Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download ""

Transcript

1 Θέμα Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ Η Βιολογία στο Σχολείο - Biologyinschool ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) - ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ)

2 Θέμα Β Η Βιολογία στο Σχολείο - Biologyinschool Β1. Σελ. 137: Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος, διαθέτει τη φυσική ικανότητα να μολύνει φυτικά κύτταρα μεταφέροντας σ' αυτά ένα πλασμίδιο που ονομάζεται Ti. Β2. Σελ. 112: «Η θερμοκρασία μικρότερη των 20 ο C». Β3. Σελ. 61: «Η εισαγωγή του DNA σε βακτηριακό κύτταροξενιστή ονομάζεται μετασχηματισμός». Σελ. 63: «Το σύνολο των βακτηριακών κλώνων που περιέχει το συνολικό DNA του οργανισμού δότη αποτελεί μία γονιδιωματική βιβλιοθήκη». Σελ. 61: «Ο φορέας κλωνοποίησης είναι ένα μόριο δημιουργείται είναι ανασυνδυασμένο». Β4. α: Σ, β: Λ, γ: Λ, δ: Λ, ε: Σ.

3 Θέμα Γ Γ1. Δ. Στη μετάφαση τα χρωμοσώματα βρίσκονται διπλασιασμένα. Άρα η ποσότητα του γενετικού υλικού του πυρήνα είναι διπλάσια από ότι είναι σε σωματικό κύτταρο που δεν διαιρείται (άρα στον πυρήνα σωματικού κυττάρου το μήκος θα είναι 0,8m). Ένας γαμέτες έχει μισή ποσότητα γενετικού υλικού σε σχέση με ένα σωματικό κύτταρο (άρα στον πυρήνα του γαμέτη το μήκος θα είναι 0,4m). Όμως επειδή αναφέρεται το συνολικό DNA, θα πρέπει να υπολογίσουμε και το μιτοχονδριακό DNA που υπάρχει στο θηλυκό γαμέτη. Άρα τελικά η ποσότητα και άρα το μήκος θα είναι λίγο μεγαλύτερο από το πυρηνικό DNA του γαμέτη. Γ2. Θα είναι μικρότερο ή το ίδιο. Όσοι αρσενικοί γαμέτες έχουν Ψ αντί για Χ χρωμόσωμα, το μήκος του γενετικού υλικού θα είναι μικρότερο (από αυτούς τους αρσενικούς που έχουν Χ χρωμόσωμα), λόγω του ότι το Ψ χρωμόσωμα είναι μικρότερο του Χ. Αντιθέτως, όσοι αρσενικοί γαμέτες έχουν το Χ χρωμόσωμα το μήκος τους θα είναι ίδιο με τους θηλυκούς. Γ3. Για τα κωδικόνια έναρξης και λήξης ισχύει: Έναρξης Λήξης mrna 5 AUG3 5 UGA3, 5 UAA3, UAG3 κωδική αλυσίδα 5 AΤG3 5 ΤGA3, 5 ΤAA3, ΤAG3 μη-κωδική αλυσίδα 3 TAC5 3 ACT5, 3 ATT5, 3 ATC5 Για να εντοπίσουμε την κωδική αλυσίδα, αναζητούμε ένα κωδικόνιο έναρξης 5 AΤG3, εφαρμόζουμε τις ιδιότητες του γενετικού κώδικα (κώδικας τριπλέτας, συνεχής, μη επικαλυπτόμενος) και διαβάζοντας την κωδική αλυσίδα με βήμα τριών νουκλεοτιδίων (ένα κωδικόνιο) σταματάμε όταν εντοπίσουμε ένα κωδικόνιο λήξης. Εργαζόμενοι κατά αυτό τον τρόπο, βρίσκουμε την κωδική και μη-κωδική αλυσίδα καθώς και τις περιοχές που κωδικοποιούν τα γονίδια Α και Β.

4 Υπενθυμίζουμε πως η μη-κωδική αλυσίδα είναι συμπληρωματική της κωδικής, οπότε τα αποτελέσματα φαίνονται παρακάτω Α Γονίδιο 3TATGCAATGGTACACCCATATATGGAGTACCAGCATTCTTGG5 5ATACGTTACCATGTGGGTATATACCTCATGGTCGTAAGAACC3 Β Γονίδιο 3TATGCAATGGTACACCCATATATGGAGTACCAGCATTCTTGG5 5ATACGTTACCATGTGGGTATATACCTCATGGTCGTAAGAACC3 Ι. Οι 5 αμετάφραστες περιοχής βρίσκονται πριν από ο κωδικόνιο έναρξης, σε κάθε περίπτωση. Άρα αυτές είναι: Α Γονίδιο: 3CCAGCATTCTTGG5 Β Γονίδιο: 5ATACGTTAC3 ΙΙ. Για το γονίδιο Α θα συνδεθεί από τη θέση Δ, Για το γονίδιο Β θα συνδεθεί από τη θέση Γ. Η RNA πολυμεράση με τη βοήθεια των μεταγραφικών παραγόντων συνδέεται στην περιοχή του υποκινητή, που είναι πάντα στην αρχή του γονιδίου. Επίσης η μεταγραφή γίνεται με κατεύθυνση 5 3, άρα θα συνδεθεί πριν από τα κωδικόνια έναρξης (αφού από αυτά προσδιορίζεται η αφετηρία του γονιδίου) για να ξεκινήσει η μεταγραφή. Γ4. Γνωρίζουμε πως: 1) βακτήρια του γένους Mycobacterium: υποχρεωτικά αερόβιοι (απαιτούν υψηλή συγκέντρωση οξυγόνου) 2) μύκητες που χρησιμοποιούνται στην αρτοβιομηχανία: προαιρετικά αερόβιοι (αναπτύσσονται παρουσία οξυγόνου με μεγαλύτερο ρυθμό από ότι απουσία οξυγόνου)

5 3) βακτήρια του γένους Clostridium: υποχρεωτικά αναερόβιοι (το οξυγόνο για αυτά είναι τοξικό). Στις καμπύλες βλέπουμε: α: ανάπτυξη παρουσία και απουσία οξυγόνου, παρουσία οξυγόνου υπάρχει μεγαλύτερος ρυθμός ανάπτυξης β: απουσία οξυγόνου ο ρυθμός ανάπτυξης γίνεται μέγιστος, παρουσία οξυγόνου ο ρυθμός ανάπτυξης μειώνεται με πτωτική τάση να μηδενιστεί. γ: όταν το οξυγόνο μειώνεται, ο ρυθμός ανάπτυξης μειώνεται και βαθμιαία μηδενίζεται Άρα: 1γ, 2α, 3β

6 Θέμα Δ: Δ1. Ένζυμο Ι: DNA πολυμεράση, Ένζυμο ΙΙ: DNA δεσμάση. Η DNA πολυμεράση επιμηκύνει τμήματα DNA ή RNA (πρωταρχικά τμήματα), προσθέτοντας νουκλεοτίδια σε 3 ελεύθερο άκρο. Άρα δρα με κατεύθυνση 5 3. Στην εν λόγω περίπτωση η διόρθωση γίνεται από την πλευρά Χ προς την πλευρά Ψ, άρα θα πρέπει το 3 άκρο να είναι από την πλευρά που επιμηκύνεται η αλυσίδα. Έτσι βρίσκουμε τα άκρα της πάνω αλυσίδας. Η κάτω αλυσίδα είναι συμπληρωματική και αντιπαράλληλη της πάνω, άρα βρίσκουμε τα άκρα της. Συνολικά τα άκρα φαίνονται στο παρακάτω σχήμα. Δ2. Στο παρακάτω σχήμα φαίνεται η θηλιά, όπου παρατηρούμε πως στο ένα άκρο της μητρικής αλυσίδας 4 υπάρχει ΟΗ-.

7 Άρα σε αυτό το άκρο υπάρχει 3 άκρο. Αν το ένα άκρο είναι 3 το άλλο της ίδιας αλυσίδας είναι 5. Ταυτόχρονα οι δύο αλυσίδες είναι συμπληρωματικές και αντιπαράλληλες, άρα απέναντι από 3 θα υπάρχει 5 και απέναντι από 5 θα υπάρχει 3. Συνολικά τα άκρα φαίνονται στο παρακάτω σχήμα. Στη ΘΕΑ, η αντιγραφή γίνεται και προς τις δύο κατευθύνεις. Το πρωταρχικό τμήμα για να συμμετέχει σε συνεχή αντιγραφή, θα πρέπει το 3 άκρο του να επιμηκύνεται διαρκώς, και το 5 άκρο του να βρίσκεται στην αρχή της θεα. Για να είναι το 5 άκρο στην αρχή της ΘΕΑ, επειδή τα πρωταρχικά τμήματα είναι συμπληρωματικά και αντιπαράλληλα με τη μητρική αλυσίδα, θα πρέπει το κομμάτι της θυγατρικής αλυσίδας να έχει στο τέλος του 5, ώστε να είναι συμπληρωματικό και αντιπαράλληλο με το 3 άκρο που επιμηκύνεται. Άρα το πρωταρχικό τμήμα μπορεί να ενσωματωθεί σε δύο θέσεις, όπως φαίνεται με τα κόκκινα βέλη στο παρακάτω σχήμα.

8 Δ3. Στο 3 άκρο του πρωταρχικού τμήματος, υπάρχει ελεύθερη μία υδροξυλομάδα (ΟΗ-). Στο άκρο αυτό η DNA πολυμεράση κάνει πολυμερισμό, επιμηκύνοντας τα πρωταρχικά τμήματα. Άρα στο άκρο αυτό μπορεί να δημιουργηθεί ένας 3-5 φωσφοδιεστερικός δεσμός. Δ4. Εργαζόμαστε όπως και στο ερώτημα Γ3 και βρίσκουμε το τμήμα του γονιδίου που μεταγράφεται καθώς και την κωδική και μη κωδική αλυσίδα. Το αποτέλεσμα φαίνεται παρακάτω. 3 GAACTAATACCTACTCGGACATTTGACCGCGATTGTACCA5 (μη κωδική) 5 CTTGATTATGGATGAGCCTGTAAACTGGCGCTAACATGGT3 (κωδική) Έτσι προκύπτουν 9 κωδικόνια, που κατά τη μετάφραση παράγουν πεπτίδιο με 8 αμινοξέα (κάθε κωδικόνιο αντιστοιχεί σε ένα αμινοξύ, το κωδικόνιο λήξης δεν κωδικοποιεί κάποιο αμινοξύ).

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ Θέμα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2016 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 δ Α.4 α Α.5

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 6 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 6 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 γ Α.4 α Α.5

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ

Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου Απαντήσεις Θεμάτων ΦΡΟΝΤΙΣΤΗΡΙΑ Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 18 Μαίου 2011 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κ.Ε.Κ. EROWY: τηλ 210-6147001 EROWY ΠΛΗΡΟΦΟΡΙΚΗ: τηλ 210-6147002 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΙΜΕΛΕΙΑ:

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. α. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1. Α. 2. Β. 3. Α. 4. Β. 5. Δ. ΘΕΜΑ Β I. Βιβλίο σελ. 15 17 (ή 19 21 στη νέα έκδοση) .

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α.1. γ Α.2. β Α.3. α Α.4. δ Α.5. α ΘΕΜΑ Β Β.1. Σελ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ

ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. Β ΘΕΜΑ Β

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΘΕΜΑ Α Α1=β,

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΩΝ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ 2009 ΘΕΜΑ ο. γ. 2. γ. 3. β. 4. α. 5. δ. ΘΕΜΑ 2 ο. Σελ.

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα