Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο"


1 Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται ραδιενεργά στοιχεία, όπως φώσφορος ή άζωτο. Όταν το DΝΑ αντιγράφεται σε περιβάλλον με ραδιενεργό 32 Ρ ή 15 Ν η κάθε θυγατρική αλυσίδα που σχηματίζεται αποτελείται από νουκλεοτίδια που περιέχουν ραδιενεργό 32 Ρ ή 15 Ν. Από ένα (1) μόριο DΝΑ μετά από κ αντιγραφές σε περιβάλλον με ραδιενεργό 32 Ρ ή 15 Ν θα έχουν σχηματιστεί 2 κ μόρια που θα αποτελούνται από 2 2 κ =2 κ+1 πολυνουκλεοτιδικές αλυσίδες από τις οποίες οι 2 2 κ - 2=2 κ+1-2 πολυνουκλεοτιδικές αλυσίδες φέρουν ραδιενεργό 32 Ρ ή 15 Ν, ενώ 2 πολυνουκλεοτιδικές αλυσίδες (οι αρχικές) δε θα περιέχουν ραδιενεργό 32 Ρ ή 15 Ν. Όταν το DΝΑ αντιγράφεται σε περιβάλλον με ραδιενεργό 35 S η κάθε θυγατρική αλυσίδα που σχηματίζεται αποτελείται από νουκλεοτίδια που δεν περιέχουν ραδιενεργό 35 S. (Το ραδιενεργό 35 S ενσωματώνεται μόνο στις πρωτεΐνες.) Χρήσιμα στην επίλυση αυτών των ασκήσεων είναι σχήματα που υποδεικνύουν τον ημισυντηρητικό τρόπο αντιγραφής, όπως το ακόλουθο (οι αλυσίδες με το κόκκινο χρώμα αντιπροσωπεύουν τις αλυσίδες των οποίων τα νουκλεοτίδια περιέχουν ραδιενεργό 32 Ρ ή 15 Ν). 2. Ασκήσεις στις οποίες ζητούνται τα άκρα ενός τμήματος DΝΑ, η μη κωδική αλυσίδα, το mrna, το ανοιχτό πλαίσιο ανάγνωσης στο μόριο του mrna, τα αντικωδικόνια των trna και ο αριθμός των αμινοξέων της πολυπεπτιδικής αλυσίδας. Το DΝΑ αποτελείται από δύο (2) αλυσίδες, την κωδική που δεν μεταγράφεται και τη μη κωδική που μεταγράφεται. Η μεταγραφή γίνεται πάντα με κατεύθυνση 5 3. Η μη κωδική αλυσίδα του DΝΑ και το mrna είναι συμπληρωματικές και αντιπαράλληλες πολυνουκλεοτιδικές αλυσίδες. Η κωδική αλυσίδα του DΝΑ και το mrna είναι παράλληλες και σχεδόν πανομοιότυπες με εξαίρεση ότι στο mrna υπάρχει ουρακίλη αντί θυμίνης. Τα κωδικόνια έναρξης και λήξης της μετάφρασης του mrna και τα αντίστοιχά τους στην κωδική και στη μη κωδική αλυσίδα του DΝΑ φαίνονται στον παρακάτω πίνακα: Κωστανίκος Δημήτρης 1 Βιολόγος

2 mrna Μη κωδική αλυσίδα του DΝΑ Κωδική αλυσίδα του DΝΑ Κωδικόνιο έναρξης. 5 AUG 3 3 TAC 5 5 ATG 3 5 UAG 3 3 ATC 5 5 TAG 3 Κωδικόνια λήξης. 5 UGA 3 3 ACT 5 5 TGA 3 5 UAA 3 3 ATT 5 5 TAA 3 Για να εντοπίσουμε τα άκρα ενός τμήματος DΝΑ και ποια από τις δύο αλυσίδες είναι η μη κωδική «εργαζόμαστε» ως εξής: Αποφασίζουμε εάν θα αναζητήσουμε την κωδική ή τη μη κωδική αλυσίδα του DΝΑ. Αρχίζουμε να «διαβάζουμε» τη μία (1) από τις δύο (2) αλυσίδες του DΝΑ βάση-βάση από τα αριστερά προς τα δεξιά αναζητώντας το κωδικόνιο έναρξης. Εάν βρεθεί κωδικόνιο έναρξης τότε, από εκεί και κάτω, «διαβάζουμε» την αλυσίδα ανά τριπλέτα βάσεων αναζητώντας οπωσδήποτε ένα από τα κωδικόνια λήξης. Εάν δε βρεθεί κωδικόνιο έναρξης και κωδικόνιο λήξης τότε αρχίζουμε να διαβάζουμε με τον ίδιο τρόπο την αλυσίδα από τα δεξιά προς τα αριστερά. Εάν δε βρεθεί και πάλι κωδικόνιο έναρξης και κωδικόνιο λήξης τότε εξετάζουμε με τον ίδιο τρόπο την άλλη αλυσίδα. ΣΗΜΕΙΩΣΗ: Ακόμη και αν βρεθεί κωδικόνιο έναρξης και κωδικόνιο λήξης καθώς «διαβάζουμε» τη μια από τις δύο αλυσίδες προς μια κατεύθυνση (π.χ. από αριστερά προς τα δεξιά) η διαδικασία αυτή επαναλαμβάνεται και προς την άλλη κατεύθυνση (από δεξιά προς τα αριστερά), αλλά και για τη δεύτερη αλυσίδα. Αυτό συμβαίνει γιατί υπάρχει πιθανότητα από το συγκεκριμένο τμήμα DNA να προκύπτουν περισσότερες από μία πολυπεπτιδικές αλυσίδες. Παράδειγμα: Έστω το γονίδιο με την παρακάτω αλληλουχία βάσεων: TT CCGTATGCCC TTTGGC TACTAGCCC TCC AAGGCATACGGGAAACCGATGATCGGGAGG Να βρεθούν τα άκρα του γονιδίου. Απάντηση. Θα αναζητήσουμε τη μη κωδική αλυσίδα. Αρχίζουμε να «διαβάζουμε» την 1 η αλυσίδα από τα αριστερά προς τα δεξιά αναζητώντας κωδικόνιο έναρξης (3 TAC 5 ) και ένα από τα κωδικόνια λήξης (3 ATC 5, 3 ACT 5, 3 ATT 5 ) : TTCCGTATGCCCTTTGGC TAC TAG CCC TCC Βρέθηκε μόνο κωδικόνιο έναρξης. Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. CCTCCCGATCATCGGTTTCCCGTATGCCTT. Δεν υπάρχει κωδικόνιο έναρξης. Αρχίζουμε να «διαβάζουμε» τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. AAGGCA TAC GGG AAA CCG ATG ATC GGGAGG Υπάρχει κωδικόνιο έναρξης και κωδικόνιο λήξης. Αν «διαβάζουμε» την ίδια αλυσίδα από τα δεξιά προς τα αριστερά τότε: GGAGGGCTAGTAGCCAAAGGGCA TAC GGA A Διαπιστώνουμε ότι υπάρχει μόνο κωδικόνιο έναρξης. Κατά συνέπεια μη κωδική είναι η 2 η αλυσίδα από τα αριστερά προς τα δεξιά, οπότε τα άκρα του γονιδίου έχουν ως εξής: 5 TT CCGT ATG CCC TTT GGC TAC TAG CCC TCC 3 3 AAGGCA TAC GGG AAA CCG ATG ATC GGGAGG 5 Αν ζητείται το ανοικτό πλαίσιο ανάγνωσης στο μόριο του mrνα (δηλαδή το τμήμα του mrna που θα εκφραστεί σε αμινοξέα) τότε αυτό αρχίζει με το κωδικόνιο έναρξης και σταματά στο κωδικόνιο πριν από το κωδικόνιο λήξης. Αν ζητούνται τα αντικωδικόνια των trνα που συμμετέχουν στη μετάφραση, γράφουμε τριπλέτες βάσεων ριβονουκλεοτιδίων (δηλαδή ουρακίλη αντί θυμίνης) Κωστανίκος Δημήτρης 2 Βιολόγος

3 συμπληρωματικών των βάσεων των κωδικονίων, τις οποίες και χωρίζουμε με κόμματα ή κάθετες γραμμές, για να δείξουμε ότι είναι ανεξάρτητες μεταξύ τους. Δε γράφουμε αντικωδικόνιο για το κωδικόνιο λήξης. Ένα αμινοξύ κωδικοποιείται από ένα κωδικόνιο. Στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ. Το πρώτο αμινοξύ κάθε πολυπεπτιδικής αλυσίδας έχει ελεύθερο αμινικό άκρο και το τελευταίο έχει ελεύθερο καρβοξυλικό άκρο. Παράδειγμα: Έστω το γονίδιο με την παρακάτω αλληλουχία βάσεων: 5 TT CCGTATGCCC TTT GGCTACTAGCCCT CC 3 3 AAGGCATACGGGAAACCGATGATCGGGAGG 5 Να βρεθεί το mrna, το ανοιχτό πλαίσιο ανάγνωσης, τα αντικωδικόνια, τα αμινοξέα και τα άκρα της πολυπεπτιδικής αλυσίδας. Απάντηση. Η μη κωδική αλυσίδα είναι η 2 η, οπότε το mrna που προκύπτει είναι το εξής: 5 UUCCGU AUG CCC UUU GGC UAC UAG CCCUCC 3 Το ανοιχτό πλαίσιο ανάγνωσης είναι το εξής: 5 AUG CCC UUU GGC UAC 3 Τα αντικώδικόνια είναι τα εξής: 3 UAC 5, 3 GGG 5, 3 AAA 5, 3 CCG 5, 3 AUG 5 Η πολυπεπτιδική αλυσίδα που σχηματίζεται αποτελείται από 5 αμινοξέα και με βάση το γενετικό κώδικα είναι η εξής: NH 2 -met-pro-phe-gly-tyr-cooh 3. Ασκήσεις στις οποίες δίνεται ο αριθμός βάσεων ενός γονιδίου και ζητείται ο αριθμός των αζωτούχων βάσεων του πρόδρομου mrna, του ώριμου mrna, των εξωνίων, των κωδικονίων του ώριμου mrna, ο αριθμός των κωδικονίων και ο αριθμός των αμινοξέων της πολυπεπτιδικής αλυσίδας (μπορεί να δίνεται ο αριθμός των αμινοξέων της πολυπεπτιδικής αλυσίδας και να ζητείται ο αριθμός των βάσεων του γονιδίου που την κωδικοποιούν). Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2. Βάσεις ώριμου mrna = Βάσεις πρόδρομου mrna- βάσεις εσωνίων. Βάσεις κωδικονίων ώριμου mrna = Βάσεις ώριμου mrna - βάσεις 5 και 3 αμετάφραστων περιοχών (Δεν αφαιρούμε τις 3 βάσεις από το κωδικόνιο λήξης παρόλο που ανήκουν στην 3 αμετάφραστη περιοχή). Αριθμός κωδικονίων ώριμου mrna= Βάσεις κωδικονίων ώριμου mrna/3 (3 βάσεις δίνουν 1 κωδικόνιο). Αριθμός αμινοξέων πολυνουκλεοτιδικής αλυσίδας= Αριθμός κωδικονίων ώριμου mrna - κωδικόνιο λήξης (στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ). Ο αριθμός των αμινοξέων της πολυνουκλεοτιδικής αλυσίδας που προκύπτει μπορεί να μειωθεί με την απομάκρυνση αμινοξέων (μεταμεταφραστική τροποποίηση) προκειμένου η αλυσίδα να γίνει λειτουργική πρωτεΐνη. Εάν δε δίνεται κάποιο δεδομένο π.χ. ο αριθμός των βάσεων των 5 και 3 αμετάφραστων περιοχών, κατά τους υπολογισμούς δεν το λαμβάνουμε υπόψη. Στην επίλυση των ασκήσεων μπορεί να βοηθήσει το παρακάτω σχήμα: Κωστανίκος Δημήτρης 3 Βιολόγος

4 Παράδειγμα: Δίνονται: βάσεις γονιδίου=140, βάσεις εσωνίων= 22. Να βρεθεί ο αριθμός των αμινοξέων της πολυνουκλεοτιδικής αλυσίδας που προκύπτει. Απάντηση: Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=140/2=70. Βάσεις ώριμου mrna = Βάσεις πρόδρομου mrna - βάσεις εσωνίων=70-22=48 Βάσεις κωδικονίων ώριμου mrna = Βάσεις ώριμου mrna - βάσεις 5 και 3 αμετάφραστων περιοχών=48 (επειδή οι βάσεις των 5 και 3 αμετάφραστων περιοχών δε δίνονται δεν τις λαμβάνουμε υπόψη). Αριθμός κωδικονίων ώριμου mrna= βάσεις κωδικονίων ώριμου mrna/3=48/3=16 Αριθμός αμινοξέων πολυνουκλεοτιδικής αλυσίδας= Αριθμός κωδικονίων ώριμου mrna - κωδικόνιο λήξης=16-1=15 Εάν δίνεται ο αριθμός των αμινοξέων μιας πολυπεπτιδικής αλυσίδας π.χ 4 αμινοξέα τότε ο ελάχιστος αριθμός κωδικονίων που είναι απαραίτητος για την κωδικοποίησή της είναι κατά ένα (1) μεγαλύτερος δηλαδή 5 κωδικόνια (συμπεριλαμβάνεται και το κωδικόνιο λήξης, αφού είναι απαραίτητο για τη λήξη της μετάφρασης). 4. Ασκήσεις στις οποίες ζητείται ο αριθμός των φωσφοδιεστερικών δεσμών που σπάνε και σχηματίζονται κατά την ωρίμανση του mrνα. Τα εσώνια είναι ενδιάμεσες αλληλουχίες των γονιδίων και ως εκ τούτου ενδιάμεσες αλληλουχίες στο πρόδρομο mrνα. Αν ένα γονίδιο έχει x εσώνια, τότε έχει x + 1 εξώνια. Για την απομάκρυνση των x εσωνίων σπάνε 2x φωσφοδιεστερικοί δεσμοί. Για τη συρραφή x εξωνίων δημιουργούνται x-1 φωσφοδιεστερικοί δεσμοί. Παράδειγμα: Κωστανίκος Δημήτρης 4 Βιολόγος

5 Κατά την ωρίμανση ενός πρόδρομου mrνα που περιέχει 4 εσώνια (δηλαδή έχει 5 εξώνια) σπάνε 8 φωσφοδιεστερικοί δεσμοί για την απομάκρυνσή τους και δημιουργούνται 4 φωσφοδιεστερικοί δεσμοί για τη συρραφή των εξωνίων του. Κωστανίκος Δημήτρης 5 Βιολόγος


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


ΘΕΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΟ Μ.Ε επιμέλεια : ΣΟΦΙΑ ΧΑΡΙΣΙΟΥ ΘΕΜΑ Α. Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. σελ. 24 σχ. βιβλίου «Κάθε φυσιολογικό μεταφασικό χρωμόσωμα...η απεικόνιση αυτή αποτελεί τον καρυότυπο». «Ο αριθμός και η μορφολογία

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 2016 ΘΕΜΑ Α Α1 Β Α2 Β Α3 Δ Α4 Γ Α5 Γ ΘΕΜΑ Β Β1 1. Α 2. Γ 3. Α 4. Β 5. Α 6. Α 7. Γ Β2 ΣΕΛ.24 σχολ.βιβ. «Κάθε φυσιολογικό µεταφασικό.. Η απεικόνιση αυτή αποτελεί

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα


Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ Εκφωνήσεις ΘΕΜΑ 1 ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Πόσα µόρια DNA απεικονίζονται στον καρυότυπο ενός σωµατικού κυττάρου, ενός

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 Β Α.2 Β Α.3 Δ Α.4 Γ Α.5 Γ ΘΕΜΑ B B.1 1.

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 15 Ιουνίου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Επαναληπτικών Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Α Α.1 β Α.2 γ Α.3 γ Α.4 α Α.5

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα)

Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα) ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Βιολογία Προσανατολισμού (Παλαιό και νέο σύστημα) 27-5-2016 Β1. 1: Α 2: Γ 3: Α 4: Β 5: Α 6: Α 7: Γ Β2. Σελ 20: «Τα μεταφασικά χρωμοσώματα κάθε είδους.» Συμπεράσματα:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα