Εκτίμηση της Γενετικής Ποικιλότητας Αυτοφυών Πληθυσμών Τσάι του Βουνού (Sideritis raeseri) με τη Χρήση Μοριακών Δεικτών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Εκτίμηση της Γενετικής Ποικιλότητας Αυτοφυών Πληθυσμών Τσάι του Βουνού (Sideritis raeseri) με τη Χρήση Μοριακών Δεικτών"



2 Εξεταστική Επιτροπή Πολύδωρος Αλέξιος, Επίκουρος Καθηγητής: Επιβλέπων Νιάνιου-Ομπεϊντάτ Ειρήνη, Επίκουρη Καθηγήτρια: Μέλος Μυλωνά Φωτεινή, Αναπληρώτρια Ερευνήτρια του ΕΛΓΟ-ΔΗΜΗΤΡΑ: Μέλος Η διατριβή αυτή χρηματοδοτήθηκε εν μέρει από το ερευνητικό έργο με τίτλο: Conservation and exploitation of indigenous Medicinal and Aromatic plants traditionally used in the SEE, WB countries. A model approach for Sideritis spp. (Mountain tea), στο πλαίσιο του ευρωπαϊκού Ανταγωνιστικού Προγράμματος SEE-ERA-NET PLUS που υλοποιήθηκε στο ΚΓΕΒΕ του ΕΛΓΟ-ΔΗΜΗΤΡΑ.

3 ΕΥΧΑΡΙΣΤΙΕΣ Θα ήθελα να εκφράσω τις θερμές μου ευχαριστίες στον επιβλέποντα της διατριβής μου, Επίκουρο Καθηγητή, κ. Αλέξιο Πολύδωρο για την εμπιστοσύνη του, την ανελλιπή καθοδήγηση και τη συμπαράστασή του, καθώς και για την άψογη συνεργασία που είχαμε από την πρώτη στιγμή, μέχρι την ολοκλήρωση της εργασίας. Θα ήθελα να ευχαριστήσω ιδιαιτέρως την Αναπληρώτρια Ερευνήτρια του ΕΛΓΟ- ΔΗΜΗΤΡΑ κ. Φωτεινή Μυλωνά, που μου ανάθεσε μέρος του ερευνητικού έργου που υλοποιήθηκε στο ΚΓΕΒΕ του ΕΛΓΟ-ΔΗΜΗΤΡΑ, το οποίο και αποτέλεσε το θέμα της διατριβής μου, καθώς και για τις συμβουλές και τη στήριξή της. Ευχαριστίες εκφράζονται και προς την Επίκουρη Καθηγήτρια κ. Ειρήνη Νιάνιου-Ομπεϊντάτ για το θετικό κλίμα συνεργασίας που υπήρξε στο χώρο του εργαστηρίου, τις υποδείξεις της και το χρόνο που αφιέρωσε στη διόρθωση του κειμένου της διατριβής. Θα ήθελα τέλος να εκφράσω την ευγνωμοσύνη μου στη μητέρα μου, που χωρίς την ηθική και υλική στήριξή της, δεν θα ήταν δυνατή η περάτωση του μεταπτυχιακού, ειδικά για τους καιρούς που διανύουμε. Ως ελάχιστο δείγμα αυτής της ευγνωμοσύνης, της αφιερώνω τη διατριβή μου.

4 ΠΕΡΙΕΧΟΜΕΝΑ ΠΕΡΙΛΗΨΗ... 1 ABSTRACT... 2 Ι. ΕΙΣΑΓΩΓΗ... 3 ΙΙ. ΒΙΒΛΙΟΓΡΑΦΙΚΗ ΑΝΑΣΚΟΠΗΣΗ... 7 ΙΙ.1 Ιστορικά Στοιχεία, Συστηματική Ταξινόμηση και Γεωγραφική Εξάπλωση των ειδών Sideritis... 8 ΙΙ.2 Βοτανικοί Χαρακτήρες των ελληνικών ειδών Sideritis sect. Empedoclea ΙΙ.3 Η Καλλιέργεια Τσάι του Βουνού ΙΙ.3.1 Προετοιμασία αγρού-εγκατάσταση φυτείας ΙΙ.3.2 Λίπανση ΙΙ.3.3 Άρδευση ΙΙ.3.4 Καταπολέμηση ζιζανίων ΙΙ.3.5 Συγκομιδή και αποδόσεις ΙΙ.3.6 Πολλαπλασιασμός ΙΙ Εγγενώς με σπόρο ΙΙ Αγενώς με παραφυάδες ΙΙ.4 Χημική Σύσταση του Σιδερίτη ΙΙ.4.1 Μονοτερπένια και σεσκιτερπένια ΙΙ.4.2 Διτερπένια ΙΙ.4.3 Φαινολικά συστατικά ΙΙ.5 Φαρμακευτικές Ιδιότητες του Σιδερίτη ΙΙ.5.1 Αντιφλεγμονώδης δράση ΙΙ.5.2 Αντιοξειδωτική δράση - Επίδραση στο Κεντρικό Νευρικό Σύστημα ΙΙ.5.3 Αντιμικροβιακή δράση ΙΙ.5.4 Αντιελκογόνος δράση ΙΙ.5.5 Αντιϊική δράση ΙΙ.5.6 Αντικαρκινικές ιδιότητες ΙΙ.6 Οι Μοριακοί Δείκτες ΙΙ.7 Κυριότεροι Τύποι Μοριακών Δεικτών i

5 Περιεχόμενα ΙΙ.7.1 RFLPs (Restriction Fragment Length Polymorphism) ΙΙ.7.2 Μινιδορυφόροι (Minisatellites) ΙΙ.7.3 CAPS (Cleaved Amplified Polymorphic Sequence) ή PCR-RFLPs ΙΙ.7.4 AFLPs (Amplified Fragment Length Polymorphism) ΙΙ.7.5 RAPDs (Random Amplified Polymorphic DNA) ΙΙ.7.6 SCARs (Sequence Characterized Amplified Region) ΙΙ.7.7 Μικροδορυφόροι (Microsatellites/Single Sequence Repeats-SSRs) ΙΙ.7.8 ESTs (Expressed Sequence Tags) ΙΙ.7.9 EST-SSRs ΙΙ.7.10 SNPs (Single Nucleotide Polymorphism) ΙΙ.7.11 EST- SNPs ΙΙ.7.12 ISSRs (Inter Simple Sequence Repeats) ΙΙ.8 Μικροσυστοιχίες (Microarrays) ΙΙ.9 Οι Universal Rice Primers (URP) ΙΙ.10 Εφαρμογή μοριακών δεικτών στην οικογένεια Lamiaceae και το γένος Sideritis ΙΙ.11 Σκοπός της Διατριβής ΙΙΙ. ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ ΙΙΙ.1 Φυτικό υλικό ΙΙΙ.2 Απομόνωση γενετικού υλικού ΙΙΙ.3 Παρασκευή πηκτής αγαρόζης-ηλεκτροφόρηση ΙΙΙ.4 Αλυσιδωτή αντίδραση πολυμεράσης (PCR) ΙΙΙ.5 Ηλεκτροφόρηση των προϊόντων της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR) 58 ΙΙΙ.6 Ανάλυση των δεδομένων ΙV. ΑΠΟΤΕΛΕΣΜΑΤΑ ΙV.1 Προφίλ URP εκκινητών και πληθυσμών ΙV.2 Γενετική Παραλλακτικότητα ΙV.2.1 Ποσοστά Πολυμορφικών Ζωνών Δείκτες Παραλλακτικότητας των Nei και Shannon ΙV.2.2 Ανάλυση Μοριακής Παραλλακτικότητας (AMOVA) ii

6 Περιεχόμενα ΙV.2.3 Έλεγχος του Mantel ΙV.2.4 Πολυπαραγοντικές Μέθοδοι Ανάλυσης ΙV Ανάλυση Διασποράς (Cluster Analysis) ΙV Η Μέθοδος UPGMA ΙV Μέθοδος βασισμένη σε Παραμετρικό Μοντέλο - STRUCTURE ΙV Ανάλυση κύριων συντεταγμένων (PCoA) ΙV.3 Αξιολόγηση URP εκκινητών V. ΣΥΖΗΤΗΣΗ - ΣΥΜΠΕΡΑΣΜΑΤΑ VI. ΒΙΒΛΙΟΓΡΑΦΙΚΕΣ ΑΝΑΦΟΡΕΣ iii

7 ΠΕΡΙΛΗΨΗ Τα είδη του γένους Sideritis (Lamiaceae) χρησιμοποιούνται παραδοσιακά ως τσάι για διάφορους θεραπευτικούς σκοπούς. Το τσάι του βουνού έχει γίνει πολύ δημοφιλές τελευταία, εξαιτίας των φαρμακευτικών ιδιοτήτων των κύριων συστατικών του. Έτσι, τα είδη Sideritis υφίστανται εμπορευματοποίηση η οποία οδηγεί σε εκτεταμένη συλλογή φυτών, με αποτέλεσμα τη δραματική μείωση του πραγματικού μεγέθους των φυσικών πληθυσμών τους ή ακόμα και την απώλεια κάποιων από αυτούς. Η γενετική παραλλακτικότητα είναι ενδεικτική του βαθμού απειλής προς εξαφάνιση αυτών των ειδών. Αναλύθηκαν συνολικά 156 ατομικά φυτά του είδους Sideritis raeseri που συλλέχθηκαν από 9 αυτοφυείς πληθυσμούς ορεινών περιοχών της Β. Ελλάδας και της FYROM. Χρησιμοποιήθηκαν 12 URP μοριακοί δείκτες (Universal Rice Primers) στην ανάλυση με PCR (URP-PCR). Η μέθοδος αυτή δίνει πολυμορφικές ζώνες σε ένα εύρος δειγμάτων φυτικού, ζωικού και μικροβιακού DNA και ανιχνεύει γενετική παραλλακτικότητα μεταξύ ειδών, ποικιλιών, ακόμα και ατομικών γενοτύπων στα φυτικά είδη. Οι 12 δείκτες ενίσχυσαν συνολικά 283 ευδιάκριτες και αξιόπιστες πολυμορφικές ζώνες σε όλους τους πληθυσμούς, με κάθε ατομικό φυτό να έχει ένα μοναδικό προφίλ ηλεκτροφόρησης. Η διαπληθυσμιακή γενετική παραλλακτικότητα ήταν μεγαλύτερη σε σχέση με την ενδοπληθυσμιακή, ωστόσο, η διαφοροποίηση αυτή των πληθυσμών δε σχετίζεται με τη γεωγραφική τους απόσταση. Ως κατάλληλα μέτρα διαχείρισης για την προστασία των φυτογενετικών πόρων ενάντια στη γενετική διάβρωση, προτείνεται η ex situ διατήρηση σε τράπεζες γενετικού υλικού και η ενίσχυση της καλλιέργειας. Λέξεις-κλειδιά: σιδερίτης, μοριακοί δείκτες URP, γενετική παραλλακτικότητα 1

8 ABSTRACT Sideritis species (Lamiaceae) are traditionally used as herbal tea for several therapeutical purposes. This mountain tea has become very popular recently due to the pharmaceutical properties of its main compounds. Therefore, Sideritis species undergo commercialisation leading to extensive collection of plants which results in reduction of observed census size or even complete loss of some of their natural populations. The degree of endangerement of these species is indicated by genetic variation. 156 individual plants from 9 native populations that belong to the Sideritis raeseri species, growing in mountainous regions of N. Greece and FYROM were analysed. 12 Universal Rice Primers were used in the PCR analysis (URP-PCR). This technique generates polymorphic bands in a wide range of plant, animal and microbial DNA samples and detects genetic diversity among species, cultivars, even individual genotypes in plant species. The 12 markers amplified a total of 283 distinct and reliable polymorphic bands in all populations, each individual plant having a unique electrophoretic profile. Genetic diversity between populations was greater than diversity found in each population, however inter-population diversity was not correlated to geographic distance. Ex citu conservation strategies and culture development are suggested as appropriate management measures for protection of germplasm resources against genetic erosion. Keywords: Sideritis, URP molecular markers, genetic variation 2

9 Ι. Εισαγωγή

10 Εισαγωγή Η χρήση των αρωματικών και φαρμακευτικών φυτών (ΑΦΦ) ήταν διαδεδομένη από αρχαιοτάτων χρόνων, καθότι ήταν ήδη γνωστές πολλές από τις θεραπευτικές τους ιδιότητες. Σήμερα, τα είδη αυτά αξιοποιούνται ευρέως στην αρωματοποιία, κοσμετολογία, σαπωνοποιία, ζαχαροπλαστική, βιομηχανία τροφίμων, φαρμακευτική, ζωοτροφές, βιολογική καταπολέμηση εχθρών των καλλιεργειών, κ.ά., έχοντας το συγκριτικό πλεονέκτημα έναντι των υπόλοιπων γεωργικών προϊόντων, να διατίθενται σε τρεις διαφορετικές αγορές (ως νωπό προϊόν, ξηρές δρόγες και αιθέρια έλαια-εκχυλίσματα). Τα τελευταία χρόνια δίνεται έμφαση στη μείωση της κατανάλωσης συνθετικών φαρμάκων, στον περιορισμό της χρήσης χημικών πρόσθετων στα τρόφιμα και παράλληλα στην ορθολογικότερη εκμετάλλευση των φυσικών πόρων. Συνεπώς, η παγκόσμια βιομηχανία τροφίμων, ποτών, καλλυντικών και φαρμάκων επιστρέφει στις ουσίες φυτικής προέλευσης για τις πρώτες ύλες της. Λόγω της συλλογής τους για εμπορικούς σκοπούς πολλά ΑΦΦ υπόκεινται σε μεγάλη πίεση επιλογής, με δραματική μείωση των αυτοφυών πληθυσμών τους, όπως συμβαίνει στη χώρα μας με τα διάφορα είδη τσάι του βουνού. Η κρητική μαλοτήρα (Sideritis syriaca), όπως αναφέρουν ερευνητές, έχει αρχίσει τα τελευταία χρόνια να εξαφανίζεται, εξαιτίας της μαζικής συλλογής, αλλά και της υπερβόσκησης που εμποδίζει τη φυσική αναγέννησή της. Το πρόβλημα οξύνθηκε όταν Γερμανοί ερευνητές εντόπισαν σε τρία ελληνικά είδη Sideritis (ένα εκ των οποίων είναι και η μαλοτήρα) κάποια συστατικά που έχουν εντυπωσιακά αποτελέσματα σε περιπτώσεις αγχώδους διαταραχής, αλλά και νευροεκφυλιστικών νόσων (Knörle, 2012). Ακολούθησε φρενίτιδα για τη συλλογή της από Ελληνες αλλά και από αλλοδαπούς που βρίσκονται στην Κρήτη και τώρα είναι είδος προς εξαφάνιση, ενώ οι απόπειρες καλλιέργειάς της εντοπίζονται εκτός Ελλάδος. Ανάλογα φαινόμενα παρατηρήθηκαν και στους ορεινούς όγκους της Β. Ελλάδας και Θεσσαλίας, όπου ενδημούν τα είδη S. scardica και S. raeseri. Για την προστασία των αυτοφυών πληθυσμών ΑΦΦ και άλλων ειδών από την αλόγιστη και άναρχη συλλογή και εκμετάλλευση για εμπορικούς σκοπούς στην Ελλάδα και το εξωτερικό, η οποία έχει οδηγήσει στην αποψίλωση ολόκληρων περιοχών, οι αρμόδιες διοικητικές υπηρεσίες (Δασαρχεία) εκδίδουν ρυθμιστικές διατάξεις που καθορίζουν ποσότητες και χρόνο συλλογής των ειδών αυτών, με εφαρμογή των αρχών της αειφορικής συλλογής. Όμως, το πλέον αποτελεσματικό μέτρο είναι η καλλιέργεια των ΑΦΦ, σε συνδυασμό με την ορθή συλλογή των αυτοφυών φυτών. Μετά τη διαπίστωση του Παγκόσμιου Οργανισμού Τροφίμων (FAO) ότι το 75% της βιοποικιλότητας των καλλιεργειών έχει χαθεί, η «Επιτροπή για τους Γενετικούς Πόρους στα Τρόφιμα και τη Γεωργία» επισημαίνει τη σημασία ανάπτυξης ενός σχεδίου δράσης για τη διατήρηση των αυτοφυών, συγγενικών των καλλιεργούμενων, ειδών που απειλούνται. Παράλληλα, το Πρωτόκολλο της Ναγκόγια για την πρόσβαση στους γενετικούς πόρους και τον ισόρροπο και δίκαιο καταμερισμό των πλεονεκτημάτων που προκύπτουν από τη χρήση τους, που έχει υιοθετήσει πρόσφατα και η χώρα μας, επιβάλλει μέτρα για την πάταξη της 4

11 Εισαγωγή «βιοπειρατείας» και ανοίγει το δρόμο για τη διεκδίκηση δικαιωμάτων από την παράνομη χρήση των γενετικών πόρων, που έχουν μεταξύ άλλων και οικονομική διάσταση. Η Ελλάδα χαρακτηρίζεται από τεράστια βιοποικιλότητα και τα αρωματικά και φαρμακευτικά φυτά αποτελούν στοιχεία του ελληνικού οικοσυστήματος. Για αυτό το λόγο, μπορούν να καλλιεργηθούν ΑΦΦ σε όλες τις περιοχές (ορεινές, ημιορεινές) και να αξιοποιήσουν τις oριακές και εγκαταλελειμμένες εκτάσεις και τα υποβαθμισμένα εδάφη, με την προϋπόθεση ότι οι βιότυποι που θα καλλιεργηθούν θα είναι επιλεγμένοι και προσαρμοσμένοι στις εδαφοκλιματικές συνθήκες της περιοχής. Ο πολυετής χαρακτήρας των περισσοτέρων ΑΦΦ, οι ελάχιστες απαιτήσεις τους σε μηχανική κατεργασία του εδάφους, εισροές και υδατικό δυναμικό, η ανθεκτικότητά τους σε εχθρούς και ασθένειες (ως είδη που είναι ήδη προσαρμοσμένα στις συνθήκες κάθε περιοχής), καθιστούν την καλλιέργειά τους οικονομική και ιδανική για εφαρμογή συστημάτων βιολογικής καλλιέργειας και αειφορικής αξιοποίησης φυσικών πόρων. Η αντίστοιχη πιστοποίηση των προϊόντων επιβάλλεται όταν προορίζονται για την αγορά του εξωτερικού και επιπλέον, τους προσδίδει την υπεραξία τους. Η καλλιέργεια ΑΦΦ παρουσιάζει ενδιαφέρον τόσο σε επίπεδο εφαρμογής όσο και σε επίπεδο επένδυσης και επιχειρηματικότητας. Ο συνδυασμός της με τη δημιουργία μονάδων επεξεργασίας, τυποποίησης, μεταποίησης - παραγωγής αιθερίων ελαίων - εκχυλισμάτων και άλλων προϊόντων υψηλής προστιθέμενης αξίας, συμβάλλει στην ανάπτυξη και του δευτερογενούς τομέα της οικονομίας. Στην κατεύθυνση της αξιοποίησης των αυτοφυών αρωματικών φυτών της χώρας μας προσανατολίζονται ήδη ελληνικές αλλά και ξένες εταιρίες, με την ανάπτυξη της βιομηχανικής έρευνας, έχοντας ως αντικείμενο την ανάδειξη ιδιοτήτων φαρμακευτικών φυτών της ελληνικής χλωρίδας. Ως αποτέλεσμα, η καλλιέργεια πλέον απολαμβάνει ιδιαίτερο ενδιαφέρον από νέους καλλιεργητές και καταγράφει αυξητική τάση της αγοράς σε εθνικό και διεθνές επίπεδο, με προοπτικές ανάπτυξης. Η περίπτωση της αξιοποίησης του σιδερίτη από τη βιομηχανία για την παραγωγή του εξαγώγιμου παραδοσιακού και ταυτόχρονα καινοτόμου ροφήματος, είναι ένα τέτοιο παράδειγμα. Τα παγωμένα ροφήματα με βάση βότανα και κυρίως το τσάι είναι μια αναπτυσσόμενη αγορά στη χώρα μας, σε αντίθεση με τα αναψυκτικά και τους χυμούς των οποίων οι πωλήσεις παρουσιάζουν πτωτική τάση. Για την κάλυψη των αναγκών σε πρώτη ύλη, ο σιδερίτης καλλιεργείται σε χαρακτηρισμένες ως μειονεκτικές περιοχές της Β. Ελλάδας με υψόμετρο πάνω από 500 μέτρα. Ενα από τα μεγαλύτερα προβλήματα που αντιμετωπίζουν σήμερα οι Ελληνες παραγωγοί είναι ότι η καλλιέργεια και εμπορία πολλαπλασιαστικού υλικού ΑΦΦ αφορά μη πιστοποιημένο ελληνικό γενετικό υλικό, ενώ συχνά παρατηρείται ότι φυτώρια πολλαπλασιάζουν κάποια είδη ΑΦΦ που έχουν προέλθει από φυσικούς πληθυσμούς. Λόγω ελλιπούς έρευνας, οι προσπάθειες καλλιέργειας είναι βραχυπρόθεσμες. Συνέπεια του κενού που υπάρχει, κάποια υποείδη ρίγανης των νησιών του Ανατολικού Αιγαίου έσπευσε να τα κατοχυρώσει η Τουρκία αξιοποιώντας λίγες καλλιέργειες στα παράλιά της, ενώ 5

12 Εισαγωγή αντίστοιχα έχει κινηθεί το Ισραήλ για ένα είδος θρούμπης, η Ισπανία για το θυμάρι, η Βουλγαρία για το τσάι του Ολύμπου κ.ο.κ.. Πέραν αυτού, η αγορά απαιτεί σταθερά και υψηλής ποιότητας προϊόντα, έτσι η εύρεση γενετικού υλικού με σταθερά ποιοτικά και ποσοτικά χαρακτηριστικά από αυτοφυείς πληθυσμούς στη χώρα μας αποτελεί επίσης ένα μείζον θέμα. Το καλοκαίρι του 2013 ιδρύθηκε η Ένωση Αρωματικών Φαρμακευτικών Φυτών Ελλάδος» (Association of Medicinal and Aromatic Plants of Greece) με διακριτικό τίτλο «ΕΑΦΦΕ» (ΑMΑPs of Greece) και έδρα τη Θεσσαλονίκη, που έχει τη μορφή Αστικής Μη Κερδοσκοπικής Εταιρίας. Η Ένωση μέσω και των συνεργασιών της θα επιχειρήσει τη δημιουργία βάσης δεδομένων των μελών της ανά κατηγορία και θα συμβάλλει ενεργά στην παραγωγή και διακίνηση πιστοποιημένου πολλαπλασιαστικού υλικού ΑΦΦ, καθώς και στη βελτίωση και παραγωγή ελληνικών ποικιλιών. Συνοψίζοντας τα παραπάνω, μπορούμε να πούμε πως η προστασία των αυτοφυών πληθυσμών και η διατήρηση της βιοποικιλότητας (ειδικά για τις περιοχές που θεωρούνται hotspots), η εθνική κατοχύρωση των γενετικών πόρων για την ορθή οικονομική εκμετάλλευσή τους, καθώς και η αξιολόγηση του διαθέσιμου γενετικού υλικού για τη δημιουργία πιστοποιημένου πολλαπλασιαστικού υλικού και τα οφέλη που μπορεί να έχει η χώρα μας από την καλλιέργειά του, έχουν κοινό εναρκτήριο βήμα την καταγραφή και αξιολόγηση της κατάστασης των αυτοφυών πληθυσμών των ΑΦΦ. Στη διατριβή αυτή μελετώνται αυτοφυείς πληθυσμοί του είδους S. raeseri ορεινών περιοχών της Β. Ελλάδας και της FYROM με τη χρήση μοριακών δεικτών και επιχειρείται να δοθεί απάντηση όσον αφορά στο βαθμό απειλής τους από την αλόγιστη συλλογή. Οι μοριακοί δείκτες έχουν τη δυνατότητα να απεικονίσουν τη γενετική παραλλακτικότητα, η οποία σχετίζεται με τη βιωσιμότητα των πληθυσμών και τη δυνατότητα μελλοντικής εξέλιξής τους, ενώ μπορεί να διαπιστωθεί η παρουσία γενετικής διάβρωσης. Ο απώτερος σκοπός σε πρώτη φάση είναι να καταρτιστεί και να εφαρμοστεί το κατάλληλο σχέδιο για την προστασία και τη διατήρηση των αυτοφυών πληθυσμών. 6

13 II. Βιβλιογραφική Ανασκόπηση

14 Βιβλιογραφική Ανασκόπηση II.1 Ιστορικά Στοιχεία, Συστηματική Ταξινόμηση και Γεωγραφική Εξάπλωση των ειδών Sideritis Στην Ελλάδα το τσάι του βουνού είναι γνωστό από την αρχαιότητα και αναφέρεται από το Θεόφραστο ( π.χ.) και τον Διοσκουρίδη (40-90 μ.χ.) (Ανάσης, 1976). Το επιστημονικό όνομα Sideritis προέρχεται από τη λέξη «σίδηρος» και κατά μια εκδοχή δόθηκε στο φυτό εξαιτίας της ικανότητάς του να επουλώνει τις πληγές από σιδερένια αντικείμενα, όπως βέλη και ξίφη. Σύμφωνα με μια άλλη, λόγω της υψηλής περιεκτικότητας σε σίδηρο που χαρακτηρίζουν τα ροφήματά του. Κατ άλλους, η ονομασία του φυτού οφείλεται στο σχήμα των οδόντων του κάλυκα, που μοιάζουν με αιχμή λόγχης (Γεννάδιος, 1959). Ο Διοσκουρίδης στο έργο του «Περί Ιατρικής Ύλης» ( De Materia Medica ) περιγράφει τους βοτανικούς χαρακτήρες και τις φαρμακευτικές ιδιότητες τριών ειδών σιδερίτη. Κατά ορισμένους ερευνητές που διαφωνούν με την περιγραφή του Διοσκουρίδη, τα είδη αυτά αντιστοιχούν στο Sίderίtίs scordίοίdes ή το Stachys cretica, σε κάποιο είδος Poterium, ενώ για το τρίτο είδος που δεν υπάρχει ταύτιση απόψεων, η περιγραφή του αποδίδεται κατά καιρούς στο Geranium robertianum, καθώς και σε είδη Scrophularia, κ.α.. Ο Λινναίος ήταν ο πρώτος που περιέγραψε τα είδη αυτά (Γαβριέλη, 1999). Το γένος Sideritis είναι ένα εκ των τριών μεγαλυτέρων της οικογένειας Lamioideae (Cantino, 1992) και εκπροσωπείται από πάνω από 150 είδη θαμνωδών, ποωδών, ετήσιων και πολυετών φυτών, που κατανέμονται στις εύκρατες και τροπικές περιοχές του Β. ημισφαιρίου (Εικόνα 1). Τα περισσότερα είδη εντοπίζονται στη λεκάνη της Μεσογείου, από τα Κανάρια νησιά και τη Μαδέρα ως τον Καύκασο. Η Ισπανία και η Τουρκία κατέχουν το μεγαλύτερο αριθμό διαφορετικών ειδών (Güvenç et al., 2005, Aslan et al.,2006, Loğoğlu et al., 2006). Tο γένος περιλαμβάνει πολλά ενδημικά είδη (González-Burgos et al., 2011). Εικόνα 1: Γεωγραφική εξάπλωση του γένους Sideritis. Είναι διακριτή η παρουσία του υπογένους Marrubiastrum στο αρχιπέλαγος της Μαδέρας (Barber et al., 2002). 8

15 Βιβλιογραφική Ανασκόπηση Κατά τους Barber et. al (2002), στην πλειοψηφία τους τα είδη Sideritis, ανήκουν στο υπογένος Sideritis, που διαχωρίζεται στα επιμέρους sections Sideritis και Empedoclea (πολυετή είδη), Hesiodia και Burgsdorfia (ετήσια είδη). Τα είδη του section Empedoclea είναι χαρακτηριστικά στην Ιταλία, τα Βαλκάνια, τα νησιά του Αιγαίου, την Τουρκία και την Εγγύς Ανατολή και σύμφωνα με τους Duman et al. (2005), το κέντρο καταγωγής του section είναι η Τουρκία, με ένα ποσοστό ενδημικών ειδών 80%. Το δε section Sideritis περιλαμβάνει είδη που ενδημούν στη Δυτική Μεσόγειο και που φτάνουν μέχρι τη Β. Ιταλία και τη Β. Τυνησία (Rivera Nuñez and Obón De Castro, 1990). Το έτερο υπογένος Marrubiastrum αντιπροσωπεύει ενδημικά πολυετή είδη του αρχιπελάγους της Μαδέρας και των Καναρίων Νήσων και υποδιαιρείται στα sections Marrubiastrum, Empedocleopsis και Creticae (Pérez de Paz and Negrín Sosa, 1992). Αρχικά, οι Webb and Berthelot, 1845 και μετέπειτα ο Kunkel (1973) πρότειναν την ταξινόμηση των taxa των Καναρίων Νήσων στο ξεχωριστό γένος Leucophae. Ιδιαίτερο ενδιαφέρον παρουσιάζει το ότι κάποια taxa των Καναρίων είναι πιο συγγενικά με εκείνα της Αν. Μεσογείου, σε σχέση με εκείνα της Ιβηρικής Χερσονήσου ή της Β. Αφρικής (Bramwell, 1976, Bramwell and Richardson, 1973, Sventenius, 1968), γεγονός που ώθησε την Huynh (1972), μετά από παλυνολογική μελέτη, να τα εντάξει σε ένα δικό τους section, το Empedocleopsis. Όμως, το 1977 η Mendoza-Heuer έκρινε πως τα νησιωτικά είδη ήταν αρκετά διακριτά από τα ηπειρωτικά και τα ταξινόμησε στο ξεχωριστό υπογένος Marrubiastrum. Την ύπαρξη των υπογενών Sideritis και Marrubiastrum για τα είδη της Μεσογείου και των Καναρίων Νήσων αντίστοιχα, αντί του ξεχωριστού γένους Leucophae, υποστηρίζει και ο Fraga στην ανασκόπησή του βάσει χημικής σύστασης (2012), αλλά και οι González-Burgos et al. (2011) επισημαίνουν τη σημαντική διαφοροποίηση των υπογενών αναφορικά με τον αριθμό χρωμοσωμάτων. Όσον αφορά στα ετήσια είδη, υπήρξαν επίσης πολλές διαφωνίες, όπου αρχικά ο Bentham (1848) ομαδοποίησε όλα τα μέχρι τότε γνωστά ετήσια είδη σε ένα section, το Hesiodia. Πλέον, η επικρατούσα άποψη είναι αυτή του Briquet (1893), όπου διέκρινε δύο sections, το Hesiodia και το Burgsdorfia, άποψη που υποστηρίχθηκε και από τις μελέτες των Huynh (1972) και Rejdali (1990, 1992). Στην Ελλάδα αυτοφύονται διάφορα είδη Sideritis, εκ των οποίων τα κυριότερα και πιο διαδεδομένα ανήκουν στο section Empedoclea και είναι τα εξής (Εικόνα 2, Ανάσης, 1976): Sideritis raeseri Boiss. & Heldr. (τσάι του Παρνασσού ή τσάι του Bελουχιού): αυτοφύεται στον Παρνασσό, Τυμφρηστό (Βελούχι) και σε άλλα βουνά της Αιτωλίας, Δωρίδας και Φθιώτιδας. Sideritis clandestina Chaub. & Borry. (τσάι Ταΰγετου): αυτοφύεται πάνω στους βράχους, στις υποαλπικές και αλπικές περιοχές του Μαλεβού, του Ταΰγετου και της Κυλλήνης. 9

16 Βιβλιογραφική Ανασκόπηση Sideritis scardica Griseb. (τσάι του Ολύμπου): αυτοφύεται σε βραχώδη εδάφη της υποαλπικής ζώνης του Ολύμπου, Κίσαβου, Πηλίου και Σκάρδου. Sideritis euboea Heldr. (τσάι της Εύβοιας ή τσάι από το Δέλφι): αυτοφύεται άφθονο στο βουνό Δίρφυς σε υψόμετρο μ., καθώς και στο Ξεροβούνι Εύβοιας, σε υψόμετρο 1400μ. Sideritis athoa Papanikolaou & Kokkini. (τσάι βλάχικο): φύεται στον Άθω, στην Πίνδο και στα ορεινά του νησιού Σαμοθράκη. S. perfoliata, έχει αναφερθεί κάποιες φορές και ως συνώνυμο του S. athoa Sideritis syriaca L., συνώνυμο του. S. cretica Sibth. & Sm. (τσάι της Κρήτης ή μαλοτήρα): Αυτοφύεται στα ψηλά βουνά της Κρήτης και κυρίως στα Λευκά Όρη και τον Ψηλορείτη, σε ύψος μέτρα. Tο όνομα μαλοτήρα προέρχεται από τις Ιταλικές λέξεις male (αρρώστια) και tirare (σύρω), επειδή στην ενετοκρατούμενη Κρήτη το θεωρούσαν πανάκεια για τα κρυολογήματα και τις παθήσεις του αναπνευστικού. Ο Heywood στη Flora Europaea (1972) έκρινε πως το S. raeseri και το S. taurica είναι συνώνυμα του S. syriaca, ενώ ο Baden στο Mountain Flora of Greece (1991) περιγράφει ξεχωριστά το S. raeseri από το S. syriaca. Εικόνα 2: Γεωγραφική εξάπλωση των διαφόρων ειδών Sideritis στον Ελλαδικό χώρο (Ανάσης, 1976). 10

17 Βιβλιογραφική Ανασκόπηση II.2 Βοτανικοί Χαρακτήρες των ελληνικών ειδών Sideritis sect. Empedoclea Το γένος Sideritis ανήκει στην οικογένεια Lamiaceae και αποτελείται από δικότυλα, ετήσια ή πολυετή ημιθαμνώδη φυτά, ύψους cm. Τα φύλλα και οι βλαστοί των φυτών αυτών φέρουν τις χαρακτηριστικές της οικογένειας αδενώδεις τρίχες που εκκρίνουν αιθέρια έλαια. Οι βλαστοί είναι απλοί ή διακλαδισμένοι και προς τη βάση τους συνήθως αποξυλωμένοι, ενώ σε κάποια είδη, όπως στο S. syriaca, έχουν τη χαρακτηριστική τετράγωνη διατομή των Lamiaceae. Τα φύλλα είναι απλά, χωρίς παράφυλλα, ωοειδή ή προμήκη, ακέραια ή οδοντωτά. Τα κατώτερα είναι έμμισχα, ενώ τα ανώτερα συνήθως δε φέρουν μίσχο. Τα άνθη είναι ερμαφρόδιτα, μικρά, ζυγόμορφα, που συνήθως σχηματίζουν στάχυ. Ο κάλυκας είναι σε σχήμα κώνου, με 10 νευρώσεις και 5 οδόντες, διατεταγμένους σε δύο χείλη. Η στεφάνη είναι κίτρινη, κιτρινόλευκη, λευκή ή ροδόχροη, σωληνοειδής, συμπέταλη, δίχειλη, όπου το άνω χείλος αποτελούμενο από δύο συμφυή πέταλα, είναι συνήθως δισχιδές, ενώ το κάτω καταλήγει σε τρεις λοβούς, από τους οποίους ο μεσαίος είναι ο μεγαλύτερος. Υπάρχουν τέσσερεις διδύναμοι στήμονες, εκ των οποίων οι δύο πρόσθιοι είναι επιμηκέστεροι και διαθέτουν από 2 γυρεόσακκους, ενώ οι άλλοι δύο έχουν ατροφικούς ή δύσμορφους ανθήρες. Ο στύλος είναι απλός και καταλήγει σε ένα δισχιδές στίγμα. Είναι έγκλειστος, με τον άνω λοβό κυλινδρικό και τον κάτω πεπλατυσμένο, ο οποίος περιβάλλει τη βάση του άνω. Η ωοθήκη είναι επιφυής, σύγκαρπη, δίχωρη που με ψευδή διαφράγματα γίνεται τετράχωρη. Σε κάθε χώρο περιέχεται μια ανάτροπη σπερμοβλάστη. Ο δε καρπός είναι σχιζοκάρπιο, αποτελούμενος από 4 μονόσπερμα κάρυα (Διαπούλης, 1949, Χατζοπούλου, 1962, Στεφανάκη-Νικηφοράκη, 2000). Οι κυριότερες μορφολογικές διαφορές των διαφόρων ειδών Sideritis αφορούν στην απόχρωση και το σχήμα των φύλλων, ιδιαίτερα των βράκτιων, στο χνούδι των φύλλων, στο μέγεθος και το χνούδι του κάλυκα και στο μήκος των μεσογονατίων διαστημάτων των ανθοφόρων στελεχών που καθορίζει τη συνεκτικότητα της ταξιανθίας. Ο αριθμός χρωμοσωμάτων στα ελληνικά είδη σιδερίτη στα οποία αναφερθήκαμε στην προηγούμενη παρ άγραφο είναι 2n=32, με εξαίρεση τα S. athoa και S. scardica που έχουν από 2 επιπλέον Β- χρωμοσώματα (Goliaris and Roupakias, 1997). Κατά τους Esra et al. (2009), το S. athoa, το S. scardica και το S. perfoliata που φύονται στην Τουρκία έχουν αντίστοιχα 6, 1 και 3 Β χρωμοσώματα. Στη φύση, τα είδη Sideritis αναπαράγονται εγγενώς και αγενώς, αλλά επειδή το σύστημα αναπαραγωγής δεν έχει ερευνηθεί επαρκώς, είναι άγνωστο το ποσοστό συμμετοχής κάθε τρόπου στην εξάπλωση κάθε είδους. Επομένως, αναμένεται γενετική παραλλακτικότητα στους φυσικούς πληθυσμούς (Goliaris and Roupakias, 1997). Έχει αναφερθεί στη 11

18 Βιβλιογραφική Ανασκόπηση βιβλιογραφία μεγαλύτερη ενδοπληθυσμιακή παραλλακτικότητα από ότι μεταξύ των πληθυσμών σε είδη του section Sideritis και συγκεκριμένα στο S. pusilla (Las Heras Vasquez et al., 1999) και στο S. discolor (Batista et al., 2004), γεγονός που συμφωνεί με την αναμενόμενη παραλλακτικότητα για τα σταυρογονιμοποιούμενα είδη (Hamrick, 1990) και ίσως οφείλεται και στη διχογαμία που χαρακτηρίζει συχνά τα είδη Sideritis (Pallarés, 1990). Παρατίθενται στη συνέχεια φωτογραφίες της ταξιανθίας και ολόκληρου φυτού (Εικόνα 3) από το S. raeseri ssp. raeseri. β α Εικόνα 3: (α) Ταξιανθία του S. raeseri ssp. raeseri (όρος Γράμμος, m), (β) Φυτό S. raeseri ssp. raeseri (όρος Παρνασσός, m). Ευχαριστούμε θερμά τον κ. Πολυμενάκο Κωνσταντίνο για την ευγενική παραχώρηση των φωτογραφιών. II.3 Η Καλλιέργεια Τσάι του Βουνού Ο σημαντικός ρόλος του σιδερίτη ως παραδοσιακό αφέψημα στην περιοχή της ανατολικής Μεσογείου και της Ισπανίας, έχει αυξήσει την ανάγκη για καλλιέργειά του, καθότι η συλλογή των αυτοφυών φυτών δεν αρκεί για να καλύψει τις ανάγκες της αγοράς (González-Burgos et al., 2011). Συγκεκριμένα, οι Pljevljakušić et al. (2011) αναφέρουν πως οι σημαντικές θεραπευτικές ιδιότητες του Sideritis raeseri έχουν καταστήσει απαραίτητη την καλλιέργειά του στη Σερβία, όπου μέχρι σήμερα γίνονται εισαγωγές από την Αλβανία και την ΠΓΔΜ. Στη βιβλιογραφία υπάρχουν αναφορές για την καλλιέργεια του S. scardica και του υβριδίου S. scardica x S. syriaca (Evstatieva and Koleva, 2000, Kostadinova et al., 2008). Τα είδη Sideritis αυτοφύονται μεμονωμένα ή σε πληθυσμούς σε πολλές ορεινές περιοχές της χώρας μας, με υψόμετρο πολλές φορές πάνω από m. Συνήθως ευδοκιμούν σε 12

19 Βιβλιογραφική Ανασκόπηση βραχώδη και ασβεστολιθικά εδάφη, αλλά μπορούν να προσαρμοστούν σε πολλούς τύπους εδαφών, με ένα εύρος ph (6-8). Παρουσιάζουν ιδιαίτερη αντοχή στις χαμηλές θερμοκρασίες του χειμώνα, όχι μόνον το υπόγειο, αλλά και το υπέργειο μέρος των φυτών, έτσι η ανάπτυξή τους αρχίζει πολύ νωρίς την άνοιξη. Ευνοούνται επίσης πολύ από μεγάλες διαφορές θερμοκρασίας ημέρας και νύχτας. Η εγκατάσταση της καλλιέργειας μπορεί να γίνει σε χωράφια που έχουν καταστραφεί από μακροχρόνια χρήση ή ακόμα και σε βραχώδεις χορτολιβαδικές εκτάσεις. Ως καλλιέργεια χαρακτηρίζεται ξηρική, αλλά για να διατηρήσει το προϊόν την ποιότητά του και για την ελαχιστοποίηση των προβλημάτων, θα πρέπει οι συνθήκες να ομοιάζουν στο μέγιστο δυνατό με εκείνες στα φυσικά ενδιαιτήματα του είδους. Έχει παρατηρηθεί πως όσο κατεβαίνουμε υψομετρικά, τόσο τα προβλήματα μεγαλώνουν κυρίως από ζιζάνια, αλλά και από εχθρούς (έντομα, αφίδες). Όπως στα περισσότερα ΑΦΦ, η εμπορική μορφή και στο τσάι του βουνού είναι είτε η ξηρή δρόγη, είτε προϊόντα μεταποίησης υψηλής προστιθέμενης αξίας (αιθέρια έλαια, ή άλλες βιοδραστικές ουσίες), έπειτα από σχετική κατεργασία. Για την εδραίωσή τους στις αγορές του εξωτερικού, τα προϊόντα αυτά πρέπει να χαρακτηρίζονται από υψηλή ποιότητα, σταθερότητα, αλλά και συνέχεια στην παράδοση. Οι καλλιεργητικές φροντίδες, αλλά και όλοι οι πιθανοί χειρισμοί μετά τη συγκομιδή έχουν ιδιαίτερη σημασία, γιατί προσδίδουν υπεραξία στο προϊόν, οπότε πρέπει να γίνονται με ιδιαίτερη προσοχή και με τα σωστά μέσα. II.3.1 Προετοιμασία αγρού-εγκατάσταση φυτείας Η υπερβολική κατεργασία του εδάφους δεν είναι απαραίτητη για την εγκατάσταση. Η προετοιμασία του χωραφιού διενεργείται το καλοκαίρι με ένα βαθύ όργωμα και λίγο πριν τη φύτευση, ανάλογα το έδαφος, συνεχίζεται με ένα φρεζάρισμα ή ελαφρύ όργωμα και δισκοσβάρνισμα, κυρίως για την καταπολέμηση των ζιζανίων και τη διευκόλυνση της φύτευσης (Γκόλιαρης, 1999). Για τις ελληνικές συνθήκες η περίοδος Οκτώβριος-Νοέμβριος είναι η καταλληλότερη για τη φύτευση των παραφυάδων ή των φυταρίων του σπορείου. Οι αποστάσεις φύτευσης είναι cm μεταξύ των γραμμών και 40 cm επί της γραμμής. Ο αριθμός φυτών ανά στρέμμα που προκύπτει είναι γύρω στις Η φύτευση μπορεί να γίνει με φυτευτικές μηχανές καπνού/τομάτας, εφαρμόζοντας την κατάλληλη ρύθμιση, με το χέρι σε μικρούς λάκκους ή με το φυτευτήρι. Αν δεν ακολουθήσει βροχόπτωση, ποτίζουμε στις ρίζες για καλύτερο αποτέλεσμα (Σαρλής, 1994). II.3.2 Λίπανση Γενικά γίνεται προσεκτικά και με μικρές δόσεις. Συνήθως, λιπαίνουμε με 20 kg/στρέμμα φωσφορικής αμμωνίας κατά το φθινόπωρο, εφόσον κριθεί αναγκαίο. Όταν η καλλιέργεια 13

20 Βιβλιογραφική Ανασκόπηση είναι ζωηρή, αποφεύγεται η λίπανση που θα είχε ως συνέπεια μεγάλη ανάπτυξη φυτών και υποβάθμιση του τελικού προϊόντος. II.3.3 Άρδευση Η καλλιέργεια είναι κυρίως ξηρική και γενικά το πότισμα αποφεύγεται, για να αποτραπεί η υποβάθμιση της ποιότητας και κατά συνέπεια η εμπορική αξία του προϊόντος. Ο σιδερίτης όμως αξιοποιεί πολύ καλά το νερό όταν του δοθεί, αρκεί να είναι σε μικρές δόσεις και να μην παραμένει στο ριζικό σύστημα του φυτού, καθώς είναι ευαίσθητο σε σηψιρριζίες. II.3.4 Καταπολέμηση ζιζανίων Το μεγαλύτερο πρόβλημα που αντιμετωπίζει η καλλιέργεια του σιδερίτη είναι τα ζιζάνια. Κατά κύριο λόγο η εδαφοκάλυψη ή τα ανοιξιάτικα σκαλίσματα είναι τα μέσα καταπολέμησής τους και συνήθως κατά το πρώτο και δεύτερο έτος της φυτείας, επειδή τα επόμενα χρόνια τα φυτά καλύπτουν την επιφάνεια του χωραφιού. II.3.5 Συγκομιδή και αποδόσεις Η συλλογή των ανθοφόρων βλαστών γίνεται στο στάδιο της πλήρους ανθήσεως (Ιούλιος- Αύγουστος), όταν οι βλαστοί αρχίσουν να ξυλοποιούνται, οπότε και η περιεκτικότητα σε αιθέριο έλαιο είναι μεγαλύτερη. Συλλέγονται προσεκτικά, με λεπίδα ή ψαλίδι τα ανθοφόρα στελέχη μαζί με βλαστικό τμήμα μήκους 5-6 cm, πάνω από το ξυλώδες τμήμα του φυτού, αφήνοντας τουλάχιστον το 1/3 με καλά αναπτυγμένους ανθοφόρους βλαστούς, προκειμένου να εξασφαλιστεί η σποροπαραγωγή. Ακολουθεί η ξήρανσή τους σε υπόστεγα, με άπλωμα ή κρέμασμα σε μικρά δεμάτια, μέχρι να αποκτήσουν το επιθυμητό πρασινοκίτρινο χρώμα, που μαζί με το δυνατό και ευχάριστο άρωμα αποτελούν δείκτες καλής ξήρανσης. Τέλος, ακολουθεί η δεματοποίηση σε δέματα των kg, που περιμετρικά καλύπτονται με λινάτσα όπως ο καπνός και η φύλαξή τους σε καλά αεριζόμενες αποθήκες, μέχρι τη διάθεση της ξηρής δρόγης στο εμπόριο (Σαρλής, 1994, Γκόλιαρης, 1999). Η καλλιέργεια στο ίδιο χωράφι διαρκεί 5-8 χρόνια και με τις κατάλληλες καλλιεργητικές φροντίδες η παραγωγική ζωή της μπορεί να φτάσει και τα έτη. Η παραγωγή αυξάνεται το 2ο-4ο έτος και από το 5ο αρχίζει και μειώνεται. Η μέση παραγωγή ξηρού προϊόντος σε χρονιά πλήρους παραγωγής (3ο έτος), ανέρχεται σε kg/στρέμμα και οι ποσότητες που συλλέγονται ετησίως στη χώρα μας ανέρχονται σε τόνους (Σαρλής, 1994). Έχει αναφερθεί πως η βιολογική καλλιέργεια του σιδερίτη έχει πολύ μεγαλύτερες αποδόσεις, σχεδόν διπλάσιες. II.3.6 Πολλαπλασιασμός Επειδή πρόκειται για πολυετή καλλιέργεια, το κόστος για την απόκτηση πολλαπλασιαστικού υλικού στο τσάι του βουνού επιβαρύνει κυρίως τον πρώτο χρόνο της 14

21 Βιβλιογραφική Ανασκόπηση καλλιέργειας, εφόσον τα επόμενα χρόνια ο παραγωγός έχει τη δυνατότητα να δημιουργήσει το δικό του πολλαπλασιαστικό υλικό και να επεκτείνει την καλλιέργεια από τις έτοιμες φυτείες. Ο σιδερίτης πολλαπλασιάζεται εγγενώς, αλλά και αγενώς με παραφυάδες. Στις ακόλουθες παραγράφους αναλύονται κατά περίπτωση οι διαδικασίες για την απόκτηση του πολλαπλασιαστικού υλικού. II Εγγενώς με σπόρο Τα φυτά από τα οποία θα συλλέξουμε τις ταξιανθίες πρέπει να είναι υγιή και εύρρωστα, να έχει γίνει καλά η γονιμοποίηση των ανθέων και η ωρίμανση του σπόρου. Οι ταξικαρπίες συλλέγονται, ξηραίνονται και με χτύπημά τους ο σπόρος αποχωρίζεται. 1 gr σπόρου ισοδυναμεί με 600 σπόρους. Θεωρητικά, για την κάλυψη ενός στρέμματος στο χωράφι, αρκούν 7 gr σπόρου, όμως πρακτικά χρησιμοποιούνται περίπου 15 gr, για να αντισταθμιστούν τυχόν απώλειες λόγω μειωμένης βλαστικής ικανότητας. Η ποσότητα αυτή σπέρνεται σε σπορείο 5 m 2 από τον Αύγουστο μέχρι αρχές Οκτώβρη. Η σπορά και οι καλλιεργητικές φροντίδες του σπορείου είναι ίδιες με εκείνες της τομάτας ή του καπνού. Ο σπόρος πρέπει να σπέρνεται αραιά, ειδάλλως η μεγάλη πυκνότητα των φυτών θα έχει ως επακόλουθο τον ανεπαρκή αερισμό τους και το αυξημένο ενδεχόμενο να καταστραφούν από σηψιρριζία. Τέλος, τα σπορόφυτα μεταφυτεύονται στον αγρό, μόλις φτάσουν το στάδιο των 4-6 φύλλων (Γκόλιαρης, 1999). Φτηνή και μαζική μέθοδος, ο εγγενής πολλαπλασιασμός έχει το πλεονέκτημα της γρήγορης ανάπτυξης των σποροφύτων, λόγω ζωηρότητας και νεανικότητας. II Αγενώς με παραφυάδες Από φυτείες δύο ετών ή παλαιότερες, επιλέγονται μητρικά φυτά από όπου αφαιρούνται οι πλευρικοί βλαστοί (φυσικές καταβολάδες με λίγες ρίζες στη βάση) οι οποίοι και φυτεύονται, όπως και τα φυτάρια των σπορείων. Μπορούν να προκύψουν έως και 50 νέα φυτά από κάθε φυτό. Η εποχή της διαίρεσης τοποθετείται τον Οκτώβριο. Εάν είναι καλλιεργούμενο το φυτό μπορεί να δώσει πολλές παραφυάδες, σε αντίθεση με το αυτοφυές που δίνει πολύ λιγότερες (Γκόλιαρης, 1999). Προτιμάται ο αγενής τρόπος πολλαπλασιασμού, ώστε να αποφευχθεί η ανομοιομορφία του φυτικού υλικού στην ανάπτυξη κατά την άνθιση και στον αριθμό των παραγόμενων ανθοφόρων βλαστών. Μέσω ιστοκαλλιέργειας μπορεί να δημιουργηθεί αρχικό υλικό υψηλής ποιότητας σε μεγάλη ποσότητα και σε σύντομο χρονικό διάστημα και στη συνέχεια να προκύψουν νέα υγιή φυτά στον αγρό από παραφυάδες. Προϋπόθεση για τα παραπάνω αποτελεί η τήρηση σειράς μέτρων για την άριστη φυτοϋγεία. 15

22 Βιβλιογραφική Ανασκόπηση II.4 Χημική Σύσταση του Σιδερίτη Έχει πραγματοποιηθεί μεγάλος αριθμός εργασιών που αφορούν στον ποιοτικό και ποσοτικό προσδιορισμό των συστατικών διαφόρων ειδών Sideritis. Λόγω των χαρακτηριστικών του γένους διτερπενοειδών και φλαβονοειδών (Venturella and Bellino, 1977, Gonzáles et al., 1978, García-Granados et al., 1979, Gonzáles et al., 1979, García- Granados et al., 1981), οι φυτοχημικές μελέτες κατά τις δεκαετίες του 70 και 80 εστιάζονταν στη χημειοταξινόμηση. Τα είδη Sideritis παρουσιάζουν έντονο υβριδισμό, ο οποίος μπορεί να λάβει χώρα ακόμα και μεταξύ πιο απομακρυσμένων ειδών (που ανήκουν ακόμα και σε διαφορετικά sections), γεγονός που δυσχεραίνει την ταξινόμηση βάσει κλασικών μεθόδων, αλλά ακόμα και αυτήν την ίδια τη χημειοταξινόμηση (Gergis et al., 1989, Sanchez and Segura, 1997, Todorova et al., 2000). Ωστόσο ο συνδυασμός χημειοταξινομικών δεικτών του γένους (διτερπένια και φλαβονοειδή) με συγκεκριμένα μορφολογικά χαρακτηριστικά έχει συνεισφέρει στη διαλεύκανση αρκετών περιπτώσεων στη συστηματική των ειδών Sideritis (González-Burgos et al., 2011). Πέραν του γενετικού παράγοντα, η διαφοροποίηση στην ποσότητα αλλά και τη χημική σύσταση των αιθερίων ελαίων, ακόμα και εντός του είδους, όπως διαπιστώνουν οι Aligiannis et al. (2001), οφείλεται επιπλέον σε περιβαλλοντικούς παράγοντες, στο χρόνο συγκομιδής και άλλες καλλιεργητικές πρακτικές, στο χημειότυπο του φυτού, καθώς και στην κατάσταση θρέψης του (González-Burgos et al., 2011). Επίσης, έχει αναφερθεί η διαφορετική μέθοδος απομόνωσης των αιθερίων ελαίων, ως αίτιο της παραλλακτικότητας αυτής, π.χ. απόσταξη υπ ατμόν έναντι υδροαπόσταξης (Pljevljakušić et al., 2011). Σύμφωνα με την ανασκόπηση των González-Burgos et al. (2011), τα είδη σιδερίτη είναι πλούσια σε διτερπενοειδή και φλαβονοειδή, εντούτοις, τα τελευταία χρόνια έχουν απομονωθεί και άλλα συστατικά, όπως ιριδοειδή, κουμαρίνες, λιγνάνες και γλυκοσίδια φαινυλοπροπανοειδών. Ο Fraga (2012) ταξινόμησε τα μεσογειακά είδη του γένους Sideritis σε τέσσερεις κατηγορίες με βάση το χημειότυπό τους, συμπεραίνοντας για τις φυλογενετικές σχέσεις τους και για τη συσχέτισή τους με τα είδη των Καναρίων Νήσων, για τα οποία είχαν προηγηθεί ανάλογες εργασίες (González et al., 1979, Fraga, 1982, Fraga et al., 2009). Η ταξινόμηση κατά Fraga είχε ως εξής: i) είδη που περιέχουν τριτερπένια, αλλά όχι διτερπένια, ii) είδη που περιέχουν δικυκλικά διτερπένια του τύπου του λαβδανίου και όχι άλλα διτερπένια, iii) είδη που χαρακτηρίζονται από την παρουσία τετρακυκλικών διτερπενίων του τύπου του ent-καουρενίου και iv) είδη που περιέχουν τετρακυκλικά διτερπένια του τύπου του ent-beyer-15-ενίου ή/και του ent-atis-13-ενίου. Στην τρίτη ομάδα ανήκει ολόκληρο το section Empedoclea (με εξαίρεση ένα είδος S. perfoliata από την Τουρκία που ανήκει στη δεύτερη κατηγορία), ενώ το section Sideritis αποτελείται κυρίως από είδη της τρίτης ομάδας, περιλαμβάνει όμως και είδη της δεύτερης 16

23 Βιβλιογραφική Ανασκόπηση και τέταρτης κατηγορίας, λιγότερο ή περισσότερο εξελιγμένα αντίστοιχα, σε σχέση με το section Empedoclea. Η χημική σύνθεση των αιθερίων ελαίων των ειδών που φύονται στην Τουρκία έχει διερευνηθεί επισταμένα, αλλά σε Ελλάδα και Ισπανία δεν έχει μελετηθεί στην ίδια έκταση. Από την άλλη, έχει απομονωθεί μεγάλος αριθμός τερπενοειδών και φλαβονοειδών από ισπανικά είδη, σε αντίθεση με τα είδη της Μ. Ανατολής. Παρά το μεγάλο αριθμό συστατικών που έχουν απομονωθεί, διεξήχθησαν συγκριτικά λίγες μελέτες αναφορικά με τις φαρμακευτικές τους ιδιότητες (González-Burgos et al., 2011). Στο παρόν κεφάλαιο επικεντρωνόμαστε κυρίως στα είδη του section Empedoclea που φύονται και στην Ελλάδα και ιδιαίτερα στο S. raeseri που είναι το είδος υπό μελέτη. Στη βιβλιογραφία οι περισσότερες μελέτες βασίστηκαν κυρίως σε φυτικό υλικό από συλλογή αυτοφυών φυτών, ενώ σε φυτά πειραματικής καλλιέργειας εργάστηκαν οι Pljevljakušić et al. (2011). Ο Knörle (2012) εστιάστηκε στο εμπορικά διαθέσιμο και καλλιεργούμενο είδος S. scardica, ένα κύριο συστατικό του γερμανικού Bergtee, δείγματα του οποίου χρησιμοποίησε για τον καθορισμό της φαρμακευτικής επίδρασης του σιδερίτη. Ομοίως, οι Samanidou et al. (2012) χρησιμοποίησαν δείγματα του εμπορίου για τα S. raeseri και S. scardica. Η δε χημική σύσταση μελετήθηκε κατά κύριο λόγο με εκχυλίσματα σε οργανικούς διαλύτες και τα κλάσματά τους, ενώ ορισμένοι απομόνωσαν αιθέρια έλαια μέσω απόσταξης, όπως υδροαπόσταξη (Koedam, 1986, Aligiannis et al., 2001, Kostadinova et al., 2007, Pljevljakušić et al., 2011). Υδατικά εκχυλίσματα και γενικά παρασκευάσματα που να ομοιάζουν με το κοινό αφέψημα του σιδερίτη χρησιμοποίησαν στις αναλύσεις τους οι Pljevljakušić et al. (2011), οι Samanidou et al. (2012) και οι Vasilopoulou et al. (2013). II.4.1 Μονοτερπένια και σεσκιτερπένια Τα ιριδοειδή μονοτερπένια αγιουγκόλη, αγιουγκοσίδη και μελιττοσίδη (Εικόνα 4) έχουν απομονωθεί από τα S. scardica και S. syriaca (Koleva et al., 2003), ενώ το τελευταίο συστατικό εντοπίστηκε και στο S. perfoliata ssp. perfoliata (Charami et al., 2008). Στο υδατικό εκχύλισμα του S. clandestina ssp. clandestina, οι Vasilopoulou et al. (2013) διέκριναν επίσης δύο παράγωγα μελιττοσίδης. Aγιουγκόλη: R=H Aγιουγκοσίδη: R=Ac Mελιττοσίδη Εικόνα 4: Τα ιριδοειδή μονοτερπένια που έχουν απομονωθεί από διάφορα είδη Sideritis (Fraga, 2012). 17

24 Βιβλιογραφική Ανασκόπηση Από φυτά που συλλέχθησαν στη Βουλγαρία (Todorova et al., 2000), βρέθηκε πως το κυριότερο συστατικό των αιθερίων ελαίων του S. syriaca ήταν το μονοτερπένιο μυρκένιο. Σε αντίστοιχα δείγματα από την Κρήτη το βασικό σεσκιτερπένιο ήταν το β-καρυοφυλλένιο (Läer et al., 1996). Χαρακτηριστική σύμφωνα με τους Aligiannis et al. (2001), ήταν η παρουσία, εκτός του β-καρυοφυλλενίου, αυτή του β-φελλανδρενίου/λιμονενίου και του δικυκλο-γερμακρενίου. Οι Kostadinova et al., (2007) παρατήρησαν πως στο S. scardica η σύσταση των δειγμάτων διαφοροποιείτο ανάλογα την περιοχή συλλογής, όπου στα δείγματα από την ΠΓΔΜ, κυριαρχούσε σε ποσοστό άνω του 20% η α-κανδινόλη, σε σχέση με τα δείγματα της Βουλγαρίας που χαρακτηρίζονταν από μεγαλύτερη συγκέντρωση διτερπενίων, ενώ το ελληνικό S. scardica, σύμφωνα με τους Kokkalou, 1987 και Komaitis et al., 1992, βρέθηκε να είναι πλούσιο σε μονοτερπένια. Τα αποτελέσματα των Kostadinova et al., (2007) διαφοροποιούνται και από αυτά των Todorova et al. (2000), κατά τους οποίους τα κύρια συστατικά του S. scardica είναι το σεσκιτερπένιο, το β-καρυοφυλλένιο και η νερολιδόλη. Οι Menkovic, et al. (1991) στη θέση αυτών αναφέρουν τη μενθόλη, τη νερόλη και τη γερανιόλη, για το ίδιο είδος στην Πρώην Γιουγκοσλαβία. Το S. clandestina ssp. clandestina βρέθηκε να είναι μεγάλης περιεκτικότητας σε β- κοπαένιο, α-πινένιο, β-πινένιο και δ-κανδινένιο και να περιέχει μικρότερες συγκεντρώσεις σε β-καρυοφυλλένιο και λιμονένιο (Koedam, 1986). Οι Aligiannis et al. (2001) συμφωνούν αναφορικά με την υψηλή συγκέντρωση των α- και β-πινενίων, ωστόσο εντόπισαν επιπλέον μεγάλα ποσοστά δικυκλο-γερμακρενίου και α-βισαβολόλης. Τα αποτελέσματα της ανάλυσης που διεξήγαγε ο Koedam (1986) στο είδος S. raeseri ssp. raeseri που συνέλεξε από το όρος Οίτη, έδειξαν πως τα κυρίαρχα συστατικά ήταν το β- πινένιο, ακολουθούμενο από το α-πινένιο, το α-χουμουλένιο, το λιμονένιο, το β- καρυοφυλλένιο και το δίκυκλο-γερμακρένιο. Υψηλά ποσοστά αναφέρουν και οι Aligiannis et al. (2001), για το α- και β-πινένιο, ενώ ακολουθούν η AR-κουρκουμένη, το β- φελλανδρένιο/λιμονένιο, το δ-κανδινένιο, το β-καρυοφυλλένιο και το α-κοπαένιο, αναφορικά με το S. raeseri ssp. raeseri, ενώ το S. raeseri ssp. attica, εκτός από τις πολύ υψηλότερες συγκεντρώσεις α- και β-πινενίου (42,84%), σε σχέση με το S. raeseri ssp. raeseri (12,69%, σε ένα ολικό ποσοστό μονοτερπενίων 30,18%), χαρακτηρίζεται από την παρουσία του β-φελλανδρενίου/λιμονενίου, του α-τερπινενίου, του δ-3-καρενίου, του α- φελλανδρενίου, του trans-β-καρυοφυλλενίου και του δικυκλο-γερμακρενίου. Υπήρξαν κι άλλοι που χαρακτήρισαν τα αιθέρια έλαια του S. raeseri πλούσια σε μονοτερπένια (Tabanca and Kirimer, 2001, Tzakou, 2002). Αντίθετα, υψηλή συγκέντρωση σε σεσκιτερπένια, κυρίως γερμακρόνιο και elemol acetate βρέθηκε στο έλαιο του S. raeseri από ΠΓΔΜ και Βουλγαρία (Kostadinova et al., 2007) και την ίδια ομάδα συστατικών ανέδειξαν ως κυρίαρχη και οι Pljevljakušić et al. το 2011, εκπροσωπώντας ποσοστό 58,2-67,8% του ελαίου του S. raeseri ssp. raeseri, με σημαντικότερο το δικυκλο-γερμακρένιο. Άλλα σεσκιτερπένια που βρέθηκαν σε σημαντικές 18

25 Βιβλιογραφική Ανασκόπηση ποσότητες ήταν το σπαθουλένιο και το β-καρυοφυλλένιο, ενώ ως κυρίαρχο μονοτερπένιο αναφέρεται η cis-β-οσιμένη. II.4.2 Διτερπένια Τα είδη της ανατολικής και κεντρικής Μεσογείου περιέχουν σχεδόν αποκλειστικά διτερπένια του ent-καουρανίου (Fraga, 2012), τα οποία συνοψίζονται στον Πίνακα 1 και την Εικόνα 5. Σημειώνεται πως το S. syriaca έχει συλλεχθεί στην Ιταλία και κατά κάποιους αυτό το είδος θεωρείται ταυτόσημο του S. sicula, το οποίο αργότερα μετονομάστηκε σε S. italica. Επιπροσθέτως, η αθονολόνη, το 3α,7β-διϋδροξυ-ent-καουρ-16-ενιο και η καναδιόλη έχουν βρεθεί σε εκχύλισμα S. athoa από την Τουρκία (Topçu et al., 1999, Fraga et al., 2003, Halfon et al., 2011) S. distans S. euboea S. raeseri S. scardica S. sicula S. syriaca S. theezans Πίνακας 1: Διτερπένια διαφόρων ειδών Sideritis (Fraga, 2012): σιδόλη (1), λινεαρόλη (2), ισοφολιόλη (3), ισολινεαρόλη (4), ισολινεαρόλη (5), 18-ακετοξυ λευκανθόλη (6), σιδεριδιόλη (7), σιδερόλη (8), σιδεριπόλη (9), σιδεροξόλη (10), εποξυσιδερόλη (11), σιδεριτριόλη (12), εποξυσιδεριτριόλη (13), ουκριόλη (14), σιδερόνη (15), εουμποτριόλη (16), εουμπόλη (17), εποξυισολινεαρόλη (18), ντιστανόλη (19), 7-επικανδικανδιόλη (20). 1: R 1 =Ac, R 2 =H 3: R 1 =R 2 =H 6: R 1 =R 3 =H, R 2 =Ac 2: R 1 =H, R 2 =Ac 4: R 1 = Ac, R 2 =Η 5: R 1 =H, R 2 =Ac 7: R 1 =R 2 =H 10: R 1 =R 2 =H 16: R=H 8: R 1 =H, R 2 =Ac 11: R 1 =H, R 2 =Ac 17: R=Ac Εικόνα 5: Δομή των διτερπενίων του ent-καουρανίου. H αρίθμηση είναι εκείνη του Πίνακα 1 (Fraga, 2012). 19

26 Βιβλιογραφική Ανασκόπηση 18 19: R 1 =R 2 =H 20: R 1 =ΟH, R 2 =ΟAc Αθονολόνη 3α,7β-διϋδροξυ-ent-καουρ-16-ενιο Καναδιόλη Εικόνα 5 (συνέχεια) Στα είδη S. perfoliata και S. athoa που συλλέχθησαν στην Τουρκία εντοπίστηκαν αντιστοιχα το διτερπένιο 2β-υδροξυ-ent-13-epi-μανοϋλ- οξείδιο (Sezik et al., 1985), που ανήκει στην ομάδα του λαβδανίου και των οξειδίων του και η φλαβοβιρόλη της κατηγορίας των ent-beyerane διτερπενίων (Kiliç et al., 2003) (Εικόνα 6). α β Εικόνα 6: Δομή των (α) 2β-υδροξυ-ent-13-epi-μανοϋλ- οξειδίου και (β) φλαβοβιρόλης (Fraga, 2012). II.4.3 Φαινολικά συστατικά Στη μελέτη των Janeska et al. (2007) που αφορούσε και το είδος S. scardica ταυτοποιήθηκαν η απιγενίνη, η ισοσκουτελλαρίνη και η 3 -O-μεθυλ-υπολαιτίνη, μαζί με τη χρυσοεριόλη. Ακυλιωμένα γλυκοσίδια της χρυσοεριόλης έχουν βρει και οι Sattar et al. (1993, 1995). Όσον αφορά στα φαινυλοπροπανοειδή, οι Koleva et al. (2003) ανίχνευσαν την βερμπασκοσίδη και επιπλέον αυτής, οι Petreska et al. (2011) διαπίστωσαν την παρουσία λευκοσεπτοσίδης Α, φορσυθοσίδης Α, αλυσσονοσίδης και εχινακοσίδης. Χλωρογενικό οξύ, μυρικετίνη, απιγενίνη και επικατεχίνη γαλλιξού εστέρα εντόπισαν οι Samanidou et al. (2012). 20

27 Βιβλιογραφική Ανασκόπηση Το είδος S. raeseri περιέχει ένα 7-γλυκοσίδιο της απιγενίνης και 7-(4-Ο-β-γλυκοσυλtrans-κουμαρική) απιγενίνη, σύμφωνα με τους Gabrieli and Kokkalou (1990), ενώ την απιγενίνη εντόπισαν και οι Janeska et al. (2007), οι οποίοι επιπλέον επιβεβαίωσαν την προγενέστερη μελέτη των Koleva et al. (2003), αναφορικά με την παρουσία της υπολαιτίνης, της 3 -O-μεθυλ-υπολαιτίνης, της ισοσκουτελλαρίνης και της 4 -O-μεθυλισοσκουτελλαρίνης. Παρόμοια με αυτά αποτελέσματα έδωσε και η ανάλυση των Gabrieli et al. (2005) στο ελληνικό S. raeseri, όπου όλα τα συστατικά που ταυτοποιήθηκαν στο κλάσμα μεθανόλης του n-buoh εκχυλίσματος ήταν 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-Dγλυκοπυρανόσυλ- παράγωγα των 5,8-διϋδροξυφλαβονών, τα πιο πολικά συστατικά που έχουν ανιχνευτεί. Οι Pljevljakušić et al. (2011) εντόπισαν ως επικρατέστερα, τα γλυκοσίδια των φλαβονών της 4 -Ο-μεθυλ-υπολαιτίνης και της 4 -Ο-μεθυλ-ισοσκουτελλαρίνης. Ακετυλογλυκοσίδια φλαβονοειδών αναφέρουν και οι Petreska et al. (2011), όπως και τα φαινυλοπροπανοειδή βερμπασκοσίδη, λευκοσεπτοσίδη Α και πιθανόν φορσυθοσίδη Α, αλυσσονοσίδη και εχινακοσίδη. Στις αναλύσεις των Pljevljakušić et al. (2011), το χλωρογενικό οξύ ήταν παρόν σε όλα τα στάδια της άνθησης, ενώ το γαλλικό και τα παράγωγά του μόνο στο εκχύλισμα που αντιπροσώπευε το στάδιο μετά την άνθηση. Τέλος, κατεχίνη, απιγενίνη, μυρικετίνη και χλωρογενικό οξύ εντόπισαν στο S. raeseri οι Samanidou et al. (2012). Οι ακυλ-φλαβόνες 7-trans-p-κουμαρική ισοσκουτελλαρίνη και η 7,4 -δι-trans-pκουμαρική απιγενίνη ταυτοποιήθηκαν στο είδος S. syriaca ssp. syriaca (Plioukas et al., 2010), ενώ ακυλιωμένα γλυκοσίδια της χρυσοεριόλης αναφέρουν οι Sattar et al. (1993) και Venturella et al. (1995). Το χλωρογενικό οξύ, καθώς και δύο παράγωγα του 7-ραμνοσυλκινικού οξέος, ο 1-p-κουμαροϋλ, 3-πρωτοκατεχούοϋλ και 5-διυδροκαφφεοϋλ- τριεστέρας και το ισομερές του, έχουν αναγνωριστεί ως συστατικά του S. syriaca, που συλλέχθηκε στην Κρήτη από τους Armata et al. (2008), καθώς και τρία κοινά με το S. raeseri γλυκοσιδικά παράγωγα των 5,8-διϋδροξυφλαβονών που αναφέρουν οι Gabrieli et al. (2005). Στην εργασία των Aligiannis et al. (2001), η καρβακρόλη ήταν το κύριο συστατικό του S. syriaca ssp. syriaca, σε ποσοστό 33,68%. Όσον αφορά στα φαινυλοπροπανοειδή, αναφέρεται η παρουσία βερμπασκοσίδης από τους Koleva et al. (2003). Γλυκοσίδια φλαβονοειδών έχουν απομονωθεί από το S. perfoliata (Ezer at al., 1992, Charami et al., 2008). Η λαβαντουλιφολιοσίδη (Charami et al., 2008), καθώς και η βερμπασκοσίδη (ακτεοσίδη), η λευκοσεπτοσίδη Α και η μαρτυνοσίδη είναι τα φαινυλοπροπανοειδή που έχουν αναγνωριστεί (Ezer et al., 1992, Akços et al., 1999, Şahin et al., 2004, Charami et al., 2008). Για πρώτη φορά, αναφορικά με τα είδη Sideritis, εντοπίστηκε η β-υδροξυβερμπασκοσίδη ή β-υδροξυισοβερμπασκοσίδη στο υδατικό εκχύλισμα του S. clandestina ssp. clandestina (Vasilopoulou et al., 2013). Μαζί με αυτά, παρόντα ήταν η μαρτυνοσίδη, δύο παράγωγα του κινικού οξέος, καθώς και γλυκοσίδια της απιγενίνης και ισοσκουτελλαρίνης, περιλαμβανομένων τεσσάρων ισομερών του 7-Ο-(κουμαροϋλ) γλυκοπυρανοσιδίου της 21

28 Βιβλιογραφική Ανασκόπηση απιγενίνης και του πρωτοαναφερόμενου επίσης 7-Ο-ακετυλ-κουμαρόϋλ-αλλοσυλ (1 2) γλυκοσιδίου της απιγενίνης. Τέλος, αναφέρεται η παρουσία καμπφερόλης στο S. euboea (Tsaknis and Lalas, 2005). Βερμπασκοσίδη: R 1 =R 2 =R 3 =H Λευκοσεπτοσίδη Α: R 1 =Me, R 2 =R 3 =H Mαρτυνοσίδη: R 1 =R 2 =Me, R 3 =H Λαβαντουλιφολιοσίδη: R 1 =R 2 =H, R 3 = Αραβινοπιρανοσύλιο Εικόνα 7: Η δομή των φαινυλοπροπανοειδών που εντοπίζονται στα διάφορα είδη Sideritis (Fraga, 2012). 1: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της υπολαιτίνης 2: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της ισοσκουτελλαρίνης 3: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της 3 -Ο-μεθυλ-υπολαιτίνης 4: 7-Ο-(6 -Ο-ακετυλ- β-d-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της ισοσκουτελλαρίνης 5: 7-Ο-(6 -Ο-ακετυλ- β-d-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της 3 -Ο-μεθυλ-υπολαιτίνης 6: 7-Ο-(6 -Ο-ακετυλ- β-d-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της 4 -Ο-μεθυλ-υπολαιτίνης 7: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της 4 -Ο-μεθυλ- ισοσκουτελλαρίνης 8: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-6 -Ο-ακετυλ-γλυκοπυρανοσίδιο) της 4 -Ο-μεθυλ- ισοσκουτελλαρίνης 9: 7-Ο-(6 -Ο-ακετυλ- β-d-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανοσίδιο) της 4 -Ο-μεθυλ- ισοσκουτελλαρίνης Εικόνα 8: 7-Ο-(β-D-αλλοπυρανοσυλ-(1 2)-β-D-γλυκοπυρανόσυλ- παράγωγα των 5,8-διϋδροξυφλαβονών που έχουν ταυτοποιηθεί στο Sideritis raeseri και άλλα είδη Sideritis (Gabrieli et al., 2005). 22

29 Βιβλιογραφική Ανασκόπηση II.5 Φαρμακευτικές Ιδιότητες του Σιδερίτη Το αφέψημα και το έγχυμα των υπέργειων τμημάτων του φυτού χορηγούμενα είτε διά της στοματικής οδού είτε τοπικά, χρησιμοποιούνται από τη λαϊκή ιατρική ως αντιφλεγμονώδη, αντιμικροβιακά, αντισπασμωδικά, αναλγητικά, επουλωτικά, στη θεραπεία του έλκους, της δυσπεψίας και άλλων ανωμαλιών του γαστρεντερικού, αναπνευστικού και ουροποιητικού συστήματος. Ανάλογα την περιοχή που φύεται και το είδος, ο σιδερίτης χρησιμοποιείται κάθε φορά με διαφορετικό τρόπο (González-Burgos et al., 2011). Μια άλλη χρήση των ειδών του γένους Sideritis είναι ως πρόσθετο-ενισχυτικό γεύσης και συντηρητικό στο ελαιόλαδο. Λόγω των φλαβονοειδών που βρέθηκαν στα διάφορα είδη και γνωρίζοντας τη θετική συσχέτιση μεταξύ φλαβονοειδών και αντιοξειδωτικής δράσης, θα μπορούσαν να αξιοποιηθούν ως φυσική πηγή αντιοξειδωτικών σε τρόφιμα, ή ακόμα και στο σχεδιασμό λειτουργικών τροφίμων για την πρόληψη της οστεοπόρωσης, με ιδιαίτερα οικονομικά οφέλη για την Ελλάδα (Tsaknis and Lalas, 2005, Kassi et al., 2004). Από τη δεκαετία του 90, το ενδιαφέρον των περισσότερων ερευνητών στράφηκε στις φαρμακευτικές ιδιότητες ενός μικρού, ωστόσο, ποσοστού των ειδών Sideritis, στη συσχέτισή τους με τις παραδοσιακές χρήσεις του σιδερίτη στις διάφορες περιοχές που φύεται, αλλά και στην ανίχνευση νέων ιδιοτήτων (González-Burgos et al., 2011). Αξιολογήθηκαν διαφορετικά εκχυλίσματα ή συγκεκριμένα κλάσματά τους από διάφορα είδη σιδερίτη, σε in vitro και in vivo μελέτες. Υπάρχουν και εργασίες εστιασμένες σε μεμονωμένες ομάδες ουσιών, όπως διτερπένια, φλαβονοειδή και γλυκοσίδια φαινυλοπροπανοειδών. II.5.1 Αντιφλεγμονώδης δράση Οι Moroney et al. (1988) μελετώντας την επίδραση γλυκοσυλιωμένων/άγλυκων φλαβονοειδών στην παρεμπόδιση της δημιουργίας εικοσανοειδών μέσω της οδού των 5- λιποξυγενασών και κυκλοξυγενασών, συμπέραναν πως η περιοχή του σακχάρου μειώνει τη δραστικότητα. Επίσης, παρατηρήθηκε πως τα φλαβονοειδή που εμπεριέχουν ομάδα κατεχόλης στο Β δακτύλιο είναι εκλεκτικοί παρεμποδιστές της 5-λιποξυγενάσης, ενώ φλαβονοειδή με υποκαταστάτες υδροξύλια, εκτός του Β δακτυλίου, δρουν έναντι των κυκλοξυγενασών. Την εξειδικευμένη δράση της κατεχόλης επιβεβαίωσαν και οι Ferrándiz et al. (1990), που αναφέρουν ότι την ισχυρότερη αντιφλεγμονώδη δράση μεταξύ άλλων, έχει και το γλυκοσίδιο της 8-υπολαιτίνης. Η παρουσία της κατεχόλης ωστόσο, δεν είναι πάντα απαραίτητη για την παρεμπόδιση του σχηματισμού των προϊόντων της λιποξυγενάσης (Bas et al., 2006). Αναφορικά με τα γλυκοσίδια των φαινυλοπροπανοειδών, αναφέρεται η δραστικότητα της βερμπασκοσίδης, της λευκοσεπτοσίδης Α, της μαρτυνοσίδης και της λαβαντουλιφολιοσίδης και επιπλέον, προκαλούν 50% λιγότερο γαστρικό έλκος σε σχέση με την ουσία αναφοράς (Akços et al., 1999). Εκχυλίσματα ισπανικών, ως επί το πλείστον, ειδών Sideritis, καθώς και διτερπένιά τους έχουν επίσης εμφανίσει αντιφλεγμονώδη δράση 23

30 Βιβλιογραφική Ανασκόπηση (González-Burgos et al., 2011). Η φολιόλη και η λινεαρόλη λειτουργούν ως αναστολείς της έκφρασης των COX-2 NOS-2 και παρεμποδίζουν την ενεργοποίηση του παραγοντα NF-κ2 (Heras et al., 2007). Επίσης, τα δύο αυτά συστατικά επέδειξαν αντι-αποπτωτική δράση (Castrillo et al., 2011). II.5.2 Αντιοξειδωτική δράση - Επίδραση στο Κεντρικό Νευρικό Σύστημα Σε προηγούμενες μελέτες, αναδείχθηκε η αντιοξειδωτική δράση των διτερπενίων καουρανίου και η σημασία της στην πρόληψη των βλαβών που προκαλούνται από το οξειδωτικό stress, χωρίς αυτές να περιορίζονται στις νευροεκφυλιστικές, ηπατικές και καρδιακές ασθένειες (Choi et al., 2006, Lee et al., 2007, Xu et al., 2011). Στη μελέτη των González-Burgos et al. (2013) αποδείχθηκε πως η λινεαρόλη και η σιδόλη μετρίασαν σημαντικά την απώλεια της μιτοχονδριακής λειτουργίας και της ακεραιότητας της μεμβράνης, καθώς και μορφολογικές μεταβολές που προκαλούνται από το οξειδωτικό stress. Η δε χορήγησή τους πριν την επαγωγή του stress μείωσε σημαντικά την ενδοκυτταρική παραγωγή ενεργών μορφών οξυγόνου (ROS), μείωσε τα επίπεδα της μαλονδιαλδεΰδης και αποκατέστησε την αναλογία της ανηγμένης μορφής της γλουταθειόνης (GSH/GSSG), ενώ φαίνεται πως αυτά τα διτερπένια ενισχύουν την υπερέκφραση των κύριων αντιοξειδωτικών ενζύμων που σχετίζονται με τη ρύθμιση του αντιοξειδωτικού συστήματος του παράγοντα Nrf2. Η δράση εκκαθάρισης ελεύθερων ριζών, που μετράται με τη μέθοδο DPPH (1,1-diphenyl- 2-picrylhydrazyl) φαίνεται να αυξάνεται με την αύξηση του ολικού περιεχομένου σε φαινολικά συστατικά των εκχυλισμάτων του σιδερίτη σε μεθανόλη κατά τους Tunalier et al., 2004 και Sagdic et al., Οι Armata et al. (2008) αναφέρουν επίσης αυτή τη συσχέτιση και διαπιστώνουν πως το κλάσμα του οξικού αιθυλεστέρα του S. syriaca παρουσίασε την υψηλότερη αντιοξειδωτική δραστικότητα σε σχέση με άλλα κλάσματα, που ίσως οφείλεται στην παρουσία γλυκοσιδίων απιγενίνης και ισοσκουτελλαρίνης. Οι Gabrieli et al. (2005) και οι Armata et al. (2008) αποδίδουν μέτρια αντιοξειδωτική ιδιότητα στο S. raeseri, σε σχέση με συγγενικά του είδη. Σε σχέση με το S. scardica, το S. raeseri έχει ένα πολύ μικρότερο περιεχόμενο σε ολικές φαινολικές ενώσεις, παράμετρος που εκφράστηκε ως mg των ισοδύναμων του γαλλικού οξέος ανά gr ξηρής ουσίας ή 100 ml εκχυλίσματος (Pljevljakušić et al., 2011). Οι αναλύσεις δε των Janeska et al. (2007) έδειξαν πως το περιεχόμενο στο σύνολο των φλαβονοειδών που απομονώθηκαν ήταν υψηλότερο στο S. raeseri, σε σχέση με το S. scardica. Στην ποιοτική μεταβολή των φαινολικών και στην εμφάνιση του γαλλικού οξέος φαίνεται να αποδίδεται κατά τους Pljevljakušić et al. (2011) η αυξανόμενη δραστικότητα εκκαθάρισης ελεύθερων ριζών του S. raeseri ssp. raeseri που παρατηρήθηκε στη φάση μετά την άνθηση, παρά το γεγονός ότι το αντίστοιχο εκχύλισμα περιείχε το μικρότερο ποσοστό σε ολικές φαινολικές ενώσεις, σε σχέση με τα προγενέστερα στάδια. 24

31 Βιβλιογραφική Ανασκόπηση Η ακτεοσίδη χαρακτηρίζεται ως το πιο δραστικό συστατικό, ακόμα και από την ουσία αναφοράς στη δοκιμή ΤΒΑ (thiobarbituric acid), κατά την αξιολόγηση ως προς την αντιοξειδωτική δράση εκχυλισμάτων, αλλά και μεμονωμένων φλαβονοειδών και γλυκοσιδίων φαινυλοπροπανοειδών του S. perfoliata ssp. perfoliata (Charami et al., 2008). Η ισχυρότατη αντιοξειδωτική ικανότητα των γλυκοσιδίων φλαβονοειδών με ελεύθερη ομάδα κατεχόλης στις θέσεις 3-4 ή 7-8 και ιδιαίτερα του γλυκοσιδίου της 8-υπολαιτίνης, όπως διαπιστώθηκε από τους Rios et al. (1992), οφείλεται στην ικανότητά τους να εκκαθαρίζουν τις υπεροξειδικές ρίζες. Έχουν πραγματοποιηθεί δοκιμές in vivo, όπου διαπιστώθηκε η αντιοξειδωτική ικανότητα εγχυμάτων του S. clandestina (Linardaki et al., 2008). Ωστόσο, κλινικές μελέτες με χορήγηση σε υγιείς εθελοντές επιδορπίου εμπλουτισμένου με S. euboea δεν επέδειξαν σημαντική επίδραση στις βιοχημικές παραμέτρους (Skouroliakou et al., 2009). Όμως, δεν συμφωνούν όλες οι μελέτες ως προς την αντιοξειδωτική δράση των εκχυλισμάτων σιδερίτη. Στο S. scardica τα διάφορα εκχυλίσματα αύξησαν την παραγωγή των ελεύθερων ριζών (ROS) στα πρωτογενή αστροκύτταρα και στη C6 κυτταρική σειρά γλοιώματος ποντικών, οδηγώντας μέσω της απόπτωσης σε κυτταρικό θάνατο (Tadic et al., 2009). Στην πρόσφατη εργασία των Danesi et al. (2013) όμως, παρατηρήθηκε πως η αντιοξειδωτική δράση του S. scardica στα HepG2 κύτταρα ήταν παρεμφερής με εκείνη του Camellia sinensis, παρά το μικρότερο περιεχόμενο σε ολικά φαινολικά συστατικά και τη χαμηλότερη ολική αντιοξειδωτική ικανότητα του πρώτου. Αυτό οφείλεται στο διαφορετικό χημικό προφίλ του εκχυλίσματός του σε μεθανόλη, όπου κυριαρχούν το χλωρογενικό οξύ, η βερμπασκοσίδη και τα γλυκοσίδια της υπολαιτίνης, ισοσκουτελλαρίνης και απιγενίνης, σε αντίθεση με τις κατεχίνες που αποτελούν τα κύρια αντιοξειδωτικά συστατικά στο πράσινο τσάι. Το οξειδωτικό stress έχει προταθεί ως αιτιώδης παράγοντας της νόσου του Alzheimer και του Parkinson, ακόμα και της διαδικασίας της γήρανσης (Halliwell, 1992). Πρόσφατες μελέτες παρουσιάζουν επίσης μια σύνδεση μεταξύ οξειδωτικού stress και αγχώδους συμπεριφοράς (Rammal et al., 2008). Η in vivo μελέτη των Vasilopoulou et al. (2013) επιβεβαίωσε την σημαντική νευροπροστατευτική δράση της κατανάλωσης του τσαγιού, μέσω της παρεμπόδισης της οξειδωτικής βλάβης του εγκεφάλου και της ενίσχυσης της ενδογενούς αντιοξειδωτικής άμυνάς του, με αποτέλεσμα που εξαρτάται από την εγκεφαλική περιοχή και τη δόση. Συγκεκριμένα, επιφέρει δοσοεξαρτώμενη μείωση του επιπέδου της μαλονδιαλδεΰδης, ενός ισχυρά ενεργού τελικού προϊόντος της περοξείδωσης των λιπιδίων με κυτοτοξικές επιδράσεις και ταυτόχρονα σημαντική αύξηση της ανηγμένης μορφής της γλουταθειόνης, ουσίας που δρα ως εκκαθαριστής ελεύθερων ριζών, προλαμβάνοντας την κυτταρική βλάβη. Οι περιοχές του εγκεφάλου όπου παρουσιάστηκε επίδραση εμπλέκονται σε διαταραχές άγχους (Avila et al., 2008, Baldaçara et al., 2008). Έχουν προηγηθεί βιβλιογραφικές αναφορές σχετικά με τη νευροπροστατευτική δράση των ουσιών που ανίχνευσαν οι Vasilopoulou et al. (2013) στο υδατικό εκχύλισμα του S. 25

32 Βιβλιογραφική Ανασκόπηση clandestina ssp. clandestina, καθώς και για τη θετική επίδρασή τους στις μαθησιακές δυσκολίες, την εξασθένηση της μνήμης και την κατάθλιψη, τόσο για τα ιριδοειδή, όσο και για τα παράγωγα του κινικού οξέος και της απιγενίνης. Τα τελευταία χρόνια, οι έρευνες εστιάζονται στην επίδραση των παρασκευασμάτων σιδερίτη στο Κεντρικό Νευρικό Σύστημα (ΚΝΣ), εξαιτίας της in vitro αναστολής της ακετυλοχοληνεστεράσης (Ertaş et al., 2009) και της in vivo αγχολυτικής επίδρασης που παρατηρήθηκε σε ενήλικα ποντίκια (Vasilopoulou et al., 2013), σε συνδυασμό με την προτίμηση για φυσικά σκευάσματα της πλειοψηφίας των ασθενών με διαταραχές του ΚΝΣ. Η ανισορροπία στη μονοαμινεργική νευροδιαβίβαση, λόγω της επαναπρόσληψης των μονοαμινικών νευροδιαβιβαστών ντοπαμίνης, νοραδρεναλίνης και σεροτονίνης από τους φορείς μονοαμινών, θεωρείται υπεύθυνη για ένα πλήθος ψυχικών διαταραχών, όπως κατάθλιψη, Διαταραχή Ελλειμματικής Προσοχής Υπερκινητικότητας (ΔΕΠ-Υ) και σχιζοφρένεια, ακόμα και για τον εθισμό σε ουσίες. Τα φάρμακα που χορηγούνται για να επιδράσουν στην μονοαμινική νευροδιαβίβαση, συνήθως λειτουργούν με το να συνδέονται με τον αντίστοιχο φορέα και έτσι να παρεμποδίσουν την επαναπρόσληψη των νευροδιαβιβαστών, αυξάνοντας τα ενεργά επίπεδά τους στη σύναψη (Charney, 1988). Ο κάθε νευροδιαβιβαστής ελέγχει ορισμένα συμπτώματα, επομένως θα ήταν επιθυμητή μια ουσία που να επιδρά σε όσα περισσότερα μονοαμινεργικά συστήματα είναι δυνατό. Τα τελευταία χρόνια αναπτύσσονται σύνθετοι τριπλοί αναστολείς, των οποίων η χρήση μπορεί να επεκταθεί πιθανόν και σε νευροεκφυλιστικές ασθένειες, όπως Parkinson ή Alzheimer (Marks et al., 2008, Lehr et al., 2010). Τα αποτελέσματα της μελέτης του Knörle (2012) έδειξαν πως το S. scardica είναι ισχυρός παρεμποδιστής και των τριών φορέων μονοαμινών. Τα υδατικά και αλκοολικά εκχυλίσματά του ανέστειλαν την πρόσληψη της σεροτονίνης, της νοραδρεναλίνης και της ντοπαμίνης από τους αντίστοιχους φορείς τους, με δοσοεξαρτώμενο τρόπο. Η δραστικότητα της φλουβοξαμίνης (αναστολέα πρόσληψης σεροτονίνης) αυξάνεται παρουσία αλκοολικού εκχυλίσματος, ανάλογα με τη συγκέντρωση του τελευταίου, μέχρι και πάνω από 8 φορές. Απαιτείται δηλαδή μικρότερη δόση φλουβοξαμίνης για την ίδια βιολογική απόκριση, χωρίς να επηρεαστεί το μέγιστο της αναστολής, όταν αυτή συνδυάζεται με το αλκοολικό εκχύλισμα. Η συντονισμένη αλληλεπίδραση των δύο αναστολέων, ή η αλλοστερική τροποποίηση του φορέα ή μεταβολή στη δραστικότητά του, πέραν από την αναστολή, ίσως να ερμηνεύουν τα αποτελέσματα. Αξίζει να αναφερθεί πως συστατικά του S. scardica τα οποία ίσως συνεισφέρουν στη λειτουργία του ΚΝΣ, όπως τερπένια, φλαβονοειδή και φαινολικές ενώσεις γενικά, έχουν μοριακό βάρος που κυμαίνεται μεταξύ g/mol και λιπόφιλο χαρακτήρα, ιδιότητες που τα καθιστούν ικανά να διαπεράσουν και in vivo τον εγκέφαλο, μέσω διάχυσης (Knörle, 2012). 26

33 Βιβλιογραφική Ανασκόπηση II.5.3 Αντιμικροβιακή δράση Στην εργασία των Kostadinova et al. (2008), το εκχύλισμα σε εξάνιο από δύο φυσικούς πληθυσμούς, αλλά και από καλλιεργούμενα φυτά του είδους S. scardica έδειξε μικρή αντιμικροβιακή ικανότητα έναντι στο Escherichia coli και το Candida albicans, αλλά ισχυρή έναντι στο Staphylococcus aureus. Το περιεχόμενο του εκχυλίσματος αυτού χαρακτηρίζεται από υψηλή συγκέντρωση διτερπενίων και n-αλκανίων. Τα δείγματα με μεγαλύτερο περιεχόμενο σε διτερπένια είχαν και την ισχυρότερη αντιμικροβιακή δράση. Οι Loğoğlu et al. (2006) που εργάστηκαν πάνω στα διτερπένια σιδερόλη, λινεαρόλη και επικανδικανδιόλη είδαν πως μόνο η επικανδικανδιόλη ήταν ενεργή έναντι στα Staphylococcus aureus, Bacillus subtilis και Candida albicans. Προφανώς, η παρουσία ακετυλικής ομάδας στις άλλες δύο ουσίες σχετίζεται με τη μειωμένη δραστικότητά τους. Στην παρουσία του α- και β-πινενίου ως βασικά συστατικά των αιθερίων ελαίων τους είναι πιθανόν να οφείλεται η αντιβακτηριακή ικανότητα κάποιων ενδημικών ειδών από την Τουρκία (Iscan et al., 2005, Köse et al., 2010), ενώ στην εργασία των Aligiannis et al. (2001), η καρβακρόλη μαζί με το α-πινένιο φαίνεται να ευθύνονται για την ισχυρή αντιμικροβιακή ικανότητα του S. syriaca ssp. syriaca. II.5.4 Αντιελκογόνος δράση Το 8-Ο-β-D-γλυκοσίδιο της υπολαιτίνης, φλαβονοειδές που απαντά συχνά σε διάφορα είδη σιδερίτη, έχει προστατευτική δράση, η οποία έγκειται στην παραγωγή βλέννας και στη μείωση της οξύτητας του στομάχου. Σύμφωνα και με άλλες μελέτες, η παρουσία της ομάδας της πυροκατεχόλης στη θέση 3-4 στο σκελετό του φλαβονοειδούς σχετίζεται με μεγαλύτερη προστατευτική δράση ενάντια στο έλκος (Alcaraz and Tordera, 1988). II.5.5 Αντιϊική δράση Κάποια ent-καουρεν-παράγωγα της λινεαρόλης με εστερικές περιοχές στις θέσεις C 3 και C 7 έχουν δείξει πως παρεμποδίζουν την εξάπλωση του ιού HIV (Bruno et al., 2002). Από την άλλη, οι Lazari et al. (2006) διαπίστωσαν πως το εκχύλισμα σε διχλωρομεθάνιο των υπέργειων τμημάτων του είδους S. perfoliata ssp. perfoliata είχε θετικά αποτελέσματα στην καταπολέμηση του ιού του έρπη HSV. Το τελευταίο είναι ιδιαίτερα χρήσιμο, μιας και προκύπτουν διαρκώς ανθεκτικά στελέχη του ιού, ειδικά στα φάρμακα που βασίζονται σε νουκλεοσίδια. II.5.6 Αντικαρκινικές ιδιότητες Τα υδατικά εκχυλίσματα των υπέργειων τμημάτων των ειδών S. euboea και S. clandestina δρουν σαν εκλεκτικοί ρυθμιστές του υποδοχέα οιστρογόνου (SERM), καταστέλλοντας την ανάπτυξη καρκινικών κυττάρων του μαστού, χωρίς να επιτρέπουν τον μετέπειτα πολλαπλασιασμό των αδενοκαρκινωμάτων του τραχήλου της μήτρας (Kassi et al., 2004). 27

34 Βιβλιογραφική Ανασκόπηση Εκτός από τα παραπάνω, διάφορα είδη Sideritis εμφανίζουν αναλγητική δράση, καθώς και δράση ενάντια στον πολλαπλασιασμό κάποιων κυτταρικών σειρών, με δοσοεξαρτώμενο τρόπο (Aboutabl et al., 2002, Demirtas et al., 2009). II.6 Οι Μοριακοί Δείκτες Οι κλασικές μέθοδοι αξιολόγησης της γενετικής παραλλακτικότητας που εμφανίζουν οι οργανισμοί είναι η συγκριτική ανατομία, μορφολογία, εμβρυολογία και φυσιολογία. Επικουρικό ρόλο αναλαμβάνει η ανάλυση χημικών συστατικών, όπως των δευτερογενών μεταβολιτών στα φυτά, ο χαρακτηρισμός μακρομορίων και αλλοενζύμων, κ.ά.. Τα τελευταία χρόνια, η έρευνα έχει επικεντρωθεί στην ανάπτυξη των μοριακών δεικτών, οι οποίοι βασίζονται στους πολυμορφισμούς του DNA ή των πρωτεϊνών. Η σημασία τους είναι μεγάλη, καθότι έχουν δυνατότητα αξιοποίησης σε ένα ευρύ πεδίο εφαρμογών, από την ταξινόμηση, τη φυλογένεια, την οικολογία, μέχρι και τη γενετική και τη βελτίωση των φυτών. Η μεθοδολογία αποσκοπεί στην ελαχιστοποίηση της πολυπλοκότητας του DNA, με την ανάδειξη των απλών τμημάτων-προτύπων που αντιπροσωπεύουν τις διαφοροποιήσεις (Rao et al.,2010). Τα πλεονεκτήματα των μοριακών DNA δεικτών έναντι των μορφολογικών που τους καθιστούν πλέον ιδιαίτερα ελκυστικούς για πολλούς ερευνητές, αναφέρονται επιγραμματικά στα παρακάτω (Tanksley, 1983, Crawford, 1990): Θεωρητικά, είναι δυνατό να δημιουργηθεί απεριόριστος αριθμός ανεξάρτητων μοριακών δεικτών. Αντίθετα, οι διαθέσιμοι μορφολογικοί και βιοχημικοί δείκτες είναι περιορισμένοι. Οι γενότυποι των θέσεων μπορούν να καθοριστούν ακόμα και σε κυτταρικό επίπεδο, κάτι που δεν μπορεί να συμβεί με τους περισσότερους μορφολογικούς δείκτες, οι οποίοι διακρίνονται σε ανώτερα επίπεδα οργάνωσης. Στις γενετικές θέσεις των μοριακών δεικτών μπορεί να εντοπιστεί ένας σχετικά μεγάλος αριθμός αλληλομόρφων. Τα αλληλόμορφα των μορφολογικών δεικτών διακρίνονται σπάνια, έτσι συνήθως επάγεται η δημιουργία τους με εφαρμογή εξωγενών μεταλλαξιγόνων. Συνήθως δεν παρατηρείται εμφάνιση επιβλαβών αλληλομόρφων στους μοριακούς δείκτες, σε αντίθεση με τους μορφολογικούς, οι οποίοι συχνά συνοδεύονται από ανεπιθύμητους φαινοτύπους. Κάποιοι από τους μοριακούς δείκτες έχουν τη δυνατότητα να διακρίνουν ομοζύγωτα από ετεροζύγωτα άτομα. Οι μορφολογικοί και βιοχημικοί δείκτες στην πλειοψηφία τους είναι κυρίαρχοι ή αφορούν χαρακτήρες που υπόκεινται σε πλειοτροπική ή επιστατική επίδραση, οπότε είναι λιγότερο επιδεκτικοί σε αναλυτικές μεθόδους μεγάλης ισχύος. 28

35 Βιβλιογραφική Ανασκόπηση Οι μοριακοί δείκτες δεν εμφανίζουν φαινοτυπική πλαστικότητα, σε αντίθεση με τους μορφολογικούς και βιοχημικούς που επηρεάζονται από το περιβάλλον. Οι μοριακοί δείκτες που δεν αφορούν σε κωδικές περιοχές, δεν επηρεάζονται από τη φυσική επιλογή. Τα παραπάνω πλεονεκτήματα δεν υποβαθμίζουν τη σημασία των δεδομένων των περισσότερο παραδοσιακών μεθόδων που χρησιμοποιούνται μέχρι και σήμερα. Αυτές συνεχίζουν να προσφέρουν πολύτιμες, χρήσιμες και πρακτικές πληροφορίες για το χαρακτηρισμό των φυτογενετικών πόρων. Σε πολλές περιπτώσεις, αν υπάρχουν τα διαθέσιμα μέσα, ενδείκνυται ο συνδυασμός μεθόδων. Οι βασικές τεχνικές μοριακών δεικτών εκ των οποίων οι κυριότεροι παρουσιάζονται σε επόμενο κεφάλαιο, κατηγοριοποιούνται σε: A. Τεχνικές που βασίζονται στον υβριδισμό (RFLP, μινιδορυφόροι) B. Τεχνικές που βασίζονται στην PCR i. Δείκτες που σχετίζονται με τυχαίες αλληλουχίες (RAPD, AFLP) ii. Δείκτες που σχετίζονται με συγκεκριμένη αλληλουχία Η αλυσιδωτή αντίδραση της πολυμεράσης (Polymerase Chain Reaction-PCR) ήταν μια επανάσταση για τους μοριακούς δείκτες, καθότι έχοντας μικρή ποσότητα DNA (5-100 ng ανά αντίδραση), μπορούσε πλέον να ενισχυθεί και να αναλυθεί οποιαδήποτε περιοχή του γονιδιώματος, σε αντίθεση με την απομόνωση και κλωνοποίηση μεγάλων ποσοτήτων πολύ καθαρού DNA που απαιτούσαν οι τεχνικές υβριδισμού (Schlötterer, 2004). Αυτό είναι εξαιρετικά χρήσιμο, ειδικά στις περιπτώσεις που δεν είναι δυνατό κάτι τέτοιο. Επιπρόσθετα, σχεδόν όλες οι μέθοδοι που βασίζονται στην PCR μπορούν ως ένα βαθμό να αυτοματοποιηθούν. Τα τελευταία χρόνια έχουν έρθει στο προσκήνιο προηγμένες τεχνικές που είτε συνδυάζουν τις βασικές μεθόδους, συγκεντρώνοντας τα πλεονεκτήματά τους, είτε είναι τροποποιημένες βασικές τεχνικές, με αυξημένη ευαισθησία και διακριτική ικανότητα. Οι νέες τεχνικές αξιοποιούν νεότερα στοιχεία DNA, όπως τα ρετροτρανσποζόνια (από την ομάδα των επαναλαμβανόμενων στοιχείων) και χλωροπλαστικούς/μιτοχονδριακούς μικροδορυφόρους και επιτυγχάνουν την αύξηση της κάλυψης του γονιδιώματος. Το χλωροπλαστικό και μιτοχονδριακό γονιδίωμα εμφανίζουν διαφορετικά πρότυπα γενετικής παραλλακτικότητας, σε σχέση με το γονιδίωμα του πυρήνα, εξαιτίας του τρόπου κληρονόμησής τους (Provan et al., 1999a,b). Επομένως, για την ενδελεχή μελέτη και κατανόηση της παραλλακτικότητας και της εξέλιξης ενός πληθυσμού φυτών, θα πρέπει να ληφθούν υπόψη τρία αλληλένδετα γονιδιώματα. Οι πληροφορίες που προσφέρουν οι αντίστοιχοι δείκτες σχετικά με την καταγωγή, συνεισφέρουν σε μεγάλο βαθμό στη γενετική βελτίωση και εξέλιξη (Agarwal et al., 2008). 29

36 Βιβλιογραφική Ανασκόπηση Η βιολογική απόκριση και ο αναπτυξιακός προγραμματισμός ενός οργανισμού ρυθμίζονται με τον ακριβή έλεγχο της γονιδιακής έκφρασης. Οι RAPD και AFLP τεχνικές εφαρμόζονται πλέον και στο cdna, για τη μελέτη διαφορετικών προτύπων γονιδιακής έκφρασης (Agarwal et al., 2008), ενώ συμβάλλουν στην αποκάλυψη νέων γονιδίων που ευθύνονται για τη διαφοροποίηση στην έκφραση (Yaο et al., 2007). Οι οικογένειες επαναλήψεων του DNA μπορεί να είναι κοινές σε μια οικογένεια ή γένος ή μπορεί να χαρακτηρίζουν κάποια είδη ή και χρωμοσώματα. Είτε συγκεντρώνονται σε συγκεκριμένα τμήματα του γονιδιώματος, π.χ. στα τελομερή ή βρίσκονται διάσπαρτες στο γονιδίωμα, ενώ υπόκεινται σε διαφορετικούς εξελικτικούς περιορισμούς σε σχέση με τα γονίδια. Οι επαναλαμβανόμενες αλληλουχίες χαρακτηρίζονται συνήθως από καλά συντηρημένη δομή, ενώ διαφοροποιούνται κυρίως στον αριθμό των επαναλήψεων. Η παραλλακτικότητά τους αυτή αποτελεί τη βάση για την αξιοποίησή τους στις διάφορες ταξινομικές και φυλογενετικές μελέτες (Smith and Flavell, 1974). Ειδικά το επαναλαμβανόμενο DNA των μη-κωδικών περιοχών διαφέρει από μία ομάδα οργανισμών σε άλλη και από οργανισμό σε οργανισμό, έτσι χρησιμοποιείται συχνά ως εργαλείο για τον καθορισμό του γενετικού αποτυπώματος (Rao et al., 2010). Συγκεκριμένα, η κατηγορία των διαδοχικών επαναλήψεων παίζει σημαντικό δομικό, αλλά και λειτουργικό ρόλο. Οι αλληλουχίες αυτές υπάρχουν σε αφθονία σε δομικές περιοχές, όπως τα κεντρομερή και τα τελομερή, καθώς και σε περιοχές πρόσδεσης των ιστονών. Κοντά σε γονίδια κατέχουν ρυθμιστικό ρόλο, ίσως και εντός των κωδικών περιοχών. Πιθανόν, επηρεάζουν και τη μεταγραφή, π.χ. σχηματίζοντας το Z-DNA (Yang et al., 1996). Οι μικρο- και μινιδορυφορικές αλληλουχίες χαρακτηρίζονται από υψηλό ρυθμό μεταλλαγών (πάνω από 5%), ο οποίος παρουσιάζει θετική συσχέτιση με το ολικό μήκος των επαναλήψεων. Σύμφωνα με αυτά, σε ένα γενετικό αποτύπωμα πολλαπλών θέσεων τη μεγαλύτερη παραλλακτικότητα θα την εμφανίσουν ζώνες υψηλού μοριακού βάρους, σε σχέση με τις μικρού μοριακού βάρους (Rao et al., 2010). Άλλοι πιθανοί μηχανισμοί στους οποίους οφείλεται η παραλλακτικότητα είναι το «γλίστρημα» στην αντιγραφή, η μεταθετότητα και τα γεγονότα ανασυνδυασμού (Jarman and Wells, 1989, Jeffreys et al., 1990, Wolff et al., 1991, Richards and Sutherland, 1992). Οι διαφορές των μοριακών δεικτών στις θεμελιώδεις αρχές, τη μεθοδολογία και τις εφαρμογές χρήζουν ιδιαίτερης προσοχής κατά την επιλογή μιας ή περισσότερων μεθόδων. Κανένας μοριακός δείκτης ως τώρα δεν θεωρείται ιδανικός να εκπληρώσει όλες τις απαιτήσεις των ερευνητών. Ανάλογα το είδος της μελέτης που εκπονείται, το θεωρητικό βαθμό πολυμορφισμού που απαιτείται, την επάρκεια των ανάλογων τεχνικών δυνατοτήτων και της τεχνογνωσίας και τέλος τους χρονικούς και οικονομικούς περιορισμούς, μπορεί κάποιος να επιλέξει από μια μεγάλη και διαρκώς διευρυνόμενη ποικιλία μοριακών δεικτών, καθένας από τους οποίους συνδυάζει τουλάχιστον κάποια επιθυμητά χαρακτηριστικά (Spooner et al., 2005, Semagn et al., 2006). Η επιλογή του κατάλληλου μοριακού δείκτη 30

37 Βιβλιογραφική Ανασκόπηση πρέπει να απορρέει από το συμβιβασμό αξιοπιστίας και ευκολίας στην ανάλυση, τη στατιστική ισχύ και την ικανότητα ανάδειξης πολυμορφισμού (Agarwal et al., 2008). Ο γενικός κανόνας είναι πως με την αυξανόμενη εξελικτική απόσταση των υπό εξέταση δειγμάτων, καταλληλότεροι θεωρούνται οι πιο συντηρημένοι δείκτες, που χαρακτηρίζονται από χαμηλότερο εξελικτικό ρυθμό. Έτσι, η υψηλότερη αναλυτική ικανότητα που απαιτείται για στενά συγγενικά δείγματα, π.χ. εντός του είδους, ικανοποιείται από τους μικροδορυφορικούς δείκτες. Οι γενετικοί δείκτες πολλαπλών θέσεων πλεονεκτούν στο ότι αναδεικνύουν ταυτόχρονα πολυμορφισμούς διαφόρων θέσεων του γονιδιώματος, προσφέροντας επομένως περισσότερη πληροφορία, ενώ συνήθως είναι τυχαία κατανεμημένοι. Ωστόσο, τα πρότυπα ζωνών δεν μπορούν να ερμηνευτούν με όρους θέσεων και αλληλομόρφων (ζώνες παρόμοιου μεγέθους μπορεί να αντιπροσωπεύουν αλληλόμορφα διαφορετικών θέσεων), αλλά «σκοράρονται» ως παρουσία/απουσία ζώνης ορισμένου μεγέθους. Στις μελέτες φυλογένειας ή γενετικής συγγένειας θα πρέπει να αναζητηθούν δείκτες εξειδικευμένοι της θέσης, που όμως προαπαιτούν γνώση της αλληλουχίας ως επί το πλείστον. Αντίθετα, για την έκφραση του γενετικού αποτυπώματος, αρκούμαστε στην ανάδειξη των διαφορών, ενώ η ομολογία δεν μας απασχολεί. Συνήθως, οι εξειδικευμένοι της θέσης δείκτες είναι συγκυρίαρχοι, που σημαίνει πως μπορούν να διακρίνουν τα ετεροζύγωτα από τα ομοζύγωτα άτομα και να καθοριστεί η συχνότητα των αλληλομόρφων σε μια γενετική θέση. Στους κυρίαρχους δείκτες (συνήθως πολλαπλής θέσης) η ετεροζυγωτία και οι συχνότητες των αλληλομόρφων υπολογίζονται έμμεσα, με την υπόθεση ότι ο πληθυσμός βρίσκεται σε ισορροπία Hardy-Weinberg (Spooner et al., 2005). Στον Πίνακα 2 εντοπίζονται οι κυριότερες ομοιότητες και διαφορές των δημοφιλέστερων μοριακών δεικτών. II.7 Κυριότεροι Τύποι Μοριακών Δεικτών II.7.1 RFLPs (Restriction Fragment Length Polymorphism) Προκύπτουν από την πέψη του γενωμικού DNA με περιοριστικά ένζυμα. Το αρχικό διάχυτο πρότυπο ζωνών της ηλεκτροφόρησης μετατρέπεται σε πρότυπο πολυμορφικών ζωνών κατόπιν Southern υβριδισμού με σημασμένο εξειδικευμένο της θέσης ανιχνευτή. Ο πολυμορφισμός των συγκεκριμένων δεικτών οφείλεται στη δημιουργία ή απώλεια θέσεων αναγνώρισης (Spooner et al., 2005). II.7.2 Μινιδορυφόροι (Minisatellites) Όπως και τα RFLPs, επίσης περιλαμβάνουν πέψη του γενωμικού DNA με περιοριστικά ένζυμα, ωστόσο η φιλοσοφία τους είναι εντελώς διαφορετική. Οι μινιδορυφόροι αποτελούνται από χρωμοσωμικές περιοχές διαδοχικά επαναλαμβανόμενων μοτίβων των 31

38 Βιβλιογραφική Ανασκόπηση βάσεων που συνορεύουν με συντηρημένες θέσεις αναγνώρισης περιοριστικών ενζύμων. Το μινιδορυφορικό προφίλ προκύπτει με τη χρήση κοινών ανιχνευτών πολλαπλών θέσεων, που είναι ικανοί να υβριδίσουν με τις μινιδορυφορικές αλληλουχίες σε διαφορετικά είδη, ενώ από αυτή τη διαδικασία μπορούμε περαιτέρω να απομονώσουμε εξειδικευμένους της θέσης ανιχνευτές. Ο άνισος διασκελισμός ή αναστροφή είναι τα κύρια αίτια του πολυμορφισμού (Spooner et al., 2005). Όμως, η τυχαία κατανομή των μινιδορυφορικών περιοχών στο γονιδίωμα έχει αμφισβητηθεί (Schlötterer, 2004). II.7.3 CAPS (Cleaved Amplified Polymorphic Sequence) ή PCR-RFLPs Είναι τμήματα DNA που έχουν ενισχυθεί με τη χρήση εκκινητών bp και που έχουν στη συνέχεια υποστεί πέψη με περιοριστικά ένζυμα. Επομένως, ο πολυμορφισμός που προκύπτει σχετικά με το μέγεθος των προϊόντων πολυμερισμού, οφείλεται στην παρουσία/απουσία θέσεων αναγνώρισης των περιοριστικών ενζύμων. Στα πλεονεκτήματα της μεθόδου συγκαταλέγονται η υψηλή επαναληψιμότητα και η συγκυριαρχία του δείκτη. Τα CAPS δεν έχουν τις τεχνικές απαιτήσεις του υβριδισμού κατά Southern, όπως τα RFLPs, απαιτείται όμως γνώση της αλληλουχίας για το σχεδιασμό των εκκινητών. Το δε μέγεθος των ενισχυμένων τμημάτων είναι περιορισμένο (Spooner et al., 2005). II.7.4 AFLPs (Amplified Fragment Length Polymorphism) Είναι επίσης μια μέθοδος που συνδυάζει PCR και πέψη με περιοριστικά ένζυμα. Πρωτίστως, το DNA υφίσταται μια πέψη με περιοριστικά ένζυμα και κατόπιν προσδένονται ολιγονουκλεοτιδικοί προσαρμογείς στα κολλώδη άκρα των προϊόντων πέψης. Ακολουθεί η αλυσιδωτή αντίδραση της πολυμεράσης για τα τμήματα αυτά, όπου οι εκκινητές αποτελούνται στην ουσία από ένα τμήμα του προσαρμογέα και την αλληλουχία αναγνώρισης του περιοριστικού ενζύμου, καθώς και 1-5 νουκλεοτίδια (όσο περισσότερα, τόσο λιγότερες ζώνες θα ανακτηθούν στο πρότυπο ηλεκτροφόρησης). Το πρότυπο προκύπτει από διαφοροποιήσεις των θέσεων αναγνώρισης των περιοριστικών ενζύμων ή στην ενδιάμεση περιοχή. Με τη μέθοδο αυτή ενισχύονται τμήματα από πολλές θέσεις ταυτόχρονα ( ανά αντίδραση) και διαχωρίζονται σε πηκτή πολυακρυλαμίδης. Η διαδικασία αυτή απαιτεί καθαρό DNA υψηλού μοριακού βάρους. Επιπλέον, εξαιτίας του μεγάλου αριθμού και της ποικίλης έντασης των ζωνών ανά συνδυασμό εκκινητών, πρέπει να ορίζονται αντικειμενικά και αυστηρά κριτήρια για την αποδοχή της ύπαρξης μιας ζώνης (Spooner et al., 2005). Τα AFLPs ίσως να μην κατανέμονται εντελώς τυχαία στο γονιδίωμα, καθότι έχει αναφερθεί πως σε ορισμένα καλλιεργούμενα φυτά συσσωματώνονται σε συγκεκριμένες περιοχές, όπως το κεντρομερές (Alonso-Blanco et al., 1998, Young et al., 1999, Saal and Wrickle, 2002). 32

39 Βιβλιογραφική Ανασκόπηση II.7.5 RAPDs (Random Amplified Polymorphic DNA) Ένας τυχαίος μονήρης εκκινητής, συνήθως δεκαμερές, υβριδίζει σε διάφορες περιοχές του γονιδιώματος. Η PCR ενισχύει εκείνα τα τμήματα DNA (από 1-10 θέσεις ταυτόχρονα) όπου υπάρχει ο κατάλληλος προσανατολισμός του εκκινητή και η κατάλληλη απόσταση μεταξύ των θέσεων υβριδισμού, ώστε να επιτραπεί η ενίσχυση. Ο πολυμορφισμός στα προϊόντα της PCR ανιχνεύεται από την παρουσία ή απουσία ζώνης συγκεκριμένου μεγέθους και οφείλεται πρωτίστως στο πλήθος των θέσεων που μπορεί να προσδεθεί ο εκκινητής. Η μέθοδος χαρακτηρίζεται από ταχύτητα, αλλά και μεγάλη ευαισθησία στις συνθήκες της αντίδρασης. Οπότε, απαιτεί στανταρισμένη διαδικασία, DNA υψηλής καθαρότητας και μοριακού βάρους και όλες τις απαραίτητες προφυλάξεις για αποφυγή επιμόλυνσης, καθότι οι τυχαίοι, μικρού μεγέθους εκκινητές είναι ικανοί να ενισχύσουν DNA από ένα πλήθος οργανισμών (Spooner et al., 2005). II.7.6 SCARs (Sequence Characterized Amplified Region) Είναι ενισχυμένα τμήματα DNA που προέκυψαν από PCR με τη χρήση εκκινητών μήκους bp. Οι εκκινητές αυτοί σχεδιάζονται με βάση ακολουθίες κλωνοποιημένων RAPDs που συνδέονται με κάποιο χαρακτηριστικό ενδιαφέροντος. Με τον τρόπο αυτό, τα SCARs δεν αντιμετωπίζουν το πρόβλημα της επαναληψιμότητας που έχουν τα RAPDs, εξαιτίας των μεγαλύτερων εκκινητών. Ουσιαστικά μετατρέπονται οι κυρίαρχοι σε συγκυρίαρχους, εξειδικευμένους της θέσης δείκτες, αν και υπάρχει πιθανότητα κυριαρχίας. Οι πολυμορφισμοί αφορούν πάλι μέγεθος ζώνης στην πηκτή ηλεκτροφόρησης και η μέθοδος χαρακτηρίζεται από ευκολία και ταχύτητα. Οι δείκτες αυτοί χρησιμοποιούνται συχνά στην επιλογή γενοτύπων σε προγράμματα βελτίωσης (Spooner et al., 2005). II.7.7 Μικροδορυφόροι (Microsatellites/Single Sequence Repeats-SSRs) Οπως οι μινιδορυφόροι, αντιπροσωπεύουν διαδοχικές επαναλήψεις, με επαναλαμβανόμενη μονάδα 1-6 βάσεις. Εάν οι γειτονικές αλληλουχίες είναι γνωστές, μπορούν να σχεδιαστούν εξειδικευμένοι εκκινητές (20-25 bp) για την ενίσχυση του μικροδορυφορικού τμήματος μιας θέσης μέσω της PCR. Η κύρια αιτία της διαφοροποίησης του αριθμού επαναλήψεων και επομένως του μεγέθους της μικροδορυφορικής περιοχής, είναι το «γλίστρημα» της πολυμεράσης κατά την αντιγραφή. Οι περιοχές πρόσδεσης των εκκινητών μάλλον είναι συντηρημένες εντός του είδους και μερικές φορές και σε ανώτερες ταξινομικές βαθμίδες. Μεταλλάξεις στις περιοχές αυτές έχουν ως αποτέλεσμα την αδυναμία ενίσχυσης του μικροδορυφορικού DNA και την εμφάνιση των λεγόμενων null αλληλομόρφων. Τα αλληλόμορφα αυτά μπορεί να οδηγήσουν σε λάθη κατά το «σκοράρισμα» του γενοτύπου και εν συνεχεία σε μεροληπτική εκτίμηση της συχνότητας αλληλομόρφων και γενοτύπων και σε υποτίμηση του βαθμού της ετεροζυγωτίας. Η πιθανότητα εμφάνισής τους αυξάνει όταν χρησιμοποιούνται εκκινητές που προήλθαν από μη-συγγενικό γενετικό υλικό. 33

40 Βιβλιογραφική Ανασκόπηση Ένα συχνό φαινόμενο στους μικροδορυφόρους τέλος, είναι η εμφάνιση ψευδοζωνών που περιπλέκουν την ερμηνεία των προτύπων ηλεκτροφόρησης, συγχέοντας τα ομοζύγωτα με τα ετεροζύγωτα άτομα. Αυτή η δυσκολία ξεπερνάται με τη χρήση κατάλληλων γνωστών γενοτύπων αναφοράς (Spooner et al., 2005). Η κατανομή των SSRs είναι τυχαία, ωστόσο έχει αναφερθεί συγκέντρωσή τους στα κεντρομερή και τελομερή (Morgante et al., 2002), εντοπίζονται όμως επίσης συχνά πλησίον ή εντός κωδικών περιοχών (Rao et al., 2010). Οι θέσεις εντοπισμού ορισμένων μικροδορυφόρων φαίνεται να είναι σχετικά σταθερές (Zietkiewicz et al., 1994). II.7.8 ESTs (Expressed Sequence Tags) Μια ακόμα ομάδα δεικτών προκύπτει από την αλληλούχιση μερικών εκατοντάδων νουκλεοτιδίων cdna, ξεκινώντας είτε από το 3 είτε από το 5 άκρο (Jongeneel, 2000). Tα 5 ESTs περιλαμβάνουν τμήμα των εξονίων, άρα οι αλληλουχίες αυτές είναι περισσότερο συντηρημένες μεταξύ ειδών, ενώ τα 3 ESTs συνήθως εκτείνονται σε περιοχές ιντρονίων, οπότε και εμφανίζονται λιγότερο συντηρημένα (Semagn et al., 2006). II.7.9 EST-SSRs Αρχικά, τα ESTs εφαρμόζονταν στην αναγνώριση μεταγραφικών μονάδων γονιδίων, μετέπειτα όμως βοήθησαν στη δημιουργία κι άλλων τύπων μοριακών δεικτών. Με δεδομένα ESTs και άλλες DNA αλληλουχίες και τη βοήθεια κατάλληλων προγραμμάτων, η ανάπτυξη EST-SSRs έχει καταστεί γρήγορη, αποτελεσματική και σχετικά φθηνότερη διαδικασία, σε σύγκριση με την ανάπτυξη των κλασικών SSRs (Gupta et al., 2003). Επιπλέον, τα EST-SSRs είναι πιο ομοιόμορφα κατανεμημένα, ενώ επειδή τείνουν να εντοπίζονται εντός των περισσότερο συντηρημένων μεταγραφόμενων περιοχών, σε σχέση με τις μημεταγραφόμενες (Caudrado and Schwarzacher, 1998), αναμένεται να είναι σε μεγαλύτερο βαθμό κοινά μεταξύ στενά συγγενικών ειδών (Cordeiro et al., 2001, Decroocq et al., 2003, Hempel and Peakall, 2003,) και άρα να τυγχάνουν ευρύτερης χρήσης απ ότι τα γενωμικά SSRs. Η παραλλακτικότητα που τυχόν εντοπίζεται σε αυτούς τους δείκτες αντανακλά το διαφοροποιημένο ποσοστό του γονιδιώματος που εκφράζεται. Έτσι, οι δείκτες αυτοί θα μπορούσαν να χρησιμοποιηθούν για την αναγνώριση επιθυμητών γενοτύπων με εμπορικό ενδιαφέρον, καθώς και για την επιλογή υψηλοαποδοτικών γενοτύπων που θα αποτελούσαν υλικό για βελτίωση νέων ποικιλιών. II.7.10 SNPs (Single Nucleotide Polymorphism) Όπως μαρτυρά και το όνομα, πρόκειται για πολυμορφισμό που οφείλεται σε αντικατάσταση μιας βάσης μιας δεδομένης αλληλουχίας, όπου συνήθως υπάρχει η εναλλακτική δύο νουκλεοτιδίων για τη συγκεκριμένη θέση. Επομένως, σε σχέση με άλλες μεθόδους, η διάκριση των αλληλομόρφων δεν βασίζεται σε διαφοροποίηση μεγέθους ζωνών σε μια πηκτή ηλεκτροφόρησης (Semagn et al., 2006). Τα SNPs είναι οι αφθονότεροι και οι πιο διάσπαρτα κατανεμημένοι μοριακοί δείκτες στο γονιδίωμα, ωστόσο η παρουσία 34

41 Βιβλιογραφική Ανασκόπηση τους και η κατανομή τους διαφοροποιείται μεταξύ ειδών. Επικρατούν κατά βάση στις μηκωδικές περιοχές (Agarwal et al., 2008). Υπάρχουν πολλά πρωτόκολλα για την ανίχνευση των SNPs και η επιλογή του καταλληλότερου εξαρτάται κάθε φορά από την επιθυμητή επαναληψιμότητα και ακρίβεια, το κόστος και την ευελιξία της εφαρμογής, καθώς και το διαθέσιμο χρόνο. Όπως επίσης, ο συγκεκριμένος σκοπός, αλλά και το υλικό που εξετάζεται θα καθορίσουν σε μεγάλο βαθμό το πρωτόκολλο που θα εφαρμοστεί, αν π.χ. έχουμε γενότυπους με περιορισμένο αριθμό SNPs σε μεγάλα δείγματα πληθυσμών ή το αντίστροφο (Semagn et al., 2006). II.7.11 EST- SNPs Δύο στρατηγικές έχουν ακολουθηθεί όσον αφορά τη δημιουργία SNP δεικτών με βάση ESTs. Για μεγαλύτερη πιθανότητα αποκάλυψης πολυμορφισμών, σχεδιάζονται ζεύγη εκκινητών με βάση 3 ESTs που περιλαμβάνουν μη-μεταγραφόμενες περιοχές. Ενισχύονται τα αντίστοιχα τμήματα και ακολουθεί η αλληλούχισή τους. Εναλλακτικά, μπορούν να υπολογιστούν μέσω προγραμμάτων πιθανά SNPs από ομάδες δεδομένων ESTs διαφόρων ποικιλιών (Semagn et al., 2006). II.7.12 ISSRs (Inter Simple Sequence Repeats) Είναι τμήματα DNA bp που παρεμβάλλονται μεταξύ γειτονικών μικροδορυφορικών περιοχών αντίθετου προσανατολισμού. Ο εκκινητής που χρησιμοποιείται σε αυτήν την τεχνική για την ενίσχυση αυτών των τμημάτων, είναι μονήρης και αποτελείται από έναν αριθμό επαναλήψεων της αλληλουχίας πυρήνα (μοτίβο) του μικροδορυφόρου, με την προσθήκη λίγων εκλεκτικών νουκλεοτιδίων, είτε προς το 5 άκρο του εκκινητή (16-18 βάσεις, από τη μη-επαναλαμβανόμενη περιοχή), είτε προς το 3 άκρο (1-5 βάσεις εντός της περιοχής που θέλουμε να ενισχύσουμε). Με αυτόν τον τρόπο, περιορίζεται η ενίσχυση σε λιγότερες θέσεις-στόχους (ενισχύονται ταυτόχρονα περιοχές) (Spooner et al., 2005). Γενικά, όσο πιο πολύπλοκος είναι ο οργανισμός που μελετάται και όσο πιο πυκνό πρότυπο δίνει η μέθοδος, τόσο πιο εξειδικευμένος πρέπει να είναι ο εκκινητής και τόσο πιο αυστηρές οι συνθήκες της PCR, ώστε να μειωθεί ο αριθμός των ενισχυμένων τμημάτων και να αριστοποιηθεί η ανάλυσή τους στην ηλεκτροφόρηση που θα ακολουθήσει (Zietkiewicz et al., 1994). Παρότι σχετίζονται με την αλληλουχία των μικροδορυφόρων, τα ISSRs μοιάζουν με RAPDs (Joshi et al., 2000), ωστόσο χρησιμοποιούνται μεγαλύτερου μήκους εκκινητές, γεγονός το οποίο επιτρέπει την εφαρμογή υψηλών θερμοκρασιών υβριδισμού κατά την PCR και κατ επέκταση μεγαλύτερη αυστηρότητα της μεθόδου, σε σχέση με τις αντιδράσεις χαμηλής εξειδίκευσης των RAPDs (Bebeli et al., 1997, Semagn et al., 2006). Εναλλακτικά, όταν ο εκκινητής περιέχει μόνο την αλληλουχία πυρήνα ενός μικροδορυφόρου ή μινιδορυφόρου, τότε μιλάμε αντίστοιχα για Single Primer Amplification Reaction (SPAR) και «κατευθυνόμενη ενίσχυση της μινιδορυφορικής περιοχής DNA» (Directed Amplification of Minisatellite-region DNA-DAMD) (Spooner et al., 2005). 35

42 Βιβλιογραφική Ανασκόπηση Οι Heath et al. (1993) ανέπτυξαν την τεχνική της DAMD-PCR. Θεώρησαν πως σε μερικές θέσεις διαδοχικών επαναλήψεων ποικίλου αριθμού (Variable Number of Tandem Repeats- VNTRs), κάποιες από τις επαναλήψεις μπορεί να αντιστραφούν σε προσανατολισμό, εξαιτίας τοπικών αναστροφών ή άλλων χρωμοσωμικών αναδιατάξεων. Εάν τέτοια γεγονότα μετακινούν τις επαναλήψεις, έτσι ώστε να παρεμβληθεί ένα τμήμα DNA στη μια αλυσίδα μεταξύ των επαναλήψεων, τότε η PCR που χρησιμοποιεί VNTRs ως μονήρεις εκκινητές θα ενίσχυε τα παρεμβαλλόμενα τμήματα. Τα προϊόντα της PCR μπορεί να δείχνουν μικρή διαφοροποίηση εντός του είδους, αλλά αρκετές διαφορές μεταξύ των ειδών, έτσι η τεχνική χρησιμοποιήθηκε από πολλούς για την ανίχνευση πολυμορφισμών μεταξύ διαφορετικών ειδών. Τα προϊόντα της αντίδρασης της πολυμεράσης διαχωρίζονται με ηλεκτροφόρηση και καταγράφεται η παρουσία ή απουσία ζώνης συγκεκριμένου μεγέθους (Spooner et al., 2005). Τα ISSRs διασπώνται κυρίως ως κυρίαρχοι δείκτες, αν και ορισμένες φορές έχει παρατηρηθεί και συγκυρίαρχη διάσπαση (Wu et al., 1994, Akagi et al., 1996, Wang et al., 1998, Sankar and Moore, 2001). Το επίπεδο του πολυμορφισμού διαπιστώθηκε πως διαφοροποιείται ανάλογα τη μέθοδο ανίχνευσης. Η ηλεκτροφόρηση σε πηκτή πολυακρυλαμίδης (PAGE), σε συνδυασμό με ραδιοενεργότητα φαίνεται να είναι η περισσότερο ευαίσθητη, ακολουθούμενη από PAGE με χρώση AgNO 3 και τέλος από αγαρόζη με χρώση με EtBr (Semagn et al., 2006). Από την πηκτή αγαρόζης μπορούν να αφαιρεθούν τα εξειδικευμένα για το είδος ISSR- PCR προϊόντα και να κλωνοποιηθούν ή να επανενισχυθούν με τον ίδιο εκκινητή, ώστε να χρησιμοποιηθούν ως ανιχνευτές στην ταυτοποίηση πληροφοριακών μοριακών δεικτών μιας θέσης από γενωμικές βιβλιοθήκες χωρίς να είναι απαραίτητη η σάρωση βιβλιοθήκης, η κλωνοποίηση ή η αλληλούχιση (Zietkiewicz et al., 1992, Heath et al., 1993, Bebeli et al., 1997). 36

43 Βιβλιογραφική Ανασκόπηση Αφθονία στο γονιδίωμα Ποσότητα DNA που απαιτείται Επίπεδο πολυμορφισμού Τρόπος κληρονόμησης RFLP SSR RAPD AFLP ISSR Υψηλή Μέτρια ή υψηλή Πολύ υψηλή Πολύ υψηλή Μέτρια προς υψηλή Μεγάλη Μικρή Μικρή Μέτρια Μικρή Μέτριο Υψηλό ή μέτριο Υψηλό ή μέτριο Πολύ υψηλό ή μέτριο Υψηλό ή μέτριο Συγκυρίαρχος Συγκυρίαρχος Κυρίαρχος Κυρίαρχος Κυρίαρχος Εξειδίκευση της θέσης Ναι Ναι Όχι Όχι Όχι Απαιτείται γνώση αλληλουχίας Βαθμός δυσκολίας εφαρμογής Επιδεκτικότητα στον αυτοματισμό Επαναληψιμότητα (αξιοπιστία) Όχι Ναι Όχι Όχι Όχι Μεγάλος Μηδενικός Μηδενικός Μεγάλος αρχικά Μηδενικός Μικρή Υψηλή Μέτρια Μέτρια Μέτρια Υψηλή Υψηλή ή μέτρια Ενδιάμεση ή χαμηλή Υψηλή προς μέτρια Μέτρια προς υψηλή Κόστος έναρξης Υψηλό Υψηλό Χαμηλό Μέτριο Μέτριο Ένταση εργασίας Υψηλή Χαμηλή Χαμηλή Μέτρια Χαμηλή Πίνακας 2: Τα σημαντικότερα χαρακτηριστικά των 5 αντιπροσωπευτικότερων και δημοφιλέστερων μοριακών δεικτών (Spooner et al., 2005, Semagn et al., 2006, Agarwal et al., 2008). II.8 Μικροσυστοιχίες (Microarrays) Οι μικροσυστοιχίες DNA που έχουν αναπτυχθεί τα τελευταία χρόνια, βασίζονται στον υβριδισμό μεταξύ του φθορίζοντα στόχου (ή ανιχνευτή) και των ανιχνευτών (ή στόχων) που είναι τοποθετημένοι στη μικροσυστοιχία (Carles et al., 2005, Sze et al., 2008). Σε σχέση με τις τεχνικές που στηρίζονται στην PCR, οι μικροσυστοιχίες επιτρέπουν τον υβριδισμό του σημασμένου στόχου με ένα μεγάλο αριθμό ανιχνευτών. Επομένως, είναι πιο ακριβείς, λιγότερο χρονοβόρες και απαιτούν λιγότερη εργασία (Niu et al., 2011). Επιπλέον, η ηλεκτροφόρηση που χρησιμοποιείται για την ανίχνευση του πολυμορφισμού στις κλασικές μεθόδους, μειονεκτεί στην ακρίβεια με την οποία γίνεται η συσχέτιση των ζωνών με τα διάφορα αλληλόμορφα (Jaccoud et al., 2001), αλλά και στην ικανότητα ανάλυσης σε ορισμένες περιπτώσεις (Li et al., 2006). Οι μικροσυστοιχίες διακρίνονται ως εξής: A. σε μικροσυστοιχίες εξαρτώμενες της αλληλουχίας, που κατηγοριοποιούνται σε: i. ολιγονουκλεοτιδικές και ii. βασισμένες σε γονίδιο. B. σε μικροσυστοιχίες ανεξάρτητες της αλληλουχίας: i. Diversity Arrays Technology (DArT), ii. Subtracted Diversity Array (SDA) και iii. Suppression-Subtractive Hybridization (SSH) Array. 37

44 Βιβλιογραφική Ανασκόπηση Ο καθορισμός της γενετικής ταυτότητας με τη χρήση μικροσυστοιχιών που εξαρτώνται από την αλληλουχία είναι φθηνή και ταχεία διαδικασία η οποία εφαρμόζεται σε είδη όπου υπάρχουν γνωστές αλληλουχίες στις βάσεις δεδομένων. Στις ολιγονουκλεοτιδικές μικροσυστοιχίες οι ανιχνευτές προέρχονται είτε από κωδική είτε από μη-κωδική περιοχή του γονιδιώματος. Η μικροσυστοιχία μπορεί να περιλαμβάνει ανιχνευτές από εκατοντάδες είδη και ο υβριδισμός με την αντίστοιχη αλληλουχία του στόχου γίνεται κάτω από πολύ αυστηρές συνθήκες. Ο υβριδισμός στη συνέχεια ποσοτικοποιείται για τον καθορισμό της σχετικής αφθονίας των χαρακτηριστικών του είδους αλληλουχιών στη μικροσυστοιχία (Niu et al., 2011). Η βασισμένη σε γονίδιο μικροσυστοιχία είναι παρόμοια με την ολιγονουκλεοτιδική, με τη διαφορά ότι η πρώτη περιλαμβάνει μοναδικές αλληλουχίες από κωδικές περιοχές (π.χ. αλληλουχίες ITS, που είναι συνήθως χαρακτηριστικές για κάθε είδος) και το μέγεθος του ανιχνευτή μπορεί να φτάσει ακόμα και εκείνο ολόκληρου γονιδίου. Η τεχνική αυτή είναι περισσότερο ακριβής, σε σχέση με τις ολιγονουκλεοτιδικές μικροσυστοιχίες, μιας και που ο ανιχνευτής είναι μεγαλύτερου μεγέθους τμήμα DNA (Niu et al., 2011). Μια από τις πιο πρόσφατα ανεπτυγμένες τεχνικές αποτελεί η DArT. Επιτρέπει τον ταυτόχρονο προσδιορισμό πολλών εκατοντάδων πολυμορφικών θέσεων, διασπαρμένων στο γονιδίωμα (Jaccoud et al., 2001, Wenzl et al., 2004). Η τεχνική μοιάζει με εκείνη των AFLPs, αλλά για την ανίχνευση του πολυμορφισμού δε βασιζόμαστε στην ανάλυση ζωνών σε πηκτή, αλλά στον υβριδισμό του στόχου με τους ανιχνευτές (Vos et al., 1995), οι οποίοι προέρχονται από κλωνοποίηση των προϊόντων της PCR σε φορείς. Με αυτόν τον τρόπο είναι εφικτός ο καθορισμός της γενετικής ταυτότητας οποιουδήποτε οργανισμού ή ομάδας οργανισμών από τη συλλογή γονιδιώματος βάσει της οποίας δημιουργήθηκε η μικροσυστοιχία (Xie et al., 2006). Οι δείκτες DArT είναι κυρίαρχοι (υβριδισμός ή όχι με συγκεκριμένο τμήμα DNA) ή δίνουν ποικίλη ένταση σήματος υβριδισμού για διαφορετικά άτομα, γεγονός που περιορίζει την αξία τους σε κάποιες εφαρμογές (Niu et al., 2011).. Στα πλεονεκτήματα της μεθόδου συγκαταλέγονται η ταχύτητα, η υψηλή επαναληψιμότητα και η μεγαλύτερη απόδοση κόστους σε σχέση με τα SSRs (Xia et al., 2005). Μειονεκτεί στο ότι έχει αυξημένες απαιτήσεις σε εργασία και δεξιότητες, καθώς και σε εξειδικευμένο πρόγραμμα, άρα και το κόστος της επένδυσης είναι σχετικά υψηλό (Semagn et al., 2006). Εξαιτίας του τρόπου με τον οποίο δημιουργείται η μικροσυστοιχία, παραμένει σε αυτή μεγάλος αριθμός ομόλογων/μονομορφικών αλληλουχιών, που επηρεάζει σημαντικά το ανιχνεύσιμο επίπεδο πολυμορφισμού (Li et al., 2006). Για τη δημιουργία μικροσυστοιχίας με τη μέθοδο SSH συγκεντρώνονται ανά ζεύγη ειδών τα αφαιρετικά (διαφορετικά) τμήματα του είδους «δοκιμαστή» (tester) που δεν εντοπίζονται στο είδος «οδηγό» (driver). Τα τμήματα αυτά ενισχύονται και δημιουργούνται οι αντίστοιχοι κλώνοι που θα αποτελέσουν τους ανιχνευτές της μικροσυστοιχίας (Niu et al., 2011). Με αυτόν τον τρόπο, σαρώνονται τα χαρακτηριστικά τμήματα κάθε είδους, τα οποία 38

45 Βιβλιογραφική Ανασκόπηση χρησιμοποιούνται ως ανιχνευτές για το είδος (Li et al., 2006). Η αναλογία οδηγούδοκιμαστή είναι σημαντική κατά τη δημιουργία της συστοιχίας, καθότι υπάρχουν ακόμα και μαθηματικά μοντέλα που υποστηρίζουν ότι αυξανομένης της αναλογίας επιτυγχάνεται η απομάκρυνση υψηλά και μερικώς ομόλογων αλληλουχιών μεταξύ δοκιμαστή και οδηγού και ο εμπλουτισμός με αυτόν τον τρόπο των χαρακτηριστικών για το είδος αλληλουχιών στη μικροσυστοιχία (Gadgil et al., 2002). Τέλος, η μέθοδος SDA είναι ένα νέο είδος μικροσυστοιχίας που στηρίζεται σε μια τροποποίηση της SSH μεθόδου. Αντί να συγκεντρώνουμε τα αφαιρετικά τμήματα DNA κάθε είδους, με την ανά δύο είδη διαδικασία της SSH (Li et al., 2006), οι Jayasinghe et al. (2007) συγκέντρωσαν το γενωμικό υλικό από 49 αντιπροσωπευτικά είδη αγγειόσπερμων από το οποίο προήλθαν τα αφαιρετικά τμήματα με την ίδια διαδικασία, από τη συλλογή 5 αντιπροσωπευτικών μη-αγγειόσπερμων ειδών. Έτσι, αποτυπώθηκαν στη μικροσυστοιχία τα θραύσματα-ανιχνευτές αγγειόσπερμων ειδών. Όπως είναι φυσικό, η μέθοδος αυτή είναι κατάλληλη για το διαχωρισμό ειδών που είναι αρκετά απομακρυσμένα (ανήκουν σε διαφορετικούς κλάδους ή τάξεις) και δείχνει μικρότερο πολυμορφισμό για στενά συγγενικά είδη (Niu et al., 2009). II.9 Οι Universal Rice Primers (URP) Σε αυτό το ξεχωριστό κεφάλαιο θα αναφερθούμε στους μοριακούς δείκτες που χρησιμοποιήθηκαν στην παρούσα διατριβή. Είναι γνωστό πως οι επαναλαμβανόμενες DNA αλληλουχίες εμπλέκονται στην επαναδιάταξη του γονιδιώματος, όπως στις ελλείψεις, αναστροφές ή ανασυνδυασμούς (Deumling, 1981, Grellet et al., 1986, Dhar et al., 1988, Ohmido et al., 2000). Τα μεταθετά στοιχεία (transposable elements-tes) έχουν βρεθεί ως επαναλαμβανόμενες ακολουθίες, έχοντας σημαντικό ρόλο στη δομή, παραλλακτικότητα και εξελικτική προσαρμογή του γονιδιώματος (McClintock, 1984, McDonald, 1995). Τα TEs διακρίνονται σε δύο κατηγορίες, ανάλογα το μηχανισμό μεταφοράς τους, την ομάδα Ι όπου ανήκουν τα ρετρομεταθετά στοιχεία και την ομάδα ΙΙ που τα μέλη της χαρακτηρίζονται από τελικές ανεστραμμένες επαναλήψεις αλληλουχιών (terminal inverted-repeats-tirs). Κάποια μέλη υπεροικογενειών της ομάδας ΙΙ έχουν σημαντική θετική συσχέτιση με το ρυθμό ανασυνδυασμού και τη γονιδιακή πυκνότητα (Matsumoto et al., 2005). Στο γονιδίωμα του ρυζιού περιλαμβάνονται ρετρομεταθετά στοιχεία, αλλά και μεταθετά στοιχεία της ομάδας ΙΙ, όπως η υπεροικογένεια των CACTA μεταθετών στοιχείων (Kang and Kang, 2008). Η υπεροικογένεια CACTA πήρε το όνομά της από το συντηρημένο μοτίβο στο οποίο λήγουν οι ανεστραμμένες επαναλήψεις που οριοθετούν τα στοιχεία και χαρακτηρίζεται από υψηλό αριθμό αντιγράφων (Wicker et al., 2003). Ο κλώνος pkrd απομονώθηκε από τη γονιδιακή βιβλιοθήκη ενός είδους κόκκινου ρυζιού και μελετήθηκαν τα μοριακά του χαρακτηριστικά σε προηγούμενη μελέτη (Kang et al., 1997). 39

46 Βιβλιογραφική Ανασκόπηση Για την αλληλουχία του pkrd (Εικόνα 9) οι Kang and Kang το 2008 έδειξαν πως πρόκειται ίσως για ένα νέο και ενεργό μεταθετό στοιχείο της οικογένειας CACTA που παρουσιάζει 94% ομολογία με τα En/Spm (Enhancer/Suppressor mutator) στοιχεία του ιαπωνικού τύπου ρυζιού. Η En/Spm οικογένεια αποτελείται κυρίως από μη αυτόνομα στοιχεία, τα οποία προήλθαν από τα αυτόνομα (ενεργά, που κωδικοποιούν για το ένζυμο της τρανσποζάσης), εξελίχθηκαν περαιτέρω και διαφοροποιήθηκαν μεταξύ τους (Wicker et al., 2003). Η pkrd αλληλουχία φαίνεται να βρίσκεται αποκλειστικά στα γονιδιώματα των ειδών Oryza, σε διάφορες επαναλήψεις. Στο γονιδίωμα του ρυζιού ιαπωνικού τύπου εντοπίζονται 126 διαφορετικές περιοχές ομολογίας του pkrd, ομοιόμορφα κατανεμημένες και στα 12 χρωμοσώματά του. Η pkrd αλληλουχία ακολουθεί την κατανομή των μεταθετών στοιχείων που αναφέρεται από τους Matsumoto et al. (2005). Εικόνα 9: Η νουκλεοτιδική αλληλουχία του pkrd των bp (Kang and Kang, 2008), με σημειωμένους τους URP. Με κίτρινη επισήμανση είναι οι forward primers, ενώ με κόκκινο φόντο και περίγραμμα, οι reverse complement primers. Οι αλληλεπικαλύψεις τους αντιπροσωπεύονται με γκρι επισήμανση και με πράσινο φόντο αντίστοιχα. Οι εκκινητές URP που δημιουργήθηκαν από τους Kang et al. (2002), με σκοπό να χρησιμοποιηθούν στον καθορισμό γενετικών προφίλ, βασίστηκαν στην επαναλαμβανόμενη αλληλουχία pkrd. Γενικά, η εφαρμογή εκκινητών που ενισχύουν τις περιοχές οι οποίες παρεμβάλλονται σε επαναλαμβανόμενα στοιχεία περιορίζεται στα ζωικά ή φυτικά είδη ή μικροοργανισμούς που διατηρούν τα συγκεκριμένα στοιχεία. Στην περίπτωση του pkrd, λόγω απουσίας καθορισμένων επαναλαμβανόμενων στοιχείων (π.χ. μικροδορυφόρων) που χρησιμοποιούνται συνήθως στο σχεδιασμό τέτοιων εκκινητών, επιχειρήθηκε ο τυχαίος σχεδιασμός τους, χρησιμοποιώντας ολόκληρη την επαναλαμβανόμενη ακολουθία. Έτσι, εντοπίστηκαν διάσπαρτα στο γονιδίωμα του ρυζιού ομόλογα των εκκινητών ολιγονουκλεοτίδια. Οι Xiong et al., (2013) επισημαίνουν το διαχωρισμό των URP από τους DAMD εκκινητές, όσον αφορά στο σχεδιασμό τους, στο ότι οι μεν πρώτοι προήλθαν από 40

47 Βιβλιογραφική Ανασκόπηση ένα στοιχείο DNA που βρίσκεται σε διάσπαρτα αντίγραφα, ενώ οι DAMD (βλ. παράγραφο Ι.8.12) από μια περιοχή του DNA με διαδοχικές επαναλήψεις. Από τους 40 εκκινητές που δημιουργήθηκαν από τους Kang et al. (2002), οι 12 έδωσαν πολυμορφικές ζώνες σε μια ποικιλία δειγμάτων φυτικού, ζωικού και μικροβιακού DNA και για αυτό το λόγο, ονομάστηκαν Universal Rice Primers (URP). Μέσω του ελέγχου για παρόμοιες αλληλουχίες στην GenBank (Blast Search) βρέθηκε ομολογία για πάνω από 15 βάσεις των 12 URP εκκινητών σε διάφορα γονιδιώματα. Επομένως, είναι λογικό να υποθέσουμε πως οι ομόλογες αυτές ακολουθίες βρίσκονται σε διάσπαρτες επαναλήψεις στα διάφορα γονιδιώματα και σε θέσεις που πιθανόν να έχουν έναν κρίσιμο εξελικτικό ρόλο στη διαφοροποίηση των ειδών. Οι ζώνες που εντοπίστηκαν σε όλα τα ευκαρυωτικά είδη που αναλύθηκαν, ποικίλουν σε μέγεθος, από 100 bp μέχρι άνω των 3000 bp. Οι εύκολα διακριτές ζώνες που παρατηρήθηκαν, κυμαίνονταν σε πλήθος από 4 έως 14. Από τα αποτελέσματα που πήραν οι Kang et al. το 2002 στους διάφορους τύπους ρυζιού, αλλά και από άλλες μελέτες στο κρεμμύδι και το αχλάδι (Kim et al., 2001, Oh et al., 2001), συμπεραίνεται πως η μέθοδος URP-PCR έχει τη δυνατότητα ανίχνευσης γενετικής παραλλακτικότητας μεταξύ ειδών, ποικιλιών, ακόμα και ατόμων στα φυτικά είδη. Επομένως, είναι χρήσιμη στην ταξινομική και φυλογενετική ανάλυση, ακόμα και στο γενοτυπικό έλεγχο ατόμων σε ένα πληθυσμό, ειδικά σε ενδο- και διειδικό επίπεδο. Υπήρξαν κάποιες εργασίες στις οποίες επιχειρήθηκε σύγκριση μεθόδων, όσον αφορά στην ικανότητα ανάδειξης της γενετικής παραλλακτικότητας. Σε σχέση με τους SSRs και RAPDs που χρησιμοποιήθηκαν για τη διάκριση καλλιεργούμενων και άγριων γενοτύπων του γένους Vigna, οι URP εκκινητές αποδεικνύονται καλύτεροι, πιο εξειδικευμένοι και εύρρωστοι (Dikshit et al., 2007), ενώ οι Xiong et al., (2013) για την αραχίδα (Arachis hypogaea) έκριναν αποτελεσματικότερη τη μέθοδο των URP, σε σχέση με τους DAMD, όπου οι URP εκκινητές παρήγαν το υψηλότερο ποσοστό πολυμορφισμού. Η αξιοποίηση των URP εκκινητών σε είδη της οικογένειας Lamiaceae αναλύεται μεταξύ άλλων στην αμέσως επόμενη παράγραφο, ενώ οι αλληλουχίες τους καταγράφονται στα «Υλικά και Μέθοδοι». II.10 Εφαρμογή μοριακών δεικτών στην οικογένεια Lamiaceae και στο γένος Sideritis Η καταγωγή, η συστηματική ταξινόμηση και τα εξελικτικά μονοπάτια που ακολούθησαν τα διάφορα είδη της οικογένειας Lamiaceae απασχολούν αρκετά μέχρι και σήμερα τους επιστήμονες. Ο έντονος υβριδισμός και η δυσκολία διάκρισης που χαρακτηρίζει κάποια από αυτά, έχουν ως αποτέλεσμα τη δυσχέρεια αξιολόγησης και εμπορικής αξιοποίησης του διαθέσιμου γενετικού υλικού. Αυτή η εκδήλωση ενδιαφέροντος αυξάνεται λόγω της ανάγκης διατήρησης της βιοποικιλότητας, ειδικά σε γεωγραφικές περιοχές που θεωρούνται 41

48 Βιβλιογραφική Ανασκόπηση «θερμές» (hotspots). Αναρίθμητα μέλη της οικογένειας Lamiaceae υπόκεινται σε μεγάλη πίεση επιλογής, λόγω της συλλογής για εμπορικούς σκοπούς. Η διαλεύκανση αυτών των θεμάτων επιχειρήθηκε αρχικά με περισσότερο κλασικές μεθόδους, όπως καρυολογικές, παλυνολογικές, μορφολογικές, τις οποίες συμπλήρωσαν αργότερα τα αποτελέσματα των αναλύσεων της χημικής σύστασης των αιθερίων ελαίων. Στη συνέχεια, δοκιμάστηκαν οι μοριακοί δείκτες, ξεκινώντας από τους χλωροπλαστικούς, τις αλληλουχίες ITS και τα ισοένζυμα και φτάνοντας μέχρι τα RAPDs, ISSRs, SSRs, τις μικροσυστοιχίες και το barcoding. Στην περίπτωση των φαρμακευτικών φυτών, οι αναλύσεις που βασίζονται στο DNA έχει αρκετές προκλήσεις, μιας και που δεν αποτελούν φυτά-μοντέλα, το μέγεθος του γονιδιώματός τους είναι συνήθως άγνωστο και δεν υπάρχουν διαθέσιμες τεχνικές βασισμένες στους μοριακούς δείκτες για τη βελτίωσή τους (Canter et al., 2005). Οι χλωροπλαστικές και ITS περιοχές δεν παρουσιάζουν πάντα πολυμορφισμό μεταξύ αρκετά συγγενικών ειδών και επιπρόσθετα, είναι σχεδόν απίθανο να συσχετιστούν με κάποιο γονίδιο που ευθύνεται για ένα επιθυμητό γνώρισμα αγρονομικού ενδιαφέροντος, καθότι τα γονίδια αυτά κυρίως εδράζουν στον πυρήνα. Επομένως, είναι φανερή η ανάγκη για δημιουργία γενετικών δεικτών που δεν θα ήταν χρήσιμοι μόνο στην ακριβή ταυτοποίηση στενά συγγενικών ειδών, αλλά που θα μπορούσαν να συσχετιστούν με επιθυμητά χαρακτηριστικά (Olarte et al., 2013). Παρότι η οικογένεια Lamiaceae και ειδικά το γένος Sideritis έχουν μελετηθεί ελάχιστα με βάση τους μοριακούς δείκτες, σε σχέση με τα καλλιεργούμενα είδη κυρίως, εντούτοις, οι μοριακοί δείκτες αποδείχθηκαν πολύτιμα εργαλεία ανάλυσης, επιβεβαιώνοντας αρκετές φορές τα αποτελέσματα των κλασικών μεθόδων και παρέχοντας πολλή περισσότερη πληροφορία. Αναφορικά με τα είδη Sideritis, η πλειοψηφία των εργασιών στρέφεται στα είδη της Ιβηρικής Χερσονήσου και των Καναρίων Νήσων. Οι Κανάριες Νήσοι θεωρούνται ένα από τα hotspots της βιοποικιλότητας, με μεγάλο ποσοστό ενδημικών φυτικών ειδών (Santiago-Valentín and Francisco-Ortega, 2008). Αξίζει να σημειωθεί πως στη βιβλιογραφία η πλειοψηφία των αναλύσεων των μοριακών δεικτών για τα είδη Sideritis τουλάχιστον, δεν αφορούσε ατομικά φυτά. Πέραν από την ανασκόπηση για το γένος Sideritis, θα αναφερθούμε στη χρήση των URP εκκινητών, καθώς και σε κάποιες από τις πιο πρόσφατες και καινοτόμες εφαρμογές μοριακών δεικτών σε άλλα είδη Lamiaceae. Οι Fernández-Peralta και González-Aguilera (1984) εργάστηκαν πάνω σε πληθυσμoύς δύο διαφορετικών, αλλά στενά συγγενικών μορφολογικά ειδών, των S. saetabensis και S. tragoriganum. Ο καρυότυπος και το πρωτεϊνικό προφίλ σπερμάτων με τη χρήση κάθετης ηλεκτροφόρησης πηκτής SDS-πολυακριλαμίδης διαφοροποίησαν τα είδη και λαμβάνοντας υπόψη τη διαπληθυσμιακή παραλλακτικότητα στον καρυότυπο του είδους S. saetabensis, από προηγούμενη μελέτη των Fernández-Peralta et al. (1983), ώθησε τους συγγραφείς στο συμπέρασμα της ύπαρξης μιας ομάδας στενά συνδεδεμένων πληθυσμών που υφίστανται σταδιακή εγκατάσταση μηχανισμών απομόνωσης και αρχόμενη ειδογένεση. 42

49 Βιβλιογραφική Ανασκόπηση Οι ίδιοι το 1986 συμπέραναν για τις φυλογενετικές σχέσεις έξι στενά συνδεδεμένων ειδών που αποτελούν την ομάδα του Sideritis leucantha. Οι παράμετροι που μελετήθηκαν σε πληθυσμούς αυτών των ειδών ήταν η μειωτική συμπεριφορά, ο καρυότυπος, το μέγεθος και η γονιμότητα της γύρης, η ποσότητα του DNA και το πρωτεϊνικό προφίλ. Οι δείκτες ομοιότητας στο πρωτεϊνικό επίπεδο είναι οι υψηλότεροι που έχουν βρεθεί στο Sideritis και ενίοτε, υψηλότεροι από εκείνους μεταξύ πληθυσμών διαφορετικών γεωγραφικών περιοχών του ίδιου είδους. Αυτή η παρατήρηση συμφωνεί με την άποψη διαφόρων συστηματικών ότι αυτά τα είδη αποτελούν μια ομάδα μέσα στο γένος. Η διαφοροποίηση τους θα μπορούσε να οφείλεται στη δυσπλοειδία και την επαναδιάταξη χρωμοσωμάτων ενός κοινού προγόνου. Οι Las Heras Vasquez et al. (1999), μελέτησαν τις γενετικές σχέσεις και τη δομή πληθυσμών διάφορων υποειδών (ομάδων) του S. pusilla, χρησιμοποιώντας δείκτες RAPD. Το S. pusilla θεωρείται παραλλαγή του S. leucantha, ενώ για κάποιους ερευνητές οι σημαντικές διαφορές που έχει στη μορφολογία, όπως και στις βιογεωγραφικές και οικολογικές παραμέτρους, σε σχέση με τα συγγενικά του είδη S. hirsuta και S. leucantha, το καθιστούν πραγματικό είδος, παρόλο που τα κοινά χαρακτηριστικά που έχει με τα παραπάνω είδη μαρτυρούν κοινή προέλευση. Ακολουθήθηκαν δυο διαφορετικές προσεγγίσεις κατά τη δειγματοληψία. Η «πληθυσμιακή μελέτη», όπου δημιουργείται ένα αντιπροσωπευτικό προφίλ για κάθε πληθυσμό, με τη συγκέντρωση γενετικού υλικού ενός αριθμού ατόμων και η «ατομική μελέτη», όπου εξετάστηκε ένας αριθμός ατομικών δειγμάτων κάποιων πληθυσμών. Η γενετική δομή των πληθυσμών μελετήθηκε μέσω της στατιστικής ανάλυσης της μοριακής παραλλακτικότητας (AMOVA), που αναπτύχθηκε από τους Excoffier, Smouse και Quatro (1992), βασιζόμενη εκ των προτέρων σε ταξινομικά και γεωγραφικά κριτήρια, για να διαχωριστεί η γενετική παραλλακτικότητα σε τρία επίπεδα: μεταξύ των ομάδων των πληθυσμών του S. pusilla, μεταξύ των πληθυσμών εντός της ομάδας και μεταξύ ατόμων εντός πληθυσμού. Με την τεχνική αυτή ελέγχεται η μηδενική υπόθεση της παμμειξίας των ομάδων. Αν οι μοριακοί χαρακτήρες διαφέρουν σημαντικά μεταξύ των ομάδων, αυτή η υπόθεση απορρίπτεται. Χρησιμοποιήθηκε επίσης η HOMOVA για να ελεγχθεί αν η ετερογένεια της μοριακής παραλλακτικότητας ήταν στατιστικά σημαντική μεταξύ των πληθυσμών. Τα αποτελέσματα της ανάλυσης έδειξαν πως το S. pusilla διαφοροποιείτο σημαντικά από τα S. hirsuta και S. leucantha, που θεωρούνται πρόγονοί του. Όσον αφορά στις σχέσεις μεταξύ των πληθυσμών του S. pusilla, τα αποτελέσματα είναι συμβατά με την αρχική συστηματική προσέγγιση, όπου προτείνονται 3 ομάδες στο επίπεδο του υποείδους, με γενετικές αποστάσεις οι οποίες δε συσχετίζονται ιδιαίτερα με τις γεωγραφικές. Ακόμα και η περίπτωση του υποείδους S. pusilla ssp. osteoxylla, που πολλοί το θεωρούν ξεχωριστό είδος, σύμφωνα με τα γενετικά δεδομένα, κατατάσσεται σε επίπεδο υποείδους. 43

50 Βιβλιογραφική Ανασκόπηση Το μεγαλύτερο ποσοστό παραλλακτικότητας παρατηρήθηκε εντός των πληθυσμών και το μικρότερο μεταξύ των ομάδων, γεγονός αναμενόμενο για ένα σταυρογονιμοποιούμενο είδος. Η ετερογένεια της παραλλακτικότητας, όπως υπολογίζεται από το δείκτη του Bartlett, διέφερε μεταξύ των ομάδων, εξαιτίας της πολύ μικρότερης παραλλακτικότητας των πληθυσμών της ομάδας osteoxylla που πιθανώς αποδίδεται στην πρόσφατη εγκατάστασή τους με ελάχιστο αριθμό ιδρυτικών ατόμων. Γενικά, οι πληθυσμοί με μειωμένη γενετική παραλλακτικότητα είναι λιγότερο ευέλικτοι στις περιβαλλοντικές προκλήσεις κι έτσι δικαιολογημένα χαρακτηρίζεται το συγκεκριμένο υποείδος «υπό εξαφάνιση», λόγω και της περιορισμένης περιοχής εξάπλωσής του (Gómez Campo, 1987). Οι Barber et al. (2000) προκειμένου να διαλευκάνουν την εξέλιξη των ειδών του υπογένους Marrubiastrum, χρησιμοποίησαν την RFLP τεχνική σε χλωροπλαστικό DNA, όπου και διαπίστωσαν την παρουσία υβριδισμού. Επιπλέον, παρατήρησαν πως σε σχέση με τα ηπειρωτικά είδη, εκείνα που ανήκουν στο υπογένος Marrubiastrum εμφανίζουν υψηλό χρωμοσωμικό αριθμό και αυξημένο ρυθμό χρωμοσωμικών αλλαγών και αναφέρουν μεταξύ άλλων τη διαφοροποίηση των επαναλαμβανόμενων στοιχείων στο σχήμα της αλληλουχίας και τον αριθμό των αντιγράφων ως παράγοντα που πιθανώς συνεισφέρει στις χρωμοσωμικές αλλαγές και τελικά στην εξέλιξη του γονιδιώματος ακόμα και μεταξύ πολύ στενά συγγενικών ειδών. Η ίδια σχεδόν ομάδα το 2002 κατασκεύασε φυλογενετικά δένδρα για τα διάφορα είδη Sideritis, με βάση δεδομένα είτε από χλωροπλαστικούς δείκτες (trnl intron, περιοχή trnttrnl) είτε από την ITS περιοχή είτε από το συνδυασμό τους. Οι ατομικές, αλλά και οι συνδυασμένες αναλύσεις επιβεβαιώνουν τη γεωγραφική διάκριση των ειδών στα sections Sideritis και Empedoclea και την κατάταξη των νησιωτικών ειδών του αρχιπελάγους της Μαδέρας στο υπογένος Marrubiastrum. Στην εκτεταμένη μελέτη των Barber et al. (2007) πάνω στη φυλογένεια των νησιωτικών ειδών Sideritis, πάλι με χλωροπλαστικούς δείκτες και την περιοχή ITS, παρατηρήθηκε ασυμφωνία των φυλογενετικών σχέσεων που προέκυπταν από κάθε μεμονωμένη ομάδα δεδομένων. Αυτή η ασυμφωνία ίσως οφείλεται στον υβριδισμό και την πιθανή ανάμειξη του χλωροπλαστικού γενετικού υλικού μεταξύ των ειδών, που σχετίζεται με γεωγραφική παράμετρο, εν αντιθέσει με τις αλληλουχίες ITS που δεν έδειξαν ετερογένεια στα θεωρητικά υβρίδια, πράγμα που σημαίνει ή ότι έχει περάσει αρκετός χρόνος και επήλθε μια ισορροπία στις γονεϊκές ITS αλληλουχίες ή ότι δεν υπήρχε διαφοροποίηση μεταξύ των γονεϊκών ομάδων πριν τον υβριδισμό. Ο υβριδισμός μάλλον αποδίδεται σε ανθρωπογενή αίτια που είχαν ως συνέπεια την διατάραξη των γεωγραφικών απομονωτικών φραγμών. Οι Cinar et al εφάρμοσαν για πρώτη φορά την τεχνική DAMD-PCR σε 8 είδη Sideritis sect. Empedoclea από την Τουρκία, χρησιμοποιώντας URP εκκινητές. Η τεχνική των SSR, παρότι πολλά υποσχόμενη, δεν ενδείκνυται στα συγκεκριμένα είδη, λόγω έλλειψης κατάλληλων εκκινητών. Οι URP εκκινητές επιβεβαίωσαν την καθολικότητά τους, παρουσίασαν υψηλή επαναληψιμότητα εντός και μεταξύ των PCR, αλλά και ανεξάρτητα από τη μέθοδο που χρησιμοποιήθηκε για την απομόνωση του DNA, καθώς και υψηλό 44

51 Βιβλιογραφική Ανασκόπηση βαθμό πολυμορφισμού, ο οποίος εκφράστηκε μέσω των τιμών PIC (Polymorphism Information Content). Για την οπτικοποίηση των σχέσεων μεταξύ των ειδών Sideritis χρησιμοποιήθηκαν η πολυπαραγοντική ανάλυση διασποράς, η ανάλυση κύριων συντεταγμένων (principle coordinate analysis) και η UPGMA μέθοδος. Όλα τα είδη φαίνεται να διακρίνονται μεταξύ τους και τα αποτελέσματα επιβεβαίωσαν την κλασική συστηματική που βασίζεται σε μορφολογικά χαρακτηριστικά (Davis, 1982), επομένως συμπεραίνεται ότι η DAMD-PCR τεχνική μπορεί να χρησιμοποιηθεί με ασφάλεια για τη διάκριση και ταυτοποίηση των ειδών Sideritis, ειδικά στις περιπτώσεις που είναι πολύ δύσκολο να διακριθούν μορφολογικά, λόγω έλλειψης παραλλακτικότητας. Οι μορφολογικές ομοιότητες και ο υβριδισμός που παρατηρείται στα είδη Salvia οδηγούν στη χρήση μοριακών δεικτών για την ταυτοποίησή τους. Οι Karaca et al. (2008), συνέλεξαν για κάθε ένα από τα είδη Salvia που θα μελετούσαν υλικό από τρεις διαφορετικές περιοχές και για κάθε είδος και περιοχή δημιούργησαν αντιπροσωπευτικό δείγμα αποτελούμενο από έναν αριθμό ατομικών φυτών. Χρησιμοποίησαν PCR-RFLP για την αναγνώριση εξειδικευμένων χλωροπλαστικών και μιτοχονδριακών δεικτών από ένα σύνολο εκκινητών που είχαν εξετάσει πριν σε άλλα είδη και είχαν δώσει πολυμορφισμό. Διαπιστώθηκε πως το χλωροπλαστικό γονιδίωμα διέφερε αρκετά μεταξύ των ειδών Salvia, σε σχέση με το μιτοχονδριακό και μάλιστα τα προϊόντα PCR των εκκινητών trnh-psba δε χρειάστηκε καν να υποστούν πέψη, προκειμένου να δώσουν πολυμορφικές ζώνες. Καθότι και στην περίπτωση του γένους Salvia η εφαρμογή της τεχνικής των SSR, παρότι καταλληλότερη, ήταν περιορισμένη, λόγω της έλλειψης κατάλληλων εκκινητών, η ερευνητική ομάδα εφάρμοσε επιπλέον DAMD-PCR, χρησιμοποιώντας τους 12 URP εκκινητές των Kang et al. (2002), οι οποίοι λειτούργησαν σε όλα τα είδη, με υψηλή επαναληψιμότητα. Τα αποτελέσματα των DAMD-PCR και RFLP-PCR τεχνικών συνδυάστηκαν, έτσι ώστε να υπάρχει μια απεικόνιση τόσο του πυρηνικού γονιδιώματος, όσο και του μιτοχονδριακού και χλωροπλαστικού για την τελική ανάλυση (Demesure et al., 1995, Karaca et al., 2002, Walker at al., 2004, Walker and Sytsma, 2007). Χρησιμοποιήθηκαν η πολυπαραγοντική ανάλυση διασποράς, η ανάλυση κύριων συντεταγμένων και η UPGMA μέθοδος για την κατασκευή των φυλογενετικών δένδρων. Όλα τα είδη δεν έδειξαν να διαφοροποιούνται ιδιαίτερα μεταξύ των περιοχών, με εξαίρεση δύο που στα αντίστοιχα δείγματά τους περιλαμβάνονταν υποείδη ή πολύ διαφορετικές συλλογές. Οι γενετικές σχέσεις που προέκυψαν από τα συνδυασμένα δεδομένα των δύο τεχνικών ήταν περισσότερο αξιόπιστες, σε σχέση με τα μεμονωμένα, λόγω υψηλότερων bootstrap τιμών (Bertea et al., 2006) και μάλιστα ίσως στη μεγαλύτερη αξιοπιστία των συνδυασμένων αποτελεσμάτων εύρρωστων τεχνικών με εξειδικευμένους δείκτες αποδίδεται η παρατηρούμενη συσχέτιση των αποδόσεων σε αιθέρια έλαια των ειδών Salvia με τους δείκτες γενετικής ομοιότητάς τους. 45

52 Βιβλιογραφική Ανασκόπηση Τελευταία, η τεχνολογία της PCR πραγματικού χρόνου (real-time PCR), σε συνδυασμό με την υψηλή ανάλυση της τήξης του DNA (High Resolution DNA Melting- HRM), που αρχικά, χρησιμοποιήθηκε κυρίως στη Γενετική του Ανθρώπου γίνεται όλο και πιο διαδεδομένη για διάφορες εφαρμογές και στα φυτά (MacKay et al., 2008, Wu et al., 2008, Donini et al., 2009). Στην εργασία των Mader et al., 2010, συγκεντρώθηκαν 10 ατομικά φυτά από 19 πληθυσμούς του είδους S. officinalis και χρησιμοποιήθηκαν διαθέσιμα ESTs του συγγενούς είδους S. fruticosa. Σκοπός, η εύρεση πιθανών θέσεων SNPs, που ικανοποιούν το κριτήριο της ύπαρξης παρεμφερών αλληλουχιών σε άλλα μέλη της οικογένειας Lamiaceae, που θα αφορούν ταυτόχρονα σε γονίδια του δευτερογενούς μεταβολισμού (ώστε να αυξηθούν οι πιθανότητες για εντοπισμό πολυμορφισμών και για να αποτελέσουν βάση για μελλοντική έρευνα). Ταυτοποιήθηκαν πολυμορφικές θέσεις και συντηρημένες περιοχές και κατασκευάστηκαν εκκινητές, που ενισχύουν PCR προϊόν με μέγεθος κατάλληλο για την ανίχνευση SNPs από την HRM. Παράλληλα, εντοπίστηκαν και 3 SSRs. Γενικά, οι πληροφορίες που δίνουν οι δείκτες SNP είναι λιγότερες από εκείνες των SSR, για το λόγο ότι έχουν μόνο δύο αλληλόμορφα συνήθως, αλλά στη συγκεκριμένη μελέτη με την HRM έδωσαν μέχρι και 5 διαφορετικά αλληλόμορφα. Οι HRM δείκτες μπορεί να περιέχουν περισσότερους από έναν SNP, ή ακόμα και συνδυασμό SNPs, SSRs και ενθέσεων/ελλείψεων. Τα δε συμπεράσματα για τις γενετικές σχέσεις των πληθυσμών που προέκυψαν από την ανάλυση τείνουν να συμφωνήσουν σε πολλά με τις φυτοχημικές αναλύσεις που διενεργήθηκαν στα ίδια δείγματα (Lamien-Meda et al., 2010). Οι Olarte et al. (2013) δημιούργησαν μια SDA μικροσυστοιχία, με σκοπό να ταυτοποιήσουν διάφορα είδη του γένους Salvia με οικονομική σημασία. Ακολούθησαν τη διαδικασία SSH μεταξύ μιας συλλογής ειδών Salvia και μιας συλλογής αγγειόσπερμων και μη-αγγειόσπερμων ειδών, ώστε να απομονωθούν οι χαρακτηριστικές του γένους αλληλουχίες DNA. Στη συλλογή του «οδηγού» δεν συμπεριέλαβαν είδη της οικογένειας Lamiaceae, για να αποφευχθεί το σφάλμα της απώλειας χρήσιμων αλληλουχιών, που θα είχε ως συνέπεια τη μείωση του πολυμορφισμού. Για την ανάλυση των αποτελεσμάτων χρησιμοποιήθηκαν τα αρχικά μη-επεξεργασμένα δεδομένα σήματος. Το γένος Salvia περιλαμβάνει σταυρογονιμοποιούμενα είδη, που παράγουν ποικίλο ή ενδιάμεσο σήμα είτε λόγω του αυξανομένου ποσοστού ετεροζυγωτίας τους είτε εξαιτίας του γεγονότος ότι πρόκειται για είδη του ίδιου γένους και επομένως έχουν κοινές αλληλουχίες, που διαφοροποιούνται σε ποσοστό λιγότερο από 10%. Η επεξεργασία των δυαδικών δεδομένων που χρησιμοποιούνται συνήθως στις μικροσυστοιχίες, τα οποία προκύπτουν βάσει της αναλογίας σήμα:θόρυβος, θα περιπλεκόταν στην περίπτωση αυτή. Η μικροσυστοιχία αυτή ήταν δυνατό να διακρίνει συγγενικά είδη με μεγάλες μορφολογικές ομοιότητες και να ανιχνεύσει πιθανή νοθεία σε εμπορικά προϊόντα, καθώς και να φανερώσει γενετικές σχέσεις, που συμφωνούν με τη γεωγραφική προέλευση. 46

53 Βιβλιογραφική Ανασκόπηση Διαπιστώθηκε τέλος πως υπάρχει η δυνατότητα κατασκευής SDA μικροσυστοιχίας με βάση κάποια αντιπροσωπευτικά είδη, αντί για όλα τα μέλη της υπό εξέταση ομάδας και να αναγνωριστεί οποιοδήποτε είδος που ανήκει π.χ. σε ένα ευρύ γένος. Η χρήση EST-SSRs, αλλά και SSRs σε πολλά γένη της οικογένειας Lamiaceae είναι περιορισμένη, έτσι στην εργασία των Karaca et al. (2013) επιχειρείται η ανάπτυξη EST-SSRs εκκινητών και ο καθορισμός της δυνατότητας μεταβίβασής τους μεταξύ 12 γενών της οικογένειας Lamiaceae που φύονται στην Τουρκία, συμπεριλαμβανομένου του Sideritis. Διερευνήθηκε τέλος, αν η δυνατότητα μεταβίβασης μεταξύ γενών συνδέεται με την εξελικτική απόσταση μεταξύ των ειδών που αποτέλεσαν την πηγή των εκκινητών και των ειδών-στόχων που μελετήθηκαν. Οι δείκτες που μελετήθηκαν μπορούν να χρησιμοποιηθούν εκτός από τις παράλληλες γενετικές μελέτες διαφόρων γενών, στη συγκριτική ανάλυση της δομής πληθυσμών ενός είδους, καθώς και στη διευκόλυνση γενετικής χαρτογράφησης του γένους (Ince et al., 2010, Ince, 2012). Στην περίπτωση των ειδών που μελετήθηκαν, δεν υπήρχαν διαθέσιμα δεδομένα αλληλουχιών, ωστόσο η ανάπτυξη EST-SSRs από συγγενικά είδη μπορεί να είναι αποτελεσματική. Μάλιστα, όσο πιο συγγενικά είναι τα είδη, τόσο πιο εύκολα μεταβιβάσιμοι είναι οι συγκεκριμένοι δείκτες. Η μέθοδος του DNA barcoding είναι χρήσιμη, όχι μόνο στην ταξινόμηση και διάκριση των ειδών, αλλά και για τον έλεγχο του εμπορεύσιμου φυτικού γενετικού υλικού, συνεισφέροντας στην προστασία και τη διατήρηση της βιοποικιλότητας. Χρησιμοποιούνται μικρές περιοχές DNA, που μπορούν να ανακτηθούν ακόμα και από συλλογές ή φυτολόγια, οι οποίες συγκρίνονται με αλληλουχίες αναφοράς γνωστών οργανισμών που είναι συγκεντρωμένες σε μια βάση δεδομένων, οπότε είτε θα υπάρξει ταίριασμα και ταυτοποιείται ο άγνωστος οργανισμός, είτε προστίθεται ένα νέο barcode για ένα δεδομένο είδος. Χαρακτηρίζονται δε από επαρκή σταθερότητα, η οποία εξασφαλίζει σημαντική παραλλακτικότητα μεταξύ ειδών, μεγαλύτερη από ότι εντός του είδους, ενώ οι γειτονικές τους περιοχές είναι όσο το δυνατό πιο συντηρημένες (Kress and Erickson, 2008, Ford et al., 2009, Hollingsworth et al., 2009b). Οι μιτοχονδριακές περιοχές έχουν περιορισμένη χρήση ως universal barcodes στα φυτά, σε αντίθεση με τα ζώα. Έτσι, η έρευνα για την εύρεση των κατάλληλων αλληλουχιών εστιάστηκε στο χλωροπλαστικό γονιδίωμα, ενώ αρκετοί προτείνουν το barcode να συνδυάζει περισσότερες από μια θέσεις (Kress and Erickson, 2007, Fazekas et al., 2008, Hollingsworth et al., 2009a). Οι Theodoridis et al. (2012) βασιζόμενοι στην πρόταση των Kress et al. (2009) να περιορίζεται η εφαρμογή του barcode σε taxa που συνιστούν τη φυτοκοινωνία μιας περιοχής, λόγω της δυσκολίας ανάπτυξης universal δείκτη, μελέτησαν 48 αυτοφυή είδη Lamiaceae της Χίου και της χερσονήσου του Τσεσμέ-Καραμπορούν. Τα barcodes που επέλεξαν ήταν η συντηρημένη κωδική περιοχή rbcl, ένα τμήμα της ταχέως εξελισσόμενης κωδικής περιοχής matk και η επίσης ταχέως εξελισσόμενη μηκωδική αλληλουχία trnh-psba, που παρουσιάζει πολυμορφισμό μήκους. Τα στοιχεία αυτά 47

54 Βιβλιογραφική Ανασκόπηση ελέγχθηκαν είτε μόνα τους είτε σε συνδυασμό, ως προς: α) την επιτυχία ενίσχυσης και αλληλούχισης (καθολικότητα), β) την παραλλακτικότητα εντός και μεταξύ ειδών και γ) την ισχύ της ανάλυσης. Καταλληλότεροι δείκτες κρίθηκαν οι trnh-psba και matk, όσον αφορά στην παραλλακτικότητα εντός και μεταξύ των ειδών, αποτελέσματα που συμφωνούν με προηγούμενες μελέτες, ενώ στην πλειοψηφία τους όλα τα είδη ομαδοποιήθηκαν σε υποοικογένειες σύμφωνα με την ταξινόμηση κατά Harley et al. (2004). Προηγήθηκε η εργασία των De Mattia et al. (2011) που εστιάστηκε σε 16 καλλιεργούμενα είδη Lamiaceae για τους ίδιους δείκτες, με πολύ καλά αποτελέσματα. Οι matk και trnh-psba αξιολογήθηκαν μεταξύ άλλων ως καταλληλότεροι barcoding δείκτες μεμονωμένα είτε σε συνδυασμό για τα είδη του γένους Lamium (Krawczyk et al., 2013). Οι Tezcan et al. (2010) εξέτασαν την αποτελεσματικότητα των trnh-psba και matk barcodes στην ταυτοποίηση του ενδημικού της Τουρκίας είδους Sideritis trojana. Οι αλληλουχίες των PCR προϊόντων συγκρίθηκαν με έναν αριθμό αντίστοιχων αλληλουχιών άλλων ειδών Lamiaceae που διατίθενται στη GenBank. Και οι δύο δείκτες ήταν κατάλληλοι για το barcoding του είδους. Ο matk ήταν και μεμονωμένα επαρκής στη διάκριση των ειδών και το φυλογενετικό δένδρο που βασίζεται σε αυτόν ήταν συμβατό με την κλασική ταξινόμηση, ενώ βοηθά στα προβληματικά taxa. Ωστόσο, είναι επιθυμητός ο συνδυασμός αυτού του δείκτη με κάποιον που παρουσιάζει μεγαλύτερη παραλλακτικότητα. II.11 Σκοπός της Διατριβής Στην παρούσα εργασία μελετάται, με τη χρήση URP μοριακών δεικτών, η γενετική παραλλακτικότητα αυτοφυών πληθυσμών του είδους S. raeseri που απαντώνται σε ορεινές περιοχές της Β. Ελλάδας και της FYROM. Η γενετική παραλλακτικότητα συσχετίζεται θετικά με τη βιωσιμότητα των πληθυσμών και τη δυνατότητα μελλοντικής εξέλιξής τους. Η γενετική διάβρωση, η μείωση δηλαδή της παραλλακτικότητας εξαιτίας της τυχαίας γενετικής παρέκκλισης ή/και της εκτεταμένης ομομειξίας, αποτελεί σύμπτωμα του κινδύνου εξαφάνισης μικρών και απομονωμένων πληθυσμών, αλλά ταυτόχρονα και αιτία του προβλήματος. Τα κρίσιμα πρώιμα στάδια της διαδικασίας αυτής δεν έχει κατορθωθεί να καταγραφούν στη φύση, καθότι οι μεταβολές είναι ραγδαίες και δύσκολο να εντοπιστούν. Ωστόσο, ο καθορισμός της ενδο- και διαπληθυσμιακής παραλλακτικότητας είναι απαραίτητος στην αναγνώριση και το χαρακτηρισμό καλώς ορισμένων, σημαντικών εξελικτικά μονάδων και στην κατάλληλη διαχείρισή τους, με απώτερο σκοπό την προστασία και τη διατήρηση αυτής της γενετικής παραλλακτικότητας (Woodruff, 2001). Η μεν ενδοπληθυσμιακή παραλλακτικότητα χρησιμοποιείται στον προσδιορισμό γενεαλογικών σχέσεων, συστήματος αναπαραγωγής, όπως και του δραστικού μεγέθους του πληθυσμού (Ne), μιας εκ των σημαντικότερων εννοιών στη θεωρία της βιολογίας διατήρησης, που βάση αυτού μπορεί κανείς να αξιολογήσει την επίδραση διαφορετικών στρατηγικών πληθυσμιακής διαχείρισης (Woodruff, 2001). 48

55 Βιβλιογραφική Ανασκόπηση Η δε παραλλακτικότητα μεταξύ των πληθυσμών αποκαλύπτει χωρική δομή και μοτίβα γονιδιακής ροής, που μαζί με τους ρυθμούς της γονιδιακής ροής (οι οποίοι αναφέρονται και ως «αριθμός μεταναστευτικών ατόμων ανά γενεά», Nm), αποτελούν προαπαιτούμενες γνώσεις για τη διαχείριση ενός πληθυσμού. Η γονιδιακή ροή είναι ένας θεμελιώδης παράγοντας εξέλιξης που βασίζεται στη διασπορά των γονιδίων μεταξύ των πληθυσμών ενός είδους. Είναι προφανές, πως σε πρόσφατα κατακερματισμένους πληθυσμούς τα μοτίβα διασποράς και γονιδιακής ροής μπορεί να διαταραχθούν, με πιθανές σοβαρές επιπτώσεις για τη βιωσιμότητά τους (Woodruff, 2001). 49

56 III. Υλικά και Μέθοδοι

57 Υλικά και Μέθοδοι III.1 Φυτικό υλικό Το φυτικό υλικό που χρησιμοποιήθηκε στην παρούσα μελέτη, προήλθε από τη συλλογή αυτοφυών πληθυσμών ορεινών περιοχών της Μακεδονίας και της ΠΓΔΜ. Στον Πίνακα 3 καταγράφονται τόσο οι λεπτομέρειες από τις τοποθεσίες συλλογής, όσο και η κωδικοποίηση των πληθυσμών που χρησιμοποιήθηκε στη διεξαγωγή του πειράματος. Ακολουθεί ο χάρτης (Εικόνα 10) από όπου σημειώνονται οι περιοχές συλλογής. ΧΩΡΑ ΤΟΠΟΘΕΣΙΑ ΓΕΩΓΡΑΦΙΚΟ ΠΛΑΤΟΣ ΓΕΩΓΡΑΦΙΚΟ ΜΗΚΟΣ ΥΨΟΜΕΤΡΟ (m) ΚΩΔΙΚΟΠΟΙΗΣΗ ΠΛΗΘΥΣΜΟΥ ΜΕΓΕΘΟΣ ΠΛΗΘΥΣΜΟΥ ΕΛΛΑΔΑ Δραγασιά Βοΐου 40º19' Ν 21º08' Ε 1000 P1 25 ΕΛΛΑΔΑ Μαλιμάδι Καστοριάς 40º36' Ν 21º07' Ε 1480 P2 25 ΕΛΛΑΔΑ Γράμμος 40º25' Ν 20º52' Ε 1396 P3 25 ΕΛΛΑΔΑ Γράμμος (θέση Χάρος) 40º21' Ν 20º59' Ε 1636 P4 25 ΕΛΛΑΔΑ Κορησσός 40º29' Ν 21º23' Ε 1166 P5 25 ΠΓΔΜ Vojtino 40º54' Ν 20º48' Ε 1533 P6 25 ΠΓΔΜ Banjani 42º06' Ν 21º23' Ε P7 25 ΠΓΔΜ Konjsko 40º54' Ν 20º59' Ε 867 P8 25 ΠΓΔΜ Magaro 40º56' Ν 20º49' Ε 2000 P9 25 Πίνακας 3: Στοιχεία συλλογής αυτοφυών πληθυσμών Sideritis raeseri από ορεινές περιοχές της Μακεδονίας και της ΠΓΔΜ και κωδικοποίηση αυτών. Εικόνα 10: Χάρτης με τις περιοχές συλλογής των πληθυσμών Sideritis raeseri (http://www.google.gr/map). 51

58 Υλικά και Μέθοδοι Στο πείραμα αναλύθηκαν 18 άτομα (διακριτά φυτά) από κάθε πληθυσμό, όπου κάθε φυτό αποτελεί ξεχωριστή καταχώριση. Εξαίρεση ο P7, όπου χρησιμοποιήθηκαν 12 φυτά. Συνολικά επομένως, αναλύθηκαν 156 δείγματα από 9 πληθυσμούς. Σημειώνεται δε πως ο πληθυσμός P1 αντιστοιχεί σε καλλιεργούμενο S. raeseri. III.2 Απομόνωση γενετικού υλικού Για την εκχύλιση του γενετικού υλικού χρησιμοποιήθηκαν τα αποξηραμένα φύλλα των δειγμάτων που φυλάσσονταν σε σκιερό μέρος και θερμοκρασία δωματίου. Η παρουσία μεγάλης ποσότητας δευτερογενών μεταβολιτών στο σιδερίτη, όπως σε κάθε αρωματικό φυτό, ακόμα και στους νεαρούς ιστούς, δυσχεραίνει την απομόνωση και απαιτεί τη εκτέλεση πολύπλοκων και χρονοβόρων ως επί το πλείστον πρωτοκόλλων. Έτσι, για μεγαλύτερη ευκολία, καθώς και για τη μεγαλύτερη απόδοση της εκχύλισης, χρησιμοποιήθηκε το εμπορικό DNeasy Plant Mini Kit της εταιρείας QIAGEN, σύμφωνα με τις οδηγίες του κατασκευαστή (Mini Protocol), με ορισμένες τροποποιήσεις. Η διαδικασία περιγράφεται στις επόμενες παραγράφους. Αρχικά, ζυγίσθηκαν περίπου 50 mg φυτικού υλικού από κάθε δείγμα και ακολούθησε λειοτρίβησή τους παρουσία υγρού αζώτου σε αποστειρωμένο πορσελάνινο γουδί, ως ότου μετατραπούν σε όσο το δυνατό πιο λεπτή σκόνη, η οποία και μεταφέρθηκε σε μικροφυγοκεντρικό σωλήνα. Στην περίπτωση που το δείγμα δεν χρησιμοποιείτο αμέσως, αποθηκευόταν στους -20 o C. Στη συνέχεια, προστέθηκαν στο δείγμα 500 μl ρυθμιστικού διαλύματος εκχύλισης AP1 και 4 μl RNAse Α. Οι ποσότητες αυτές μπορεί να αυξάνονταν αναλογικά, όταν το δείγμα χαρακτηριζόταν από υπερβολική παρουσία χνουδιού, που καθιστούσε δύσκολη τη λειοτρίβηση και ανεπαρκή την προσρόφηση του ρυθμιστικού διαλύματος, με αποτέλεσμα την παραλαβή μικρής ποσότητας κυτταρικού εκχυλίσματος. Στις περιπτώσεις αυτές, προσαρμόζονταν οι ποσότητες όλων των αντιδραστηρίων, μέχρι το πέρας της διαδικασίας. Ακολούθησε vortex για την καλύτερη ανάδευση των υλικών και επώαση σε υδατόλουτρο στους 65 o C για 30 λεπτά, με ανακίνηση των σωλήνων ανά 2-3 λεπτά. Τα δείγματα φυγοκεντρήθηκαν για 10 λεπτά στις rpm. Σκοπός ήταν η παραλαβή 400 μl εκχυλίσματος, στο οποίο προστέθηκαν 130 μl διαλύματος AP2. Μετά την πρόσμιξη, τα δείγματα ανακινήθηκαν και επωάστηκαν σε πάγο για 5 λεπτά. Με αυτό τον τρόπο επιτυγχάνεται η κατακρήμνιση πρωτεϊνών και πολυσακχαριτών. Ακολούθησε φυγοκέντρηση για 5 λεπτά στις rpm. Το υπερκείμενο διηθήθηκε μέσα από τις χρωματιστές στήλες του kit και φυγοκεντρήθηκε ξανά στις rpm για 2 λεπτά, για τη συλλογή του σχεδόν απαλλαγμένου από «άχρηστα» μακρομόρια διηθήματος. Έπειτα από ογκομέτρηση του περιεχομένου του σωλήνα, προστέθηκε 1,5x διαλύματος AP3 και το μείγμα ανακινήθηκε άμεσα. Το ρυθμιστικό διάλυμα AP3 με το χαοτροπικό αλάτι που περιέχει, απομακρύνει τα μόρια νερού από τα ενυδατωμένα μόρια των νουκλεϊκών 52

59 Υλικά και Μέθοδοι οξέων και προετοιμάζει τα τελευταία για την εξειδικευμένη προσρόφησή τους στην ειδική μεμβράνη που χρησιμοποιήθηκε στο αμέσως επόμενο βήμα. Το μείγμα μεταγγίσθηκε στις λευκές στήλες του kit και φυγοκεντρήθηκε για 1 λεπτό στις rpm. Το DNA του δείγματος προσδέθηκε στη μεμβράνη της στήλης, ενώ απορρίφθηκε η υγρή φάση που περιείχε σάκχαρα, πολυφαινόλες και άλλους μεταβολίτες που θα δρούσαν πιθανώς παρεμποδιστικά σε επόμενες διαδικασίες. Η μέγιστη χωρητικότητα της στήλης είναι 650 μl, έτσι επαναλήφθηκε το βήμα αυτό μέχρι να συγκεντρωθεί το DNA ολόκληρης της ποσότητας του δείγματος στη μεμβράνη. Για την παραλαβή όσο το δυνατό πιο καθαρού δείγματος νουκλεϊκών οξέων και την απομάκρυνση των αλάτων, προστέθηκαν στις στήλες 500 μl ρυθμιστικού διαλύματος AW και πραγματοποιήθηκε φυγοκέντρηση στις rpm για 1 λεπτό. Επαναλήφθηκε το βήμα αυτό άλλη μια φορά, μόνο που η φυγοκέντρηση έγινε στις rpm για 2 λεπτά, έτσι ώστε να στεγνώσει η μεμβράνη. Ο καθαρισμός κατέστη αποτελεσματικότερος με το επιπλέον βήμα της προσθήκης 500 μl καθαρής αιθανόλης στη μεμβράνη και φυγοκέντρησης στις rpm για 2 λεπτά. Είναι σημαντικό να έχει απομακρυνθεί από το δείγμα μας όλη η ποσότητα της αιθανόλης. Τέλος, η μεμβράνη επωάσθηκε σε 100 μl ρυθμιστικού διαλύματος ΑE για 5 λεπτά, σε θερμοκρασία δωματίου με τη χρήση νέου σωλήνα, στον οποίο και συλλέχθηκε το καθαρό διήθημα των νουκλεϊκών οξέων, μετά από φυγοκέντρηση στις rpm για 1 λεπτό. Επαναλήφθηκε το βήμα αυτό άλλη μια φορά, με 50 μl διαλύματος ΑΕ, έτσι ώστε να αποδεσμευτεί όσο το δυνατό μεγαλύτερη ποσότητα DNA που είχε προσδεθεί στη μεμβράνη. Το ρυθμιστικό διάλυμα ΑΕ περιέχει 10 mm Tris-Cl και 0,5 mm EDTA, ενώ το ph του είναι 9,0, που θεωρείται άριστο για τη μέγιστη απόδοση της έκλουσης. Το τελικό δείγμα όγκου περίπου 150 μl φυλάχθηκε στους 4 o C. III.3 Παρασκευή πηκτής αγαρόζης-ηλεκτροφόρηση Για την οπτικοποίηση της ύπαρξης, αλλά και της ποιότητας του DNA που έχει απομονωθεί, τα δείγματα υποβλήθηκαν σε ηλεκτροφόρηση σε πηκτή αγαρόζης με ρυθμιστικό διάλυμα ΤBΕ (Tris-Boric acid-edta). Για το σκοπό αυτό, παρασκευάστηκε ένα πυκνό διάλυμα ΤBΕ 10x, το οποίο περιείχε για 1l: 108 g Tris base, 55 g Βορικό οξύ, 40 ml 0,5 M EDTA (ph 8,0), Απεσταγμένο νερό. 53

60 Υλικά και Μέθοδοι Το διάλυμα που χρησιμοποιήθηκε στην ηλεκτροφόρηση προκύπτει από αραίωση του άνωθεν με απεσταγμένο νερό σε τελική συγκέντρωση 0,5x. Η προετοιμασία των δειγμάτων για την ηλεκτροφόρηση έγινε με ανάμειξή τους με ένα διάλυμα χρωστικής (loading buffer). Το εν λόγω διάλυμα βοηθά στην τοποθέτηση των δειγμάτων στην πηκτή, καθιστώντας τα ορατά, ενώ τους προσδίδει βάρος, ώστε να παραμείνουν στη θέση τους. Οι χρωστικές που περιέχει το διάλυμα κινούνται προς την ίδια κατεύθυνση με το DNA και έτσι είναι δυνατός ο εντοπισμός του σταδίου της ηλεκτροφόρησης. Η σύσταση του διαλύματος είχε ως εξής: 0,21% Μπλε της βρωμοφαινόλης (Bromophenol Blue), 0,21% Κυανό του ξυλενίου (Xylene cyanol), 0,2 M EDTA (ph 8,0), 50% Γλυκερόλη. Για την ηλεκτροφόρηση χρησιμοποιήθηκε η συσκευή MultiSUB της εταιρίας UVItec Ltd και το τροφοδοτικό Power Pack P25 της Biometra. Η διαδικασία περιγράφεται ως εξής: Σε 120 ml διαλύματος TBE 0,5x προστέθηκαν 1,2 g αγαρόζη. Η συγκέντρωση αυτή της αγαρόζης (1%) κρίθηκε ικανοποιητική για να ανιχνευθεί DNA μεγάλου μήκους σε σύντομο χρόνο ηλεκτροφόρησης. Για τη διάλυση της αγαρόζης, η κωνική φιάλη με το μείγμα τοποθετήθηκε σε φούρνο μικροκυμάτων για περίπου 5 λεπτά και ένταση 600 W, μέχρι το περιεχόμενο να γίνει διαυγές. Στη συνέχεια, ογκομετρήθηκε το διάλυμα και συμπληρώθηκε με απεσταγμένο νερό, μέχρι να επανακτήσει τον αρχικό του όγκο. Με τη βοήθεια κρύου υδατόλουτρου, μειώθηκε η θερμοκρασία γύρω στους 55 o C, οπότε και προστέθηκαν 3 μl βρωμιούχου αιθιδίου και το διάλυμα αναδεύτηκε ελαφρά. Το βρωμιούχο αιθίδιο έχει την ιδιότητα να δημιουργεί σύμπλοκα με το DNA, τα οποία φθορίζουν με την παρουσία υπεριώδους ακτινοβολίας. Το διάλυμα μεταγγίστηκε με προσοχή για την αποφυγή φυσαλίδων, στο αποσπώμενο τμήμα της συσκευής ηλεκτροφόρησης που προορίζεται για την πηκτή, όπου είχαν ήδη τοποθετηθεί τα ειδικά εξαρτήματα για τη δημιουργία των θέσεων των δειγμάτων. Το διάλυμα αφέθηκε να πολυμεριστεί και να στερεοποιηθεί σε θερμοκρασία δωματίου για περίπου 30 λεπτά. Ακολούθως, το αποσπώμενο τμήμα τοποθετήθηκε εντός της συσκευής, χωρίς πλέον τα ειδικά τοιχώματα και προστέθηκαν 650 ml ρυθμιστικού διαλύματος ΤΒΕ 0,5x, έτσι ώστε να καλυφθεί πλήρως η πηκτή. Τέλος, αφαιρέθηκαν με πολλή προσοχή και τα ειδικά εξαρτήματα για τη δημιουργία των θέσεων των δειγμάτων. 54

61 Υλικά και Μέθοδοι Τα δείγματα που τοποθετήθηκαν στην πηκτή αποτελούνταν από 4 μl διαλύματος DNA και 1 μl loading buffer, τα οποία είχαν αναμειχθεί πριν πολύ καλά, με τη βοήθεια της πιπέτας. Ως δείκτη μοριακού βάρους χρησιμοποιήθηκε ο λ Hind III (New England, BioLabs inc., βλ. Εικόνα 14) σε ποσότητα 3 μl στην πρώτη θέση της πηκτής. Εφαρμόστηκε ηλεκτρικό πεδίο 75 Volt στη συσκευή ηλεκτροφόρησης για περίπου 20 λεπτά. Τέλος, τοποθετήθηκε η πηκτή σε τράπεζα υπεριώδους ακτινοβολίας, φωτογραφήθηκε και η εικόνα αποθηκεύτηκε σε ψηφιακό μέσο για τις παρατηρήσεις. Μια τυπική φωτογραφία ηλεκτροφόρησης δειγμάτων απομονωμένου DNA παρουσιάζεται στην Εικόνα 11. λhind III λhind III Εικόνα 11: Ηλεκτροφόρηση γενωμικού υλικού ενός πληθυσμού Sideritis raeseri, μετά από κατεργασία του με το τροποποιημένο πρωτόκολλο της QIAGEN, σε ΤΒΕ πηκτή αγαρόζης 1%. III.4 Αλυσιδωτή αντίδραση πολυμεράσης (PCR) Για το σκοπό της παρούσας μελέτης, χρησιμοποιήθηκαν 12 ειδικοί εκκινητές (Universal Rice Primers-URP), που παρασκευάστηκαν από την εταιρεία Syntezza και παρελήφθησαν σε λυοφιλοποιημένη μορφή. Βάση των οδηγιών του κατασκευαστή, δημιουργήθηκε το τελικό διάλυμα συγκέντρωσης 100 μm για καθέναν από αυτούς. Οι εκκινητές αυτοί είναι ολιγονουκλεοτίδια 20 βάσεων που βασίζονται στην αλληλουχία pkrd (βλ. ΙΙ.9), όπου τα χαρακτηριστικά τους παρατίθενται στον Πίνακα 4. Η αλυσιδωτή αντίδραση της πολυμεράσης πραγματοποιήθηκε σε όλα τα δείγματα και τους εκκινητές κάτω από τις ίδιες συνθήκες. Για την αντίδραση χρησιμοποιήθηκε το KAPA Taq PCR Kit της KAPA BIOSYSTEMS (εξαίρεση τα dntps που ήταν της εταιρίας Biolabs, New England). Ο συνολικός όγκος του διαλύματος της αντίδρασης για κάθε δείγμα ήταν 25 μl, εκ των οποίων 6 μl ήταν το διάλυμα του DNA που είχε απομονωθεί και που χρησίμευσε ως εκμαγείο (template). Η σύσταση του διαλύματος της αντίδρασης χωρίς το DNA (mastermix) είχε ως εξής: 55

62 Υλικά και Μέθοδοι PCR buffer Α (που περιέχει 15 mm Mg +2 ) σε συγκέντρωση 1x. Το ρυθμιστικό αυτό διάλυμα εξασφαλίζει το άριστο περιβάλλον δράσης της πολυμεράσης. Διάλυμα MgCl 2 σε ποσότητα τέτοια, ώστε η ολική συγκέντρωση ιόντων μαγνησίου στο μείγμα αντίδρασης να είναι 3,0 mm, συνυπολογιζόμενης της ποσότητας μαγνησίου που παρείχε το προηγούμενο ρυθμιστικό διάλυμα. dntps (δεοξυριβο-τριφωσφορικά νουκλεοτίδια) σε μία συγκέντρωση 0,2 mm για την καθεμία από τις τέσσερεις βάσεις. Αυτά είναι τα δομικά συστατικά για την επιμήκυνση των θυγατρικών αλυσίδων DNA που δημιουργούνται κατά την PCR. Για λόγους διευκόλυνσης, παρασκευάστηκε ένα μείγμα των τεσσάρων dntps, από όπου λαμβανόταν η κατάλληλη ποσότητα για το διάλυμα αντίδρασης. Η συγκέντρωση καθενός νουκλεοτιδίου στο μείγμα αυτό ήταν 10 mm. Εκκινητής (URP primer) σε συγκέντρωση 2,4 μμ (Karaca et al., 2008, Cinar et al., 2009). Το διάλυμα που χρησιμοποιήθηκε για τον εκκινητή προκύπτει από μια αραίωση 1:10 του αντίστοιχου πυκνού διαλύματος. Ένζυμο της Taq πολυμεράσης σε ποσότητα που αντιστοιχούσε σε 1,2 U ενζύμου. Ειδικά καθαρό απεσταγμένο νερό. Το KAPA Taq PCR Kit, τα διαλύματα των εκκινητών και των dntps φυλάχθηκαν στους -20 o C. Όλη η διαδικασία της προετοιμασίας των δειγμάτων για την PCR έγινε στον πάγο, για να εξασφαλιστεί η όσο το δυνατό μεγαλύτερη σταθερότητα των αντιδρώντων και για την αποφυγή τυχόν σχηματισμού διμερών συμπλόκων και με μεγάλη προσοχή, για να μην λάβει χώρα επιμόλυνση των δειγμάτων. Εκκινητής Αλληλουχία (5-3 ) Περιεχόμενο (%) GC Tm ( o C) URP1F ATCCAAGGTCCGAGACAACC 55 59,4 URP2F GTGTGCGATCAGTTGCTGGG 60 61,4 URP2R CCCAGCAACTGATCGCACAC 60 61,4 URP4R AGGACTCGATAACAGGCTCC 55 59,4 URP6R GGCAAGCTGGTGGGAGGTAC 65 63,4 URP9F ATGTGTGCGATCAGTTGCTG 50 57,3 URP13R TACATCGCAAGTGACACAGG 50 57,3 URP17R AATGTGGGCAAGCTGGTGGT 55 59,4 URP25F GATGTGTTCTTGGAGCCTGT 50 57,3 URP30F GGACAAGAAGAGGATGTGGA 50 57,3 URP32F TACACGTCTCGATCTACAGG 50 57,3 URP38F AAGAGGCATTCTACCACCAC 50 57,3 Πίνακας 4: Οι ολιγονουκλεοτιδικές αλληλουχίες (Kang et al., 2002, Karaca et al., 2008, Cinar et al., 2009) και οι ιδιότητες των εκκινητών βάση κατασκευαστή, που χρησιμοποιήθηκαν στην αλυσιδωτή αντίδραση της πολυμεράσης. 56

63 Υλικά και Μέθοδοι Οι ποσότητες των συστατικών υπολογίστηκαν βάση του Biometra_s_EXCEL_PCR_tool (καρτέλα: PCR mastermix designer, πηγή με περιθώριο ασφαλείας 5%. Παρασκευάστηκε η συνολική ποσότητα του mastermix για αντίστοιχο αριθμό δειγμάτων ανά εκκινητή, ενώ η προσθήκη του ενζύμου της πολυμεράσης έγινε τελευταία. Ένα παράδειγμα υπολογισμού των ποσοτήτων των αντιδρώντων για μία αντίδραση που περιλαμβάνει 20 δείγματα, φαίνεται στην Εικόνα 12. Εικόνα 12: Το φύλλο υπολογισμού των ποσοτήτων των αντιδρώντων για την PCR. Ακολούθησε ελαφρύ vortex και μια σύντομη φυγοκέντρηση, προτού το mastermix μοιραστεί σε όγκους των 19 μl για καθένα από τα δείγματα. Τέλος, πραγματοποιήθηκε σύντομη φυγοκέντρηση σε όλα τα δείγματα, προτού τοποθετηθούν στον θερμοκυκλοποιητή. Για την PCR χρησιμοποιήθηκε ο θερμοκυκλοποιητής Veriti 96Well Thermal Cycler της Αpplied Biosystems, ενώ το πρόγραμμα που εφαρμόστηκε από κοινού σε όλους τους εκκινητές αναλύεται στις ακόλουθες παραγράφους (Cinar et al., 2009). Πρώτο στάδιο έναρξης: ένας κύκλος για 3 λεπτά στους 94 C. Σε αυτό το στάδιο ενεργοποιείται το ένζυμο της πολυμεράσης και γίνεται μια πρώτη μετουσίωση του DNA του δείγματός μας. Δεύτερο στάδιο: 10 κύκλοι που αποτελούνται από τα επιμέρους βήματα: 30 sec στους 94 C. Το DNA αποδιατάσσεται με το «σπάσιμο» των υδρογονικών δεσμών μεταξύ των συμπληρωματικών βάσεων του δίκλωνου μορίου. Έτσι προκύπτουν οι μονόκλωνες αλυσίδες του. 57

64 Υλικά και Μέθοδοι 45 sec στους 56 C στον πρώτο κύκλο, με σταδιακή μείωση της θερμοκρασίας κατά 1 C ανά κύκλο. Ο εκκινητής βρίσκει τη συμπληρωματική περιοχή του DNA του δείγματος και προσδένεται σε αυτήν. Ξεκινώντας από μια σχετικά υψηλή θερμοκρασία, προωθείται ο υβριδισμός εκκινητή-στόχου με όσο το δυνατό μεγαλύτερη συμπληρωματικότητα. Κατόπιν, η μείωση της θερμοκρασίας κατά 1 C σε κάθε κύκλο έχει σαν αποτέλεσμα να αυξάνεται η απόδοση υβριδισμού. Λόγω της εκθετικής αύξησης των μορίων από κύκλο σε κύκλο, στο τέλος του δεύτερου σταδίου τα μη-εξειδικευμένα σύμπλοκα περιορίζονται σημαντικά. 3 λεπτά στους 72 C. Χρησιμοποιώντας τα dntps, η πολυμεράση επιμηκύνει τη θυγατρική αλυσίδα DNA, πολλαπλασιάζοντας τα μόρια-στόχους. Τρίτο στάδιο: 30 κύκλοι που αποτελούνται, κατά αντιστοιχία με το δεύτερο στάδιο, από 30 sec στους 94 C, 45 sec στους 47 C (η τελική θερμοκρασία στον τελευταίο κύκλο του προηγούμενου σταδίου) και 3 λεπτά στους 72 C. Οι περιοχές που ενισχύθηκαν κατά τη διάρκεια των προηγούμενων 10 κύκλων ενισχύονται ακόμα περισσότερο. Τέταρτο στάδιο: ένας κύκλος στους 72 C για 11 λεπτά. Σκοπός, η ολοκλήρωση της επιμήκυνσης των προϊόντων της PCR που δημιουργήθηκαν κατά τον τελευταίο κύκλο του προηγούμενου σταδίου. Ακολουθεί η διατήρηση των προϊόντων στους 4 C. Τα προϊόντα της PCR φυλάχθηκαν στους -20 C. Το δε πρόγραμμα συνοψίζεται στον κάτωθι Πίνακα 5: Στάδιο Αριθμός κύκλων (επαναλήψεων) Βήμα Χρόνος 3 min 30 sec 45 sec 3 min 30 sec 45 sec 3 min Θερμοκρασία 94 C 94 C 56 C 72 C 94 C 47 C 72 C 72 C 4 C 11 min Πίνακας 5: Το πρόγραμμα της PCR που χρησιμοποιήθηκε στα δείγματα του σιδερίτη (Cinar et al., 2009). III.5 Ηλεκτροφόρηση των προϊόντων της αλυσιδωτής αντίδρασης της πολυμεράσης (PCR) Τα αποτελέσματα της πειραματικής διαδικασίας οπτικοποιήθηκαν μέσω ηλεκτροφόρησης σε πηκτή αγαρόζης με ρυθμιστικό διάλυμα ΤΒΕ. Η διαδικασία της παρασκευής των ρυθμιστικών διαλυμάτων, καθώς και η ηλεκτροφόρηση πραγματοποιήθηκαν όπως περιγράφονται στην παράγραφο ΙΙΙ.3. Η συγκέντρωση της αγαρόζης επιλέχθηκε να είναι 1% σε όλους τους εκκινητές, εκτός από τον URP9F όπου ήταν 2%, βάση του εύρους του μεγέθους των ζωνών που έδιναν τα δείγματα. Ο URP9F έδινε ζώνες μικρότερου μεγέθους, εξού και η πηκτή έπρεπε να έχει μικρότερο πορώδες. 58

65 Υλικά και Μέθοδοι Τα δείγματα στην περίπτωση αυτή αποτελούνταν από 5 μl διαλύματος προϊόντος PCR και 2 μl loading buffer. Τέλος, κατάλληλος δείκτης μοριακού βάρους κρίθηκε ο 1 kb (Invitrogen, Life Technologies, βλ. Εικόνα 14), ο οποίος τοποθετήθηκε στην πρώτη και στην τελευταία θέση της πηκτής σε ποσότητα 1,5 μl. Εφαρμόστηκε ηλεκτρικό πεδίο 40 Volt στη συσκευή ηλεκτροφόρησης για περίπου 2,5-3 ώρες αναλόγως τον εκκινητή και η πορεία της ηλεκτροφόρησης ελεγχόταν συχνά στην τράπεζα υπεριώδους ακτινοβολίας. Η ξεκάθαρη εικόνα διαχωρισμένων μεταξύ τους ζωνών, φωτογραφήθηκε και αποθηκεύτηκε σε ψηφιακό μέσο. Μια τυπική φωτογραφία προϊόντων PCR σε εκκινητή URP φαίνεται στην Εικόνα 13. 1kb kb Εικόνα 13: Ηλεκτροφόρηση προϊόντων PCR ενός πληθυσμού Sideritis raeseri στον εκκινητή URP17R, σε ΤΒΕ πηκτή αγαρόζης 1%. λ Hind III 1 kb Εικόνα 14: Οι ζώνες γνωστού μοριακού βάρους που δίνουν οι δείκτες λ Hind III σε πηκτή αγαρόζης 1% (Πηγή: https://www.neb.com/products/n3012-dna-hindiii-digest) και 1 kb σε πηκτή αγαρόζης 0,9% (Πηγή: 59

66 Υλικά και Μέθοδοι III.6 Ανάλυση των δεδομένων Οι φωτογραφίες που συλλέχθησαν από τις ηλεκτροφορήσεις όλων των προϊόντων της PCR όλων των πληθυσμών σε όλους τους εκκινητές, ταξινομήθηκαν και υπέστησαν επεξεργασία με το πρόγραμμα ανάλυσης εικόνας ηλεκτροφόρησης GelAnalyzer 2010 (http://www.gelanalyzer.com). Σκοπός, η βαθμονόμηση των ζωνών των δειγμάτων όλων των πληθυσμών για κάθε εκκινητή, όπου ζώνες με την ίδια κινητικότητα θεωρούνταν ομόλογες. Κατόπιν, η ύπαρξη ή απουσία κάποιας ζώνης κωδικοποιήθηκε με 1 ή 0 αντίστοιχα. Η σημείωση της ύπαρξης ζωνών (band scoring) έγινε χωρίς να λαμβάνεται υπόψη η φωτεινότητά τους, παρότι έχει αναφερθεί πως ο βαθμός φωτεινότητας φαίνεται να δίνει περισσότερη πληροφορία (Demeke, Adams and Chibbar, 1992). Η επεξεργασία των κωδικοποιημένων αποτελεσμάτων πραγματοποιήθηκε με το στατιστικό πρόγραμμα GenAlEx 6.5 (http://biology.anu.edu.au/genalex, Peakall and Smouse, 2006, 2012). Τα δεδομένα ορίστηκαν ως «Binary Haploid Data», όπου ως p αναφέρεται η συχνότητα εμφάνισης ζώνης και q η συχνότητα του null φαινοτύπου. Σύμφωνα με τον Zhivotovsky (1999), οι κυρίαρχοι δείκτες μπορούν να αντιμετωπιστούν ως δυαδικοί χαρακτήρες, με δύο φαινότυπους ανά θέση: την παρουσία και την απουσία ζώνης. Οι αλληλόμορφοι επομένως ισοδυναμούν με το «μοριακό φαινότυπο». Υπολογίστηκαν παράμετροι που εκτιμούν την ενδοπληθυσμιακή γενετική παραλλακτικότητα, όπως ποσοστά πολυμορφικών ζωνών, παραλλακτικότητα κατά Nei (h), καθώς και δείκτες πληροφορίας του Shannon. Για την εκτίμηση της παραλλακτικότητας μεταξύ των εννέα πληθυσμών, χρησιμοποιήθηκαν και πάλι οι δείκτες πληροφορίας του Shannon, αλλά και η Ανάλυση Μοριακής Παραλλακτικότητας-AMOVA (Excoffier et al., 1992), η οποία εφαρμόστηκε λαμβάνοντας ή όχι υπόψη τη γεωγραφική κατανομή των πληθυσμών. Ακολούθησε το τεστ του Mantel, για να ελεγχθεί τυχόν συσχέτιση γενετικής και γεωγραφικής απόστασης, καθώς και ανάλυση κύριων συντεταγμένων, η οποία μοιάζει με την ανάλυση κύριων συνιστωσών, για τον επιμερισμό της παραλλακτικότητας σε ανεξάρτητες μεταβλητές. Για την οπτικοποίηση των γενετικών σχέσεων των ατόμων και των πληθυσμών, κατασκευάστηκε δενδρόγραμμα με τη μέθοδο UPGMA, με τη βοήθεια του προγράμματος MEGA 5.05 (http://www.megasoftware.net, Tamura et al., 2011). Στη συνέχεια, με το λογισμικό STRUCTURE (Pritchard et al., 2000, Falush et al., 2003, 2007), το οποίο βασίζεται στη Μπεϋσιανή μέθοδο ομαδοποίησης, επιχειρήθηκε να διεξαχθεί κάποιο συμπέρασμα σχετικά με την πληθυσμιακή δομή και την προέλευση των ατόμων των πληθυσμών. Με αυτόν τον τρόπο και συμπληρωματικά με το πρόγραμμα STRUCTURE HARVESTER (Earl and VonHoldt, 2012), καθορίστηκε ο αριθμός των ομάδων Κ στις οποίες κατανέμονται τα άτομα των 9 πληθυσμών του Sideritis raeseri. Η διαμόρφωση των δεδομένων των URP δεικτών έγινε σύμφωνα με τις υποδείξεις του εγχειριδίου του προγράμματος στην περίπτωση των κυρίαρχων δεικτών, όπου κάθε άτομο 60

67 Υλικά και Μέθοδοι θεωρείται διπλοειδές. Όπου παρατηρείται εμφάνιση ζώνης, αναγράφεται στη θέση του δευτέρου αλληλομόρφου η τιμή που έχει οριστεί να αντιπροσωπεύει τις μη διαθέσιμες τιμές (missing values), ενώ υποδεικνύεται ο υπολειπόμενος αλληλόμορφος για κάθε θέση (locus). Η Μπεϋσιανή ανάλυση ομαδοποίησης πραγματοποιήθηκε για αριθμό ομάδων Κ από 3 έως 11 και σε 3 ανεξάρτητες επαναλήψεις για κάθε τιμή του Κ. Κρίθηκε πως εκτελέσεις του αλγορίθμου πριν τη συλλογή των δεδομένων (burn-in) ήταν επαρκείς για την ελαχιστοποίηση της επίδρασης της αρχικής παραμετροποίησης στα αποτελέσματα, ενώ οι εκτελέσεις που ακολούθησαν ήταν επίσης αρκετές για την ακριβέστερη εκτίμηση των τελικών αποτελεσμάτων. Το σύνολο των παραμέτρων με το οποίο εκτελέστηκε ο αλγόριθμος, ήταν το προκαθορισμένο και πιο συγκεκριμένα, χρησιμοποιήθηκε το μοντέλο μεικτής καταγωγής (admixture model) και όσον αφορά στις συχνότητες αλληλομόρφων, το μοντέλο των συσχετισμένων συχνοτήτων των Falush et al. (2003). Τέλος, αξιολογήθηκαν οι δείκτες που χρησιμοποιήθηκαν στην παρούσα διατριβή, με κριτήριο πάλι την παραλλακτικότητα κατά Nei (h), τους δείκτες πληροφορίας του Shannon και επιπρόσθετα τις τιμές PIC (Polymorphic Information Content), ως έκφραση της ικανότητας των δεικτών να ανιχνεύουν τη γενετική παραλλακτικότητα. Οι τελευταίες υπολογίστηκαν με το λογισμικό των Nagy et al. (2012), που υπάρχει στην ιστοσελίδα: 61

68 IV. Αποτελέσματα

69 Αποτελέσματα IV.1 Προφίλ URP εκκινητών και πληθυσμών Ενισχύθηκαν συνολικά 283 ευδιάκριτες και αξιόπιστες ζώνες σε όλους τους πληθυσμούς από τους δώδεκα εκκινητές, με κάθε ατομικό φυτό να έχει ένα μοναδικό προφίλ ηλεκτροφόρησης. Ο κάθε εκκινητής έδωσε από 15 (9F) έως 29 (32F), με μέσο όρο 23,58 ζώνες. Το δε μέγεθός τους ξεκινά από 32 (13R) και φτάνει τα 2241 bp (4R, 30F), με το μικρότερο εύρος να το δίνει ο 9F και το μεγαλύτερο ο 4R εκκινητής. Σε κάθε πληθυσμό διακρίθηκαν 7 έως και 21 ζώνες ανά εκκινητή, ενώ έκαστος ενισχύει κατά μέσο όρο 8,56 (9F) έως και 18 (4R) διαφορετικά τμήματα σε έναν πληθυσμό, ενώ γενικά ένα μέσο πληθυσμιακό προφίλ αποτελείται από 13,55 ζώνες. Στο σύνολο των εκκινητών, σε κάθε πληθυσμό περιλαμβάνονται 140 (πληθυσμός Ρ7) μέχρι 179 (πληθυσμός Ρ4) και κατά μέσο όρο 162,56 διαφορετικές ζώνες, όλες με συχνότητα εμφάνισης μεγαλύτερη του 5%. Οι 1F, 2F, 9F, 25F, 32F και 38F εκκινητές παράγουν από μία κοινή ζώνη για όλους τους πληθυσμούς, ενώ ο 4R παράγει τέσσερεις και ο 30F δύο. Αρκετές από αυτές τις ζώνες χαρακτηρίζονται και μονομορφικές για αρκετούς πληθυσμούς, αν και δεν ανιχνεύθηκε κάποια που να είναι καθολικά μονομορφική, επομένως όλοι οι εκκινητές θεωρούμε ότι παράγουν μόνο πολυμορφικές ζώνες σε συνολικό επίπεδο. Ωστόσο, για κάθε εκκινητή (με εξαίρεση τον 9F) υπάρχουν ζώνες που απουσίαζαν από ένα πληθυσμό. Σε αυτήν την περίπτωση, παρατηρούνται μεταξύ άλλων, και αυστηρά μονομορφικές ζώνες για τους υπόλοιπους οκτώ πληθυσμούς. Συγκεκριμένα, δύο ζώνες του εκκινητή 2R (που απουσιάζουν από τους πληθυσμούς Ρ1 και Ρ5), μία του 25F (απουσιάζει από Ρ4) και μία του 38F (απουσιάζει από Ρ1). Όσον αφορά στις αποκλειστικές (private) ζώνες, δηλαδή εκείνες που χαρακτηρίζουν έναν πληθυσμό, παρατηρήθηκε να ενισχύουν από μια οι 2F (σε P9), 6R (σε P9), 17R (σε Ρ8), 30F (σε Ρ1) και 32F (σε Ρ4) εκκινητές και από τρεις ο 38F (σε Ρ1). Αξίζει να σημειωθεί πως τα τμήματα αυτά ήταν από τα μεγαλύτερα που ενισχύει ο κάθε εκκινητής, με εξαίρεση την περίπτωση του 32F, που ήταν μάλλον από τα μικρότερα. Στους πίνακες 6 και 7 αναγράφονται τα χαρακτηριστικά του προφίλ ηλεκτροφόρησης των εννιά πληθυσμών με τους δώδεκα εκκινητές. 63

70 Αποτελέσματα URP Εκκινητής Μέγεθος (bp) Συνολικός Αριθμός Ζωνών Πλήθος ανά Πληθυσμό Μέσος Όρος ανά Πληθυσμό Κοινές Ζώνες Απουσία από έναν Πληθυσμό Μοναδικές (Private) Ζώνες 1F , F R , R R , F , R , R , F , F , F , F , Μ.Ο. 23,58 13,55 Σύνολο Πίνακας 6: Αριθμός ζωνών και μέγεθός τους ανά εκκινητή, πλήθος ενισχυμένων τμημάτων κάθε εκκινητή ανά πληθυσμιακό προφίλ, καθώς και μέσος αριθμός τους, ζώνες που ενισχύονται από κοινού στους πληθυσμούς, αλλά και πλήθος τμημάτων που απουσιάζουν από ένα πληθυσμό, αριθμός χαρακτηριστικών για τους πληθυσμούς ζωνών που δίνει έκαστος εκκινητής. Πληθυσμοί Ρ1 Ρ2 Ρ3 Ρ4 Ρ5 Ρ6 Ρ7 Ρ8 Ρ9 Πλήθος Ζωνών Σε συχνότητα 5% Μοναδικές (Private) Ζώνες Κοινές Ζώνες (σε 25% των πληθυσμών) Κοινές Ζώνες (σε 50% των πληθυσμών) Πίνακας 7: Συνολικός αριθμός ζωνών που ενισχύονται σε κάθε πληθυσμό από το σύνολο των εκκινητών, πλήθος με συχνότητα εμφάνισης 5%, πλήθος αποκλειστικών ζωνών, αλλά και κοινών ζωνών σε ποσοστά κάτω του 25% και 50% των πληθυσμών. IV.2 Γενετική Παραλλακτικότητα IV.2.1 Ποσοστά Πολυμορφικών Ζωνών Δείκτες Παραλλακτικότητας των Nei και Shannon Από το σύνολο των διαφορετικών ζωνών που ενισχύθηκαν με τους δώδεκα εκκινητές, 86 έως 122 ήταν πολυμορφικές σε κάθε πληθυσμό και το αντίστοιχο ποσοστό επί τοις εκατό κυμάνθηκε από 30,39 (Ρ7) μέχρι 43,11 (Ρ9). Ένα ακόμα μέγεθος έκφρασης του πολυμορφισμού είναι η παραλλακτικότητα h κατά Nei, που είναι ανάλογη της αναμενόμενης ετεροζυγωτίας He των συγκυρίαρχων δεικτών σε συνθήκες ισορροπίας Hardy-Weinberg. Δίνεται δε από τον τύπο: h = 1 - (p 2 + q 2 ), με unbiased τιμές που εξαρτώνται από το μέγεθος του πληθυσμού Ν, uh = (N/(N-1)) h. Παρότι 64

71 Αποτελέσματα η χρήση του δείκτη αυτού είναι αμφίβολη εξαιτίας της εξάρτησής του από την υπόθεση Hardy Weinberg (Mendelson and Shaw, 2005), οι εκτιμήσεις του στην περίπτωση των δεικτών πολλαπλών θέσεων έχουν αποδειχτεί αρκετά εύρωστες, ακόμα και όταν δεν ισχύει η υπόθεση Hardy Weinberg (Kremer et al., 2005), ενώ ο δείκτης θεωρείται αξιόπιστος, όταν εξετάζονται σταυρογονιμοποιούμενα είδη (Meudt and Clarke, 2007). Μέσω του GenAlex, υπολογίστηκε η παραλλακτικότητα h για κάθε θέση (locus) σε κάθε πληθυσμό. Στη συνέχεια, υπολογίστηκε σε κάθε πληθυσμό ο μέσος όρος των θέσεων του κάθε δείκτη και τέλος ο σταθμισμένος μέσος όρος των δεικτών αποτελεί την παραλλακτικότητα του πληθυσμού. Η χαμηλότερη τιμή της εντοπίστηκε στον πληθυσμό Ρ7 (0,107 ή 0,117 η unbiased τιμή) και η υψηλότερη στον Ρ9 (0,153 ή 0,162 η unbiased τιμή). Η κατάταξη των πληθυσμών βάση παραλλακτικότητας Nei σχεδόν συμπίπτει με εκείνη που δίνει το ποσοστό πολυμορφικών ζωνών (Πίνακας 8). Οι τιμές του δείκτη φαινοτυπικής παραλλακτικότητας του Shannon Ι (που σε πολλές δημοσιεύσεις αναφέρεται ως Ho όταν αφορά πληθυσμούς και ούτως θα αναφέρεται στο εξής) εκτιμήθηκαν σύμφωνα με τον τύπο: Ηο = -[p ln (p) + q ln(q)] για κάθε θέση σε κάθε πληθυσμό. Ο δείκτης αυτός αφορά επίσης την ενδοπληθυσμιακή παραλλακτικότητα. Όπως και στην περίπτωση του δείκτη Nei, υπολογίστηκε ο μέσος όρος των θέσεων κάθε δείκτη σε κάθε πληθυσμό και ο σταθμισμένος μέσος όρος των δεικτών είναι η ολική φαινοτυπική παραλλακτικότητα Shannon εντός του πληθυσμού. Ως Hpop ορίζεται η μέση ενδοπληθυσμιακή παραλλακτικότητα που διακρίνει ο κάθε δείκτης (μέσος όρος των τιμών Ηο των πληθυσμών), ενώ ως Hsp ορίζεται η παραλλακτικότητα που φανερώνει ο δείκτης βάση της μέσης φαινοτυπικής συχνότητας αυτή τη φορά, αν θεωρήσουμε δηλαδή τα άτομα στο σύνολό τους πως ανήκουν σε έναν πληθυσμό. Η διαφορά των δύο αυτών μεγεθών αντικατοπτρίζει το συστατικό της παραλλακτικότητας που οφείλεται στη διαφοροποίηση των πληθυσμών (Lewontin, 1972). Καθίσταται λοιπόν δυνατός ο υπολογισμός της αναλογίας της ενδοπληθυσμιακής (Hpop/Hsp) και διαπληθυσμιακής παραλλακτικότητας [(Hsp-Hpop)/Hsp] (βλ. πίνακα 8). Έτσι λοιπόν, τη μεγαλύτερη συνολική παραλλακτικότητα την εμφανίζει ο πληθυσμός Ρ9 (0,229) και τη μικρότερη ο Ρ7 (0,160). Η δε κατάταξη των πληθυσμών συμφωνεί με εκείνες των προηγούμενων κριτηρίων και ειδικά με εκείνη βάση της παραλλακτικότητας του Nei. Το ποσοστό της ενδοπληθυσμιακής παραλλακτικότητας είναι 35,3% και εκείνο που αναλογεί μεταξύ των πληθυσμών φτάνει το 64,7%. 65

72 Αποτελέσματα για κάθε εκκινητή Hpop, αλλά και Hsp βάση της μέσης φαινοτυπικής συχνότητας. Υπολογισμός ποσοστών ενδοπληθυσμιακής (Hpop/ Hsp) και διαπληθυσμιακής ((Hsp-Hpop)/ Hsp) παραλλακτικότητας. Δίδονται και οι σταθμισμένοι μέσοι όροι των παραπάνω. Πίνακας 8: Πλήθος των πολυμορφικών ζωνών που ενισχύει κάθε εκκινητής σε κάθε πληθυσμό και ποσοστά τους επί τοις εκατό, παραλλακτικότητα h κατά Nei (και unbiased τιμές), δείκτες φαινοτυπικής παραλλακτικότητας Shannon Ho για κάθε πληθυσμό ανά εκκινητή, καθώς και μέση ενδοπληθυσμιακή παραλλακτικότητα Shannon 66

73 Αποτελέσματα IV.2.2 Ανάλυση Μοριακής Παραλλακτικότητας (AMOVA) Η γενετική απόσταση ή ομοιότητα μεταξύ δύο γενοτύπων, πληθυσμών και ατόμων μπορεί να υπολογιστεί με διάφορα στατιστικά μεγέθη. Η επιλογή της κατάλληλης μεθόδου εξαρτάται από τον τύπο των δεδομένων και την κλίμακα μέτρησης και είναι πολύ σημαντικό συστατικό στην ανάλυση της γενετικής παραλλακτικότητας ενός συνόλου γενοτύπων. Στην περίπτωση των μοριακών δεικτών, ειδικά των κυρίαρχων όπου τα δεδομένα είναι δυαδικής μορφής, η Ευκλείδεια απόσταση που βασίζεται στον απλό συντελεστή ομοιότητας ή simple matching coefficient των Sokal και Michener (1958), χρησιμοποιείται αρκετά συχνά. Σε αυτήν λαμβάνονται υπόψη οι ομοιότητες και οι διαφορές των ατόμων, με την ίδια βαρύτητα, και δίνεται από τον τύπο: GD SM = 1 [(N 11 + N 00 )/(N 11 + N 10 + N 01 + N 00 )], όπου N 11, N 00 ο αριθμός των ζωνών (loci) που είναι παρούσες ή απουσιάζουν αντίστοιχα και στα δύο άτομα και N 10, N 01 ο αριθμός των ζωνών που είναι παρούσες στο ένα από τα δύο άτομα (Mohammadi and Prasanna, 2003). Συνεπώς, το άθροισμα N 11 + N 10 + N 01 + N 00 εκφράζει το συνολικό αριθμό των ζωνών που ενισχύονται από τους εκκινητές στο σύνολο των ατόμων που μελετώνται. Το γεγονός ότι δίδεται η ίδια βαρύτητα στις ομοιότητες παρουσίας και απουσίας ζώνης αποτελεί ένα μειονέκτημα για τη μέθοδο, όσον αφορά στους κυρίαρχους δείκτες, καθότι ο null φαινότυπος μπορεί να οφείλεται σε διάφορες αιτίες και επομένως αντικατοπτρίζει περισσότερο ομοιότητα από τη φύση, παρά ομοιότητα από προέλευση (Mohammadi and Prasanna, 2003). Ωστόσο, γενικά αυτό το συχνό και χαρακτηριστικό για τους κυρίαρχους δείκτες φαινόμενο της ομοπλασίας αλληλομόρφων (allele homoplasy) περιορίζεται σε ενδοειδικές συγκρίσεις (Van der Voort et al., 1997, Veckemans et al., 2002, Mendelson and Shaw, 2005), όπως στο θέμα που εξετάζεται εδώ, ενώ γίνεται εντονότερο με την αύξηση της ταξινομικής απόστασης (Mechanda et al., 2004). Το GenAlEx υπολογίζει τις γενετικές αποστάσεις βάση αυτής της μεθόδου, ουσιαστικά είναι το άθροισμα από όλες τις θέσεις των διαφορών μεταξύ των ατόμων (Huff et al., 1993). Αυτή η μήτρα των Ευκλείδειων γενετικών αποστάσεων χρησιμοποιείται στην AMOVA και τον υπολογισμό των τιμών παραλλακτικότητας Φ ΡΤ, όπως περιγράφεται στις αμέσως επόμενες παραγράφους, καθώς και σε περαιτέρω αναλύσεις. Η ανάλυση της μοριακής παραλλακτικότητας (AMOVA) επιτρέπει την εκτίμηση των F- statistics, καθώς και τον ιεραρχικό επιμερισμό της γενετικής παραλλακτικότητας στους πληθυσμούς και τις γεωγραφικές περιοχές, χρησιμοποιώντας δεδομένα από όλους τους τύπους γενετικών δεικτών (κυρίαρχους και συγκυρίαρχους). Στην περίπτωση δυαδικών δεδομένων, το αντίστοιχο του F ST μέγεθος, όσον αφορά το στατιστικό πρόγραμμα που χρησιμοποιήθηκε, είναι το Φ ΡΤ (Peakall and Smouse, 2012). Στην AMOVA η μηδενική υπόθεση Η0 είναι πως δεν υπάρχει γενετική διαφοροποίηση (Φ ΡΤ = 0). Οι πληθυσμοί θεωρούνται πως είναι αυθαίρετες ομάδες που ελήφθησαν από μια γονιδιακή δεξαμενή, επομένως είναι μέρος ενός μεγάλου παμμεικτικού πληθυσμού. Συνεπώς, αν τυχαιοποιήσουμε τα δείγματά μας και εφαρμόσουμε την AMOVA σε κάθε περίπτωση, θα λάβουμε παρόμοιες τιμές, όπως όταν έχουμε να κάνουμε με έναν και μόνο πληθυσμό που διασταυρώνεται τυχαία, με μικρές διαφοροποιήσεις λόγω δειγματοληψίας. 67

74 Αποτελέσματα Με αυτόν τον τρόπο, την τυχαία μετάθεση των δειγμάτων, πραγματοποιείται και ο στατιστικός έλεγχος στην ανάλυση μέσω AMOVA. Εάν η παρατηρηθείσα τιμή είναι μεγαλύτερη από το 95% ή και περισσότερο των αποτελεσμάτων των τυχαίων μεταθέσεων, τη θεωρούμε και στατιστικά σημαντική σε επίπεδο 5%. Εδώ, ο έλεγχος της σημαντικότητας γίνεται με 100 ανεξάρτητες εκτελέσεις της μεθόδου (με τα πραγματικά δεδομένα και 99 τυχαίες επαναλήψεις-μεταθέσεις των ατομικών δειγμάτων). Στην πρώτη περίπτωση, δεν ελήφθη υπόψη η γεωγραφική κατανομή και η απόσταση των πληθυσμών. Ακολουθούν τα αποτελέσματα της AMOVA στον πίνακα 9: Βαθμοί Άθροισμα Μέσο Άθροισμα Εκτιμηθείσα Πηγή Παραλλακτικότητας Ελευθερίας (df) Τετραγώνων (SS) Τετραγώνων (MS) Παραλλακτικότητα % Διαπληθυσμιακή , ,363 39,928 66,30 Ενδοπληθυσμιακή ,500 20,296 20,296 33,70 Σύνολο ,404 60, ,00 Πληθυσμοί P1 P2 P3 P4 P5 P6 P7 P8 P9 Μέγεθος (n) Άθροισμα 306,833 Τετραγώνων (SSWP) 362, , , , , , , ,000 Παραλλακτικότητα% 18,049 21,317 19,739 21,320 20,137 20,627 16,485 20,703 22,941 Πίνακας 9: Ανάλυση της μοριακής παραλλακτικότητας (AMOVA) των 156 ατομικών φυτών που ελήφθησαν δειγματοληπτικά από εννέα πληθυσμούς Sideritis raeseri, χρησιμοποιώντας τις 283 ζώνες που ενισχύθηκαν από τους 12 URP εκκινητές. Για κάθε πηγή παραλλακτικότητας αναφέρονται οι βαθμοί ελευθερίας, το άθροισμα των τετραγώνων, το μέσο άθροισμα των τετραγώνων, η εκτιμηθείσα παραλλακτικότητα, καθώς και η μετατροπή της σε ποσοστό επί τοις εκατό. Επιπλέον, για κάθε πληθυσμό αναγράφεται το μέγεθος του, το άθροισμα των τετραγώνων και η ενδοπληθυσμιακή παραλλακτικότητα. Το ολικό Φ ΡΤ ισούται με 0,663, με P-value = 0,010 και σύμφωνα με τα δεδομένα του Πίνακα 8, η ενδοπληθυσμιακή παραλλακτικότητα φτάνει το 33,70%, ενώ η διαπληθυσμιακή το 66,30%, ποσοστά στατιστικά σημαντικά σε επίπεδο 1%. Τα αποτελέσματα συνάδουν με αυτά που προηγήθηκαν με τους δείκτες φαινοτυπικής παραλλακτικότητας του Shannon. Ομοίως, η κατάταξη των πληθυσμών συμπίπτει με εκείνες όπου οι αντίστοιχες τιμές υπολογίστηκαν με τους τύπους του Nei και του Shannon. Τη μικρότερη ενδοπληθυσμιακή παραλλακτικότητα επομένως την εμφανίζει ο πληθυσμός Ρ7 (16,485%) και τη μεγαλύτερη ο Ρ9 (22,941%). Οι τιμές γενικά συμπίπτουν με τις αντίστοιχες βάση του δείκτη Shannon. Υπολογίστηκαν ακόμα οι επιμέρους τιμές του Φ ΡΤ ανά ζεύγη πληθυσμών, οι οποίες συνοψίζονται στον Πίνακα 10. Όλες ήταν στατιστικά σημαντικές σε επίπεδο 1%, που σημαίνει πως όλοι οι πληθυσμοί διαφοροποιούνται μεταξύ τους. Η μικρότερη διαφοροποίηση παρουσιάστηκε στα ζεύγη Ρ6-Ρ8 και Ρ2-Ρ5 (0,618), ενώ η μεγαλύτερη μεταξύ των Ρ1 και Ρ5 (0,699) και ο μέσος όρος ήταν επίσης 0,663. Φαίνεται δε πως γενικά ο πληθυσμός Ρ1 διαφοροποιείται περισσότερο από τους υπόλοιπους, ακολουθούμενος από τον Ρ4, ενώ ο Ρ9 είναι ο λιγότερο διαφοροποιημένος. Εκ πρώτης όψεως, δε φαίνεται να εξαρτάται η διαφοροποίηση των πληθυσμών από τη γεωγραφική απόστασή τους, σύμφωνα με τα δεδομένα του Πίνακα 10, η γενική εικόνα δηλαδή είναι πως όλοι οι πληθυσμοί φαίνεται να διαφοροποιούνται στα ίδια επίπεδα. 68

75 Αποτελέσματα Πληθυσμός P1 P2 P3 P4 P5 P6 P7 P8 P9 P1 31,146 24,674 13,144 27,653 70, ,028 65,724 72,700 P2 0,688 29,108 30,216 25,705 42, ,198 35,382 44,551 P3 0,690 0,662 12,140 43,667 53, ,609 54,174 44,551 P4 0,687 0,662 0,665 36,820 63, ,445 61,158 65,891 P5 0,699 0,618 0,663 0,662 67, ,136 57,606 68,790 P6 0,656 0,620 0,653 0,660 0, ,906 15,128 3,735 P7 0,676 0,671 0,685 0,694 0,665 0, , ,200 P8 0,665 0,663 0,646 0,682 0,679 0,618 0,680 13,852 P9 0,664 0,635 0,671 0,648 0,646 0,633 0,638 0,665 Πίνακας 10: Τιμές παραλλακτικότητας ΦΡΤ ανά ζεύγη πληθυσμών (κάτω από τη διαγώνιο), καθώς και οι γεωγραφικές τους αποστάσεις σε km (πάνω από τη διαγώνιο). Εναλλακτικά, οι πληθυσμοί θεωρούνται κατανεμημένοι σε 8 γεωγραφικές ομάδες: οι ελληνικοί πληθυσμοί Ρ1 έως Ρ5 ανήκουν ο καθένας σε ξεχωριστή περιοχή, όπως και οι πληθυσμοί της ΠΓΔΜ Ρ7 και Ρ8, ενώ οι εναπομείναντες δύο πληθυσμοί της ΠΓΔΜ (Ρ6, Ρ9) ομαδοποιούνται σε μια περιοχή, λόγω της αρκετά πιο μικρής γεωγραφικής τους απόστασης (< 10 km), σε σχέση με τις υπόλοιπες αποστάσεις. Τα αποτελέσματα της AMOVA παρατίθενται στον Πίνακα 11 που ακολουθεί. Πηγή Παραλλακτικότητας Βαθμοί Ελευθερίας (df) Άθροισμα Τετραγώνων (SS) Μέσο Άθροισμα Τετραγώνων (MS) Εκτιμηθείσα Παραλλακτικότητα Γεωγραφική περιοχή , ,082 2,272 3,77 Διαπληθυσμιακή 1 699, ,333 37,724 62,57 Ενδοπληθυσμιακή ,500 20,296 20,296 33,66 Σύνολο ,404 60, Πίνακας 11: Ανάλυση της μοριακής παραλλακτικότητας (AMOVA) των 156 ατομικών φυτών που ελήφθησαν δειγματοληπτικά από εννέα πληθυσμούς Sideritis raeseri, χρησιμοποιώντας τις 283 ζώνες που ενισχύθηκαν από τους 12 URP εκκινητές. Για κάθε πηγή παραλλακτικότητας αναφέρονται οι βαθμοί ελευθερίας, το άθροισμα των τετραγώνων, το μέσο άθροισμα των τετραγώνων, η εκτιμηθείσα παραλλακτικότητα, καθώς και η μετατροπή της σε ποσοστό επί τοις εκατό. Σε αυτήν την περίπτωση, υπάρχει διαφοροποίηση των περιοχών μεταξύ τους που εκφράζεται με την τιμή Φ RT = 0,038, των πληθυσμών μιας περιοχής με Φ PR = 0,650 και των πληθυσμών στο σύνολό τους με Φ ΡΤ = 0,663, με P-values = 0,010. Το ποσοστό της ενδοπληθυσμιακής παραλλακτικότητας επομένως που δε μεταβάλλεται ιδιαίτερα, είναι στο 33,66%, ενώ υπάρχει ένα μικρό ποσοστό της τάξεως του 3,77% της παραλλακτικότητας που αποδίδεται στη γεωγραφική κατανομή των πληθυσμών και τέλος στο μεγαλύτερο ποσοστό της, συγκεκριμένα στο 62,57%, η παραλλακτικότητα οφείλεται στη διαφοροποίηση των εννέα πληθυσμών μεταξύ τους. Τα ποσοστά ήταν στατιστικά σημαντικά σε επίπεδο 1%. Διαγραμματικά, τα αποτελέσματα της AMOVA και στις δύο περιπτώσεις παρουσιάζονται στην Εικόνα 15. % 69

76 Αποτελέσματα α) Within Pops 33,70% β) Within Pops 33,66% Among Regions 3,77% Among Pops 66,30% Among Pops 62,57% Εικόνα 15: Κατανομή της παραλλακτικότητας στις πηγές της, σύμφωνα με την Ανάλυση Μοριακής Παραλλακτικότητας (AMOVA). Διακρίνουμε δύο περιπτώσεις: α) χωρίς να συνυπολογιστεί η περιοχή στις πηγές παραλλακτικότητας και β) με την περιοχή να συμπεριλαμβάνεται στις πηγές παραλλακτικότητας. IV.2.3 Έλεγχος του Mantel Υπάρχουν διάφορες αναλυτικές μέθοδοι που χρησιμοποιούνται για την μελέτη της γενετικής διασποράς. Η χωρική αυτοσυσχέτιση (Sokal and Neal 1978) και οι έλεγχοι του Mantel (Mantel 1967) βασίζονται στα άτομα και όχι στους πληθυσμούς, έτσι δεν περιορίζονται από την ανάγκη της γνώσης σχετικά με τα όρια των πληθυσμών, σε αντίθεση με τις κλασικές μεθόδους (Manel et al. 2003). Αυτές οι διαδικασίες χρησιμοποιούν δεδομένα γεωγραφικών και γενετικών αποστάσεων προκειμένου να περιγράψουν τη μικρογεωγραφική γενετική χωρική δομή εντός του πληθυσμού και έχουν χρησιμοποιηθεί για τη διερεύνηση της διασποράς, του συστήματος αναπαραγωγής και των φραγμών στη γονιδιακή ροή στη χωρική γενετική δομή εντός και μεταξύ των πληθυσμών (Double et al., 2005). Ο έλεγχος του Mantel εξετάζει τη στατιστική σχέση που μπορεί να έχουν δύο οποιεσδήποτε μήτρες αποστάσεων με αντιστοιχία δεδομένων (Mantel, 1967). Η μέθοδος αυτή υπερσκελίζει την μη-ανεξαρτησία των δεδομένων εντός της μήτρας και υπολογίζει έναν συντελεστή συσχέτισης ο οποίος αξιολογείται με έλεγχο σημαντικότητας μέσω τυχαιοποίησης δεδομένων (Manly, 1991), αντίστοιχο της AMOVA. Το τεστ του Mantel βασίζεται στη γραμμική συσχέτιση, επομένως υπόκειται στις ίδιες προϋποθέσεις που αφορούν και στην κοινή συσχέτιση του Pearson (Mohammadi and Prasanna, 2003). Στην περίπτωση του Mantel, η μηδενική υπόθεση είναι πως δεν υπάρχει συσχέτιση μεταξύ των αντίστοιχων δεδομένων στις δύο μήτρες (Rxy = 0). Ωστόσο, επειδή ο έλεγχος της χωρικής εξάρτησης στο απλό τεστ του Mantel είναι ουσιαστικά ένας μέσος όρος που αφορά στο σύνολο των αποστάσεων, δεν είναι δυνατή η ανίχνευση μεταβολών στα μοτίβα συσχέτισης σε διαφορετικές κλίμακες (Mohammadi and Prasanna, 2003). Με αυτή τη μέθοδο μπορεί να μελετηθεί η πιθανότητα της απομόνωσης λόγω απόστασης (isolation by distance), όπου συγκρίνονται γεωγραφικές και γενετικές αποστάσεις, να συγκριθούν θέσεις (loci) ή και δεδομένα από διαφορετικούς τύπους 70

77 LinGD Αποτελέσματα μοριακών δεικτών ή ακόμα και διαφορετικά στατιστικά μεγέθη, π.χ. Φ ΡΤ με γενετική απόσταση D του Nei. Σχετικά με τα δεδομένα μας, ο έλεγχος του Mantel δεν έδειξε κάποια σημαντική συσχέτιση μεταξύ των τιμών Φ ΡΤ και της γεωγραφικής απόστασης των εννιά πληθυσμών (Rxy = 0,282, P-value = 0,150 για 99 επαναλήψεις). Όταν δε συγκρίθηκαν οι γεωγραφικές με τις γραμμικές Ευκλείδειες γενετικές αποστάσεις των 156 δειγμάτων, όπως προτείνεται από τους Blyton και Flanagan στο εγχειρίδιο της 6.5 έκδοσης του GenAlex (http://biology.anu.edu.au/genalex), εντοπίστηκε μια στατιστικά σημαντική, πολύ μικρή όμως θετική συσχέτιση (Rxy = 0,302, P-value = 0,010 για 99 επαναλήψεις, Εικόνα 16). 14,000 12,000 10,000 8,000 6,000 4,000 2,000 y = 0,0086x + 9,9909 R² = 0,0915 0,000 0,000 50, , , , ,000 GGD Εικόνα 16: Γράφημα όπου αναπαριστώνται οι γραμμικές τιμές της γενετικής απόστασης (LinGD) σε συνάρτηση της γεωγραφικής απόστασης (GGD) όλων των ζευγών των ατόμων και των 9 πληθυσμών Sideritis raeseri. IV.2.4 Πολυπαραγοντικές Μέθοδοι Ανάλυσης Η χρήση πολυπαραγοντικών στατιστικών αλγορίθμων είναι μια σημαντική στρατηγική στην ταξινόμηση του γενετικού υλικού, την κατάταξη της παραλλακτικότητας για ένα μεγάλο αριθμό γενοτύπων ή και στην ανάλυση των γενετικών σχέσεων μεταξύ τους. Οι πολυπαραγοντικές αναλυτικές τεχνικές που αναλύουν ταυτόχρονα πολλαπλά δεδομένα για το καθένα υπό εξέταση άτομο χρησιμοποιούνται ευρέως στην ανάλυση της γενετικής παραλλακτικότητας, ανεξάρτητα της φύσης των δεδομένων που έχουμε (Mohammadi and Prasanna, 2003). IV Ανάλυση σε Ομάδες (Cluster Analysis) Η ανάλυση σε ομάδες, σύμφωνα με τον ορισμό που διατυπώνεται στη δημοσίευση του Hair και των συνεργατών του (1995), αναφέρεται σε μια ομάδα πολυπαραγοντικών τεχνικών των οποίων ο κύριος σκοπός είναι να ομαδοποιήσουν τα άτομα βάση των χαρακτηριστικών που έχουν, έτσι ώστε τα άτομα με παρόμοια χαρακτηριστικά να βρίσκονται στην ίδια ομάδα. Ως αποτέλεσμα μιας επιτυχούς ταξινόμησης, θα πρέπει να παρατηρείται υψηλή ομοιογένεια εντός των ομάδων, ενώ μεταξύ των ομάδων υψηλή ετερογένεια. 71

78 Αποτελέσματα Οι μέθοδοι διακρίνονται σε εκείνες που βασίζονται στην απόσταση, που είναι και οι πιο κοινές και σε αυτές που βασίζονται σε κάποιο μοντέλο. Οι μεν πρώτες κατηγοριοποιούνται περαιτέρω σε ιεραρχικές και μη-ιεραρχικές. ΙV Η Μέθοδος UPGMA Οι πιο γνωστές και κοινές μέθοδοι που ανήκουν στην κατηγορία των ιεραρχικών μεθόδων ανάλυσης που βασίζονται στην απόσταση, είναι η UPGMA (Unweighted Pair- Group Method with Arithmetic mean) και η Neighbor-Joining. Η δεύτερη χρησιμοποιείται κυρίως για φυλογενετικές μελέτες και όχι τόσο για ενδοειδική παραλλακτικότητα (Liu et al., 2000). Όπως σε όλες τις μεθόδους της κατηγορίας της, έτσι και στη UPGMA ο αλγόριθμος ομαδοποίησης χρησιμοποιεί τα δεδομένα μιας μήτρας αποστάσεων ζευγών (Johnson and Wichern, 1992). Το αποτέλεσμα, μέσω μιας διαδικασίας διαδοχικών συγχωνεύσεων ομάδων ατόμων, είναι μια γραφική αναπαράσταση με μορφή δενδρογράμματος, στο οποίο οι ομάδες μπορούν να διακριθούν οπτικά. Η εν λόγω μέθοδος δηλαδή ξεκινά με τόσες ομάδες όσα είναι και τα άτομα (Mohammadi and Prasanna, 2003). Τα δεδομένα της μήτρας Ευκλείδειων αποστάσεων του GenAlEx εξήχθησαν στο πρόγραμμα MEGA, όπου και κατασκευάστηκε το φυλογενετικό δένδρο των πληθυσμών με τη μέθοδο UPGMA, το οποίο αποδίδεται στην Εικόνα 17. Όλα τα άτομα κάθε πληθυσμού ομαδοποιούνται μεταξύ τους, επομένως φαίνεται να είναι περισσότερο γενετικά όμοια από ότι άτομα που ανήκουν σε διαφορετικούς πληθυσμούς. Ο Ρ4, ακολουθούμενος από τον Ρ9, είναι οι πιο απομακρυσμένοι γενετικά πληθυσμοί σε σχέση με τους υπόλοιπους, ενώ διακρίνονται ως περισσότερο γενετικά όμοιοι, ο Ρ6 με τον Ρ8, ο Ρ2 με τον Ρ5 (και τα δύο αυτά ζεύγη ανταποκρίνονται στις χαμηλότερες τιμές Φ ΡΤ, βλ. Πίνακα 10) και ο Ρ1 με τον Ρ7. 72

79 Αποτελέσματα Ρ6 Ρ8 Ρ7 Ρ1 Ρ3 Ρ2 Ρ5 Ρ9 Ρ Εικόνα 17: Δενδρόγραμμα απεικόνισης των αποστάσεων των εννιά πληθυσμών Sideritis raeseri με τη μέθοδο UPGMA. 73

80 Αποτελέσματα ΙV Μέθοδος βασισμένη σε Παραμετρικό Μοντέλο - STRUCTURE Στις μεθόδους που βασίζονται σε μοντέλα, οι παρατηρήσεις κάθε ομάδας (cluster) υποτίθεται πως είναι τυχαία επιλεγμένες από κάποιο παραμετρικό μοντέλο. Χρησιμοποιώντας βασικές στατιστικές μεθόδους, όπως τη μέγιστη πιθανοφάνεια ή τη Μπεϋσιανή (Bayesian) μέθοδο, μπορούν να εξαχθούν συμπεράσματα σχετικά με τις αντίστοιχες παραμέτρους της κάθε ομάδας και της συμμετοχής κάθε ατόμου στην ομάδα (Mohammadi and Prasanna, 2003). Οι Pritchard και οι συνεργάτες του (2000) περιέγραψαν μια τέτοια μέθοδο ομαδοποίησης που βασίζεται σε μοντέλο και σε Μπεϋσιανή στατιστική, όπου χρησιμοποιούνται ως δεδομένα γενότυποι πολλαπλών μη συνδεδεμένων μεταξύ τους θέσεων (loci), ώστε να συμπεράνει κανείς για την πληθυσμιακή δομή. Η ισχύς αυτής της προσέγγισης οφείλεται στην αποτελεσματική ανάλυση της πληθυσμιακής δομής, στην ακριβή ομαδοποίηση και στην κατηγοριοποίηση κάθε ατόμου στον κατάλληλο πληθυσμό, καθώς και στην αναγνώριση μεταναστευτικών ατόμων (migrants) και ατόμων μεικτής προέλευσης (admixed individuals). Με αυτή τη μέθοδο, είναι δυνατή η εκτίμηση της συνεισφοράς συγκεκριμένου πληθυσμού στο γονιδίωμα ενός ατόμου. Η μέθοδος εξελίχθηκε ακόμα περισσότερο από τους Falush et al. το 2003 όπου αυξήθηκε η ευαισθησία της, ενώ παρέχεται πλέον η δυνατότητα να συμπεριλαμβάνονται συνδεδεμένες θέσεις στην ανάλυση. Το 2007, οι ίδιοι περιγράφουν τον Markov Chain Monte Carlo (MCMC) αλγόριθμο που ανέπτυξαν ειδικά για την ανάλυση δεδομένων που προέρχονται από κυρίαρχους δείκτες. Στο πρόγραμμα STRUCTURE που χρησιμοποιήθηκε, ο αλγόριθμος εκτελέστηκε θεωρώντας το μοντέλο μεικτής καταγωγής (admixture model), σύμφωνα με το οποίο τα άτομα μπορεί να έχουν μεικτή προέλευση. Έτσι, το άτομο i έχει ουσιαστικά κληρονομήσει ένα ποσοστό του γονιδιώματός του από προγόνους που ανήκουν στον πληθυσμό k. Ως αποτέλεσμα λαμβάνεται η εκ των υστέρων μέση εκτίμηση αυτών των αναλογιών, με την προϋπόθεση πως η προέλευση κάθε αλληλομόρφου είναι ανεξάρτητη. Αυτό το μοντέλο προτείνεται ως εναρκτήριο για τις περισσότερες αναλύσεις. Είναι ένα λογικά ευέλικτο μοντέλο για την αντιμετώπιση της πολυπλοκότητας που υπάρχει στους πραγματικούς πληθυσμούς, καθότι η ανάμειξη είναι κάτι που συμβαίνει συχνά. Επιπλέον, χρησιμοποιήθηκε το μοντέλο των συσχετισμένων συχνοτήτων των Falush et al. (2003) όπου οι συχνότητες σε διαφορετικούς πληθυσμούς είναι πιθανό να είναι όμοιες, λόγω μετανάστευσης ή κοινών προγόνων. Στην Εικόνα 18 αποτυπώνεται η κατανομή των 156 δειγμάτων σε 9 ομάδες, όπως προέκυψε από τα αποτελέσματα του λογισμικού STRUCTURE. Σύμφωνα με αυτά, αλλά και με το πρόγραμμα STRUCTURE HARVESTER (Earl and VonHoldt, 2012), η πιθανότητα να ομαδοποιούνται τα δείγματα σε K = 9 ομάδες ήταν η μέγιστη (Εικόνα 18, 19 Πίνακας 12). Τα άτομα κάθε πληθυσμού ταξινομούνται στην ίδια ομάδα και σε ποσοστό μεγαλύτερο του 95%, γεγονός που επιβεβαιώνει το δενδρόγραμμα UPGMA. 74

81 DeltaK Πιθανότητα ταξινόμησης Αποτελέσματα Πληθυσμός Εικόνα 18: Ραβδόγραμμα των μέσων πιθανοτήτων ταξινόμησης των δειγμάτων σε ομάδες με τη χρήση των δεδομένων των URP δεικτών που αναλύθηκαν με το πρόγραμμα STRUCTURE. Πίνακας 12: Τιμές ΔΚ όπως υπολογίζονται από το πρόγραμμα STRUCTURE HARVESTER βάση της μεθόδου των Evanno et al. (2005), για κάθε τιμή Κ. Επισημαίνεται η υψηλότερη τιμή του ΔΚ (ΔK=211.36), όταν K = 9. K Εικόνα 19: Διαγραμματική απεικόνιση των τιμών ΔΚ για κάθε τιμή Κ, σύμφωνα με τους Evanno et al. (2005), για την ανίχνευση του ιδανικού αριθμού των Κ ομάδων που ταιριάζει στα δεδομένα. 75



Διαβάστε περισσότερα

Αρωματικά-Φαρμακευτικά Φυτά


Διαβάστε περισσότερα

Τσάι του Βουνού (Sideritis spp)

Τσάι του Βουνού (Sideritis spp) Τσάι του Βουνού (Sideritis spp) Δημήτριος Σιούλας, Χημικός, MSc Αγορίτσα Σχιζοδήμου, Χημικός Μηχ/κός, MSc, Υποψήφια Διδάκτορας Ονομασία Είδη Το τσάι του βουνού ανήκει στην οικογένεια των χειλανθών (Lαmiαceαe)

Διαβάστε περισσότερα

«Ο αιθέριος θησαυρός του τόπου μας». Ηλίας Ντζάνης, Γεωπόνος πρ. πρ/νος Κ.Σ.Ε Αγρινίου ΔΗΜΗΤΡΑ (ΕΘΙΑΓΕ)

«Ο αιθέριος θησαυρός του τόπου μας». Ηλίας Ντζάνης, Γεωπόνος πρ. πρ/νος Κ.Σ.Ε Αγρινίου ΔΗΜΗΤΡΑ (ΕΘΙΑΓΕ) Τα Αρωματικά Φυτά. «Ο αιθέριος θησαυρός του τόπου μας». Τάσεις Προοπτικές. Ηλίας Ντζάνης, Γεωπόνος πρ. πρ/νος Κ.Σ.Ε Αγρινίου ΔΗΜΗΤΡΑ (ΕΘΙΑΓΕ) τα ερωτήματα: 1. Τι είναι Αρωματικά-φαρμακευτικά φυτά? 2.

Διαβάστε περισσότερα

Χρυσή Γαβριέλη, Εργαστήριο Φαρµακογνωσίας, Τµήµα Φαρµακευτικής, Σχολή Επιστηµών Υγείας, Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης, 54006 Θεσσαλονίκη

Χρυσή Γαβριέλη, Εργαστήριο Φαρµακογνωσίας, Τµήµα Φαρµακευτικής, Σχολή Επιστηµών Υγείας, Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης, 54006 Θεσσαλονίκη 1 Φυσικοχηµική και Φαρµακολογική Μελέτη του Φυτού Sideritis raeseri ssp. raeseri «Τσάι του Βουνού» Χρυσή Γαβριέλη, Εργαστήριο Φαρµακογνωσίας, Τµήµα Φαρµακευτικής, Σχολή Επιστηµών Υγείας, Αριστοτέλειο Πανεπιστήµιο

Διαβάστε περισσότερα

Ρίγανη. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ.

Ρίγανη. Τζουραµάνη Ε., Ναβρούζογλου Π., Σιντόρη Αλ., Λιοντάκης Αγ., Παπαευθυµίου Μ. Καρανικόλας Π. και Αλεξόπουλος Γ. Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596 Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα

Αρωµατικά Φυτά: Ο αιθέριος θησαυρός του τόπου µας -Τάσεις και προοπτικές

Αρωµατικά Φυτά: Ο αιθέριος θησαυρός του τόπου µας -Τάσεις και προοπτικές 1 Αρωµατικά Φυτά: Ο αιθέριος θησαυρός του τόπου µας -Τάσεις και προοπτικές Χρήστος όρδας Αριστοτέλειο Πανεπιστήµιο Θεσσαλονίκης Γεωπονική Σχολή Εργαστήριο Γεωργίας 2 Αντικείµενο της οµιλίας Σηµασία των

Διαβάστε περισσότερα

Καλλιέργεια ελληνικών αρωματικών / φαρμακευτικών φυτών

Καλλιέργεια ελληνικών αρωματικών / φαρμακευτικών φυτών Καλλιέργεια ελληνικών αρωματικών / φαρμακευτικών φυτών Δρ. Κατερίνα Γρηγοριάδου Γεωπόνος Βιοτεχνολόγος http://myrtisfytoria.com e-mail: info@myrtisfytoria.com Γιατί καλλιέργεια των ελληνικών αρωματικών/φαρμακευτικών

Διαβάστε περισσότερα

Αξιοποίηση των ελληνικών φυτών

Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.)

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών (ΕΘ.Ι.ΑΓ.Ε.) Δρ Ελένη Μαλούπα, Τακτική Ερευνήτρια ΕΘΙΑΓΕ Fritilaria pontica Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών

Διαβάστε περισσότερα

Διατήρηση και αξιοποίηση των ελληνικών αρωματικών και φαρμακευτικών ειδών

Διατήρηση και αξιοποίηση των ελληνικών αρωματικών και φαρμακευτικών ειδών ΗΜΕΡΙΔΑ «ΥΓΡΟΤΟΠΟΙ ΚΑΙ ΓΕΩΡΓΙΑ: ΣΥΝΕΡΓΑΣΙΑ & ΑΝΑΠΤΥΞΗ» ΦΟΡΕΑΣ ΔΙΑΧΕΙΡΙΣΗΣ ΔΕΛΤΑ ΝΕΣΤΟΥ-ΒΙΣΤΩΝΙΔΑΣ-ΙΣΜΑΡΙΔΑΣ, Κομοτηνή, 3-2-2014 Διατήρηση και αξιοποίηση των ελληνικών αρωματικών και φαρμακευτικών ειδών

Διαβάστε περισσότερα

DIOSCURIDES OE. Μεταποίηση αρωματικών και φαρμακευτικών φυτών. Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος

DIOSCURIDES OE. Μεταποίηση αρωματικών και φαρμακευτικών φυτών. Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος DIOSCURIDES OE Μεταποίηση αρωματικών και φαρμακευτικών φυτών Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος ηιδέα ΓΕΝΙΚΑ ΔΕΔΟΜΕΝΑ 1200 Αρωματικά Φαρμακευτικά Φυτά είναι Βιομηχανικά 900 Αρωματικά Φαρμακευτικά

Διαβάστε περισσότερα

Ινστιτούτο ασικών Ερευνών. πολύτιµες ιδιότητες»

Ινστιτούτο ασικών Ερευνών. πολύτιµες ιδιότητες» ΓΕΝΙΚΗ ΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ Ινστιτούτο ασικών Ερευνών (Βασιλικά, Λουτρά Θέρµης) ρ. Ιωάννης Σπανός Τακτικός Ερευνητής «Κρανιά: Μία νέα καλλιέργεια µε πολύτιµες ιδιότητες» Λαµία, 16Μαϊου 2012 Τοποθέτηση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ημερίδα. Τετάρτη 22 Σεπτεμβρίου 2010 Αίθουσα Ένωσης Αγροτικών Συνεταιρισμών Αμύνταιου

Ημερίδα. Τετάρτη 22 Σεπτεμβρίου 2010 Αίθουσα Ένωσης Αγροτικών Συνεταιρισμών Αμύνταιου Ημερίδα Η Καλλιέργεια των αρωματικών φυτών στο Νομό Φλώρινας και η δυνατότητα αξιοποίησης των παραγόμενων πρώτων υλών τους Τετάρτη 22 Σεπτεμβρίου 2010 Αίθουσα Ένωσης Αγροτικών Συνεταιρισμών Αμύνταιου ΠΡΟΓΡΑΜΜΑ

Διαβάστε περισσότερα

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη

Τοπικές Ποικιλίες. Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία. Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες Γεωπονική Θεώρηση - O Ρόλος τους στην Σημερινή Γεωργία Πηνελόπη Μπεμπέλη Τοπικές Ποικιλίες (Εγχώριοι Πληθυσμοί) Είναι ετερογενείς πληθυσμοί Είναι τοπικά προσαρμοσμένοι Έχουν δημιουργηθεί

Διαβάστε περισσότερα

ΣΥΚΙΑ. Γραμματικός Διονύσιος, Γεωπόνος, Msc Τμήμα Αμπέλου & Ξ. Κ. Δ/νση ΠΑΠ Δενδροκηπευτικής

ΣΥΚΙΑ. Γραμματικός Διονύσιος, Γεωπόνος, Msc Τμήμα Αμπέλου & Ξ. Κ. Δ/νση ΠΑΠ Δενδροκηπευτικής ΣΥΚΙΑ Γραμματικός Διονύσιος, Γεωπόνος, Msc Τμήμα Αμπέλου & Ξ. Κ. Δ/νση ΠΑΠ Δενδροκηπευτικής ΒΟΤΑΝΙΚΟΙ ΧΑΡΑΚΤΗΡΕΣ Τάξη των Αγγειόσπερμων Δικότυλων φυτών. Οικογένεια Moraceae, γένος Ficus, είδος Carica.

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

Αειφορία και Αγροτική ανάπτυξη Δρ Ηλίας Ελευθεροχωρινός, Καθηγητής, Εργαστήριο Γεωργίας, Γεωπονική Σχολή, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης

Αειφορία και Αγροτική ανάπτυξη Δρ Ηλίας Ελευθεροχωρινός, Καθηγητής, Εργαστήριο Γεωργίας, Γεωπονική Σχολή, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Αειφορία και Αγροτική ανάπτυξη Δρ Ηλίας Ελευθεροχωρινός, Καθηγητής, Εργαστήριο Γεωργίας, Γεωπονική Σχολή, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Αειφορία και Αγροτική ανάπτυξη Αειφόρος αγροτική ανάπτυξη

Διαβάστε περισσότερα

3ο ΓΥΜΝΑΣΙΟ ΜΥΤΙΛΗΝΗΣ ΠΡΟΓΡΑΜΜΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΘΕΜΑ: Ο ελαιώνας ως οικοσύστημα: φυτά, πτηνά, θηλαστικά

3ο ΓΥΜΝΑΣΙΟ ΜΥΤΙΛΗΝΗΣ ΠΡΟΓΡΑΜΜΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΘΕΜΑ: Ο ελαιώνας ως οικοσύστημα: φυτά, πτηνά, θηλαστικά 3ο ΓΥΜΝΑΣΙΟ ΜΥΤΙΛΗΝΗΣ ΠΡΟΓΡΑΜΜΑ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΘΕΜΑ: Ο ελαιώνας ως οικοσύστημα: φυτά, πτηνά, θηλαστικά Στάδια Προγράμματος Καθορισμός Θέματος Ομάδων εργασίας Συλλογή υλικού σχετικού με το

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΣΠΟΥΔΩΝ e-school by Agronomist.gr


Διαβάστε περισσότερα


ΕΙΣΑΓΩΓΗ ΣΤΗ ΦΥΤΟΓΕΩΓΡΑΦΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΦΥΤΟΓΕΩΓΡΑΦΙΑ ΑΝΤΙΚΕΙΜΕΝΑ ΤΗΣ ΦΥΤΟΓΕΩΓΡΑΦΙΑΣ Χωρολογία των φυτών Εξελικτική ή ιστορική φυτογεωγραφία Φυτοκοινωνιολογία Οικολογική φυτογεωγραφία Η ΠΕΡΙΟΧΗ ΕΞΑΠΛΩΣΗΣ 1) Η ερμηνεία της περιοχής

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βότανα της Κρήτης, ένας ανεκμετάλλευτος πλούτος;

Βότανα της Κρήτης, ένας ανεκμετάλλευτος πλούτος; Βότανα της Κρήτης, ένας ανεκμετάλλευτος πλούτος; Δρ. Κώστας Δ. Οικονομάκης Γεωπόνος, τέως Τακτικός Ερευνητής ΕΘΙΑΓΕ c.economakis@yahoo.gr Α) ΠΑΡΟΎΣΑ ΚΑΤΆΣΤΑΣΗ Η αρωματική-φαρμακευτική χλωρίδα της Κρήτης

Διαβάστε περισσότερα

Καινοτόμα προϊόντα από αρωματικά και φαρμακευτικά φυτά της ελληνικής χλωρίδας Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος Dioscurides OE

Καινοτόμα προϊόντα από αρωματικά και φαρμακευτικά φυτά της ελληνικής χλωρίδας Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος Dioscurides OE Η συμβολή των αρωματικών και φαρμακευτικών φυτών στην ανάπτυξη της Δυτικής Μακεδονίας Καινοτόμα προϊόντα από αρωματικά και φαρμακευτικά φυτά της ελληνικής χλωρίδας Στέργιος Τζιμίκας Ιατρός διευθύνων σύμβουλος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πρόγραμμα εκπαίδευσης V-3DAS

Πρόγραμμα εκπαίδευσης V-3DAS Πρόγραμμα εκπαίδευσης V-3DAS 3. Συστήματα Πιστοποίησης της Ποιότητας Ιχνηλασιμότητας των Αγροτικών Προϊόντων 3.4. Συστήματα Παραγωγής και Πιστοποίησης Βιολογικών Προϊόντων 3.4.1. Νομοθετικό πλαίσιο, Κανονισμοί

Διαβάστε περισσότερα

Η αχλαδιά αφού φυτευτεί στο χωράφι κλαδεύεται στα 70εκ-120εκ από το έδαφος. Έκτοτε αφήνουμε το δέντρο να αναπτυχθεί μέχρι την αρχή του 3 ου

Η αχλαδιά αφού φυτευτεί στο χωράφι κλαδεύεται στα 70εκ-120εκ από το έδαφος. Έκτοτε αφήνουμε το δέντρο να αναπτυχθεί μέχρι την αρχή του 3 ου Αχλάδι Έχει πάρα πολλές ποικιλίες και υποποικιλίες. Είναι φυλλοβόλο δέντρο και ευδοκιμεί σε μέρη που δεν χαρακτηρίζονται ούτε από την υπερβολική ζέστη ούτε από το υπερβολικό κρύο. Καλλιεργείται σε όλη

Διαβάστε περισσότερα

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών

Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών ΓΕΩΤΕΧΝΙΚΟ ΕΠΙΜΕΛΗΤΗΡΙΟ ΕΛΛΑΔΑΣ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ Ελληνικά Αρωματικά Φυτά Αξιοποίηση των ελληνικών φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Δράμα, 10 και 11

Διαβάστε περισσότερα

Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης. Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης

Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης. Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης Πιστοποίηση βιολογικών προϊόντων και ολοκληρωμένης διαχείρισης Γιώργος Κράββας Δ/ντης Agrisystems Γραφείο Θεσσαλονίκης Πιστοποίηση βιολογικών προϊόντων Αρχή Εποπτείας: Υπουργείο Αγροτικής Ανάπτυξης & Τροφίμων

Διαβάστε περισσότερα

Βιολογικό Κτηνοτροφικό Ρεβίθι

Βιολογικό Κτηνοτροφικό Ρεβίθι Ινστιτούτο Γεωργοοικονοµικών και Κοινωνιολογικών Ερευνών Εθνικό Ίδρυµα Αγροτικής Έρευνας Λ. ηµοκρατίας 61, 135 61 Αγ. Ανάργυροι, Αττική Τηλ. 210 27 56 596, Fax 210 27 51 937 Email tzouramani.inagrop@nagref.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η ανάπτυξη των ενεργειακών καλλιεργειών μέσα από το βιοντίζελ και οι προοπτικές τους

Η ανάπτυξη των ενεργειακών καλλιεργειών μέσα από το βιοντίζελ και οι προοπτικές τους Η ανάπτυξη των ενεργειακών καλλιεργειών μέσα από το βιοντίζελ και οι προοπτικές τους Δρ Έφη Αλεξοπούλου Υπεύθυνη Ενεργειακών Καλλιεργειών του Τμήματος Βιομάζας ΚΑΠΕ Ενεργειακές καλλιέργειες Ετήσιες για

Διαβάστε περισσότερα

ΜΠΟΛΝΤΟ (PEUMUS BOLDUS) Βασιλείου Ιωάννα Φαρμακοποιός Μ.Ρ.Α.

ΜΠΟΛΝΤΟ (PEUMUS BOLDUS) Βασιλείου Ιωάννα Φαρμακοποιός Μ.Ρ.Α. ΜΠΟΛΝΤΟ (PEUMUS BOLDUS) Βασιλείου Ιωάννα Φαρμακοποιός Μ.Ρ.Α. ΜΠΟΛΝΤΟ (PEUMUS BOLDUS) Το μπόλντο ανήκει στην οικογένεια των Monimiaceae. Eίναι αυτοφυές της περιοχής των Άνδεων της Χιλής και του Περού, αλλά

Διαβάστε περισσότερα

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών

Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών Ελληνική Χλωρίδα: Διατήρηση και Αξιοποίηση των Αρωματικών -Φαρμακευτικών Ειδών Δρ. Ελένη Μαλούπα, Τακτική Ερευνήτρια EΛΓΟ ΔΗΜΗΤΡΑ Fritilaria pontica Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών και Ανθοκομικών

Διαβάστε περισσότερα

Η διαχρονική αξία της ελιάς για την Ελλάδα. Σταύρος Βέμμος Αναπληρωτής Καθηγητής Διευθυντής Εργαστηρίου Δενδροκομίας Γεωπονικού Πανεπιστημίου Αθηνών

Η διαχρονική αξία της ελιάς για την Ελλάδα. Σταύρος Βέμμος Αναπληρωτής Καθηγητής Διευθυντής Εργαστηρίου Δενδροκομίας Γεωπονικού Πανεπιστημίου Αθηνών Η διαχρονική αξία της ελιάς για την Ελλάδα Σταύρος Βέμμος Αναπληρωτής Καθηγητής Διευθυντής Εργαστηρίου Δενδροκομίας Γεωπονικού Πανεπιστημίου Αθηνών Η ελιά στη σύγχρονη εποχή Η Ελαιοκαλλιέργεια στην σύγχρονη

Διαβάστε περισσότερα

Προς Κοινωφελές Ίδρυμα Ιωάννη Σ. Λάτση Μελέτες 2009 ΤΕΛΙΚΗ ΕΚΘΕΣΗ

Προς Κοινωφελές Ίδρυμα Ιωάννη Σ. Λάτση Μελέτες 2009 ΤΕΛΙΚΗ ΕΚΘΕΣΗ Προς Κοινωφελές Ίδρυμα Ιωάννη Σ. Λάτση Μελέτες 2009 ΤΕΛΙΚΗ ΕΚΘΕΣΗ Ανάδειξη φυτικών εκχυλισμάτων της Ελληνικής χλωρίδας ως πιθανών θεραπειών για την οστεοπόρωση ΕΠΙΣΤΗΜΟΝΙΚΟΣ ΥΠΕΥΘΥΝΟΣ Ρωξάνη Τέντα, Χαροκόπειο

Διαβάστε περισσότερα


ΚΑΛΛΙΕΡΓΕΙΑ ΑΚΤΙΝΙΔΙΩΝ ΚΑΛΛΙΕΡΓΕΙΑ ΑΚΤΙΝΙΔΙΩΝ Το ακτινίδιο είναι θάμνος με άνθη χρώματος λευκού. Τα φύλλα του έχουν ωοειδές σχήμα και στο κάτω μέρος τους έχουν χνούδι. Ο καρπός του είναι εδώδιμος, με γλυκόξινη γεύση. Το εξωτερικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες

Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Μοριακή ταυτοποίηση Ελαιολάδων Κρήτης σε σχέση με τις καλλιεργούμενες ποικιλίες Α. Ντούλης, Ινστιτούτο Αμπέλου, Λαχανοκομίας & Ανθοκομίας Ηρακλείου (ΙΑΛΑΗ), Εθνικό Ίδρυμα Αγροτικών Ερευνών (ΕΘΙΑΓΕ) και

Διαβάστε περισσότερα

Τ.Ε.Ι. Ηπείρου Σχολή Τεχνολογίας Γεωπονίας Τμήμα Φυτικής Παραγωγής ΚΑΛΛΙΕΡΓΕΙΕΣ. Εργαστήριο 2 ο. Υλικό Καλλιέργειας. Δούμα Δήμητρα Άρτα, 2013

Τ.Ε.Ι. Ηπείρου Σχολή Τεχνολογίας Γεωπονίας Τμήμα Φυτικής Παραγωγής ΚΑΛΛΙΕΡΓΕΙΕΣ. Εργαστήριο 2 ο. Υλικό Καλλιέργειας. Δούμα Δήμητρα Άρτα, 2013 Τ.Ε.Ι. Ηπείρου Σχολή Τεχνολογίας Γεωπονίας Τμήμα Φυτικής Παραγωγής ΚΑΛΛΙΕΡΓΕΙΕΣ IN VITRO Εργαστήριο 2 ο Υλικό Καλλιέργειας Δούμα Δήμητρα Άρτα, 2013 ΥΛΙΚΟ ΚΑΛΛΙΕΡΓΕΙΑΣ o Ο ζυγώτης εμφανίζει ολοδυναμικότητα

Διαβάστε περισσότερα

Κ ι λ µα µ τι τ κές έ Α λλ λ α λ γές Επι π πτ π ώ τ σει ε ς στη τ β ιοπο π ικιλό λ τη τ τα τ κ αι τ η τ ν ν ά γρια ζ ωή

Κ ι λ µα µ τι τ κές έ Α λλ λ α λ γές Επι π πτ π ώ τ σει ε ς στη τ β ιοπο π ικιλό λ τη τ τα τ κ αι τ η τ ν ν ά γρια ζ ωή Επιπτώσεις στη βιοποικιλότητα και την άγρια ζωή Η παγκόσµια κλιµατική αλλαγή θεωρείται ως η σηµαντικότερη τρέχουσα απειλή για τη βιοποικιλότητα του πλανήτη. Παραδείγµατα από την Κυπριακή Φύση Μερικές από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΑΜΠΕΛΙΟΥ ΣΤΗ ΘΗΒΑ ΒΙΟΛΟΓΙΚΗ ΚΑΛΛΙΕΡΓΕΙΑ ΑΜΠΕΛΙΟΥ ΣΤΗ ΘΗΒΑ Βιολογική γεωργία είναι ένα σύστηµα διαχείρισης και παραγωγής αγροτικών προϊόντων που στηρίζεται σε φυσικές διεργασίες δηλαδή στη µη χρησιµοποίηση µη χηµικών µεθόδων

Διαβάστε περισσότερα



Διαβάστε περισσότερα

2. Επέλεξε τα μέσα (ποτιστικό, σύγχρονα εργαλεία)

2. Επέλεξε τα μέσα (ποτιστικό, σύγχρονα εργαλεία) Πριν ξεκινήσεις 1. Επέλεξε το χώρο (νερό, καλό έδαφος) 2. Επέλεξε τα μέσα (ποτιστικό, σύγχρονα εργαλεία) 3. Ξέχασε κατ αρχήν ευαίσθητα και σπάνια φυτά. Πρώτα περπάτα σε γνωστά μονοπάτια και σ αυτό που

Διαβάστε περισσότερα


ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΤΩΝ ΦΥΤΩΝ Sideritis scardica και Origanum vulgare ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ ΜΕΛΕΤΗ ΤΩΝ ΣΥΝΘΗΚΩΝ ΕΚΧΥΛΙΣΗΣ ΦΑΙΝΟΛΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΤΩΝ ΦΥΤΩΝ Sideritis scardica και Origanum vulgare ΜΕ ΤΗ ΧΡΗΣΗ ΜΙΚΡΟΚΥΜΑΤΩΝ Ι. Σαρακατσιάνος Τμήμα Χημικών Μηχανικών, Αριστοτέλειο Πανεπιστήμιο, 54124

Διαβάστε περισσότερα

Διαμορφώνοντας το μέλλον μιας αειφόρου και καινοτόμου γεωργίας. Καινοτομίες στη γεωργία

Διαμορφώνοντας το μέλλον μιας αειφόρου και καινοτόμου γεωργίας. Καινοτομίες στη γεωργία Διαμορφώνοντας το μέλλον μιας αειφόρου και καινοτόμου γεωργίας Καινοτομίες στη γεωργία Ενίσχυση της επιχειρηματικότητας των αγροτών Βελτίωση της ανταγωνιστικότητας των προϊόντων Αύξηση της παραγωγικότητας

Διαβάστε περισσότερα

Ολοκληρωµένη Διαχείριση Ζιζανίων Πρόγραµµα LIFE+ HydroSense

Ολοκληρωµένη Διαχείριση Ζιζανίων Πρόγραµµα LIFE+ HydroSense Ολοκληρωµένη Διαχείριση Ζιζανίων Πρόγραµµα LIFE+ HydroSense Δρ Βάγια Α. Κατή Τµήµα Ζιζανιολογίας Μπενάκειο Φυτοπαθολογικό Ινστιτούτο Α Κύκλος Εκπαίδευσης Νίκαια Λάρισας, 8 Φεβ. 2011 Ζηµιές από τα ζιζάνια

Διαβάστε περισσότερα

Οριζόντια Προτεραιότητα & Εγκάρσιος Στόχος

Οριζόντια Προτεραιότητα & Εγκάρσιος Στόχος Οριζόντια Προτεραιότητα & Εγκάρσιος Στόχος Στην Πρόταση Κανονισμού για τη στήριξη της Αγροτικής Ανάπτυξης μετά το 2013, δίνεται ιδιαίτερη βαρύτητα στην καινοτομία αφού, όπως φαίνεται και στο παρακάτω διάγραμμα,

Διαβάστε περισσότερα

Μελέτη της δυνατότητας σύμπλεξης ιόντων χαλκού και σιδήρου από αφεψήματα Ελληνικών βοτάνων

Μελέτη της δυνατότητας σύμπλεξης ιόντων χαλκού και σιδήρου από αφεψήματα Ελληνικών βοτάνων Μελέτη της δυνατότητας σύμπλεξης ιόντων χαλκού και σιδήρου από αφεψήματα Ελληνικών βοτάνων Δ. Κογιάννου 1, Χ. Κουνδουράκη 1, Σ. Καραβόλτσος 2, Α. Σακελλάρη 2, Ν. Καλογερόπουλος 1 1 Τμήμα Επιστήμης Διαιτολογίας

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΣΥΚΙΑ ΣΥΚΙΑ - ΠΕΤΡΟΣ ΡΟΥΣΣΟΣ ΣΥΚΙΑ Καταγωγή: Ν. Αραβία Βοτανική ταξινόµηση: Οικ.: Moraceae FicuscaricaL. Βοτανικοί Χαρακτήρες Θηλυκοδίοικο (αρρενοσυκιά-µόνοικο, ηµεροσυκιά θηλυκά άνθη) Φυλλοβόλο Μέτριο έως µεγάλο µέγεθος, µαλακό ξύλο

Διαβάστε περισσότερα

Καινοτομία DeKalb... 1. Αύξηση αποδόσεων στο καλαμπόκι; 4. Με τα προϊόντα... 5. Με την Τεχνολογία - Τεχνογνωσία... 6-7. Μειωμένη κατεργασία εδάφους 8

Καινοτομία DeKalb... 1. Αύξηση αποδόσεων στο καλαμπόκι; 4. Με τα προϊόντα... 5. Με την Τεχνολογία - Τεχνογνωσία... 6-7. Μειωμένη κατεργασία εδάφους 8 ΕΝΗΜΕΡΩΣΗ 2014 Περιεχόμενα Καινοτομία DeKalb... 1 Αύξηση αποδόσεων στο καλαμπόκι; 4 Με τα προϊόντα... 5 Με την Τεχνολογία - Τεχνογνωσία... 6-7 Μειωμένη κατεργασία εδάφους 8 Εγγύηση DeKalb 10-11 Μπες στο

Διαβάστε περισσότερα

Αναπαραγωγή Ευκαλύπτων Γιαννάκης Βαρνάβα Μελισσοκόμος

Αναπαραγωγή Ευκαλύπτων Γιαννάκης Βαρνάβα Μελισσοκόμος Αναπαραγωγή Ευκαλύπτων Γιαννάκης Βαρνάβα Μελισσοκόμος Το παρόν άρθρο το θεωρώ συνέχεια των προηγούμενων άρθρων σχετικά με τους ευκαλύπτους και μετά από πολλές ερωτήσεις φίλων μελισσοκόμων σχετικά με την

Διαβάστε περισσότερα

Δράσεις συλλογικότητας στην καλλιέργεια και επιχειρηματική αξιοποίηση των ελληνικών αρωματικών/φαρμακευτικών φυτών

Δράσεις συλλογικότητας στην καλλιέργεια και επιχειρηματική αξιοποίηση των ελληνικών αρωματικών/φαρμακευτικών φυτών Αθήνα, 16 Σεπτεμβρίου 2014 - Ημερίδα «Τα Αρωματικά και Φαρμακευτικά Φυτά ως Μοχλός Αέναης Ανάπτυξης της Χώρας» Δράσεις συλλογικότητας στην καλλιέργεια και επιχειρηματική αξιοποίηση των ελληνικών αρωματικών/φαρμακευτικών

Διαβάστε περισσότερα

προϊόντων ένα τρίπτυχο: Ποιότητα Ασφάλεια καταναλωτή Περιβαλλοντική μέριμνα.

προϊόντων ένα τρίπτυχο: Ποιότητα Ασφάλεια καταναλωτή Περιβαλλοντική μέριμνα. η καλλιεργεια της μηδικης στo ΝΟΜΟ ΛΑΡΙΣΑΣ Σήμερα όσο ποτέ άλλοτε το ζητούμενο στην Ελληνική γεωργία είναι η ποιότητα και η ανταγωνιστικότητα των προϊόντων της, η γεωργική παραγωγή είναι απαραίτητο να

Διαβάστε περισσότερα

Σκοποί του Επιμελητηρίου

Σκοποί του Επιμελητηρίου Σκοποί του Επιμελητηρίου Το Γεωτεχνικό Επιμελητήριο Ελλάδος (ΓΕΩΤ.Ε.Ε.) είναι Νομικό Πρόσωπο ημόσιου ικαίου (Ν.Π...) που εποπτεύεται από το Υπουργείο Γεωργίας, έχει πανελλαδική διάρθρωση και εμβέλεια και

Διαβάστε περισσότερα

Για να περιγράψουμε την ατμοσφαιρική κατάσταση, χρησιμοποιούμε τις έννοιες: ΚΑΙΡΟΣ. και ΚΛΙΜΑ

Για να περιγράψουμε την ατμοσφαιρική κατάσταση, χρησιμοποιούμε τις έννοιες: ΚΑΙΡΟΣ. και ΚΛΙΜΑ Το κλίμα της Ευρώπης Το κλίμα της Ευρώπης Για να περιγράψουμε την ατμοσφαιρική κατάσταση, χρησιμοποιούμε τις έννοιες: ΚΑΙΡΟΣ και ΚΛΙΜΑ Καιρός: Οι ατμοσφαιρικές συνθήκες που επικρατούν σε μια περιοχή, σε

Διαβάστε περισσότερα

αρωματικών/φαρμακευτικών ειδών

αρωματικών/φαρμακευτικών ειδών 10 11 Νοεμβρίου 2012 The Programme is co-funded by the European Union (ERDF) and National Funds of Greece and Bulgaria Στοιχεία καλλιέργειαςαξιοποίησης ελληνικών αρωματικών/φαρμακευτικών ειδών Δρ. Ελένη

Διαβάστε περισσότερα


ΛΟΙΠΕΣ ΠΡΑΞΕΙΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ C 273/26 Επίσημη Εφημερίδα της Ευρωπαϊκής Ένωσης 16.9.2011 ΛΟΙΠΕΣ ΠΡΑΞΕΙΣ ΕΥΡΩΠΑΪΚΗ ΕΠΙΤΡΟΠΗ Δημοσίευση αίτησης σύμφωνα με το άρθρο 6 παράγραφος 2 του κανονισμού (ΕΚ) αριθ. 510/2006 του Συμβουλίου για

Διαβάστε περισσότερα

Τα μεγάλα και σοβαρά προβλήματα της παραδοσιακής

Τα μεγάλα και σοβαρά προβλήματα της παραδοσιακής Νεότερα συστήματα καλλιέργειας της ελιάς Σταύρος Βέμμος Αναπλ. Καθηγητής, Δ/ντής Εργαστηρίου Δενδροκομίας, Γεωπονικό Πανεπ. Αθηνών Για αύξηση της απόδοσης και μείωση του κόστους παραγωγής ελαιολάδου γίνεται

Διαβάστε περισσότερα

1.1 Οικολογικό περιβόλι. Σχεδιασµός και οργάνωση του. 2.1 Έδαφος γεµάτο ζωή Α ΜΕΡΟΣ (70 ) 2.1.1 Η διαδικασία δηµιουργίας χούµους στο έδαφος

1.1 Οικολογικό περιβόλι. Σχεδιασµός και οργάνωση του. 2.1 Έδαφος γεµάτο ζωή Α ΜΕΡΟΣ (70 ) 2.1.1 Η διαδικασία δηµιουργίας χούµους στο έδαφος Σεµινάριο Οικολογικό περιβόλι & ανθόκηποι ταράτσας Το σεµινάριο αποτελείται από 20 µαθήµατα των 10 συναντήσεων Σύνολο: 35 εκπαιδευτικές ώρες 1 η Συνάντηση (1 ο µάθηµα) 1.1 Οικολογικό περιβόλι. Σχεδιασµός

Διαβάστε περισσότερα

Ευρωπαϊκά Σχέδια Δράσης

Ευρωπαϊκά Σχέδια Δράσης Ευρωπαϊκά Σχέδια Δράσης Ζήσης Βρύζας Λέκτορας, Εργαστήριο Γεωργικής Φαρμακολογίας & Οικοτοξικολογίας, Τμήμα Αγροτικής Ανάπτυξης 17 Ιανουαρίου 2013, ΑΘΗΝΑ Η ΠΑΡΟΥΣΙΑΣΗ Ιστορικό στρατηγικής μείωσης της χρήσης

Διαβάστε περισσότερα

) η οποία απελευθερώνεται στην ατμόσφαιρα και ένα ποσοστό σε αμμωνιακά ιόντα (NH + ). Αυτή η διαδικασία

) η οποία απελευθερώνεται στην ατμόσφαιρα και ένα ποσοστό σε αμμωνιακά ιόντα (NH + ). Αυτή η διαδικασία Ιδιότητες και αποτελέσματα UTEC 46 = Ο ΕΠΙΤΥΧΗΜΕΝΟΣ ΤΥΠΟΣ ΓΙΑ ΥΨΗΛΕΣ ΑΠΟΔΟΣΕΙΣ Η Ουρία είναι ένα από τα πιο ευρέως διαδεδομένα αζωτούχα λιπάσματα, συνδυάζοντας τις υψηλές λιπαντικές μονάδες και την ευκολία

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΥΒΡΙΔΙΑ ΗΛΙΑΝΘΟΥ 2014. Κάνουν τη διαφορά στις ελληνικές συνθήκες. Φυσικά από την

ΥΒΡΙΔΙΑ ΗΛΙΑΝΘΟΥ 2014. Κάνουν τη διαφορά στις ελληνικές συνθήκες. Φυσικά από την ΥΒΡΙΔΙΑ ΗΛΙΑΝΘΟΥ 2014 Κάνουν τη διαφορά στις ελληνικές συνθήκες Φυσικά από την Υβρίδια Ηλίανθου ΕΠΙΛΟΓΗ ΣΤΡΑΤΗΓΙΚΗΣ Η απόδοση του γενετικού υλικού της RAGT στον ηλίανθο Η RAGT παρέχει στην αγορά μια σειρά

Διαβάστε περισσότερα

aγρoterra #14 Αγροτικές εξαγωγές Τα προϊόντα-πρωταγωνιστές τού αύριο Πλήρης οδηγός για την αλόη και η ελληνική εμπειρία 14/09/2013

aγρoterra #14 Αγροτικές εξαγωγές Τα προϊόντα-πρωταγωνιστές τού αύριο Πλήρης οδηγός για την αλόη και η ελληνική εμπειρία 14/09/2013 π ε ρ ι ο δ ι κ η ε κ δ ο σ η τ η ς ε φ η μ ε ρ ι δ α σ ε π ε ν δ υ τ η σ aγρoterra #14 14/09/2013 Μάρκετινγκ Εξάγεις; Χτίσε τον «μύθο» των προϊόντων σου Καλλιέργειες Λαχανικά: Μπορούμε να γίνουμε ο κήπος

Διαβάστε περισσότερα

ΚΑΡΥ ΙΑ. Ινστιτούτο Φυλλοβόλων ένδρων ιεύθυνση Αγροτικής Έρευνας Ελληνικός Γεωργικός Οργανισµός ΗΜΗΤΡΑ, Νάουσα

ΚΑΡΥ ΙΑ. Ινστιτούτο Φυλλοβόλων ένδρων ιεύθυνση Αγροτικής Έρευνας Ελληνικός Γεωργικός Οργανισµός ΗΜΗΤΡΑ, Νάουσα ΚΑΡΥ ΙΑ ρ. Παυλίνα ρογούδη, Αναπληρώτρια Ερευνήτρια Ινστιτούτο Φυλλοβόλων ένδρων ιεύθυνση Αγροτικής Έρευνας Ελληνικός Γεωργικός Οργανισµός ΗΜΗΤΡΑ, Νάουσα Νάουσα, Ιστοσελίδα www.pomologyinstitute.gr Η χώρα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας

Μελέτη της συγκαλλιέργειας βίκου-κριθής. κριθής και µπιζελιού- και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Μελέτη της συγκαλλιέργειας βίκου-κριθής κριθής και µπιζελιού- βρώµης ως προς τα ποσοτικά και ποιοτικά χαρακτηριστικά της παραγόµενης χλωροµάζας Χατζηγεωργίου Ι. 1, Φορτάτος Ε. 1, Τσιµπούκας Κ. 2, Ζέρβας

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Οινοποιία Δαρεμά Βιολογικοί αμπελώνες

Οινοποιία Δαρεμά Βιολογικοί αμπελώνες Οινοποιία Δαρεμά Βιολογικοί αμπελώνες Ιστορικό Η Οινοποιία Δαρεμά αποτελεί τη φυσική συνέχεια μιας οικογενειακής παράδοσης γενεών στο Μαρκόπουλο Μεσογαίας Αττικής που ξεκινά πριν από πολλές δεκαετίες.

Διαβάστε περισσότερα

Το αγροδασικό μέτρο στα πλαίσια της νέας ΚΑΠ και οι προοπτικές εφαρμογής του στην Ελλάδα

Το αγροδασικό μέτρο στα πλαίσια της νέας ΚΑΠ και οι προοπτικές εφαρμογής του στην Ελλάδα ΗΜΕΡΙΔΑ ΕΛΓΟ ΔΗΜΗΤΡΑ, ΓΕΩΤΕΕ ΠΑΡΑΡΤΗΜΑ ΑΝΑΤΟΛΙΚΗΣ ΣΤΕΡΕΑΣ ΕΛΛΑΔΑΣ, ΕΛΛΗΝΙΚΟ ΑΓΡΟΔΑΣΙΚΟ ΔΙΚΤΥΟ Η Αγροδασοπονία στα Πλαίσια της Νέας ΚΑΠ 2014 2020 Αθήνα, 26 Φεβρουαρίου 2014 Το αγροδασικό μέτρο στα πλαίσια

Διαβάστε περισσότερα

Η Ελαιοκαλλιέργεια στην Κρήτη Προβλήματα και Προοπτικές

Η Ελαιοκαλλιέργεια στην Κρήτη Προβλήματα και Προοπτικές Δ/νση Αγροτικής Οικονομίας Η Ελαιοκαλλιέργεια στην Κρήτη Προβλήματα και Προοπτικές Εισηγητής: Νικόλαος Μαυράκης (Δ/ντης Αγροτικής Οικονομίας) Γενικές Πληροφορίες Η συνολική έκταση της Κρήτης είναι 8.336

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ηλίας Σμυρνιούδης Διευθυντής Έρευνας & Ανάπτυξης

Ηλίας Σμυρνιούδης Διευθυντής Έρευνας & Ανάπτυξης Ηλίας Σμυρνιούδης Διευθυντής Έρευνας & Ανάπτυξης Η μαστίχα Χίου Η μαστίχα Χίου, αποτελεί 100% φυσικό προϊόν, προέρχεται από τον κορμό και τα κλαδιά του μαστιχόδεντρου (Pistacia Lentiscus var. Chia), Το

Διαβάστε περισσότερα

Αειφορική χρήση των Ελληνικών Αρωματικών Φυτών

Αειφορική χρήση των Ελληνικών Αρωματικών Φυτών Αειφορική χρήση των Ελληνικών Αρωματικών Φυτών Δρ. Ελένη Μαλούπα τακτική ερευνήτρια ΕΛ.Γ.Ο.- ΔΗΜΗΤΡΑ (ΕΘ.Ι.ΑΓ.Ε.) Εργαστήριο Προστασίας και Αξιοποίησης Αυτοφυών και Ανθοκομικών Ειδών, Κέντρο Γεωργικής

Διαβάστε περισσότερα

Green Box Εκδοτική Α.E. Νίκης 24, Σύνταγμα, 105 57, Tηλ. 210/3232905, Fax 210/3232967 E-mail: info@agronews.gr www.agronews.gr

Green Box Εκδοτική Α.E. Νίκης 24, Σύνταγμα, 105 57, Tηλ. 210/3232905, Fax 210/3232967 E-mail: info@agronews.gr www.agronews.gr Smart Crops 3 me εθνικη ΣΤΡΑΤΗΓΙΚΗ αναπτυξησ η ελλαδα θα ΗΤΑΝ ΠΑΡΑΔΕΙΣΟΣ για ΤΑ ΑΡΩΜΑΤΙΚΑ ΦΥΤΑ Γιάννης Πανάγος Εκδότης Διευθυντής Αγαπητέ αναγνώστη, Ταξίδι στο άγνωστο με βάρκα την ελπίδα, δείχνει να έχει

Διαβάστε περισσότερα

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ''

ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' ΚΑΝΤΑΡΟΣ ΗΛΙΑΣ Γεωπόνος, Σύµβουλος Βιολογικής Γεωργίας '' ΓΕΩΡΓΙΚΑ ΜΟΝΤΕΛΑ ΠΑΡΑΓΩΓΗΣ & ΥΓΕΙΑ'' Από το 1950 και µετά αρχίζει η εντατικοποίηση της γεωργικής παραγωγής εστιάζοντας το ενδιαφέρον της αποκλειστικά

Διαβάστε περισσότερα

Νέες τεχνολογίες στη γεωργία Γεωργία ακριβείας

Νέες τεχνολογίες στη γεωργία Γεωργία ακριβείας Νέες τεχνολογίες στη γεωργία Γεωργία ακριβείας Επιστημονική Ομάδα: Δ.Τσελές, Επιστημονικός Υπεύθυνος Γ.Κυριακαράκος Τ.Ε.Ι. ΠΕΙΡΑΙΑ -2011 1 Από την ανακάλυψη της γεωργίας, χιλιάδες χρόνια πριν μέχρι και

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εθνικό Σχέδιο Στρατηγικής Αγροτικής Ανάπτυξης της Ελλάδας για την 4η προγραµµατική περίοδο. Σχόλια του WWF Ελλάς στο 3 ο προσχέδιο Μάιος 2006

Εθνικό Σχέδιο Στρατηγικής Αγροτικής Ανάπτυξης της Ελλάδας για την 4η προγραµµατική περίοδο. Σχόλια του WWF Ελλάς στο 3 ο προσχέδιο Μάιος 2006 Εθνικό Σχέδιο Στρατηγικής Αγροτικής Ανάπτυξης της Ελλάδας για την 4η προγραµµατική περίοδο Σχόλια του WWF Ελλάς στο 3 ο προσχέδιο Μάιος 2006 Γενικά σχόλια Το κείµενο παρουσιάζεται σε γενικές γραµµές ικανοποιητικό

Διαβάστε περισσότερα

Ιπποφαές: µία καινοτόµος καλλιέργεια

Ιπποφαές: µία καινοτόµος καλλιέργεια ΓΕΝΙΚΗ ΙΕΥΘΥΝΣΗ ΑΓΡΟΤΙΚΗΣ ΕΡΕΥΝΑΣ Ινστιτούτο ασικών Ερευνών (Βασιλικά, Λουτρά Θέρµης) ρ. Ιωάννης Σπανός Τακτικός Ερευνητής Ιπποφαές: µία καινοτόµος καλλιέργεια µε πολύτιµες φαρµακευτικές ιδιότητες Θήβα,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Αγροτική Επιχειρηματικότητα: Τάση ή Εργαλείο Ανάπτυξης

Αγροτική Επιχειρηματικότητα: Τάση ή Εργαλείο Ανάπτυξης Αγροτική Επιχειρηματικότητα: Τάση ή Εργαλείο Ανάπτυξης Ευρωπαϊκό Συνέδριο για την Αγροτική Επιχειρηματικότητα, «Αυτό το χωράφι είναι η Επιχείρησή σου» Ναύπλιο, 15-10-2013 Ραυτόπουλος Δημήτρης Διευθυντής

Διαβάστε περισσότερα

LIFE10 NAT/CY/000717. Βελτίωση της κατάστασης διατήρησης του οικότοπου προτεραιότητας 9560* στην Κύπρο

LIFE10 NAT/CY/000717. Βελτίωση της κατάστασης διατήρησης του οικότοπου προτεραιότητας 9560* στην Κύπρο JUNIPERCY LIFE10 NAT/CY/000717 Βελτίωση της κατάστασης διατήρησης του οικότοπου προτεραιότητας 9560* στην Κύπρο 3ο ΕΝΗΜΕΡΩΤΙΚΟ ΕΛΤΙΟ Ιούνιος 2014 2 JUNIPERCY ΤΟ ΕΡΓΟ JUNIPERCY Το έργο «Βελτίωση της κατάστασης

Διαβάστε περισσότερα

Δημιουργία νέων οινοποιήσιμων ποικιλιών αμπέλου με τη μέθοδο του υβριδισμού στο Ινστιτούτο Αμπέλου Αθηνών

Δημιουργία νέων οινοποιήσιμων ποικιλιών αμπέλου με τη μέθοδο του υβριδισμού στο Ινστιτούτο Αμπέλου Αθηνών Δημιουργία νέων οινοποιήσιμων ποικιλιών αμπέλου με τη μέθοδο του υβριδισμού στο Ινστιτούτο Αμπέλου Αθηνών Ποικιλίες για παραγωγή λευκών οίνων Δρ Ζαμανίδης Παντελής, Αναπληρωτής Ερευνητής, Honorary professor

Διαβάστε περισσότερα

Η ιστορία του φουντουκιού:

Η ιστορία του φουντουκιού: ΤΟ ΦΟΥΝΤΟΥΚΙ : Η ιστορία του φουντουκιού: Σύμφωνα με ιστορικά ευρήματα, τα φουντούκια πρωτοεμφανίστηκαν στις περιοχές της Σουηδίας, Δανίας και Γερμανίας κατά τη Μεσολιθική και Νεολιθική εποχή. Η καλλιέργεια

Διαβάστε περισσότερα

Ο Γεωπόνος. Πληροφορίες: Αθηνά Παυλάτου-Βε Αναπλ. Καθηγήτρια ΑΠΘ E-mail: ave@agro.auth.gr

Ο Γεωπόνος. Πληροφορίες: Αθηνά Παυλάτου-Βε Αναπλ. Καθηγήτρια ΑΠΘ E-mail: ave@agro.auth.gr Ο Γεωπόνος Πληροφορίες: Αθηνά Παυλάτου-Βε Αναπλ. Καθηγήτρια ΑΠΘ E-mail: ave@agro.auth.gr Τι κάνει ο Γεωπόνος Ο Γεωπόνος: Αναλύει τα φαινόμενα της αναπαραγωγής και ανάπτυξης των παραγωγικών φυτών και ζώων

Διαβάστε περισσότερα

Φ.. ΧΕΛΜΟΥ-ΒΟΥΡΑΪΚΟΥ Dr. ΓΡΗΓΟΡΗΣ ΙΑΤΡΟΥ Καθηγητής ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΒΙΟΛΟΓΙΑΣ ΦΥΤΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ Πρόεδρος Σ Φ Χελµού-Βουραϊκού Σύντοµο ιστορικό 1992 Πρόταση Ορειβατικού Συλλόγου Καλαβρύτων

Διαβάστε περισσότερα

ΠΙΛΟΤΙΚΟ ΜΑΘΗΜΑ - ΕΝΟΤΗΤΑ 6 (βασισμένο στα περιεχόμενα του Chapter 6 - Mycoticon s Textbook) ΔΙΑΙΤΗΤΙΚΗ ΑΞΙΑ ΤΩΝ ΕΔΩΔΙΜΩΝ ΜΑΝΙΤΑΡΙΩΝ

ΠΙΛΟΤΙΚΟ ΜΑΘΗΜΑ - ΕΝΟΤΗΤΑ 6 (βασισμένο στα περιεχόμενα του Chapter 6 - Mycoticon s Textbook) ΔΙΑΙΤΗΤΙΚΗ ΑΞΙΑ ΤΩΝ ΕΔΩΔΙΜΩΝ ΜΑΝΙΤΑΡΙΩΝ Identification and sustainable exploitation of wild edible mushrooms in rural areas ΠΙΛΟΤΙΚΟ ΜΑΘΗΜΑ - ΕΝΟΤΗΤΑ 6 (βασισμένο στα περιεχόμενα του Chapter 6 - Mycoticon s Textbook) Γ.Ι. Ζερβάκης & Η. Πολέμης

Διαβάστε περισσότερα


ΠΡΟΟΠΤΙΚΕΣ ΑΝΑΠΤΥΞΗΣ ΤΗΣ ΠΡΟΟΠΤΙΚΕΣ ΑΝΑΠΤΥΞΗΣ ΤΗΣ ΜΕΛΙΣΣΟΚΟΜΙΑΣ Χ. Τανανάκη, Α. Θρασυβούλου Εργαστήριο Μελισσοκομίας Σηροτροφίας Α.Π.Θ. Email: tananaki@agro.auth.gr Website: www.beelab.gr Tel: 2310-472983 2.500.000 Αριθμός Κυψελών

Διαβάστε περισσότερα