομή Ανακάλυψη του DNA Μελέτη αντιγραφής Απομόνωση ενζύμων Μελέτη της δράσης τους Αποκάλυψη των περιοριστικών ενδονουκλεασών

Διαβάστε περισσότερα

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών

ANOΣΟΓΗΡΑΝΣΗ. Ιωάννα Οικονοµίδου. Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών ANOΣΟΓΗΡΑΝΣΗ Ιωάννα Οικονοµίδου Αναπληρώτρια Καθηγήτρια Ιατρικής Πανεπιστηµίου Αθηνών Το ανοσιακό σύστηµα θεωρείται αποφασιστικός παράγοντας για την διατήρηση της υγείας και την επιβίωση στους ηλικιωµένους

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΤΙ ΠΡΕΠΕΙ ΝΑ ΞΕΡΕΤΕ ΓΙΑ ΤΗΝ ΤΡΟΦΙΚΗ ΑΛΛΕΡΓΙΑ

ΤΙ ΠΡΕΠΕΙ ΝΑ ΞΕΡΕΤΕ ΓΙΑ ΤΗΝ ΤΡΟΦΙΚΗ ΑΛΛΕΡΓΙΑ ΤΙ ΠΡΕΠΕΙ ΝΑ ΞΕΡΕΤΕ ΓΙΑ ΤΗΝ ΤΡΟΦΙΚΗ ΑΛΛΕΡΓΙΑ Τι είναι η τροφική αλλεργία; Τροφική αλλεργία είναι η αναπάντεχη και μη κανονική ανοσολογική αντίδραση του οργανισμού εναντίον ενός τμήματος μιας τροφής (συνήθως

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα