Χαρακτηρισμός των συμβιωτικών σχέσεων του βακτηρίου Wolbachia με έντομα αγροτικής, δασικής και ιατρικής σημασίας

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Χαρακτηρισμός των συμβιωτικών σχέσεων του βακτηρίου Wolbachia με έντομα αγροτικής, δασικής και ιατρικής σημασίας"

Transcript

1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΠΟΛΥΤΕΧΝΙΚΗ ΣΧΟΛΗ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ Χαρακτηρισμός των συμβιωτικών σχέσεων του βακτηρίου Wolbachia με έντομα αγροτικής, δασικής και ιατρικής σημασίας ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ ΝΤΟΥΝΤΟΥΜΗΣ ΕΥΑΓΓΕΛΟΣ Αγρίνιο 2014

2 ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ Μπούρτζης Κωνσταντίνος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών ΤΡΙΜΕΛΗΣ ΣΥΜΒΟΥΛΕΥΤΙΚΗ ΕΠΙΤΡΟΠΗ Μπούρτζης Κωνσταντίνος Βλαστός Δημήτριος Τσιάμης Γεώργιος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών Επίκουρος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών Επίκουρος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών ΕΠΤΑΜΕΛΗΣ ΕΞΕΤΑΣΤΙΚΗ ΕΠΙΤΡΟΠΗ Μαυραγάνη-Τσιπίδου Πηνελόπη Ματθόπουλος Δημήτριος Μπούρτζης Κωνσταντίνος Κίλιας Γεώργιος Δροσοπούλου Ελένη Βλαστός Δημήτριος Τσιάμης Γεώργιος Καθηγήτρια, Τμήμα Βιολογίας, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών Αναπληρωτής Καθηγητής, Τμήμα Βιολογίας, Πανεπιστήμιο Πατρών Επίκουρη Καθηγήτρια, Τμήμα Βιολογίας, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Επίκουρος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών Επίκουρος Καθηγητής, Τμήμα Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων, Πανεπιστήμιο Πατρών

3 ΠΡΟΛΟΓΟΣ-ΕΥΧΑΡΙΣΤΙΕΣ Η παρούσα διδακτορική διατριβή πραγματοποιήθηκε στο εργαστήριο της ερευνητικής ομάδας Μοριακής Γενετικής και Μικροβιολογίας του Τμήματος Διαχείρισης Περιβάλλοντος και Φυσικών Πόρων του Πανεπιστημίου Πατρών. Η ερευνητική εργασία πραγματοποιήθηκε υπό την επίβλεψη του Καθηγητή κ. Κ. Μπούρτζη τον οποίο και ευχαριστώ θερμά για την εμπιστοσύνη που μου έδειξε όλα αυτά τα χρόνια και τη δυνατότητα που μου έδωσε να ασχοληθώ με τον τομέα της συμβιωτικής μικροβιολογίας. Συνάμα, θα ήθελα να τον ευχαριστήσω ιδιαιτέρως για την ευκαιρία που μου έδωσε να επισκεφθώ διεθνούς κύρους εργαστήρια στις ΗΠΑ και την Ισπανία, καθώς και να συμμετέχω σε διεθνή συνέδρια στη Φιλαδέλφεια των ΗΠΑ και τη Γαλλία. Παράλληλα θα ήθελα να ευχαριστήσω θερμά τον Επίκουρο Καθηγητή κ. Γ. Τσιάμη για την τεράστια βοήθειά του σε όλα τα επίπεδα και την καταλυτική συμβολή του στην επιτυχημένη ολοκλήρωση της εργασίας μου. Επίσης οφείλω να ευχαριστήσω τον Επίκουρο Καθηγητή κ. Βλαστό Δημήτριο, τον Καθηγητή κ. Ματθόπουλο Δημήτριο, την Καθηγήτρια κ. Μαυραγάνη-Τσιπίδου Πηνελόπη, τον Αναπληρωτή Καθηγητή κ. Κίλια Γεώργιο και την Επίκουρη Καθηγήτρια κ. Δροσοπούλου Ελένη για τη συμμετοχή τους στην εξεταστική επιτροπή και τα χρήσιμα σχόλιά τους. Επιπλέον θα ήθελα να ευχαριστήσω τις Prof. Serap Aksoy και Prof. Amparo Latorre που με φιλοξένησαν στα εργαστήρια τους στο Yale University School of Public Health στο New Haven των ΗΠΑ (Οκτώβριος-Δεκέμβριος 2011), και στο Cavanilles Institute on Biodiversity and Evolutionary Biology του Πανεπιστημίου της Βαλένθια (Φεβρουάριος-Μάρτιος 2010), αντίστοιχα, στα πλαίσια του προγράμματος EU COST Action 0701 «Arthropod Symbiosis: From Fundamental Studies to Pest and Disease Management». Επιπρόσθετα, θα ήθελα να ευχαριστήσω όλους τους προπτυχιακούς και μεταπτυχιακούς φοιτητές, τους μεταδιδάκτορες, τους ερευνητές και τους τεχνικούς όλων των εργαστηρίων που συνεργαστήκαμε άψογα, και με τους περισσότερους έχουμε διατηρήσει φιλικές σχέσεις, ορισμένοι από τους οποίους είναι ο Στέφανος, η Εύα, η Σόνια, η Αθηνά, η Κατερίνα και ο Πάνος, ο Σαπού, η Βάσω, ο Αντώνης, η Αγγελική, η Αθηνά, ο Αποστόλης, η Ράνια, ο Ζάχος, η Κλειώ, ο Τάσος, η Μαρία, η Άρτεμις, η Αρετή, o Erich, η Veronica, o Thiago, η Michelle, o Diego, η Silvia, o Δημήτρης και ο Ηλίας, και άλλοι που να με συγχωρέσουν αν τους ξέχασα. Βαγγέλης Ντουντούμης Αγρίνιο 2014

4 ΠΕΡΙΕΧΟΜΕΝΑ ΠΡΟΛΟΓΟΣ-ΕΥΧΑΡΙΣΤΙΕΣ ΠΕΡΙΛΗΨΗ ΔΙΑΤΡΙΒΗΣ, 1 THESIS SUMMARY, 4 ΚΕΦΑΛΑΙΟ 1 - ΕΙΣΑΓΩΓΗ, 6 ΚΕΦΑΛΑΙΟ 2 - Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp., 81 ΚΕΦΑΛΑΙΟ 3 - Οριζόντια μεταφορά γονιδίων του συμβιωτικού βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina, 132 ΚΕΦΑΛΑΙΟ 4 - Αλληλεπίδραση του συμβιωτικού βακτηρίου Wolbachia και του παθογόνου ιού SGHV σε είδη Glossina, 154 ΚΕΦΑΛΑΙΟ 5 - Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε είδη αφίδων, 168 ΚΕΦΑΛΑΙΟ 6 - Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia στην καρπόκαψα καστανιάς, 182 ΚΕΦΑΛΑΙΟ 7 ΣΥΜΠΕΡΑΣΜΑΤΑ ΠΡΟΟΠΤΙΚΕΣ, 198 ΔΗΜΟΣΙΕΥΣΕΙΣ ΠΑΡΟΥΣΙΑΣΕΙΣ, 212 ΠΑΡΑΡΤΗΜΑ

5 ΚΑΤΑΛΟΓΟΣ ΕΙΚΟΝΩΝ ΚΑΙ ΠΙΝΑΚΩΝ ΚΑΤΑΛΟΓΟΣ ΕΙΚΟΝΩΝ Εικόνα Περιγραφή Σελ. Εικόνα 1.1 Διακριτές εξελικτικές πορείες συμβιωτικών βακτηρίων στα έντομα [Προσαρμογή 10 από Dale & Moran 2006] Εικόνα 1.2 Η φυλογένεια του βακτηρίου Wolbachia: παρουσιάζεται ένα άρριζο 16 φυλογενετικό δένδρο των 13 υπερομάδων του βακτηρίου Wolbachia, βάσει τμήματος 842 bp του γονιδίου 16S rrna. Για κάθε υπερομάδα, επιλέχτηκε ένας αντιπρόσωπος από τη βάση δεδομένων NCBI. Στις παρενθέσεις δίνονται οι αριθμοί πρόσβασης (accession numbers) των αντίστοιχων αλληλουχιών. (Για την κατασκευή του φυλογενετικού δένδρου χρησιμοποιήθηκε η στοίχιση κατά ClustalW, η μέθοδος Neighbor-Joining, το μοντέλο Jukes-Cantor με 1000 επαναλήψεις, μέσω του Geneious Tree Builder) Εικόνα 1.3 Παραδείγματα κυτταροπλασματικής ασυμβατότητας: Α) Μονόδρομη, Β) 33 Αμφίδρομη και Γ) Μονόδρομη παρουσία πολλαπλών στελεχών Εικόνα 2.1 Γεωγραφική κατανομή του βακτηρίου Wolbachia σε φυσικούς πληθυσμούς 95 ειδών Glossina ανά χώρα στην Αφρική. Εικόνα 2.2 Συνολικά ποσοστά παρουσίας του βακτηρίου Wolbachia ανά είδος Glossina. 97 Εικόνα 2.3 Φυλογενετικό δένδρο με βάση το γονίδιο gatb (369bp). Τα αλληλόμορφα που 106 ανιχνεύτηκαν είναι με κόκκινα γράμματα (New 1-8, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με πράσινες και μπλε και γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για τα δείγματα G. austeni (013.11Β) και G. brevipalpis (19.Brev), αντίστοιχα. Εικόνα 2.4 Φυλογενετικό δένδρο με βάση το γονίδιο coxa (402 bp). Τα αλληλόμορφα που 108 ανιχνεύθηκαν είναι με κόκκινα γράμματα (New 1-7, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με πράσινες και μπλε γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για τα δείγματα G. m. submorsitans (525.3Η) και G. p. gambiensis (405.11F), αντίστοιχα. Εικόνα 2.5 Φυλογενετικό δένδρο με βάση το γονίδιο hcpa (444 bp). Τα αλληλόμορφα που ανιχνεύθηκαν είναι με κόκκινα γράμματα (New 1-7, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν 110 καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα

6 Εικόνα 2.6 Εικόνα 2.7 Εικόνα 2.8 Εικόνα 2.9 αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με μπλε γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για το δείγμα G. brevipalpis (19.Brev). Φυλογενετικό δένδρο με βάση το γονίδιο ftsz (435 bp). Τα αλληλόμορφα που ανιχνεύθηκαν είναι με κόκκινα γράμματα (New 1-9, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με μπλε γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για το δείγμα G. brevipalpis (19.Brev). Φυλογενετικό δένδρο με βάση το γονίδιο fbpa (429 bp). Τα αλληλόμορφα που ανιχνεύθηκαν είναι με κόκκινα γράμματα (New 1-7, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με μπλε γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για τo δείγμα G. brevipalpis (19.Brev). Φυλογενετικό δένδρο με βάση το γονίδιο wsp (~489 bp). Τα αλληλόμορφα που ανιχνεύθηκαν είναι με κόκκινα γράμματα (New 1-6, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, και F. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Φυλογενετικό δένδρο με βάση το γονίδιο 16S rrna (~438 bp). Τα αλληλόμορφα που ανιχνεύθηκαν είναι με έντονα γράμματα (συνολικά 12 αλληλόμορφα, Type 1-12). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, E, F, H, I, J, K, L, M και N. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή και τον αριθμό πρόσβασης στη GenBank. Οι υπερομάδες

7 Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Εικόνα 2.10 Συσχέτιση φυλογενετικών δένδρων με βάση το γονίδιο mtcoii (~321bp) του ξενιστή και το γονίδιο wsp (~489bp) του βακτηρίου Wolbachia. Με κόκκινα γράμματα σημειώνονται τα άτομα των οποίων διαφέρει η μορφολογική ταυτοποίηση και με έντονα τα άτομα αναφοράς (δένδρο mtcoii), με μπλε τα άτομα G. pallidipes που φέρουν πολύ διαφορετικά αλληλόμορφα wsp και με μοβ τα άτομα G. p. gambiensis με πολύ ανόμοια wsp (δένδρο wsp). Εικόνα 3.1 Προϊόντα ενίσχυσης PCR του γονιδίου 16S rrna από φυσικό πληθυσμό G. m. morsitans της Κένυας (1-16 άτομα) τα οποία ηλεκτροφορήθηκαν σε 2.5% πήκτωμα αγαρόζης χρωματισμένο με βρωμιούχο αιθίδιο. Μ: μάρτυρας μοριακού μεγέθους. Ως αρνητικό μάρτυρα (neg) χρησιμοποιήσαμε νερό και ως θετικό μάρτυρα (pos) στέλεχος wmel. Τα μπλε βέλη δείχνουν το αναμενόμενο προϊόν και το κόκκινο, ένα δεύτερο μικρότερο, μη αναμενόμενο. Εικόνα 3.2 Προϊόντα ενίσχυσης PCR του γονιδίου 16S rrna από εργαστηριακά στελέχη G. m. morsitans (GmmY και Gmmtet) τα οποία ηλεκτροφορήθηκαν σε 2.5% πήκτωμα αγαρόζης χρωματισμένο με βρωμιούχο αιθίδιο. M: μάρτυρας μοριακού μεγέθους. Ως αρνητικό μάρτυρα (neg) χρησιμοποιήσαμε νερό. Το μπλε βέλος δείχνει το αναμενόμενο προϊόν μεγέθους 438bp (κυτταροπλασματικό) και το κόκκινο, ένα δεύτερο μικρότερου μεγέθους 296 bp (πυρηνικό). Στο δείγμα GmmY παρατηρήθηκαν και τα δύο προϊόντα (κυτταροπλασματικό και πυρηνικό) ενώ στο δείγμα Gmmtet παρατηρήθηκε μόνο το μικρότερο προϊόν (πυρηνικό). Στο δείγμα Gmmtet είχε απομακρυνθεί το βακτήριο Wolbachia με τη χρήση τετρακυκλίνης (Ενότητα. 3.2). Εικόνα 3.3 Σχηματική απεικόνιση των πυρηνικών ενθέσεων του γονιδίου 16S rrna του βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina: οι νουκλεοτιδικές αλληλουχίες του γονιδίου 16S rrna του βακτηρίου Wolbachia που έχουν εντεθεί στη μύγα τσε-τσε ευθυγραμμίστηκαν με την αντίστοιχη περιοχή του στελέχους wmel και των κυτταροπλασματικών στελεχών των αντίστοιχων τριών ειδών Glossina χρησιμοποιώντας το MUSCLE, μέσω της λογισμικής πλατφόρμας Genious Οι μαύρες γραμμές αντιπροσωπεύουν την περιοχή με το έλλειμμα, οι αριθμοί δείχνουν τις θέσεις πριν και μετά τα ελλείμματα σύμφωνα με το γονιδίωμα του wmel και τα αριστερά-δεξιά κόκκινα βέλη κάτω από τον αριθμό δείχνουν το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp). Ανιχνεύθηκαν δύο τύποι ελλειμμάτων: α) ο τύπος 1 (Deletion 1) σε επτά δείγματα G. m. morsitans (Gmmtet, GmmY, 12.3A, 24.4A, 30.9D, 32.3D και 34.7G), σε πέντε G. pallidipes (10.10E, 30.10G, 32.11G, 34.4A και 24.1Α) και ένα G. austeni (013.11B), β) ο τύπος 2 (Deletion 2) σε δύο δείγματα G. m. morsitans (32.3D και 24.4A) και ένα G. pallidipes (10.10E). Εικόνα 3.4 Προϊόντα ενίσχυσης PCR του γονιδίου fbpa από εργαστηριακά στελέχη G. m. morsitans (GmmY και Gmmtet) τα οποία ηλεκτροφορήθηκαν σε 2.5% πήκτωμα αγαρόζης χρωματισμένο με βρωμιούχο αιθίδιο. M: μάρτυρας μοριακού μεγέθους. Ως αρνητικό μάρτυρα (neg) χρησιμοποιήσαμε νερό. Το μπλε βέλος δείχνει το αναμενόμενο προϊόν μεγέθους 509bp (κυτταροπλασματικό) και το κόκκινο, ένα δεύτερο μικρότερου μεγέθους 453 bp (πυρηνικό). Στο δείγμα GmmY παρατηρήθηκαν και τα δύο προϊόντα (κυτταροπλασματικό και πυρηνικό), ενώ στο δείγμα Gmmtet παρατηρήθηκε μόνο το μικρότερο προϊόν (πυρηνικό). Στο δείγμα Gmmtet είχε απομακρυνθεί το βακτήριο Wolbachia με τη χρήση Εικόνα 3.5 τετρακυκλίνης (Ενότητα. 3.2). Σχηματική απεικόνιση των πυρηνικών ενθέσεων του γονιδίου fbpa του βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina: οι νουκλεοτιδικές αλληλουχίες του γονιδίου fbpa του βακτηρίου Wolbachia που έχουν εντεθεί στη

8 Εικόνα 3.6 Εικόνα 3.7 Εικόνα 3.8 μύγα τσε-τσε ευθυγραμμίστηκαν με την αντίστοιχη περιοχή του στελέχους wmel και του αντιπροσωπευτικού κυτταροπλασματικού αλληλομόρφου 15 των αντίστοιχων τριών ειδών Glossina χρησιμοποιώντας το MUSCLE, μέσω της λογισμικής πλατφόρμας Genious Οι μαύρες γραμμές αντιπροσωπεύουν την περιοχή με το έλλειμμα, οι αριθμοί δείχνουν τις θέσεις πριν και μετά τα ελλείμματα σύμφωνα με το γονιδίωμα του wmel και τα αριστερά-δεξιά κόκκινα βέλη κάτω από τον αριθμό δείχνουν το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp). Ανιχνεύθηκαν δύο τύποι ελλειμμάτων: α) ο τύπος 1 (Deletion 1) σε επτά δείγματα G. m. morsitans (Gmmtet, GmmY, 12.3A, 24.4A, 30.9D, 32.3D και 34.7G), σε πέντε G. pallidipes (10.10E, 30.10G, 32.11G, 34.4A και 24.1Α) και ένα G. austeni (013.11B), β) ο τύπος 2 (Deletion 2) σε ένα δείγμα G. m. morsitans (32.3D) και ένα G. pallidipes (10.10E). Σχηματική απεικόνιση των πυρηνικών ενθέσεων του γονιδίου ftsz του βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina: οι νουκλεοτιδικές αλληλουχίες του γονιδίου ftsz του βακτηρίου Wolbachia που έχουν εντεθεί στη μύγα τσε-τσε ευθυγραμμίστηκαν με την αντίστοιχη περιοχή του στελέχους wmel και του αντιπροσωπευτικού κυτταροπλασματικού αλληλομόρφου 113 των αντίστοιχων ειδών Glossina χρησιμοποιώντας το MUSCLE, μέσω της λογισμικής πλατφόρμας Genious Οι μαύρες γραμμές αντιπροσωπεύουν την περιοχή με το έλλειμμα, οι αριθμοί δείχνουν τις θέσεις πριν και μετά τα ελλείμματα σύμφωνα με το γονιδίωμα του wmel και τα αριστερά-δεξιά κόκκινα βέλη κάτω από τον αριθμό δείχνουν το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp). Ανιχνεύθηκαν δύο τύποι ελλειμμάτων: α) ο τύπος 1 (Deletion 1) σε τρία δείγματα G. m. morsitans (Gmmtet, GmmY και 24.4A) και σε τρία G. pallidipes (10.10E, 32.11G και 24.1Α), β) ο τύπος 2 (Deletion 2) σε ένα δείγμα G. m. morsitans (GmmY). Σχηματική απεικόνιση των πυρηνικών ενθέσεων του γονιδίου wsp του βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina: οι νουκλεοτιδικές αλληλουχίες του γονιδίου wsp του βακτηρίου Wolbachia που έχουν εντεθεί στη μύγα τσε-τσε ευθυγραμμίστηκαν με την αντίστοιχη περιοχή του στελέχους wmel και του αντιπροσωπευτικού κυτταροπλασματικού αλληλομόρφου 356 των αντίστοιχων ειδών Glossina χρησιμοποιώντας το MUSCLE, μέσω της λογισμικής πλατφόρμας Genious Οι μαύρες γραμμές αντιπροσωπεύουν την περιοχή με το έλλειμμα, οι αριθμοί δείχνουν τις θέσεις πριν και μετά τα ελλείμματα σύμφωνα με το γονιδίωμα του wmel, το αριστερό-δεξιό κόκκινο βέλος κάτω από τον αριθμό δείχνει το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp), οι κόκκινοι αριθμοί δείχνουν το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp) και το μπλε πλαίσιο και ο μπλε αριθμός δείχνουν το μέγεθος της ένθεσης σε ζεύγη βάσεων (bp). Ανιχνεύθηκαν 4 τύποι ελλειμμάτων: α) ο τύπος (Deletion 1) σε ένα δείγμα G. m. morsitans (Gmmtet), β) ο τύπος (Deletion 2) σε δύο G. m. morsitans (30.9D και 32.3D), γ) ο τύπος (Deletion 3) σε δύο G. m. morsitans (30.9D και 32.3D) και τέλος, δ) ο τύπος (Deletion 4) σε ένα G. pallidipes (10.10E). Σχηματική απεικόνιση των πυρηνικών ενθέσεων των γονιδίων gatb, coxa και hcpa του βακτηρίου Wolbachia στο γονιδίωμα ειδών Glossina: οι νουκλεοτιδικές αλληλουχίες των γονιδίων gatb, coxa και hcpa του βακτηρίου Wolbachia που έχουν εντεθεί στη μύγα τσε-τσε ευθυγραμμίστηκαν με την αντίστοιχη περιοχή του στελέχους wmel και των αντιπροσωπευτικών κυτταροπλασματικών αλληλομόρφων των αντίστοιχων ειδών Glossina χρησιμοποιώντας το MUSCLE, μέσω της λογισμικής πλατφόρμας Genious Οι μαύρες γραμμές αντιπροσωπεύουν την περιοχή με το έλλειμμα, οι αριθμοί δείχνουν τις θέσεις πριν και μετά τα ελλείμματα σύμφωνα με το γονιδίωμα του wmel και τα αριστερά-δεξιά κόκκινα βέλη κάτω από τον αριθμό δείχνουν το μέγεθος του ελλείμματος σε ζεύγη βάσεων (bp). Ανιχνεύθηκαν οι εξής τύποι ελλειμμάτων: α) για το γονίδιο gatb δύο τύποι (Deletion 1 και 2) στο ίδιο δείγμα

9 G. m. morsitans (24.4Α), β) για το coxa ο τύπος (Deletion 1) σε ένα δείγμα G. m. morsitans (30.9D), και τέλος, γ) για το hcpa ένας τύπος (Deletion 1) σε ένα δείγμα G. m. morsitans (34.7G). Εικόνα 5.1 Σχηματική απεικόνιση των θέσεων των εκκινητών στο γονίδιο 16S rrna. 175 Εικόνα 6.1 Φυλογενετικό δένδρο με βάση την ενιαία αλληλουχία MLST (concatenated 192 dataset) συνολικού μεγέθους 2079 ή 2073 bp (σε ορισμένα στελέχη της υπερομάδας Β η αλληλουχία του γονιδίου fbpa περιέχει ένα έλλειμμα μεγέθους 6 bp). Τα στελέχη που ανιχνεύτηκαν στην οικ. Tortricidae είναι με έγχρωμα γράμματα ενώ τα άλλα στελέχη αντιπροσωπεύουν τις υπερομάδες A, B, D, F και H. Τα στελέχη έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%).* Αυτό το στέλεχος Wolbachia ανιχνεύτηκε και σε ένα δείγμα C. splendana (8Ε.1ΒΚ). Εικόνα 6.2 Φυλογενετικό δένδρο βάσει του μιτοχονδριακού γονιδίου του ξενιστή mtcoi (~800 bp). Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). 193

10 ΚΑΤΑΛΟΓΟΣ ΠΙΝΑΚΩΝ Πίνακας Περιγραφή Σελ. Πίνακας 1.1 Ενδοσυμβιωτικά βακτήρια και οι επαγόμενοι από αυτούς αναπαραγωγικοί 28 φαινότυποι. [Προσαρμογή από Kageyama et al. 2012] Πίνακας 1.2 Μεταφορά γονιδίων του βακτηρίου Wolbachia σε χρωμοσώματα εντόμων και 43 νηματωδών. [Πηγή: Doudoumis et al. 2013] Πίνακας 1.3 Προγράμματα αλληλούχισης στελεχών Wolbachia [Πηγές: Doudoumis et al , NCBI Genome October 2013] Πίνακας 1.4 Χαρακτηριστικά των διαθέσιμων 7 πλήρως αποκωδικοποιημένων 47 γονιδιωμάτων στελεχών Wolbachia. [Πηγή: Duplouy et al. 2013, NCBI Genome October 2013]. Πίνακας 2.1 Προέλευση δειγμάτων που μελετήθηκαν στην παρούσα διατριβή (φυσικοί 85 πληθυσμοί από 13 Αφρικάνικες χώρες και εργαστηριακές αποικίες από 7 διαφορετικά εργαστήρια). Πίνακας 2.2 Οι εκκινητές που χρησιμοποιήθηκαν για την ανίχνευση του βακτηρίου 90 Wolbachia, το χαρακτηρισμό των στελεχών Wolbachia, καθώς και για την ταυτοποίηση του ξενιστή. Πίνακας 2.3 Ποσοστά παρουσίας του βακτηρίου Wolbachia σε 8 εργαστηριακά στελέχη 96 Glossina. Πίνακας 2.4 Ποσοστά παρουσίας του βακτηρίου Wolbachia σε φυσικούς πληθυσμούς από Αφρικάνικες χώρες και σε εργαστηριακές αποικίες από 7 διαφορετικά εργαστήρια (Οι αριθμοί στην παρένθεση δείχνουν τον αριθμό των θετικών σε Wolbachia ατόμων προς το συνολικό αριθμό των ατόμων που ελέχθησαν). Πίνακας 2.5 MLST και wsp αλληλόμορφα γονίδια των στελεχών Wolbachia σε πολλαπλά 102 μολυσμένα άτομα ειδών Glossina. Πίνακας 3.1 Οριζόντια μεταφορά γονιδίων Wolbachia σε εργαστηριακούς και φυσικούς 139 πληθυσμούς ειδών Glossina. Πίνακας 4.1 Παρουσία των μικροοργανισμών Wolbachia (W) και SGHV (V) σε φυσικούς 158 πληθυσμούς της μύγας τσε-τσε (οι αριθμοί στις παρενθέσεις δείχνουν τον αριθμό των μολυσμένων ατόμων ως προς το σύνολο των εξεταζόμενων ατόμων μυγών τσε-τσε) Πίνακας 4.2 Παρουσία των μικροοργανισμών Wolbachia (W) και SGHV (V) σε φυσικούς 159 πληθυσμούς δέκα διαφορετικών ειδών Glossina (οι αριθμοί στις παρενθέσεις δείχνουν τον αριθμό των μολυσμένων ατόμων ως προς το σύνολο των εξεταζόμενων ατόμων). Πίνακας 5.1 Στοιχεία εξεταζόμενων 26 Ελληνικών πληθυσμών αφίδων 172 Πίνακας 5.2 Θετικοί σε Wolbachia πληθυσμοί αφίδων και αποτελέσματα ενίσχυσης PCR 174 για τα γονίδια 16S rrna, MLST και wsp. Πίνακας 5.3 Εκκινητές που χρησιμοποιήθηκαν για την ενίσχυση του γονιδίου 16S rrna. 175 Πίνακας 5.4 Συνδυασμός εκκινητών που δοκιμάστηκαν για την ενίσχυση του γονιδίου 16S 176 rrna. Πίνακας 5.5 Συνοπτικά αποτελέσματα των συμβατικών και των εμφωλιασμένων 177 αντιδράσεων PCR για την ενίσχυση του γονιδίου 16S rrna. Πίνακας 6.1 Ποσοστά παρουσίας του βακτηρίου Wolbachia σε φυσικούς πληθυσμούς των 188 ειδών Cydia splendana, Cydia fagiglandana και Pammene fasciana (Οι αριθμοί στις παρενθέσεις δείχνουν το πλήθος των προνυμφών που φέρουν το βακτήριο Wolbachia προς το συνολικό αριθμό που αναλύθηκαν). Πίνακας 6.2 Τα αλληλόμορφα των γονιδίων MLST και wsp των στελεχών Wolbachia που βρέθηκαν σε ελληνικούς πληθυσμούς Cydia fagiglandana, Cydia splendana και Pammene fasciana. 190

11 ΠΕΡΙΛΗΨΗ ΔΙΑΤΡΙΒΗΣ Το βακτήριο Wolbachia είναι ένα ενδοκυττάριο και μητρικά κληρονομούμενο συμβιωτικό βακτήριο. Ανήκει στην ομοταξία των Alphaproteobacteria και την τάξη των Rickettsiales. Αποτελεί ίσως τον πιο διαδεδομένο ενδοκυττάριο συμβιωτικό οργανισμό στον πλανήτη, καθώς έχει εντοπιστεί μέχρι στιγμής σε πληθώρα αρθροπόδων και νηματωδών της φιλαρίασης. Πρόσφατες μελέτες εκτιμούν ότι πάνω από το 40% των ειδών αρθροπόδων είναι μολυσμένα με το βακτήριο Wolbachia. Το συμβιωτικό αυτό βακτήριο επηρεάζει τις βιολογικές λειτουργίες και ιδιότητες των ξενιστών του και είναι υπεύθυνο για μια σειρά αναπαραγωγικών ανωμαλιών, όπως η κυτταροπλασματική ασυμβατότητα, η παρθενογένεση, η θανάτωση των αρσενικών εμβρύων και η θηλυκοποίηση. Τα μοναδικά αυτά βιολογικά χαρακτηριστικά του βακτηρίου Wolbachia προσελκύουν όλο και περισσότερο το ενδιαφέρον διαφόρων ερευνητών τόσο για το ρόλο του βακτηρίου σε εξελικτικές διαδικασίες (κυρίως ειδογένεση) όσο και για τη χρησιμοποίησή του σε περιβαλλοντικά φιλικές εφαρμογές καταπολέμησης οργανισμών που είναι επιβλαβείς στους τομείς του γεωργικού και δασικού περιβάλλοντος, και της υγείας. Τα είδη του γένους Glossina (Diptera: Glossinidae), γνωστά και ως μύγες τσε-τσε, αποτελούν ξενιστές του βακτηρίου Wolbachia. Η μύγα τσε-τσε είναι ο σημαντικότερος φορέας των παθογόνων τρυπανοσωμάτων στην τροπική Αφρική, τα οποία προκαλούν την ασθένεια του ύπνου (sleeping sickness) στον άνθρωπο και την αντίστοιχη τρυπανοσωμίαση, γνωστή ως nagana, στα ζώα. Η χρησιμοποίηση του βακτηρίου Wolbachia σε μεθόδους βιολογικής καταπολέμησης της μύγας τσε-τσε προαπαιτεί την πλήρη γνώση της γενετικής του ταυτότητας και των αλληλεπιδράσεων του με το ξενιστή. Προς την κατεύθυνση αυτή, και στα πλαίσια της παρούσας διατριβής, πραγματοποιήθηκε η ανίχνευση του συμβιωτικού βακτηρίου Wolbachia σε περισσότερα από 5300 άτομα από φυσικούς και εργαστηριακούς πληθυσμούς 11 διαφορετικών ειδών μύγας τσε-τσε από 13 Αφρικανικές χώρες. Τα αποτελέσματα έδειξαν τεράστια απόκλιση της παρουσίας του βακτηρίου τόσο μεταξύ ειδών όσο και μεταξύ πληθυσμών του ίδιου είδους. Επίσης, πραγματοποιήθηκε ο γενετικός χαρακτηρισμός των στελεχών Wolbachia από συνολικά 29 αντιπροσωπευτικά δείγματα διαφόρων πληθυσμών και ειδών μύγας τσε-τσε, ενώ σε αρκετά από αυτά παρατηρήθηκαν πολλαπλά στελέχη του βακτηρίου. Διαπιστώθηκε εντυπωσιακή γενετική ποικιλότητα στελεχών Wolbachia που απαντούν στα διάφορα είδη μύγας τσε-τσε καθώς και ασυμφωνία μεταξύ των φυλογενειών των στελεχών Wolbachia και των μυγών τσε-τσε ξενιστών της, γεγονός που σημαίνει οριζόντια μετακίνηση του συμβιωτικού βακτηρίου κατά την εξέλιξη. 1

12 Επιπρόσθετα, εντοπίστηκαν για πρώτη φορά εκτεταμένα γεγονότα οριζόντιας μεταφοράς βακτηριακών γονιδίων στο γονιδίωμα τριών ειδών μύγας τσε-τσε: στο Glossina morsitans morsitans, Glossina pallidipes και Glossina austeni. Από εξελικτικής σκοπιάς, κρίσιμα ερωτήματα προκύπτουν από τα παραπάνω ευρήματα, και πιο συγκεκριμένα σχετικά με: την προέλευση-μηχανισμό αυτών των γεγονότων οριζόντιας μεταφοράς, τον χρονικό προσδιορισμό τους, τον πιθανό ρόλο τους σε διαδικασίες ειδογένεσης και την επιλεκτική εμφάνισή τους σε ορισμένα μόνο είδη Glossina π.χ. στo υποείδos Glossina morsitans centralis που είναι πολύ συγγενικό του Glossina morsitans morsitans δεν παρατηρήθηκε το φαινόμενο. Εξίσου σημαντική και επιβεβλημένη κρίνεται η διεξοδική διερεύνηση του ενδεχομένου τα βακτηριακά γονίδια που ενσωματώθηκαν στο ευκαρυωτικό γονιδίωμα της μύγας τσε-τσε να ευθύνονται για την έκφραση νέων λειτουργιών-ιδιοτήτων (ή να μεταβάλλουν τις ήδη υπάρχουσες), ιδίως μάλιστα εάν αυτές συνδέονται με την αποδοτικότητα μετάδοσης της νόσου της τρυπανοσωμίασης μέσω του φορέα της, δηλαδή της μύγας τσε-τσε. Τέλος, διαπιστώθηκε πιθανή αρνητική συσχέτιση της παρουσίας του βακτηρίου Wolbachia με τον παθογόνο ιό Salivary Gland hypertrophy Virus (SGHV), γεγονός που συζητείται στα πλαίσια βιολογικών εφαρμογών καταπολέμησης του εντόμου-φορέα και της τρυπανοσωμίασης. Παράλληλα, μεγάλο ενδιαφέρον παρουσιάζει η προοπτική χρησιμοποίησης του βακτηρίου Wolbachia για τη βιολογική καταπολέμηση εντόμων αγροτικής ή /και περιβαλλοντικής σημασίας, όπως είναι οι αφίδες και η καρπόκαψα καστανιάς. Το γεγονός αυτό προϋποθέτει την ανίχνευση και τη γενετική ταυτοποίηση του βακτηρίου σε φυσικούς πληθυσμούς εντόμων. Στα πλαίσια της παρούσας διατριβής πραγματοποιήθηκε ανίχνευση και χαρακτηρισμός του βακτηρίου Wolbachia σε 78 συνολικά άτομα από 22 είδη αφίδων, από 26 φυσικούς πληθυσμούς από την Ελλάδα. Από αυτούς τους 26 πληθυσμούς, μόλις οι 4 βρέθηκαν να είναι μολυσμένοι με το βακτήριο Wolbachia και συγκεκριμένα πληθυσμοί των ειδών: Aphis fabae, Aphis hederae, Metopolophium dirhodum και Baizongia pistaciae. Τα αποτελέσματα αυτά δείχνουν για πρώτη φορά ότι η παρουσία του βακτηρίου Wolbachia στις αφίδες είναι πιθανά πιο διαδεδομένη από ότι προέκυπτε από προηγούμενες μελέτες. Επίσης, μελετήθηκε η ανίχνευση και ο χαρακτηρισμός του βακτηρίου Wolbachia στα είδη Cydia splendana, Cydia fagiglandana και Pammene fasciana. Το βακτήριο Wolbachia ανιχνεύθηκε για πρώτη φορά στα συγκεκριμένα είδη και μάλιστα διαπιστώθηκε ότι η συχνότητα εμφάνισής του ποικίλει τόσο μεταξύ των δύο ειδών Cydia όσο και μεταξύ των πληθυσμών του κάθε είδους. Στο είδος Pammene fasciana, το βακτήριο ανιχνεύθηκε σε όλα τα άτομα που μελετήθηκαν. 2

13 Τα αποτελέσματα της παρούσας διατριβής συζητούνται από τη σκοπιά τόσο της οικολογικής και εξελικτικής σημασίας τους όσο και της προοπτικής χρησιμοποίησης του συμβιωτικού βακτηρίου Wolbachia για τον πληθυσμιακό έλεγχο επιβλαβών εντόμων όπως οι μύγες τσε-τσε, οι αφίδες και η καρπόκαψα καστανιάς. 3

14 THESIS SUMMARY Wolbachia is an intracellular and maternally inherited symbiotic bacterium that belongs to the class of Alphaproteobacteria and the order of Rickettsiales. It is the most ubiquitous intracellular symbiotic organism of the planet, since it has been estimated that over 40% of insect species, in addition to filarial nematodes, crustaceans, and arachnids are infected with Wolbachia. In arthropods Wolbachia affects the biological functions and properties of its hosts and it is responsible for a number of reproductive abnormalities, such as cytoplasmic incompatibility (CI), thelytokous parthenogenesis, feminization of genetic males and male killing. These unique biological characteristics of Wolbachia are attracting the interest of various researchers for: (a) decyphering the role of Wolbachia in evolutionary processes (mainly speciation), and (b) for its use in environmentally friendly applications for the control of agricultural pests and disease vectors. The species of genus Glossina (Diptera: Glossinidae) known as tsetse flies, have been found to be infected with Wolbachia. Tsetse flies are the sole vectors of pathogenic trypanosomes in tropical Africa, causing the sleeping sickness in humans and the nagana in animals. The potential use of Wolbachia for the control of tsetse flies, prerequisite a thorough knowledge of its genetic identity and the interactions with the host. To further characterize the prevalence of Wolbachia in tsetse flies an extensive screen of more than 5300 specimens from natural and laboratory populations of 11 different Glossina species originating from 13 African countries was carried out. Our results indicated a huge divergence in the prevalence of Wolbachia, both among the species and among populations of the same species. Further characterization by MLST and wsp genotyping was carried out for the Wolbachia strains of 29 representative populations and species of tsetse flies. An impressive genetic diversity of Wolbachia strains in tsetse flies was revealed. Interestingly, disconcordance between the phylogeny of Wolbachia and that of the tsetse flies was observed, suggesting horizontal transmission of Wolbachia during the evolution. Moreover, extended horizontal gene transfer events were detected for first time in Glossina morsitans morsitans, Glossina pallidipes και Glossina austeni. These results raise critical questions concerning: (a) the origin/mechanism of these horizontal gene transfer events, (b) their temporal determination, (c) their potential role as agents of speciation and (d) their selective appearance in only some Glossina species e.g in the subspecies Glossina morsitans centralis which is closely related with Glossina morsitans morsitans the phenomenon was not observed. Equally important will be to examine if genes from the chromosomal insertions were 4

15 potentially expressed and examine if these genes are associated with the vectorial capacity of tsetse flies for the trypanosoma transmission. Finally, a negative correlation between the presence of Wolbachia with the Salivary Gland Hypertrophy Virus (SGHV) was identified. This is further discussed in the context of biological applications for control of tsetse fly-vector and trypanosomiasis. Finally in this thesis, the detection and characterization of Wolbachia in 78 specimens of 22 aphids species, from 26 natural populations, from Greece was examined. Only 4 out of 26 populations were found to be infected with Wolbachia, and specifically the species: Aphis fabae, Aphis hederae, Metopolophium dirhodum και Baizongia pistaciae. These results indicated that the presence of Wolbachia in aphids is probably more prevalent than it was derived from previous studies. Also, detection and characterization of Wolbachia in the Cydia splendana, Cydia fagiglandana and Pammene fasciana was carried out. Wolbachia was detected for first time in these species, and it was found that the prevalence of Wolbachia varies between the two species of Cydia and among populations of each species, with the infection in Pammene fasciana being fixed. At the end the ecological and evolutionary importance of Wolbachia, together with the use of the bacterium for the population control of harmful insects like tsetse flies, aphids and moths is further discussed. 5

16 ΕΙΣΑΓΩΓΗ ΚΕΦΑΛΑΙΟ 1 ΕΙΣΑΓΩΓΗ 1.1 Συμβίωση και ενδοσυμβίωση Η βιολογία του βακτηρίου Wolbachia pipientis Γενικά στοιχεία - Ιστορική ανασκόπηση Μορφολογία Τροπισμός Ξενιστές του βακτηρίου Wolbachia Φυλογενετικές και εξελικτικές σχέσεις Γενετική ταυτοποίηση και το σύστημα MLST Αλληλεπιδράσεις με ξενιστές Το βακτήριο Wolbachia ως παράγοντας ειδογένεσης Οριζόντια Μεταφορά Γονιδίων (Horizontal Gene Transfer, HGT) Το γονιδίωμα του βακτηρίου Wolbachia Γενετικός ανασυνδυασμός Το βακτήριο Wolbachia ως εργαλείο ελέγχου επιβλαβών εντόμων και ασθενειών Μύγα τσε-τσε Αφίδες Καρπόκαψα καστανιάς Σκοπός της παρούσας διατριβής ΒΙΒΛΙΟΓΡΑΦΙΑ 62 6

17 ΕΙΣΑΓΩΓΗ 1.1 Συμβίωση και ενδοσυμβίωση Με τον όρο συμβίωση (symbiosis) αρχικά περιγράφηκε η κατάσταση όπου δύο διαφορετικοί οργανισμοί ζουν μαζί, ανεξαρτήτως των επιδράσεων για τους εμπλεκομένους αυτούς οργανισμούς, και ως εκ τούτου περιλαμβάνεται η αμφοτεροβίωση (mutualism), δηλαδή η αμοιβαία ωφέλιμη συμβίωση, ο παρασιτισμός (parasitism) και η κοινοβίωση (commensalism), στην οποία ο ένας εταίρος επωφελείται και ο άλλος υφίσταται ουδέτερη επίδραση (De Bary, 1879). Με άλλα λόγια, είναι η στενή συνύπαρξη μεταξύ δύο ή περισσοτέρων ανόμοιων οργανισμών. Ένα συμβιωτικό βακτήριο μπορεί να εξελιχθεί προς όφελος του ξενιστή, διότι με την επιβίωση του ξενιστή του, εξασφαλίζει την επιβίωση του τρέχοντος ενδιαιτήματός του. Σήμερα, ο όρος συμβίωση (symbiosis) χρησιμοποιείται για να περιγράψει ένα μεγάλο φάσμα αλληλεπιδράσεων προκαρυωτικών και ευκαρυωτικών οργανισμών, από τον παρασιτισμό (parasitism) μέχρι την αμοιβαία ωφέλιμη συμβίωση (mutualism) (Bourtzis & Miller 2003, Bourtzis & Miller 2006, Moran 2006, Bourtzis & Miller 2008, Zchori-Fein & Bourtzis 2011). Η ενδοσυμβίωση είναι μια μορφή συμβίωσης στην οποία ο ένας εταίρος, συνήθως βακτηριακός, ζει μέσα στον άλλο, συνήθως τον ευκαρυωτικό ξενιστή. Από εξελικτικής απόψεως, η συμβίωση εμφανίζεται πολύ πριν την ύπαρξη των πολυσύνθετων πολυκύτταρων οργανισμών. Από τη δεκαετία του `70, ο επιστημονικός κόσμος ανέπτυξε τη θεωρία σχετικά με την εξέλιξη των ευκαρυωτικών οργανισμών η οποία θεμελιώνει την ενδοσυμβιωτική προέλευση των μιτοχονδρίων και των χλωροπλαστών (Margulis 1970, Gray & Doolittle 1982). Βάσει της θεωρίας αυτής, οι χλωροπλάστες και τα μιτοχόνδρια αρχικά αποτελούσαν βακτηριακά κύτταρα τα οποία με την πάροδο του χρόνου ενσωματώθηκαν στο κυτταρόπλασμα των πρόδρομων ευκαρυωτικών κυττάρων προσφέροντάς τους ενέργεια και λαμβάνοντας ως αντίτιμο από αυτά ένα σταθερό και πλούσιο σε θρεπτικά συστατικά περιβάλλον. Κατά τη διάρκεια της εξέλιξης, αυτή η τόσο στενή σχέση είχε σαν αποτέλεσμα τη μετατροπή των προκαρυωτικών αυτών κυττάρων σε ενδοκυτταρικά οργανίδια. Η παρουσία των πολύπλοκων πολυκύτταρων οργανισμών αποτέλεσε πηγή καινούριων πρόσφορων ενδιαιτημάτων, ευνοϊκών προς αξιοποίηση από τους προκαρυωτικούς οργανισμούς. Κατά την εξελικτική διαδικασία, το γεγονός αυτό οδήγησε ένα μεγάλο σύνολο οργανισμών που ζουν σε κάθε τύπου οικότοπο (χερσαίο, λιμναίο, θαλάσσιο) να αναπτύξουν πολυσύνθετες συμβιωτικές σχέσεις με ένα μεγάλο πλήθος βακτηρίων, η έκταση και η σπουδαιότητα των οποίων άρχισε να αναδύεται μετά την ανάπτυξη της μοριακής βιολογίας (Moran 2006). Ο ρόλος αυτών των συμβιωτικών σχέσεων θεωρείται σημαντικός τόσο για την εξέλιξη, καθώς έχουν συχνά ως αποτέλεσμα την αναπαραγωγική απομόνωση των πληθυσμών τους και την ειδογένεση 7

18 ΕΙΣΑΓΩΓΗ (Bandi et al. 2001, Hurst & Werren 2001, Charlat et al. 2003, Wernegreen 2004), όσο και για την οικολογία του ξενιστή, επηρεάζοντας οικολογικούς παράγοντες όπως η διατροφή και η άμυνα σε φυσικούς εχθρούς (Zientz et al. 2004, Baumann 2005, Scarborough et al. 2005, Dunbar et al. 2007, Teixeira et al. 2008, Oliver et al. 2009). Οι συμβιωτικές σχέσεις εντόμων-βακτηρίων θεωρούνται από τις καλύτερα μελετημένες. Τα έντομα αποτελούν την ομάδα εκείνη του ζωικού βασιλείου με τη μεγαλύτερη βιοποικιλότητα (πάνω από 10 6 είδη στη Γη) και απαντούν σε πληθώρα οικοτόπων. Το γεγονός αυτό αποδίδεται στην ικανότητά τους να καλύπτουν τις διατροφικές τους ανάγκες με ποικιλία τροφών ως απόρροια, κατά ένα μεγάλο ποσοστό, της ύπαρξης των συμβιωτικών τους βακτηρίων (Ishikawa 2003). Οι σχέσεις αυτές μεταξύ συμβιωτικών μικροοργανισμών και εντόμων είναι στενές και ποικίλες, ενώ η μορφή τους καθορίζεται από το μηχανισμό εγκαθίδρυσής τους, τις επιδράσεις τους στη βιολογία του ξενιστή και στα χαρακτηριστικά του γονιδιώματος των συμβιωτικών βακτηρίων (Moran 2006). Η διάκριση των συμβιωτικών σχέσεων σε κάποιες περιπτώσεις καθίσταται ασαφής εξαιτίας της δυναμικής που τις χαρακτηρίζει, αφού είναι ευμετάβολες κατά τη διάρκεια της εξέλιξης ακόμη και για τον ίδιο οργανισμό, αν βρεθεί σε μεταβαλλόμενες, περιβαλλοντικές συνθήκες. Ωστόσο, γενικά μπορούν να διακριθούν οι παρακάτω δύο κατηγορίες. Στην πρώτη κατηγορία ανήκουν τα πρωτεύοντα ή υποχρεωτικά συμβιωτικά βακτήρια (primary ή obligate bacterial symbionts ή P-symbionts) τα οποία έχουν αναπτύξει μια υποχρεωτική και αμοιβαία ωφέλιμη σχέση με τους ξενιστές τους (Baumann 2005, Moran et al. 2008). Χαρακτηριστικά παραδείγματα αποτελούν τα είδη Buchnera aphidicola με τις αφίδες (Baumann et al. 1995, Zientz et al. 2004, Baumann 2005, Dale & Moran 2006), Wigglesworthia sp. με τις μύγες τσετσε (Aksoy 2000), Carsonella ruddii με τους ψύλλους (Clark et al. 2001) και Blochmannia sp. με τα μυρμήγκια ξύλου (Schröder et al. 1996). Τα υποχρεωτικά αυτά συμβιωτικά βακτήρια είναι μητρικά κληρονομούμενα και στεγάζονται σε ειδικά διαμορφωμένα κύτταρα-όργανα που σχηματίζουν οι ξενιστές τους, τα βακτηριώματα (bacteriomes). Σε αντάλλαγμα αυτών των σταθερών συνθηκών διαβίωσης και κληρονόμησης, προσφέρουν στον ξενιστή τους απαραίτητα θρεπτικά στοιχεία όπως βιταμίνες και αμινοξέα, τα οποία απουσιάζουν από τη δίαιτα των ξενιστών τους (Baumann 2005, Moran et al. 2008, Ferrari & Vavre 2011). Σε μερικές περιπτώσεις, έχει βρεθεί ότι ενισχύουν τον αμυντικό μηχανισμό των εντόμων έναντι των φυσικών τους εχθρών (Pais et al.2008, De Souza et al. 2009, Ferrari & Vavre 2011). Μάλιστα, η παράλληλη φυλογένεια μεταξύ βακτηρίου και ξενιστή μαρτυρεί [Εικόνα 1.1] τη συν-εξέλιξη τους και τη μακροχρόνια σχέση αλληλεξάρτησης που έχουν αναπτύξει πολύ πριν από την 8

19 ΕΙΣΑΓΩΓΗ εμφάνιση των θηλαστικών και όλων των σύγχρονων μορφών ζωής (Moran et al. 1993, Chen et al. 1999, Dale & Moran 2006). Η δεύτερη κατηγορία περιλαμβάνει τα λεγόμενα δευτερεύοντα ή προαιρετικά συμβιωτικά βακτήρια (secondary ή facultative bacterial symbionts ή S-symbionts). Ενώ τα πρωτεύοντα συμβιωτικά βακτήρια είναι αποκλειστικά μητρικά κληρονομούμενα, τα δευτερεύοντα συμβιωτικά βακτήρια μεταδίδονται τόσο κάθετα (μητρική κληρονόμηση) όσο και μέσω της οριζόντιας μεταφοράς τους μεταξύ διαφορετικών ειδών, μεταφορά που λαμβάνει χώρα σε εξελικτικό χρόνο. Αυτή η διαφορά στον τρόπο μεταβίβασης απεικονίζεται ξεκάθαρα στις φυλογενετικές σχέσεις μεταξύ των στελεχών Wolbachia και των ξενιστών τους. Υπάρχει απουσία συν-εξέλιξης, σε πλήρη αντίθεση με ό,τι παρατηρείται μεταξύ των πρωτευόντων συμβιωτικών βακτηρίων και των ξενιστών τους [Εικόνα 1.1] (Russell et al. 2003, Baumann 2005, Dale & Moran 2006, Moran et al. 2008, Viljakainen et al. 2008, Chiel et al. 2009). Εντός του ξενιστή, τα ενδοσυμβιωτικά βακτήρια απαντούν είτε ενδοκυττάρια σε διαφορετικά είδη ιστών και οργάνων (μεταξύ αυτών και στα αναπαραγωγικά όργανα) είτε εξωκυττάρια στην αιμολέμφο. Η ανάπτυξη μηχανισμών που θα προσδίδουν στους μολυσμένους πληθυσμούς κάποιο πλεονέκτημα έναντι των μη μολυσμένων αποτελεί προϋπόθεση για μια επιτυχημένη μετακίνηση, εγκαθίδρυση και διάδοση των δευτερευόντων συμβιωτικών βακτηρίων. Βάσει αυτών των μηχανισμών, τα προαιρετικά συμβιωτικά βακτήρια έχουν αναπτύξει ποικίλες αλληλεπιδράσεις με τον ξενιστή που κυμαίνονται από το να καθιστούν τον ξενιστή ικανό να ανταπεξέλθει σε συγκεκριμένες περιβαλλοντικές συνθήκες έως τον αναπαραγωγικό παρασιτισμό (Moran et al. 2008, Ferrari & Vavre 2011). Πράγματι η παρουσία δευτερευόντων συμβιωτικών βακτηρίων έχει συσχετιστεί με την ανθεκτικότητα ξενιστών σε αντίξοες περιβαλλοντικές συνθήκες (π.χ. υψηλές θερμοκρασίες), την ενισχυμένη αμυντική λειτουργία τους κατά φυσικών εχθρών (π.χ. παρασιτοειδή και ιούς) και τη δυνατότητα αξιοποίησης συγκεκριμένου τύπου θρεπτικών συστατικών (Oliver et al. 2003, Moran et al. 2005, Scarborough et al. 2005, Dunbar et al. 2007, Hedges et al. 2008, Werren et al. 2008, Chiel et al. 2009). Επίσης, άλλα είδη δευτερευόντων συμβιωτικών βακτηρίων, που ονομάζονται αναπαραγωγικά παράσιτα, έχουν αναπτύξει μια σειρά μηχανισμών χειραγώγησης της αναπαραγωγικής λειτουργίας των ξενιστών τους με σκοπό την εξασφάλιση της μητρικής κληρονόμησης και της εξάπλωσής τους. Η κατηγορία αυτή περιλαμβάνει συμβιωτικά βακτήρια που ανήκουν στα γένη Wolbachia, Rickettsia, Cardinium, Spiroplasma και Arsenophonus. Η παρουσία και η δράση των βακτηρίων αυτών έχει συσχετιστεί με φαινόμενα όπως η παρθενογένεση (parthenogenesis), η θανάτωση των αρσενικών (male killing), η θηλυκοποίηση (feminization) και το πλέον διαδεδομένο, η κυτταροπλασματική ασυμβατότητα (ΚΑ - 9

20 ΕΙΣΑΓΩΓΗ Cytoplasmic Incompatibility ή CI). Επιγραμματικά, η βασική αρχή της κυτταροπλασματικής ασυμβατότητας είναι η αύξηση της αναλογίας των μολυσμένων θηλυκών τα οποία έχουν τη δυνατότητα να μεταδώσουν τα βακτήρια. Στην απλή εκδοχή της ΚΑ, η αύξηση αυτή επιτυγχάνεται με την κατά κάποιο τρόπο στειρότητα που εμφανίζεται σε διασταυρώσεις μεταξύ μη μολυσμένων θηλυκών με μολυσμένα αρσενικά (O Neill et al. 1992, Werren 1997, Stouthamer et al. 1999, Stevens et al. 2001, Bourtzis & Miller 2003, McGraw & O Neill 2004, Bourtzis & Miller 2006, Pool et al. 2006, Gotoh et al. 2007, Bourtzis & Miller 2008). Ένα από τα πλέον μελετημένα και ενδιαφέροντα αναπαραγωγικά παράσιτα συνιστά το βακτήριο Wolbachia pipientis, τα κύρια βιολογικά χαρακτηριστικά του οποίου θα παραθέσουμε στις επόμενες παραγράφους (Bourtzis & O Neill 1998, Bourtzis & Braig 1999, Ioannidis & Bourtzis 2007, Saridaki & Bourtzis 2010). Εικόνα 1.1. Διακριτές εξελικτικές πορείες συμβιωτικών βακτηρίων στα έντομα [Προσαρμογή από Dale & Moran 2006]. 10

21 ΕΙΣΑΓΩΓΗ 1.2 Η βιολογία του βακτηρίου Wolbachia pipientis Γενικά στοιχεία - Ιστορική ανασκόπηση Το βακτήριο Wolbachia pipientis (Wolbachia για τον σκοπό της παρούσας διατριβής) συνιστά ένα ενδοκυττάριο και μητρικά κληρονομούμενο μικροοργανισμό, ο οποίος αναφέρθηκε για πρώτη φορά στη βιβλιογραφία το 1924 από τους Hertig και Wolbach μετά από τον εντοπισμό του στις ωοθήκες του κουνουπιού Culex pipiens (Hertig & Wolbach 1924). Το 1936 ο Hertig προχώρησε σε μια λεπτομερή μορφολογικά περιγραφή του βακτηρίου, η οποία ανέδειξε ομοιότητες με είδη του γένους Rickettsia (Hertig 1936). Για πρώτη φορά τη δεκαετία του 1950 καταγράφηκε το φαινόμενο της κυτταροπλασματικής ασυμβατότητας, που αρχικά είχε αποδοθεί στον ξενιστή και όχι στο βακτήριο. Το φαινόμενο αυτό ώθησε την επιστημονική κοινότητα για τη διεξοδική μελέτη του συστήματος ξενιστή-βακτηρίου (Laven 1951, Gheletovich 1952, Laven 1959). Μετά από δυο δεκαετίες, η χρήση κατάλληλων αντιβιοτικών οδήγησε τόσο στην εξάλειψη του βακτηρίου όσο και της επαγωγής του φαινοτύπου της κυτταροπλασματικής ασυμβατότητας αποδεικνύοντας έτσι τη θετική συσχέτιση της παρουσίας του βακτηρίου στον ξενιστή με το φαινόμενο της κυτταροπλασματικής ασυμβατότητας (Yen & Barr 1971). Από το 1970 έως και σήμερα έχουν πραγματοποιηθεί σειρά ερευνητικών μελετών για το βακτήριο Wolbachia και τις βιολογικές του ιδιότητες, με επίκεντρο κυρίως το φαινόμενο της κυτταροπλασματικής ασυμβατότητας, το οποίο έκτοτε έχει παρατηρηθεί σε μεγάλη ποικιλία εντόμων. Από τις αρχές της δεκαετίας του 1990, με την αξιοποίηση μεθόδων γενετικής και μοριακής βιολογίας, έχει διαπιστωθεί ότι το συγκεκριμένο βακτήριο σχετίζεται επίσης με την επαγωγή φαινομένων όπως παρθενογένεση, θηλυκοποίηση και θανάτωση των αρσενικών. Επίσης, έχει ανιχνευθεί σε μεγάλο εύρος ξενιστών και έχει γίνει σημαντική προσπάθεια του φυλογενετικού χαρακτηρισμού των βακτηριακών στελεχών (Stouthamer et al. 1990, Breeuwer et al. 1992, O'Neill et al. 1992, Rousset et al. 1992, Bouchon et al. 1998, Hurst et al. 2000). Αυτές οι σημαντικές βιολογικές ιδιότητες του βακτηρίου σε συνδυασμό με τον τεράστιο αριθμό οργανισμών που προσβάλει προσελκύουν συνεχώς όλο και περισσότερο ερευνητικό ενδιαφέρον (Bian et al. 2010, Glaser & Meola 2010, Hosokawa et al. 2010, Miller et al. 2010, Mousson et al. 2010, Saridaki & Bourtzis 2010, Apostolaki et al. 2011, Atyame et al. 2011b, Augustinos et al. 2011, Hoffmann et al. 2011, Walker et al. 2011, Fast et al. 2011, Andrews et al. 2012, Lu et al. 2012b, Mousson et al. 2012, Osborne et al. 2012, Pan et al. 2012, Albertson et al. 2013, Balmad et al. 2013, Bian et al. 2013a, 2013b, Caragata et al. 2013, Strunov et al. 2013, Turley et al. 2013, Ye et al. 2013a, 2013b). 11

22 ΕΙΣΑΓΩΓΗ Μορφολογία - Τροπισμός Το συμβιωτικό βακτήριο Wolbachia παρουσιάζεται με δύο μορφές: κοκκοειδή (διαμέτρου μm) και ραβδοειδή (μεγέθους μm). Το βακτήριο βρίσκεται έγκλειστο σε ένα κυστίδιο και περικλείεται από τρία επίπεδα μεμβρανών (χαρακτηριστικό πολλών ενδοσυμβιωτικών βακτηρίων) : ένα κυτταρικό τοίχωμα, μια εσωτερική κυτταροπλασματική μεμβράνη και μια εξωτερική μεμβράνη με πιθανή προέλευση από τον ξενιστή (Kozek 1977, Kozek & Marroquin, 1977, Wright et al. 1978, Wright & Barr 1980, Wright & Wang, 1980, Louis & Nigro 1989). Το βακτήριο Wolbachia, ως μέλος της τάξης των Rickettsiales, έχει τυπικό κυτταρικό τοίχωμα, δεν έχει μαστίγια, είναι κατά gram-αρνητικό βακτήριο και ο πολλαπλασιασμός του γίνεται με διχοτόμηση μέσα στα κύτταρα των ξενιστών. Σειρά μελετών έδειξαν ότι το βακτήριο απαντά κυρίως στο κυτταρόπλασμα των κυττάρων των αναπαραγωγικών οργάνων (Hertig 1936, Louis & Nigro 1989). Στα αναπαραγωγικά όργανα, και πιο συγκεκριμένα στις ωοθήκες, τα βακτήρια εντοπίζονται σε αφθονία στα τροφικά κύτταρα, στα οποία και πολλαπλασιάζονται (Zchori-Fein et al. 1998, Veneti et al. 2004, Ferree et al. 2005, Ferree & Sullivan 2006). Το περιεχόμενο των τροφικών κυττάρων μεταφέρεται στο αναπτυσσόμενο αυγό, μέσα στο οποίο το βακτήριο αλληλεπιδρά με μικροσωληνίσκους (microtubules) (O'Neill & Karr 1990, Callaini et al. 1994, Kose & Karr 1995, Callaini et al. 1996, Lassy & Karr 1996, Callaini et al. 1997, Ferree et al. 2005). Στο γερμάριο (germarium) της Drosophila melanogaster βρέθηκε ότι το βακτήριο Wolbachia φθάνει στα αναπαραγωγικά κύτταρα (germline) μέσω των σωματικών βλαστοκυττάρων (somatic stem cell niche). Μάλιστα, φαίνεται ότι αυτή η συγκεκριμένη θέση του βακτηρίου, παίζει σημαντικό ρόλο στην αποτελεσματική κάθετη (vertical) μετάδοσή του (Frydman et al. 2006). Παράλληλα, παρατηρήθηκε ότι η παρουσία του βακτηρίου στα αναπαραγωγικά βλαστοκύτταρα (germline stem cell niche), του εντόμου Drosophila mauritana ευνοεί τον πολλαπλασιασμό τους (Fast et al. 2011). Πέραν των αναπαραγωγικών οργάνων, το βακτήριο Wolbachia έχει εντοπιστεί και σε άλλα είδη οργάνων και ιστών, σε πλήθος ξενιστών. Αυτό αφορά τόσο περιπτώσεις φυσικών όσο και τεχνητών μολύνσεων (transinfections). Το πιο χαρακτηριστικό παράδειγμα αποτελεί το βακτηριακό στέλεχος wmelpop, που ανιχνεύτηκε σε νευρικούς και μυϊκούς ιστούς της Drosophila melanogaster (Min & Benzer 1997). Μεταγενέστερη μελέτη έδειξε ότι το στέλεχος wmelpop εντοπίζεται κυρίως στο υποοισοφαγικό γάγγλιο και τον κεντρικό εγκέφαλο του ξενιστή, κατανομή η οποία καθορίζεται κατά την εμβρυογένεση (Strunov et al. 2013). Ο Dobson και οι συνεργάτες του εντόπισαν το βακτήριο Wolbachia σε διάφορα είδη ξενιστών (Drosophila spp., Aedes albopictus Houston, Culex pipiens Barriol, Culex cautella και σε αρσενικά άτομα 12

23 ΕΙΣΑΓΩΓΗ μύγας τσε-τσε του είδους Glossina morsitans) σε πλήθος ιστών (εκτός των αναπαραγωγικών) όπως: εγκέφαλο, μύες, έντερο, σιελογόνο αδένα, μαλπιγγειανά σωληνάρια, λιπώδη ιστό, φτερά και αιμολέμφο (Dobson et al. 1999). Επιπλέον, σειρά μελετών αναφέρουν τον εντοπισμό του βακτηρίου Wolbachia σε ποικιλία ιστών και οργάνων όπως: στο σιελογόνο αδένα, και συγκεκριμένα στους πλευρικούς λοβούς του κουνουπιού (Chen et al. 2005), στο λιπώδη ιστό της προνύμφης της D. melanogaster (Clark et al. 2005), στον εγκέφαλο της Drosophila κατά την ανάπτυξη της προνύμφης και του ακμαίου (Albertson et al. 2009), στους σωματικούς ιστούς της μύγας D. simulans το στέλεχος wau βρέθηκε κατά την ανάπτυξη του εμβρύου (Miller & Riegler 2006). Πρόσφατα, προτάθηκε ότι ο εντοπισμός του βακτηρίου Wolbachia στο λιπώδη ιστό και τον εγκέφαλο των ανηλίκων ατόμων, στα είδη D. simulans και D. melanogaster, είναι ένα συντηρημένο χαρακτηριστικό του βακτηρίου (Albertson et al. 2013). Σχετικά με την κατανομή (tropism) του βακτηρίου στους διάφορους ιστούς-όργανα της μύγα τσε-τσε, αναφέρθηκε η παρουσία του σε σωματικούς ιστούς μόνο στο είδος G. austeni (Cheng et al 2000). Πρόσφατα, δείχτηκε ότι το βακτήριο απουσιάζει από το λιπώδη ιστό και το γαλακτικό αδένα του είδους G. m. morsitans (Balmad et al. 2013). Στις περιπτώσεις της τεχνητής μόλυνσης (διαμόλυνση-transinfection) ξενιστών με βακτηριακά στελέχη Wolbachia, η χωροταξική κατανομή τους είναι ευρεία σε πλήθος ιστώνοργάνων του ξενιστή. Αυτό άλλωστε έχει άμεση σχέση και με την αποτελεσματικότητα έκφρασης ορισμένων επιθυμητών ιδιοτήτων που οφείλονται στο βακτήριο, και που για τον λόγο αυτό ενσωματώθηκαν στον ξενιστή, όπως η αυξημένη ανθεκτικότητα σε ιούς/παθογόνα και η μειωμένη ικανότητα μετάδοσης αυτών (Osborne et al. 2012). Για παράδειγμα, το τεχνητό στέλεχος wmelpop-cla βρέθηκε να κατανέμεται στο λιπώδη ιστό, στο πρόσθιο έντερο, στο νευρικό ιστό, στα μαλπιγγειανά σωληνάρια του κουνουπιού A. aegypti μετά από τεχνητή μικροέγχυση, και να περιορίζει τη μόλυνση του φορέα (κουνούπι) από τον ιό Dengue, τον ιό Chikungunya και το παθογόνο Plasmodium (Moreira et al. 2009). Επίσης, το στέλεχος walbb που μεταφέρθηκε τεχνητά από το είδος κουνουπιού Aedes albopictus στο Aedes polynesiensis, ανιχνεύτηκε σε σωματικούς ιστούς, συμπεριλαμβανομένου του σιελογόνου αδένα και του εντέρου, και ενίσχυσε την ανθεκτικότητα του ξενιστή προς τον ιό Dengue (Bian et al. 2013b). Είναι προφανές, ότι τόσο ο τροπισμός του βακτηρίου Wolbachia σε επίπεδο οργάνων και ιστών, όσο και η πυκνότητα του, παίζουν σημαντικό ρόλο στην επιρροή που ασκεί στη φυσιολογία και τη συμπεριφορά του ξενιστή του (Min & Benzer 1997, Koukou et al. 2006, Osborne et al. 2012). Εύρος παραγόντων που έχουν να κάνουν με το είδος του ξενιστή και τον τύπο του βακτηριακού στελέχους, όπως το αναπτυξιακό στάδιο του ξενιστή, το γενετικό υπόβαθρο του ξενιστή, ο ανταγωνισμός μεταξύ περισσοτέρων του ενός βακτηριακών στελεχών 13

24 ΕΙΣΑΓΩΓΗ στον ίδιο ιστό, το φύλο και η ηλικία του ξενιστή, καθορίζουν την κατανομή και την πυκνότητα του βακτηρίου (Bourtzis et al. 1996, Ijichi et al. 2002, Veneti et al. 2004, Albertson et al. 2009). Άλλωστε, ο απώτερος σκοπός του συμβιωτικού βακτηρίου Wolbachia μέσω των επιδράσεων στη συμπεριφορά του ξενιστή, δεν είναι άλλος, από την εξασφάλιση/αύξηση της δικιάς του μετάδοσης (Thomas et al. 2005) Ξενιστές του βακτηρίου Wolbachia Το συμβιωτικό βακτήριο Wolbachia ανήκει σε ένα ποικιλόμορφο σύνολο ενδοκυτταρικών βακτηρίων τα οποία έχουν αναπτύξει ένα ευρύ φάσμα συμβιωτικών σχέσεων με τους ξενιστές τους από παρασιτικές έως σχέσεις αμοιβαίας ωφέλειας. Αν και συγγενικά γένη όπως αυτά των Anaplasma, Ehrlichia και Rickettsia παρασιτούν σε διάφορα είδη αρθροπόδων και μέσω αυτών μεταδίδονται σε θηλαστικά για τα οποία αποτελούν παθογόνα (Dumler et al. 2001, Brayton et al. 2005, Zhu et al. 2005), το βακτήριο Wolbachia δεν έχει εντοπιστεί μέχρι στιγμής σε κάποιο θηλαστικό. Η τεράστια λίστα των ξενιστών του βακτηρίου Wolbachia περιλαμβάνει πλήθος ασπόνδυλων όπως ακάρεα, ισόποδα, αραχνοειδή, σκορπιούς, νηματώδεις της φιλαρίασης, φυτοπαρασιτικούς νηματώδεις, κατά κύριο λόγο όμως έντομα (Rousset et al. 1992, Sironi et al. 1995, Werren et al. 1995, Breeuwer & Jacobs 1996, Werren 1997, Werren & O Neill 1997, Bandi et al. 1998a,b, West et al. 1998, Bourtzis & Braig 1999, Stouthamer et al. 1999, Jeyaprakash & Hoy 2000, Stevens et al. 2001, Gotoh et al. 2003, Kikuchi & Fukatsu 2003, Nirgianaki et al. 2003, Rowley et al. 2004, Tagami & Miura 2004, Bordenstein & Rosengaus 2005, Baldo et al. 2007, Baldo et al. 2008, Hilgenboecker et al. 2008, Haegeman et al. 2009, Ros et al. 2009). Σειρά μελετών καθιστούν το βακτήριο Wolbachia ως το πιο ευρέως διαδεδομένο ενδοκυττάριο συμβιωτικό μικροοργανισμό του πλανήτη μιας και εκτιμάται ότι πάνω από το 40% των ειδών αρθροπόδων συμβιώνουν με αυτό (Jeyaprakash & Hoy 2000, Hilgenboecker et al. 2008, Zug & Hammerstein 2012) Φυλογενετικές και εξελικτικές σχέσεις Το μόνο έως τώρα αναγνωρισμένο είδος του γένους Wolbachia είναι το Wolbachia pipientis (Lo et al. 2007). Οι φυλογενετικές μελέτες βάσει του γονιδίου 16S rrna κατατάσσουν το είδος στην υποομάδα των άλφαπρωτεοβακτηρίων, στην τάξη των Rickettsiales, οικογένεια Anaplasmataceae (Dunning Hotopp et al. 2006, Bordenstein et al. 2009, Ferri et al. 2011, Montagna et al. 2013). 14

25 ΕΙΣΑΓΩΓΗ Φυλογενετικές μελέτες βασιζόμενες κυρίως στα γονίδια 16S rrna, wsp, ftsz, dnaa, groel και glta ταξινομούν τα στελέχη Wolbachia σε 13 υπερομάδες, οι οποίες έχουν ονομαστεί από το Α έως το F και το Η εως το Ν (Werren et al. 1995, Bandi et al. 1998a, Zhou et al. 1998, Vandekerckhove et al. 1999, Cheng et al. 2000, Lo et al. 2002, Gorham et al. 2003, Rowley et al. 2004, Bordenstein & Rosengaus 2005, Casiraghi et al. 2005, Dunn & Stabb 2005, Lo et al. 2007, Vaishampayan et al. 2007, Haegeman et al. 2009, Ros et al. 2009, Augustinos et al. 2011) [Εικόνα 1.2]. Λόγω αυτής της μεγάλης γενετικής ποικιλότητας που παρουσιάζει το συμβιωτικό βακτήριο Wolbachia, o μοριακός χαρακτηρισμός των στελεχών του γίνεται πλέον μέσω της μεθόδου MLST (Multi Locus Sequence Typing, Αποτύπωση Αλληλουχίας Πολλαπλού Γενετικού Τόπου), η οποία στηρίζεται στις αλληλουχίες περισσότερων του ενός γενετικών μαρτύρων (Baldo et al. 2006a, Paraskevopoulos et al. 2006). Οι υπερομάδες A έως D θεωρούνται από τις κυριότερες καθώς σε αυτές ανήκουν και η πλειοψηφία των στελεχών, με τις Α και Β να απαντούν μόνο σε αρθρόποδα (κυρίως έντομα, χερσαία ισόποδα και ακάρεα), ενώ οι C και D απαντούν μόνο στους νηματώδεις της φιλαρίασης (Werren et al. 1995, Bandi et al. 1998a). Η υπερομάδα Ε εντοπίστηκε στα Κολέμβολα (Czarnetzki & Tebbe 2004) ενώ η υπερομάδα F έχει περιγραφεί τόσο σε αρθρόποδα (γρύλους, αράχνες, σκορπιούς, κοριούς και ψείρες) όσο και σε νηματώδεις του γένους Mansonella (Rowley et al. 2004, Casiraghi et al. 2005, Sakamoto & Rasgon 2006, Baldo et al. 2007, Covacin & Barker 2007, Panaram & Marshall 2007). Οι υπερομάδες G και H έχουν βρεθεί σε αράχνες τις Αυστραλίας (Rowley et al. 2004) και τερμίτες, αντίστοιχα (Bordenstein & Rosengaus 2005). Ωστόσο, η υπερομάδα G δε θεωρείται έγκυρη αφού ο χαρακτηρισμός της βασίστηκε μόνο στις αλληλουχίες των γονιδίων wsp και 16S rrna, ενώ τα δεδομένα που προέκυψαν με το σύστημα MLST (MultiLocus Sequence Typing) φανερώνουν ότι είναι αποτέλεσμα ανασυνδυασμού μεταξύ των υπερομάδων Α και Β (Baldo et al. 2006a, Baldo & Werren 2007). Επιπλέον, η υπερομάδα I απαντά σε ψύλλους (Gorhan et al. 2003, Casiraghi et al. 2005), η υπερομάδα J έχει βρεθεί σε νηματώδεις της φιλαρίασης του είδους Dipetalonema gracile (Casiraghi et al. 2004), η υπερομάδα Κ απαντά σε ακάρεα του γένους Bryobia (Ros et al. 2009), η υπερομάδα L εντοπίζεται σε φυτοπαρασιτικούς νηματώδεις (Haegeman et al. 2009), ενώ τέλος, οι υπερομάδες Μ και Ν, οι οποίες αποτελούν και τις πιο πρόσφατα χαρακτηρισμένες ομάδες, απαντούν σε αφίδες (Augoustinos et al. 2011). 15

26 ΕΙΣΑΓΩΓΗ Εικόνα 1.2. Η φυλογένεια του βακτηρίου Wolbachia: παρουσιάζεται ένα άρριζο φυλογενετικό δένδρο των 13 υπερομάδων του βακτηρίου Wolbachia, βάσει τμήματος 842 bp του γονιδίου 16S rrna. Για κάθε υπερομάδα, επιλέχτηκε ένας αντιπρόσωπος από τη βάση δεδομένων NCBI. Στις παρενθέσεις δίνονται οι αριθμοί πρόσβασης (accession numbers) των αντίστοιχων αλληλουχιών. (Για την κατασκευή του φυλογενετικού δένδρου χρησιμοποιήθηκε η στοίχιση κατά ClustalW, η μέθοδος Neighbor-Joining, το μοντέλο Jukes-Cantor με 1000 επαναλήψεις, μέσω του Geneious Tree Builder) Η αξιολόγηση των φυλογενετικών σχέσεων μεταξύ των υπερομάδων προσφέρει χρήσιμες πληροφορίες για την κατανόηση της βιολογίας και της εξέλιξης του βακτηρίου Wolbachia. Τα στελέχη των υπερομάδων Α και Β δεν παρουσιάζουν παράλληλη φυλογένεια με αυτή των ξενιστών τους (Werren et al. 1995), φανερώνοντας ότι το βακτήριο μεταβιβάζεται όχι μόνο μητρικά στους απογόνους, αλλά και οριζόντια μεταξύ διαφορετικών ειδών αρθροπόδων. Η 16

27 ΕΙΣΑΓΩΓΗ πρώτη αναφορά για πιθανή οριζόντια μεταφορά του βακτηρίου έγινε από τον Werren και τους συνεργάτες του (Werren et al. 1995) στην περίπτωση των παρασιτοειδών εντόμων του γένους Nasonia και των ξενιστών τους, όπου εντοπίστηκαν παρόμοια στελέχη Wolbachia. Από την άλλη πλευρά, η φυλογένεια των στελεχών Wolbachia που μολύνουν τους νηματώδεις της φιλαρίασης φαίνεται να είναι σε συμφωνία με τη φυλογένεια των ξενιστών τους (Casiraghi et al. 2001). Το γεγονός αυτό υποδηλώνει μια άκρως εξαρτημένη σχέση μεταξύ του βακτηρίου Wolbachia και των νηματωδών κάτι που επιβεβαιώνεται και από τη διαπίστωση ότι η εξάλειψη του βακτηρίου με την εφαρμογή αντιβιοτικών καθιστά αδύνατη την ανάπτυξη των νηματωδών (Langworthy et al. 2000) Γενετική ταυτοποίηση και σύστημα MLST Οι κλασικές μέθοδοι (κριτήρια κατά Koch) που εφαρμόζονται για την ταυτοποίηση ειδών και στελεχών βακτηρίων δεν μπορούν να χρησιμοποιηθούν για το βακτήριο Wolbachia. Μέχρι στιγμής, κάθε προσπάθεια απομόνωσής του σε καθαρή καλλιέργεια δεν κατέστη δυνατή, αφού πρόκειται για υποχρεωτικά ενδοκυττάριο βακτήριο (Bourtzis & O'Neill 1998, Dobson et al. 2002a). Επομένως, η ταυτοποίηση των βακτηριακών στελεχών Wolbachia και η μελέτη της φυλογένειας, επικεντρώθηκε αρχικά στη χρήση μοριακών μαρτύρων, όπως τα γονίδια 16S rrna, wsp, ftsz, dnaa, groel και glta. Μάλιστα, η πρώτη φυλογενετική μελέτη του βακτηρίου πραγματοποιήθηκε βάσει του γονιδίου 16S rrna (O'Neill et al. 1992). Εντούτοις, όπως αναφέρθηκε και προηγουμένως, το συμβιωτικό βακτήριο Wolbachia παρουσιάζει μεγάλη γενετική ποικιλότητα. Επιπλέον, φαινόμενα γενετικού ανασυνδυασμού είναι συχνά μεταξύ βακτηριακών στελεχών Wolbachia (Jiggins 2002, Wu et al. 2004, Foster et al. 2005, Baldo et al. 2006b). Βάσει των παραπάνω, καθίσταται αναγκαία η χρησιμοποίηση περισσοτέρων του ενός γενετικών μαρτύρων με σκοπό την ακριβή γενετική ταυτοποίηση και την απόδοση αξιόπιστων φυλογενετικών σχέσεων μεταξύ των διαφόρων στελεχών του βακτηρίου. Επομένως, η ανάλυση πολλαπλών γονιδιακών τμημάτων (MLST - Multi Locus Sequence Typing, Αποτύπωση Αλληλουχίας Πολλαπλού Γενετικού Τόπου), αποτελεί μια κοινώς αποδεκτή μέθοδος, καθώς έτσι μειώνονται οι πιθανότητες λανθασμένων προσδιορισμών (Baldo et al. 2006a, Paraskevopoulos et al. 2006, Paraskevopoulos thesis 2007). Το σύστημα ταυτοποίησης αλληλουχιών πολλαπλών γενετικών θέσεων (MLST) είναι ένα σύστημα μοριακού χαρακτηρισμού των στελεχών Wolbachia (Baldo et al. 2006a). Συγκεκριμένα, ενισχύονται προκαθορισμένες περιοχές από πέντε συντηρημένα γονίδια (gatb, coxa, hcpa, ftsz και fbpa) με τη χρήση εξειδικευμένων εκκινητών. Εσωτερικά τμήματα μεγέθους περίπου bp για κάθε γονίδιο χρησιμοποιούνται για την ταυτοποίηση των 17

28 ΕΙΣΑΓΩΓΗ στελεχών μέσω του προφίλ των αλληλομόρφων τους. Ο συνδυασμός των αντίστοιχων πέντε αλληλουχιών που προκύπτουν (πέντε αλληλόμορφα, ένα για κάθε γονίδιο) αποδίδουν ένα είδος γενετικής ταυτότητας (Sequence Type ST) στο εκάστοτε στέλεχος Wolbachia. Επομένως, σε κάθε στέλεχος του βακτηρίου Wolbachia αντιστοιχεί ένας αριθμός γενετικής ταυτότητας (ST) που αποτελείται από τον συνδυασμό των πέντε αλληλομόρφων των πέντε συντηρημένων γονιδίων, και ουσιαστικά, συνιστά το γενετικό προφίλ αλληλομόρφων (allelic profile) του βακτηριακού στελέχους. Η ίδια γενετική ταυτότητα (ST) μπορεί να αποδοθεί μεταξύ διαφορετικών στελεχών. Επίσης, το γονίδιο wsp που κωδικοποιεί για την κύρια πρωτεΐνη της επιφάνειας του βακτηρίου Wolbachia (Wolbachia surface protein) αποτελεί ένα επιπλέον γενετικό δείκτη που μπορεί να χρησιμοποιηθεί συμπληρωματικά του συστήματος MLST στο χαρακτηρισμό των στελεχών Wolbachia. Επιπρόσθετα του MLST προφίλ αλληλομόρφων, κάθε στέλεχος Wolbachia μπορεί να χαρακτηριστεί περαιτέρω βάσει των μοτίβων αμινοξέων των τεσσάρων υπερ-μεταβλητών περιοχών (Hyper Variable Regions - HVRs) της πρωτεΐνης Wsp. Mε το ανακάτεμα των μοτίβων μεταξύ των βακτηριακών στελεχών, προέκυψε ένα σχετικά συντηρημένο σετ από μοτίβα αμινοξέων σε κάθε μία από τις 4 HVRs περιοχές (Baldo et al. 2005). Κάθε αλληλουχία αμινοξέων της πρωτεΐνης Wsp (η θέση τους σύμφωνα με την αλληλουχία του wmel είναι ) χωρίζεται σε 4 διαδοχικά τμήματα των οποίων τα σημεία διακοπής εμπίπτουν σε συντηρημένες περιοχές μεταξύ των 4 υπερ-μεταβλητών περιοχών: HVR1 (σειρά αμινοξέων 52-84), HVR2 (85-134), HVR3 ( ), HVR4 ( ). Κάθε τμήμα περιλαμβάνει ένα από τα τέσσερα HVR μοτίβα και ένα κομμάτι από τις δύο συντηρημένες πλευρικές περιοχές. Για λόγους απλoύστευσης. αναφέρουμε την κάθε περιοχή ως μια HVR. Σε κάθε ένα μοναδικό wsp νουκλεοτιδικό αλληλόμορφο και κάθε μία μοναδική HVR αλληλουχία αμινοξέων αποδίδεται ένας αριθμός. Μιας και η πλειονότητα των αλλαγών των αμινοξέων μεταξύ των Wsp αλληλουχιών συμβαίνει στις 4 HVRs, αυτά τα μοτίβα μπορούν να χρησιμοποιηθούν ως υπογραφή για το διαχωρισμό διαφορετικών Wsp πρωτεϊνικών τύπων. Αυτή η μέθοδος μπορεί επίσης να χρησιμοποιηθεί για την εύκολη ανίχνευση «ανακατεμένων» αλληλομόρφων βάσει των μοναδικών αναγνωριστικών για κάθε HVR (Baldo et al. 2006a) Αλληλεπιδράσεις με τους ξενιστές Τα δυο κύρια χαρακτηριστικά του βακτηρίου Wolbachia είναι η ευρεία εξάπλωση του σε πληθώρα οργανισμών και η μεγάλη ποικιλία συμβιωτικών σχέσεων (από αμοιβαίας ωφέλειας μέχρι παρασιτισμού) που έχει αναπτύξει με τους ξενιστές του (Werren 1997, Stouthamer et al. 1999, Bourtzis & Miller 2003). Οι αλληλεπιδράσεις του βακτηρίου με τους νηματώδεις της 18

29 ΕΙΣΑΓΩΓΗ φιλαρίασης θεωρούνται αμοιβαίας ωφέλειας αφού η παρουσία του καθιστά δυνατή τη σωστή ανάπτυξη και γονιμότητα των νηματωδών (Taylor et al. 2005). Οι αλληλεπιδράσεις του βακτηρίου Wolbachia, εκτός των αναπαραγωγικών, αφορά βασικές λειτουργίες και ιδιότητες των αρθροπόδων, όπως είναι η θρέψη, ο μεταβολισμός σιδήρου, η παραγωγή δραστικών μορφών οξυγόνου (Reactive Oxygen Species, ROS), το οξειδωτικό στρες, η απόπτωση, η μεταβολική οδός Insulin/IGF-like signalling (IIS), η ρύθμιση των mirna, η μακροβιότηταδιάρκεια ζωής, η προ-συζευκτική απομόνωση, ο φυλοκαθορισμός, και φυσικά, η αμυντική λειτουργία Διατροφή Παρόμοιες με τις αμοιβαίας ωφέλειας σχέσεις του βακτηρίου Wolbachia και των νηματωδών, έχουν αναφερθεί και στα έντομα, όπου η συμβιωτική σχέση του βακτηρίου Wolbachia σχετίζεται με διατροφικά οφέλη για το ξενιστή. Στον κοινό κοριό Cimex lectularious, η συμβίωση με το βακτήριο Wolbachia παρουσιάζει τα χαρακτηριστικά της υποχρεωτικής διατροφικής αμοιβαιότητας. Το βακτήριο Wolbachia βρίσκεται σε ειδικά όργανα (bacteriomes) και η απομάκρυνσή του επιφέρει καθυστερημένη ανάπτυξη και στειρότητα στον ξενιστή. Αυτές οι παρενέργειες εξαλείφονται με την παροχή βιταμινών Β, κάτι που υποδηλώνει ότι το βακτήριο παρέχει απαραίτητα θρεπτικά στοιχεία στον κοριό (Hosokawa et al. 2010). Τα φυτοφάγα Λεπιδόπτερα του είδους Phyllonorycter blancardella, βρέθηκε ότι βελτιώνουν την τροφοδοσία τους από τα φυτά-ξενιστές τους μέσω του σχηματισμού πράσινων περιοχών (green islands), φωτοσυνθετικά ενεργών, πάνω σε γηρασμένα φύλλα. Αυτή η αύξηση της φωτοσυνθετικής ικανότητας του φυτού, αποδίδεται στην παρουσία του συμβιωτικού βακτηρίου Wolbachia στο φυτοφάγο έντομο, και πιθανότατα σχετίζεται με τη ρύθμιση των επιπέδων κυτοκινίνης (Kaiser et al. 2010) Μεταβολισμός σιδήρου Λαμβάνοντας υπόψη ότι ο ενδοκυττάριος τρόπος ζωής του βακτηρίου Wolbachia πιθανά στηρίζεται σε παρόμοια μοτίβα-μηχανισμούς, τόσο στις ωφέλιμες όσο και στις παρασιτικές συμβιωτικές σχέσεις, τότε ο μεταβολισμός του σιδήρου ίσως να παίζει κυρίαρχο ρόλο στις αλληλεπιδράσεις μεταξύ του βακτηρίου Wolbachia και του ξενιστή (Schaible & Kaufmann 2004). Σειρά μελετών αποδεικνύουν την καθοριστική και πολυδιάστατη σημασία του σιδήρου στις συμβιωτικές σχέσεις του βακτηρίου Wolbachia και εντόμων, μερικές εκ των οποίων περιγράφονται παρακάτω. 19

30 ΕΙΣΑΓΩΓΗ Έχει αναφερθεί ότι σε περιπτώσεις μειωμένης ή αυξημένης συγκέντρωσης σιδήρου στη δίαιτα της μύγας Drosophila melanogaster, η παρουσία του βακτηρίου επάγει την αυξημένη παραγωγή αυγών, συμβάλλοντας έτσι στη βελτίωση της αναπαραγωγικότητας των εντόμων σε συνθήκες τροφικού στρες (Brownlie et al. 2009). Το γεγονός ότι στα θηλυκά άτομα, που φέρουν το βακτήριο Wolbachia, παρατηρήθηκε σημαντικά μικρότερη μείωση της παραγωγικότητάς τους, σε σχέση με τα αντίστοιχα που δε φέρουν, κατά τη διατροφή τους με αυξημένες συγκεντρώσεις σιδήρου, δύναται να εξηγηθεί από την ικανότητα του συμβιωτικού βακτηρίου να προστατεύει το έντομο από το οξειδωτικό στρες (Brownlie et al. 2009). Είναι γνωστό ότι η αύξηση των επιπέδων σιδήρου στη διατροφή των περισσοτέρων εντόμων επάγει οξειδωτικό στρες (Sohal et al. 1985). Επιπλέον, η αλληλεπίδραση του βακτηρίου Wolbachia στη φυσιολογία του ξενιστή περιλαμβάνει την παρέμβαση του στο μεταβολισμό του σιδήρου, μέσω της ρύθμισης της έκφρασης φερριτίνης. Συγκεκριμένα, στα είδη Drosophila simulans και Aedes aegypti παρατηρήθηκε υπερ-έκφραση της φερριτίνης σε άτομα χωρίς το βακτήριο Wolbachia, σε σχέση με άτομα που έφεραν το συμβιωτικό βακτήριο. Παράλληλα, η έκφραση της βακτηριακής φερριτίνης αυξήθηκε με την παρουσία σιδήρου, μειώνοντας την περίσσεια σιδήρου στον ξενιστή. Με τον τρόπο αυτό το βακτήριο Wolbachia προστατεύει τον ξενιστή του από το οξειδωτικό στρες και την απόπτωση, εξασφαλίζοντας έτσι στο ίδιο, ασφαλή παραμονή μέσα σε αυτόν (Kremer et al. 2009) Δραστικές μορφές οξυγόνου (ROS) και οξειδωτικό στρες Στη μελέτη των Brennan και συνεργατών του (Brennan et al. 2008), παρατηρήθηκε ότι η παρουσία του βακτηρίου Wolbachia στο κουνούπι Aedes albopictus επάγει την έκφραση αντιοξειδωτικών πεπτιδίων του ξενιστή και την αυξημένη παραγωγή δραστικών μορφών οξυγόνου (Reactive Oxygen Species, ROS). Η αυξημένη παραγωγή ROS μπορεί να οφείλεται είτε στην ανοσοαπόκριση του ξενιστή λόγω της ύπαρξης του βακτηρίου, είτε στον αερόβιο μεταβολισμό του ίδιου του βακτηρίου. Πιθανά, το βακτήριο Wolbachia, μέσω της αυξημένης αυτής έκφρασης των αντιοξειδωτικών πρωτεϊνών εκ μέρους του ξενιστή, αντιμετωπίζει έμμεσα τα υψηλά επίπεδα ROS, μιας και το ίδιο έχει χάσει ενδογενή βακτηριακά γονίδια που κωδικοποιούν για αντίστοιχες αντιοξειδωτικές δράσεις (Brennan et al. 2008). Επίσης, η τεχνητή εισαγωγή του βακτηρίου Wolbachia στο κουνούπι Aedes aegypti, προκάλεσε οξειδωτικό στρες και αύξηση των επιπέδων των δραστικών μορφών οξυγόνου (ROS). Η αύξηση αυτή των ROS, συνδέεται με την ενεργοποίηση του αμυντικού μηχανισμού Toll pathway, το οποίο παίζει καταλυτικό ρόλο στην έκφραση αντιοξειδωτικών για την εξισορρόπηση του οξειδωτικού στρες. 20

31 ΕΙΣΑΓΩΓΗ Παράλληλα, ο αμυντικός μηχανισμός Toll pathway σχετίζεται με την ενεργοποίηση αντιμικροβιακών πεπτιδίων (όπως πεπτίδια άμυνας-defensins, κεκροπίνες-cecropins), τα οποία προστατεύουν το κουνούπι από τον παθογόνο ιό του δάγκειου πυρετού (Dengue) (Pan et al. 2012). Εξίσου καθοριστικό ρόλο, στην αλληλεπίδραση μεταξύ βακτηρίου Wolbachia και κουνουπιού Aedes polynesiensis, αποδείχτηκε ότι παίζει η ρύθμιση των επιπέδων ROS. Η τεχνητή εισαγωγή του στελέχους walbb (που απαντά στη φύση στο είδος Aedes albopictus) στο Aedes polynesiensis (από το οποίο απομακρύνθηκε τεχνητά το δικό του βακτηριακό στέλεχος wpola), προκάλεσε διαφοροποίηση των επιπέδων ROS, σε σχέση με τα αντίστοιχα αγρίου τύπου άτομα, δηλαδή με αυτά που φέρουν το φυσικό τους στέλεχος Wolbachia. Τα τεχνητά αυτά στελέχη κουνουπιού παρουσίασαν μειωμένη ικανότητα εξισορρόπησης του οξειδωτικού στρες και μειωμένο βαθμό ανάπτυξης των νηματωδών σκωλήκων Brugia pahangi. Το στοιχείο αυτό μπορεί να αξιοποιηθεί μελλοντικά στην αντιμετώπιση της νόσου της λυμφατικής φιλαρίασης (Lymphatic filariasis, LF), φορέας της οποίας είναι το είδος Aedes polynesiensis (Andrews et al. 2012). Από όλα τα παραπάνω προκύπτει ότι η επίδραση του βακτηρίου Wolbachia στα επίπεδα των ROS είναι σημαντική για τον αμυντικό μηχανισμό του ξενιστή και κατ επέκταση την προστασία του από παθογόνα και ιούς. Προγενέστερες μελέτες στο είδος Anopheles gambiae απέδειξαν τη σύνδεση των ROS με το ανοσοποιητικό σύστημα του ξενιστή για την αντιμετώπιση του παθογόνου Plasmodium (Kumar et al. 2003, Molina-Cruz et al. 2008) Απόπτωση Επιπλέον, το βακτήριο Wolbachia βρέθηκε να αλληλεπιδρά με τους ξενιστές του στη διαδικασία της απόπτωσης (apoptosis). Αναφέρθηκε ότι σε παρασιτοειδείς σφήκες του είδους Asobara tabida, η τεχνητή απομάκρυνση του βακτηρίου οδήγησε στην υπερβολική απόπτωση των βοηθητικών κυττάρων στους ωο θαλάμους (egg chambers) κατά την ωογένεση (Pannebakker et al. 2007). Ακόμη, το τοξικό στέλεχος wmelpop που μειώνει τη διάρκεια ζωής της μύγας Drosophila melanogaster, βρέθηκε ότι αυξάνει τον αριθμό από τα γερμάρια (germaria) στα οποία τα κύτταρα υφίστανται απόπτωση στο σημείο ελέγχου (Zhukova & Kiseleva 2012). Αυτό ίσως συνδέεται και με το ότι στο σημείο ελέγχου στη Drosophila (που είναι η περιοχή 2a του γερμάριου), το βακτήριο παρουσιάζει υψηλή επίπεδα τροπισμού και συγκέντρωσης (Frydman et al. 2006). 21

32 ΕΙΣΑΓΩΓΗ Μεταβολική οδός Insulin/IGF-like signalling (IIS) Επιπρόσθετα, δείχτηκε ότι το βακτήριο Wolbachia επιδρά στην εξελικτικά συντηρημένη μεταβολική οδό Insulin/IGF-like signalling (IIS) της φρουτόμυγας Drosophila melanogaster (Ikeya et al. 2009). Ο ρόλος αυτού του μηχανισμού είναι σημαντικός για τη ρύθμιση πολλών και πολύ βασικών λειτουργιών του εντόμου, όπως είναι η ανάπτυξη, η αύξηση, η μεταβολική ομοιόσταση, η αναπαραγωγικότητα, η αντοχή στο στρες και η μακροβιότητα. Το βακτήριο φαίνεται ότι ευνοεί την έκφραση του IIS σήματος, μιας και η τεχνητή απομάκρυνσή του ενίσχυσε την έκφραση των φαινοτύπων των μεταλλαγμένων στελεχών. Βάσει εξελικτικών θεωρήσεων, προτάθηκε ότι ο μηχανισμός της αλληλεπίδρασης βακτηρίου Wolbachia-IIS πηγάζει από το μητρικό τρόπο μετάδοσης του συμβιωτικού βακτηρίου μέσω των ωοκυττάρων (Ikeya et al. 2009). Επίσης, παρατηρήθηκε ότι αυτή η εξειδικευμένη αλληλεπίδραση Wolbachia- IIS, ρυθμίζει τη διάρκεια ζωής της Drosophila melanogaster αφού η απώλεια των πεπτιδίωνπαρόμοιων της ινσουλίνης (Drosophila insulin-like peptides, DILPs) στον εγκέφαλο του εντόμου προκάλεσε την επέκταση της διάρκειας ζωής της, μόνο υπό την παρουσία του συμβιωτικού βακτηρίου Wolbachia (Gronke et al. 2010) Μακροβιότητα-διάρκεια ζωής Επιπλέον, μελέτες προγενέστερων ετών κάνουν λόγο για την επίδραση του βακτηρίου Wolbachia στη βιωσιμότητα-διάρκεια ζωής του ξενιστή. Όπως αναφέρθηκε και προηγουμένως, το τοξικό στέλεχος Wolbachia wmelpop βρέθηκε ότι προκαλεί πρώιμο θάνατο (μείωση στο μισό περίπου της διάρκειας ζωής) στα ενήλικα άτομα της Drosophila melanogaster. Αυτό πραγματοποιείται μέσω του μαζικού πολλαπλασιασμού των κυττάρων του, που οδηγεί στον εκτεταμένο εκφυλισμό των ιστών του ξενιστή, όπως του εγκεφάλου, του αμφιβληστροειδή χιτώνα και των μυών (Min & Benzer 1997). Αξίζει να σημειωθεί, ότι η ιδιότητα αυτή εκφράστηκε με πλήρη επιτυχία κατά την τεχνητή εισαγωγή του βακτηριακού στελέχους Wolbachia wmelpop σε ένα νέο ξενιστή τεράστιας υγειονομικής σημασίας, το κουνούπι Aedes aegypti, ανοίγοντας έτσι τους ορίζοντες για την αξιοποίηση του βακτηρίου σε βιολογικές μεθόδους καταπολέμησης πολύ σοβαρών ασθενειών (McMeniman et al. 2009). Το 2007, στην εργασία των Toivonen και συνεργατών, παρατηρήθηκε ότι η αυξημένη διάρκεια ζωής των μεταλλαγμάτων Indy, δεν οφείλεται τελικά στη μετάλλαξη του γονιδίου Indy, όπως αρχικά θεωρήθηκε, αλλά εμπλέκεται καθοριστικά η επίδραση του βακτηρίου Wolbachia (Toivonen et al. 2007). Στην περίπτωση του κουνουπιού Aedes polynesiensis, που είναι φορέας του νηματώδη της φιλαρίασης Wuchereria bancrofti, διαπιστώθηκε ότι η παρουσία των φυσικών στελεχών Wolbachia αυξάνει τη μακροβιότητα των ενηλίκων ατόμων, ενώ η τεχνητή μεταφορά άλλων 22

33 ΕΙΣΑΓΩΓΗ στελεχών την ελαττώνει (Brelsfoard & Dobson 2011). Ομοίως, και στο είδος κουνουπιού Culex quinquefasciatus, βρέθηκε ότι τα θηλυκά άτομα που φέρουν φυσικά στελέχη Wolbachia εμφανίζουν μεγαλύτερη μακροβιότητα, σε σχέση με αυτά, από τα οποία απομακρύνθηκε το συμβιωτικό βακτήριο με χρήση χημικών (Almeida et al 2011) mirna ξενιστή Πρόσφατες μελέτες έδειξαν ότι το βακτήριο Wolbachia χρησιμοποιεί τα mirna (microrna) του ξενιστή για να επιδρά στη ρύθμιση έκφρασης των γονιδίων του ξενιστή, με σκοπό την αποτελεσματική διατήρησή του σε αυτόν (Hussain et al. 2011). Η επίδραση αυτή του βακτηρίου Wolbachia στα mirna του ξενιστή, συνδέθηκε και με την ενίσχυση της ανθεκτικότητας του κουνουπιού στον ιό Dengue (Zhang et al. 2013) Αμυντικό σύστημα ξενιστή Λόγω του μεγάλου εύρους ξενιστών και συμβιωτικών σχέσεων που χαρακτηρίζει το βακτήριο Wolbachia, η αλληλεπίδρασή του στους αμυντικούς μηχανισμούς του ξενιστή είναι εξίσου ποικιλότροπη. Αυτό εξασφαλίζει στο βακτήριο ασφαλή επιβίωση και μετάδοση, ενώ ο ξενιστής από την πλευρά του προσπαθεί να αποφύγει τις αρνητικές συνέπειες της παθογένειας, και να περιορίσει το κόστος στην υγεία του, μέσω της ρύθμισης του βακτηριακού φορτίου. Συγκεκριμένα στα έντομα, το αμυντικό σύστημα περιλαμβάνει μεγάλη ποικιλία μηχανισμών, μερικοί από τους οποίους είναι η παραγωγή αντιμικροβιακών πεπτιδίων (antimicrobial peptides, AMP) ως αποτέλεσμα της μεταγραφικής ρύθμισης των οδών σηματοδότησης, η φαγοκυττάρωση και ενθυλάκωση ξένων εισβολέων μέσω των αιμοκυττάρων, η μελάνωση και θρόμβωση της αιμολέμφου, η παραγωγή υψηλών επιπέδων ROS, η αντιική αμυντική οδός (RNA interference, RNAi) και η ενδογενής επαγόμενη ανοσοαπόκριση κατά παθογόνων ιών. Σημαντικό επίσης ρόλο στο ανοσοποιητικό σύστημα του εντόμου παίζουν φυσιολογικοί και οικολογικοί παράγοντες όπως είναι η διατροφή, ο ενεργειακός μεταβολισμός, ο τρόπος σίτισης, η γήρανση, η επιτυχία ζευγαρώματος, η αναπαραγωγική δραστηριότητα, ο τρόπος ζωής και το έναυσμα ενεργοποίησης του ανοσοποιητικού συστήματος (immune priming) (Eleftherianos et al. 2013). Από τα παραπάνω γίνεται κατανοητό πόσο ευρύ είναι το φάσμα επιδράσεων που μπορεί να προκαλέσει το συμβιωτικό βακτήριο στο αμυντικό σύστημα του ξενιστή. Στη συνέχεια γίνεται αναφορά σε μελέτες σχετικά με τις επιδράσεις του βακτηρίου Wolbachia στην άμυνα διαφόρων ξενιστών και τους πιθανούς μηχανισμούς μέσω των οποίων το επιτυγχάνει. 23

34 ΕΙΣΑΓΩΓΗ Σειρά μελετών κάνουν λόγο για την υπερ-ρύθμιση γονιδίων που συνδέονται με τη χυμική και κυτταρική ανοσολογική απόκριση του ξενιστή μέσω της παρουσίας του βακτηρίου Wolbachia σε στελέχη Drosophila (McEwen & Peifer 2005, Lemaitre & Hoffmann 2007, Xi et al. 2008, Hetru & Hoffmann 2009, Zheng et al. 2011). Ομοίως, σε αρκετές περιπτώσεις ξενιστών, βρέθηκε ότι η επαγόμενη από το βακτήριο Wolbachia παρεμπόδιση παθογόνων, οφείλεται στην αύξηση των επιπέδων μεταγραφής γονιδίων που σχετίζονται με τους αμυντικούς μηχανισμούς του εντόμου (Kambris et al. 2009, Moreira et al. 2009, Bian et al. 2010, Kambris et al. 2010, Ye et al. 2013b) καθώς και στην αύξηση των επιπέδων ROS (Andrews et al. 2012, Pan et al. 2012). Από την άλλη πλευρά, oι Hughes και συνεργάτες έδειξαν ότι σε κυτταρικές σειρές του κουνουπιού Anopheles gambiae, η τεχνητή εισαγωγή των στελεχών Wolbachia wri και walbb προκάλεσε σημαντική μείωση στα επίπεδα μεταγραφής γονιδίων που σχετίζονται με τους αμυντικούς μηχανισμούς του εντόμου (Hughes et al. 2011a). Επίσης, σε δύο άλλες εργασίες δεν παρατηρήθηκε καμία επίδραση του βακτηρίου Wolbachia στην ενεργοποίηση ή την καταστολή της έκφρασης γονιδίων που μετέχουν στο ανοσολογικό σύστημα του ξενιστή, τόσο στα είδη Drosophila simulans και Aedes albopictus που φέρουν φυσικά βακτηριακά στελέχη (Bourtzis et al. 2000) όσο και σε κύτταρα του είδους Bombyx mori που μολύνθηκαν τεχνητά με το στέλεχος Wolbachia wstr (Nakamura et al. 2011). Σε μια ακόμη μελέτη της παρεμπόδισης του ιού Dengue στο κουνούπι Aedes albopictus (που αποδόθηκε στην παρουσία του τεχνητά εισαχθέντος στελέχους wmel) δε διαπιστώθηκε σημαντική υπερ-ρύθμιση των γονιδίων άμυνας (Blagrove et al. 2012). Ακόμη, η σύγκριση της επίδρασης του στελέχους walbb στη ρύθμιση της μεταγραφής γονιδίων που συνδέονται με τους αμυντικούς μηχανισμούς των εντόμων, τόσο στο φυσικό ξενιστή του Aedes albopictus όσο και στον τεχνητό ξενιστή του Aedes gambiae, έδειξε ότι στον τεχνητό ξενιστή προκάλεσε αυξημένα επίπεδα ρύθμισης ενώ στο φυσικό ξενιστή μειωμένα (Pinto et al. 2012). Μάλιστα, στο παρασιτοειδές είδος Asobara tabida, η επίδραση των φυσικών στελεχών Wolbachia στη μεταγραφική ρύθμιση των γονιδίων σχετιζόμενων με το ανοσοποιητικό σύστημα της σφήκας ήταν φυλοσύνδετη και ιστό-ειδική. Δηλαδή, στα αρσενικά άτομα παρατηρήθηκε υπερ-ρύθμιση των γονιδίων άμυνας, σε αντίθεση με τις ωοθήκες των θηλυκών που σημειώθηκε καταστολή έκφρασης αυτών (Kremer et al. 2012). Ένας επιπλέον τρόπος επίδρασης του βακτηρίου Wolbachia στο ανοσοποιητικό σύστημα του ξενιστή αφορά τη μελάνωση (melanization). Δείχτηκε ότι η παρουσία των στελεχών Wolbachia wmel και wmelpop στα είδη Drosophila melanogaster, Drosophila simulans και Aedes aegypti, οδήγησε στην αύξηση των επιπέδων μελάνωσης στην αιμολέμφο (Thomas et al. 2011). Επιπλέον, η 24

35 ΕΙΣΑΓΩΓΗ διαμόλυνση του κουνουπιού Aedes aegypti με το βακτηριακό στέλεχος Wolbachia wmelpop- CLA βρέθηκε ότι αυξάνει τα επίπεδα μεταγραφής των γονιδίων που σχετίζονται με τη μελάνωση (Rancès et al. 2012) Προστασία από παθογόνους ιούς, παθογόνα βακτήρια και παράσιτα Λαμβάνοντας υπόψη την ποικιλία των επιδράσεων του βακτηρίου Wolbachia στον αμυντικό μηχανισμό του ξενιστή, γίνεται αντιληπτό πόσο σημαντικό θα ήταν να διερευνηθούν εάν επηρεάζουν την ανοσο-απόκριση του ξενιστή σε παθογόνα για τον άνθρωπο βακτήρια, ιούς και παράσιτα. Αρκετοί ξενιστές του βακτηρίου Wolbachia, είτε φυσικοί είτε τεχνητοί, αποτελούν πολύ σημαντικούς φορείς επιβλαβών ασθενειών για τον άνθρωπο, όπως διάφορα είδη κουνουπιών. Πρόσφατα βρέθηκε ότι το βακτήριο Wolbachia προστατεύει τους ξενιστές του από παθογόνα. Αυτό παρατηρήθηκε για πρώτη φορά στη Drosophila melanogaster, στην οποία τα στελέχη Wolbachia wmelcs και wmelpop αύξησαν την ανθεκτικότητα στους RNA ιούς Drosophila C Virus (DCV), Nora, Flock House Virus (FHV) και Cricket Paralysis Virus (CrPV) (Hedges et al. 2008;Teixeira et al. 2008). Επίσης, βακτηριακά στελέχη Wolbachia βρέθηκε ότι επάγουν την ανθεκτικότητα κατά των ιών DCV και FHV και στη Drosophila simulans, ιδιότητα που συνδέθηκε με τις αυξημένες συγκεντρώσεις αυτών των βακτηριακών στελεχών (Osborne et al. 2009). Επακόλουθο των παραπάνω ευρημάτων ήταν η ερευνητική προσπάθεια να επικεντρωθεί στη μελέτη πιθανών θετικών (ή/και ουδέτερών, ή/και αρνητικών) επιδράσεων της παρουσίας του βακτηρίου Wolbachia στην προστασία ξενιστών-εντόμων από παθογόνους ιούς, παθογόνα βακτήρια και παράσιτα μεγάλης υγειονομικής σημασίας. Σε διάφορες μελέτες αναφέρεται ότι το βακτήριο Wolbachia επάγει τους αμυντικούς μηχανισμούς του κουνουπιού Aedes aegypti κατά των ιών Dengue (ιός του δάγκειου πυρετού) (Moreira et al. 2009, Bian et al. 2010, Frentiu et al. 2010, Hoffmann et al. 2011, Walker et al. 2011, Pan et al. 2012, Rancès et al. 2012, Ye et al. 2013b, Zhang et al. 2013) και Chikungunya (Moreira et al. 2009) καθώς και του παθογόνου βακτηρίου Erwinia carotovora (Kambris et al. 2009). Ομοίως, στο είδος Aedes albopictus, αν και τα φυσικά του βακτηριακά στελέχη Wolbachia walbb και walba δεν ενισχύουν την παρεμπόδιση του ιού Dengue, διαπιστώθηκε ότι η τεχνητή εισαγωγή του στελέχους wmel ευνόησε το μπλοκάρισμα του ιού από το κουνούπι (Blagrove et al. 2012). Επίσης, στο κουνούπι Aedes polynesiensis η αντικατάσταση του φυσικού στελέχους Wolbachia με ένα νέο στέλεχος, οδήγησε στην ενίσχυση της ανθεκτικότητας στον ιό Dengue (Bian et al. 2013b). Μάλιστα, συνδέθηκε η ενίσχυση της παρεμπόδισης του ιού Dengue με την αυξημένη συγκέντρωση του 25

36 ΕΙΣΑΓΩΓΗ βακτηρίου Wolbachia στους ιστούς του κουνουπιού, κάτι που υποδηλώνει τη μεγάλη σημασία της συγκέντρωσης και του τροπισμού του βακτηρίου στους ιστούς του ξενιστή (Frentiu et al. 2010, Lu et al. 2012b, Osborne et al. 2012, Bian et al. 2013b). Αντίστοιχα, διαπιστώθηκε ότι η μόλυνση του κουνουπιού Aedes albopictus με τον ιό Chikungunya (Mousson et al. 2010, Zouache et al. 2012) και του Aedes aegypti με τον ιό Dengue (Ye et al. 2013b) οδήγησε στη μείωση της συγκέντρωσης του βακτηρίου Wolbachia. Επιπλέον, στο είδος κουνουπιού Culex quinquefasciatus βρέθηκε ότι φυσικοί πληθυσμοί που φέρουν το βακτήριο Wolbachia παρουσιάζουν πιο ισχυρή ανθεκτικότητα στον ιό του Δυτικού Νείλου (West Nile Virus), σε σχέση με εκείνους που δε συμβιώνουν με το βακτήριο (Glaser & Meola 2010). Τέλος, καταγράφηκαν οι πρώτες ενδείξεις ότι το στέλεχος wmel πολύ πιθανά προσδίδει στη Drosophila melanogaster την ικανότητα να εμποδίσει την αντιγραφή του ιού του καταρροϊκού πυρετού, μια πολύ σοβαρή ασθένεια των μηρυκαστικών (Shaw et al. 2012). Εξίσου θετική θεωρείται η επίδραση του βακτηρίου Wolbachia στην προστασία του ξενιστή (φυσικός ή τεχνητός) από παθογόνα παράσιτα, όπως το Plasmodium (προκαλεί την ελονοσία, malaria) (Moreira et al. 2009, Kambris et al. 2010, Zele et al. 2012, Bian et al. 2013a), και τους νηματώδεις της φιλαρίασης του είδους Brygia pahangi (Kambris et al. 2009, Andrews et al. 2012). Αξίζει να σημειωθεί ότι όλα τα βακτηριακά στελέχη Wolbachia δε διαθέτουν την ιδιότητα να ενισχύουν την ανθεκτικότητα του ξενιστή τους εναντίον παθογόνων εισβολέων (όπως βακτήρια, ιούς, παράσιτα, παρασιτοειδή και μύκητες). Μεταξύ άλλων, βρέθηκε ότι η τεχνητή μεταφορά του στελέχους Wolbachia walbb σε κουνούπια Anopheles gambiae δεν επηρέασε την υγεία τους μετά από τη λήψη αίματος από μολυσμένα με το Plasmodium berghei ποντίκια, σε αντίθεση με το στέλεχος Wolbachia wmelpop, το οποίο περιόρισε την επιβίωση του ξενιστή (Hughes et al 2012). Σχετικά με την επίδραση του βακτηρίου Wolbachia στην ανοσολογική απόκριση του ξενιστή κατά παρασιτοειδών (κυρίως μέσω της ενθυλάκωσης), παρατηρήθηκε ότι την καταστέλλει στην περίπτωση της σφήκας Leptopilina heterotoma (Fytrou et al. 2006) ή ότι δεν την επηρεάζει σημαντικά στα είδη Leptopilina boulardi (Martinez et al. 2012) και Leptopilina victoria (Gueguen et al. 2012). Ομοίως, δείχτηκε ότι η παρουσία του βακτηρίου Wolbachia δεν ασκεί κάποια επιρροή στην επιβίωση της μύγας Drosophila simulans από τη μόλυνση της από τον εντομοπαθογόνο μύκητα Beauveria bassiana (Fytrou et al. 2006). Παράλληλα, διαπιστώθηκε ότι βακτηριακά στελέχη Wolbachia δεν επιδρούν στην ανθεκτικότητα της Drosophila σε παθογόνα βακτήρια όπως Listeria monocytogenes, Salmonella typhimurium, Providencia rettgeriin (Rottschaefer & Lazzaro 2012), Pseudomonas aeruginosa PA01, Serratia marcescens και Erwinia carotovora (Wong et al. 2011), ότι το στέλεχος που 26

37 ΕΙΣΑΓΩΓΗ προκαλεί θανάτωση αρσενικών δεν αυξάνει την προστασία της Drosophila bifasciata κατά των RNA ιών DCV και FHV (Longdon et al. 2012), και τέλος, ότι τα φυσικά στελέχη Wolbachia που συμβιώνουν με το Αφρικάνικο είδος κάμπιας (African armyworm) Spodoptera exempta ενισχύουν τη θνησιμότητα της που προκαλείται από ένα DNA βακιλοϊό (Graham et al. 2012). Συνοψίζοντας, η ενίσχυση της ανθεκτικότητας του ξενιστή κατά παθογόνων, που επάγεται από το βακτήριο Wolbachia, δύναται να αποδοθεί σε δύο βασικούς μηχανισμούς: α) στο ερέθισμα-έναυσμα ενεργοποίησης (priming) των μηχανισμών άμυνας του ξενιστή και, β) στον ανταγωνισμό μεταξύ του βακτηρίου και του εκάστοτε παθογόνου για την εκμετάλλευση των πηγών κύριων θρεπτικών συστατικών που παρέχει ο ξενιστής, όπως για παράδειγμα η χοληστερόλη (Caragata et al. 2013, Sinkins 2013) Αναπαραγωγικές αλληλεπιδράσεις Οι επιδράσεις της Wolbachia στα χερσαία αρθρόποδα σε κυτταρικό και αναπαραγωγικό επίπεδο είναι πολύπλοκες και πολυάριθμες για συμβιωτικό μικροοργανισμό. Μόνο άλλη μια ομάδα συμβιωτικών βακτηρίων του γένους Canditatus Cardiniun hertigii (της τάξης Bacteroides) παρουσιάζει παρόμοια ποικιλία επιδράσεων στην αναπαραγωγική διαδικασία των ξενιστών του (Zchori-Fein & Perlman 2004). Ανάλογες αναπαραγωγικές ανωμαλίες σε αρθρόποδα, αλλά σε μικρότερη κλίμακα και ποικιλία, προκαλούν και βακτήρια του γένους Rickettsia, Arsenophonus, Spiroplasma και Flavobacteria (Kageyama et al. 2012). Με τα έως τώρα δεδομένα, συγκριτικά μπορούμε να διαπιστώσουμε ότι η θανάτωση των αρσενικών είναι η πιο κοινή αναπαραγωγική ανωμαλία που επάγεται από έξι διαφορετικά ενδοσυμβιωτικά βακτήρια: Wolbachia pipientis, Spiroplasma ixodetis relatives, Arsenophonus nasoniae, Rickettsia spp., Flavobacteria και Spiroplasma poulsonii. Τέλος, κυτταροπλασματική ασυμβατότητα και θηλυκοποίηση προκαλούν μόνο τα βακτήρια Wolbachia και Cardinium. Τα μέχρι στιγμής δεδομένα δείχνουν ότι η Wolbachia-επαγόμενη κυτταροπλασματική ασυμβατότητα αποτελεί τον πιο διαδεδομένο φαινότυπο στα έντομα (Kageyama et al. 2012) [Πίνακας 1.1]. 27

38 Κυτταροπλασματική Ασυμβατότητα Παρθενογένεση Θανάτωση αρσενικών Θηλυκοποίηση ΕΙΣΑΓΩΓΗ Πίνακας 1.1. Ενδοσυμβιωτικά βακτήρια και οι επαγόμενοι από αυτούς αναπαραγωγικοί φαινότυποι. [Προσαρμογή από Kageyama et al. 2012] Φαινότυπος Ενδοσυμβιωτικό Ξενιστής βακτήριο Ομοταξία Τάξη Wolbachia pipientis Insecta Hemiptera Lepidoptera Malacostraca Isopoda Cardinium hertigii Insecta Hymenoptera Arachnida Trombidiformes Wolbachia pipientis Insecta Coleoptera Diptera Lepidoptera Arachnida Pseudoscorpionida Spiroplasma ixodetis relatives Insecta Coleoptera Hemiptera Lepidoptera Spiroplasma poulsonii Insecta Diptera Rickettsia spp. Insecta Coleoptera Flavobacteria Insecta Coleoptera Arsenophonus nasoniae Insecta Hymenoptera Wolbachia pipientis Insecta Hymenoptera Thysanoptera Arachnida Trombidiformes Cardinium hertigii Insecta Hymenoptera Arachnida Trombidiformes Rickettsia spp. Insecta Hymenoptera Wolbachia pipientis Insecta Coleoptera Diptera Hymenoptera Hemiptera Lepidoptera Orthoptera Malacostraca Isopoda Arachnida Trombidiformes Cardinium hertigii Insecta Hymenoptera Arachnida Mesostigmata Trombidiformes Είναι βέβαιο ότι η λίστα των ξενιστών όλων των παραπάνω ενδοσυμβιωτικών βακτηρίων και των αντίστοιχων αναπαραγωγικών φαινοτύπων θα αυξάνει συνεχώς με την ολοκλήρωση νέων εργασιών στον τομέα της ενδοσυμβίωσης. Οι μηχανισμοί μέσω των οποίων το βακτήριο επάγει 28

39 ΕΙΣΑΓΩΓΗ αυτή την πληθώρα των αναπαραγωγικών φαινοτύπων στους ξενιστές του με σκοπό την εξασφάλιση της μητρικής μετάδοσής του, περιγράφονται συνοπτικά στη συνέχεια: A. Θηλυτόκος παρθενογένεση (thelytoky parthenogenesis)-φυλοκαθορισμός Γενικά παρθενογένεση ονομάζεται το φαινόμενο της αναπαραγωγής απογόνων χωρίς να έχει προηγηθεί γονιμοποίηση των θηλυκών ατόμων. Αν και υπάρχουν περιπτώσεις στις οποίες η παρθενογένεση οφείλεται στον ίδιο τον οργανισμό, στοιχεία των τελευταίων ετών αποδίδουν το φαινόμενο στην ύπαρξη των συμβιωτικών βακτηρίων σε αρκετές περιπτώσεις (Stouthamer et al. 1990). Είναι πιο συχνό φαινόμενο στην τάξη των Υμενοπτέρων εντόμων τα οποία πολλαπλασιάζονται μέσω της αρρενοτοκίας (απλοδιπλοειδής τρόπος αναπαραγωγής) (Hagimori et al. 2006). Κατά την αρρενοτοκία, τα μη-γονιμοποιημένα απλοειδή αυγά παράγουν αρσενικά άτομα ενώ τα γονιμοποιημένα δίνουν θηλυκούς απογόνους. Συγκεκριμένα, η θηλυτοκία είναι μια μορφή του φαινομένου κατά την οποία τα μη γονιμοποιημένα αυγά θηλυκών ατόμων που φέρουν το βακτήριο Wolbachia αναπτύσσονται ως θηλυκά άτομα ενώ στην αντίθετη περίπτωση θα είχαν αναπτυχθεί ως αρσενικά (αρρενοτοκία). Ο αναπαραγωγικός αυτός φαινότυπος αποδόθηκε στο βακτήριο Wolbachia (Stouthamer et al. 1990). Μετά από χορήγηση αντιβιοτικού ή/και αύξηση της θερμοκρασίας σε μολυσμένα με το βακτήριο παρθενογενετικά θηλυκά του γένους Trichogramma, διαπιστώθηκε η εξάλειψη της αναπαραγωγικής ανωμαλίας και η επανεμφάνιση αρσενικών ατόμων. Η επαγωγή του παραπάνω φαινοτύπου από το βακτήριο έχει βρεθεί σε διάφορα είδη από σφήκες, θρίπες και ακάρεα (Stouthamer 1997, Zchori-Fein et al. 1998, Arakaki et al. 2001a, 2001b, Weeks & Breeuwer 2001, Jeong & Stouthamer 2005). Στα παραπάνω είδη ξενιστών, από τα μη γονιμοποιημένα αυγά των μολυσμένων θηλυκών ατόμων παράγονται αποκλειστικά θηλυκά άτομα και καθόλου αρσενικά, και συνεπώς ευνοείται με τον τρόπο αυτό άμεσα η κάθετη μετάδοση του παρασίτου. Ειδικότερα, η επαγόμενη από το βακτήριο Wolbachia θηλυτόκος παρθενογένεση συνδέεται άμεσα με τη δράση του βακτηρίου κατά την πρώτη μιτωτική διαίρεση (Stouthamer & Kazmer 1994). Εκτός του βακτηρίου Wolbachia, έχει βρεθεί ότι παρθενογένεση στα αρθρόποδα μπορούν να προκαλέσουν και βακτήρια του γένους Rickettsia (Hagimori et al. 2006, Adachi-Hagimori et al. 2008, Giorgini et al. 2010) και Cardinium (Giorgini 2001, Zchori-Fein et al. 2001, Groot & Breeuwer 2006). Ιδιαίτερα σημαντική, επομένως, είναι η άμεση επίδραση του βακτηρίου Wolbachia στο φυλοκαθορισμό των απλοδιπλοειδών εντόμων (υμενόπτερα και θρίπες) και των ακάρεων, μέσω του φαινοτύπου της παρθενογένεσης. Το φύλο στα είδη αυτά καθορίζεται από την πλοειδία του εμβρύου, δηλαδή τα αρσενικά προέρχονται από απλοειδή αυγά (μη γονιμοποιημένα) ενώ τα 29

40 ΕΙΣΑΓΩΓΗ θηλυκά από διπλοειδή αυγά (γονιμοποιημένα) (Stouthamer 1997, Huigens & Stouthamer 2003, Hagimori et al. 2006). Το βακτήριο Wolbachia τροποποιεί την ανάφαση κατά την πρώτη μιτωτική διαίρεση στα απλοειδή αυγά με αποτέλεσμα τη δημιουργία διπλοειδούς πυρήνα (με το διπλασιασμό των χρωμοσωμάτων) και την επακόλουθη ανάπτυξη αυτών σε θηλυκά αντί σε αρσενικά άτομα. Με τον τρόπο αυτό, μη μεταδοτικά αρσενικά μετατρέπονται σε μεταδοτικά θηλυκά (Huigens & Stouthamer 2003). Όλα αυτά έχουν σαν αποτέλεσμα τα παρθενογενετικά, λόγω του βακτηρίου Wolbachia, θηλυκά άτομα να μπορούν να παράγουν θηλυκούς απογόνους ικανούς να μεταδίδουν το βακτήριο χωρίς να απαιτείται η εγγενής αναπαραγωγή, η γονιμοποίηση των ωαρίων και, εντέλει, τα ίδια τα αρσενικά άτομα (Cordeaux et al 2011). Β. Θηλυκοποίηση (feminization)-φυλοκαθορισμός Με τον όρο θηλυκοποίηση περιγράφεται το φαινόμενο της μετατροπής ενός γενετικά αρσενικού ατόμου σε πλήρως λειτουργικό θηλυκό λόγω της παρουσίας του βακτηρίου Wolbachia. Το φαινόμενο της θηλυκοποίησης εντοπίστηκε για πρώτη φορά στο χερσαίο ισόποδο Armadillidium vulgare (Juchault & LeGrand 1985) και από τότε έως σήμερα έχει παρατηρηθεί σε πλήθος χερσαίων ισόποδων (Juchault et al. 1992, Grandjean et al. 1993, Rigaud & Juchault 1993, Juchault et al. 1994, Rigaud & Juchault 1995, Rigaud 1997, Bouchon et al. 1998, Cordaux et al. 2001, Bouchon et al. 2008, Cordaux et al. 2012) και σε δύο είδη εντόμων, στην πεταλούδα Eurema hecabe (Hiroki et al. 2002, Narita et al. 2007) και στο τζιτζικάκι (leafhopper) Zyginidia pullula (Negri et al. 2006, 2009). Πρόσφατες μελέτες ανίχνευσης κατέγραψαν υψηλά ποσοστά παρουσίας του βακτηρίου Wolbachia στα καρκινοειδή (περίπου στο 61% των ειδών ισόποδων, Bouchon et al. 2008), με ενδείξεις ότι αυτά είναι αρκετά μεγαλύτερα στην πραγματικότητα (Cordaux et al. 2012). Εκτός του βακτηρίου Wolbachia έχει βρεθεί ότι και το συμβιωτικό βακτήριο Cardinium hertigii προκαλεί θηλυκοποίηση στο Υμενόπτερο Encarsia hispida (Giorgini et al. 2009) και σε ακάρεα του είδους Brevipalpus californicus (Chigira & Miura 2005). Επίσης, θηλυκοποίηση έχει παρατηρηθεί να επάγουν και ευκαρυωτικοί μικροοργανισμοί από το φύλο των Microsporidia σε μαλακόστρακα της σειράς Amphipoda (Terry et al. 1998). Η θηλυκοποίηση αποτελεί βασικό μηχανισμό άμεσης επιρροής του βακτηρίου Wolbachia στον προσδιορισμό φύλου. Όπως προαναφέρθηκε, ο φαινότυπος της θηλυκοποίησης εμφανίζεται συχνά στα καρκινοειδή (crustaceans), κυρίως στα ισόποδα, όπου το βακτήριο Wolbachia προκαλεί τη μετατροπή των γενετικά αρσενικών σε λειτουργικά φαινοτυπικά θηλυκά (Baltans et al 2007, Bouchon et al. 2008). Πιο αναλυτικά, στην περίπτωση του χερσαίου ισόποδου Armadillidium vulgare, το φύλο καθορίζεται χρωμοσωμικά από το θηλυκό ετερογαμέτη (αρσενικά άτομα = ΖΖ, θηλυκά άτομα = ZW). Η επίδραση της θηλυκοποίησης από 30

41 ΕΙΣΑΓΩΓΗ το βακτήριο Wolbachia οδηγεί στη μετάπτωση του χρωμοσωμικού φυλοκαθορισμού σε κυτταροπλασματικό, αφού βάσει της εξέλιξης του φαινομένου, το W χρωμόσωμα, που συνδέεται με το θηλυκό φύλο εξαλείφεται (αρσενικά άτομα = ΖΖ, θηλυκά άτομα = ΖZ + Wolbachia). Πιστεύεται ότι το βακτήριο Wolbachia συμβάλλει στον καθορισμό φύλου στα καρκινοειδή μέσω της αλληλεπίδρασης του με ορμόνες, οι οποίες συνιστούν τους καθοριστικούς παράγοντες για τον προσδιορισμό του φύλου σε αυτά (Bouchon et al. 2008, Negri et al. 2010). Για την καλύτερη κατανόηση των γενετικών και μοριακών μηχανισμών που λαμβάνουν μέρος στη θηλυκοποίηση και το φυλοκαθορισμό των ισόποδων, προτάθηκε η προσέγγιση ενός κυκλικού μοντέλου εξέλιξης για το εκτεταμένο σύστημα φυλοκαθορισμού (extended sexdetermination system). Σύμφωνα με την προσέγγιση αυτή, ο ρόλος του βακτηρίου Wolbachia είναι αρχικά καθοριστικός και συνοδεύεται από γονιδιακές «συγκρούσεις» (μεταξύ γονιδίων ανθεκτικότητας στη θηλυκοποίηση - R genes, γενετικών στοιχείων θηλυκοποίησης - f elements, και γονιδίων αρρενωπότητας - M genes) ως αποτέλεσμα εξελικτικών διαδικασιών. Μέσω αυτών των εξελικτικών αλλαγών του συστήματος φυλοκαθορισμού, πιθανά επιτυγχάνεται η εξισορρόπηση των αναλογιών των δύο φύλων στα ισόποδα (Cordaux et al. 2011). Ο πλήρης μηχανισμός που προκαλεί τη θηλυκοποίηση στα έντομα δεν είναι ακόμα γνωστός καθώς ο καθορισμός του φύλου δεν είναι ορμονικός στα είδη αυτά, όπως συμβαίνει στα ισόποδα. Στα έντομα, όπου το φύλο καθορίζεται από κυτταρικές διαδικασίες, οι αντίστοιχες αλληλεπιδράσεις του βακτηρίου σχετίζονται με γονίδια κλειδιά του φυλοκαθορισμού, όπως είναι στη Drososophila melanogaster το γονίδιο doublesex ή ομόλογα του γονιδίου transformer (Sugimoto et al. 2010). Γ. Θανάτωση αρσενικών ατόμων (male killing) Το βακτήριο Wolbachia επάγει θανάτωση των αρσενικών ατόμων (Hurst et al. 1999a) σε διάφορα αρθρόποδα όπως κολεόπτερα (Fialho & Stevens 2000, Majerus et al. 2000), δίπτερα (Hurst et al. 2000, Dyer & Jaenike 2004,) λεπιδόπτερα (Fujii et al. 2001, Jiggins et al. 2001a, Dyson et al. 2002, Sasaki et al. 2002, Sasaki et al. 2005) και ψευδοσκορπιούς (Zeh et al. 2005). Η ιδιότητα αυτή έχει παρατηρηθεί και σε άλλα βακτήρια του γένους Spiroplasma (Pool et al. 2006, Tinsley & Majerus 2006, Tabata et al. 2011), Rickettsia (Werren et al. 1994, Majerus & Majerus 2010), Arsenophonus (Werren et al. 1986, Gherna et al. 1991, Ferree et al. 2008) και Flavobacteria (Hurst et al. 1997a, 1999b). Παρομοίως, μελέτες σε κουνούπια έδειξαν ότι ευκαρυωτικοί μικροοργανισμοί από το φύλο των Microsporidia επάγουν θανάτωση των αρσενικών (Andreadis & Hall 1979, Andreadis 1985). Με βάση τα παραπάνω, οι μικροοργανισμοί που ευθύνονται για τη θανάτωση των αρσενικών μπορούν να καταταχθούν σε 31

42 ΕΙΣΑΓΩΓΗ δύο κατηγορίες; α) σε αυτούς που θανατώνουν τα αρσενικά άτομα στα πρώτα στάδια της ανάπτυξής τους, είτε στα πρώτα εμβρυικά είτε στα πρώτα προνυμφικά (σε αυτή ανήκουν κυρίως τα βακτήρια), και β) σε εκείνους που προκαλούν τη θανάτωση σε μεταγενέστερα αναπτυξιακά στάδια, κυρίως κατά τα τελευταία προνυμφικά στάδια (Hurst 1991). Το βακτήριο Wolbachia έχει βρεθεί ότι σκοτώνει τους αρσενικούς απογόνους των μολυσμένων θηλυκών είτε στα πρώιμα εμβρυικά στάδια είτε στα ύστερα προνυμφικά (Charlat et al. 2007). Η παραπάνω διαδικασία ευνοεί την ανάπτυξη των θηλυκών ατόμων τα οποία αποτελούν και φορείς μετάδοσης του βακτηρίου γιατί μειώνεται ο ρυθμός αιμομιξίας (inbreeding), αυξάνεται η διαθέσιμη τροφή και μειώνεται η ανταγωνιστικότητα μεταξύ των ατόμων του ίδιου πληθυσμού (Hurst et al. 1997b). Λεπτομερής μελέτη του φαινομένου στο λεπιδόπτερο Ostrinia scapulalis, όπου έχει παρατηρηθεί ότι όλοι οι απόγονοι είναι θηλυκά άτομα, αποκάλυψε ότι δεν πρόκειται για μια απλή περίπτωση θηλυκοποίησης όπως εκτιμήθηκε αρχικά, αλλά για μια μορφή θανάτωσης των αρσενικών, τα οποία όμως πρώτα είχαν μετατραπεί σε θηλυκά, δηλαδή με άλλα λόγια, πρόκειται για μία θανατηφόρο θηλυκοποίηση (Kageyama et al. 2002, Kageyama & Traut 2004). Παρόλα αυτά και βάσει των έως τώρα δεδομένων, δεν είναι ακόμη γνωστός ο ακριβής μηχανισμός αναγνώρισης από το βακτήριο Wolbachia του συστήματος φυλοκαθορισμού του ξενιστή του. Ωστόσο, αξιοσημείωτο είναι ότι το συμβιωτικό βακτήριο Spiroplasma, που παρουσιάζει παρόμοια δράση θανατώνοντας τα αρσενικά άτομα του ξενιστή του, φαίνεται να αλληλεπιδρά με άγνωστο μέχρι στιγμής τρόπο με τον μηχανισμό αντιστάθμισης του γονιδιακού πλεονάσματος στη Drosophila melanogaster (Dosage Compensation Complex) (Veneti et al. 2005). Ο μηχανισμός αυτός ευθύνεται για το διπλασιασμό της μεταγραφικής δραστηριότητας όλων σχεδόν των γονιδίων στο Χ χρωμόσωμα του αρσενικού ατόμου και παίζει σημαντικό ρόλο στο σύστημα φυλοκαθορισμού (Gelbart & Kuroda 2009). Δ. Κυτταροπλασματική ασυμβατότητα (cytoplasmic incompatibility) Η πιο καλά μελετημένη και πλέον διαδεδομένη αναπαραγωγική ανωμαλία που επάγει το συμβιωτικό βακτήριο Wolbachia είναι η Κυτταροπλασματική Ασυμβατότητα (ΚΑ). Ωστόσο, το βακτήριο δεν αποτελεί τον αποκλειστικό αιτιολογικό παράγοντα, αφού αρκετά εγωιστικά γενετικά στοιχεία που είναι γνωστά ως συστήματα εθισμού (addiction systems) επάγουν τον ίδιο φαινότυπο σε πληθυσμούς που τα φιλοξενούν προωθώντας την εξάπλωση τους (Bourtzis et al. 2003). Μέχρι στιγμής, το φαινόμενο της ΚΑ έχει βρεθεί ότι επάγεται από πλασμίδια, βακτηριακά χρωμοσώματα, μιτοχόνδρια (πιθανά και από χλωροπλάστες), χρωμοσώματα ασπονδύλων και τέλος, από τα βακτήρια Wolbachia (Bourtzis et al. 2003) και Cardinium 32

43 ΕΙΣΑΓΩΓΗ (Hunter et al. 2003, Xie et al. 2010, Harris et al. 2010). Για πρώτη φορά το 1971, οι Yen και Barr απέδειξαν ότι ο αιτιολογικός παράγοντας της κυτταροπλασματικής ασυμβατότητας που είχε παρατηρηθεί σε πληθυσμούς του κουνουπιού Culex pipiens 20 χρόνια περίπου πριν (Laven 1951), δεν ήταν άλλος από το βακτήριο Wolbachia (Yen & Barr 1971). Στα διπλοδιπλοειδή έντομα, ο φαινότυπος εμφανίζεται με δύο μορφές: α) η πρώτη απλή μορφή ονομάζεται μονόδρομη ασυμβατότητα και παρατηρείται όταν αρσενικά άτομα με το βακτήριο διασταυρώνονται με θηλυκά άτομα που δε φέρουν το βακτήριο [Εικόνα 1.3.Α]. Στην περίπτωση αυτή δεν προκύπτουν απόγονοι λόγω εμβρυικού θανάτου. Αντίθετα η γονιμοποίηση είναι απολύτως κανονική, όταν και τα θηλυκά άτομα έχουν το βακτήριο, ή όταν τα θηλυκά με το βακτήριο ζευγαρώνουν με αρσενικά που δε φέρουν το βακτήριο (Bourtzis et al. 2003). Αποτέλεσμα όλων των παραπάνω, είναι τα θηλυκά άτομα που φέρουν το βακτήριο Wolbachia να αποκτούν ένα αναπαραγωγικό πλεονέκτημα έναντι των μη-μολυσμένων μεταξύ μεικτών πληθυσμών εντόμων, κάτι που οδηγεί εντέλει στην εξάπλωση του βακτηρίου, και β) η πιο πολύπλοκη μορφή, η αμφίδρομη κυτταροπλασματική ασυμβατότητα. Ο φαινότυπος αυτός εμφανίζεται όταν αρσενικά και θηλυκά άτομα φέρουν διαφορετικά και αμοιβαία ασύμβατα βακτηριακά στελέχη με συνέπεια οι διασταυρώσεις να είναι ασύμβατες και προς τις δύο κατευθύνσεις [Εικόνα 1.3.Β] (Bourtzis et al. 2003). Μια επιπρόσθετη μορφή μονόδρομης ΚΑ προκύπτει όταν στις διασταυρώσεις συμμετέχουν άτομα του πληθυσμού που έχουν πολλαπλά βακτηριακά στελέχη [Εικόνα 1.3.Γ]. Άτομο χωρίς Wolbachia Άτομο με στέλεχος Wolbachia A Άτομο με στέλεχος Wolbachia B Άτομο με πολλαπλά στελέχη Wolbachia, στελέχη Α και Β Εικόνα 1.3. Παραδείγματα κυτταροπλασματικής ασυμβατότητας: Α) Μονόδρομη, Β) Αμφίδρομη και Γ) Μονόδρομη παρουσία πολλαπλών στελεχών 33

44 ΕΙΣΑΓΩΓΗ Δηλαδή, όταν αρσενικά άτομα με δύο (ή πολλαπλά) στελέχη Wolbachia ζευγαρώνουν με θηλυκά τα οποία φέρουν μόνο ένα στέλεχος Wolbachia δεν προκύπτουν απόγονοι, διότι λείπει ο παράγοντας διάσωσης για το βακτηριακό στέλεχος που δεν υπάρχει στο θηλυκό. Στην περίπτωση αυτή, οι πολλαπλές μολύνσεις αναμένεται να εξαπλωθούν σε πληθυσμούς που φέρουν ένα μόνο βακτηριακό στέλεχος, μιας και η αντίστροφη διασταύρωση είναι πλήρως συμβατή (Sinkins & Gould 2006, Brelsfoard & Dobson 2009). Στα απλοδιπλοειδή έντομα, η ΚΑ εκδηλώνεται με τη μορφή της ανάπτυξης αρσενικών ατόμων καθώς τα απλοειδή έμβρυα αναπτύσσονται ως αρσενικά και τα διπλoειδή ως θηλυκά (Breeuwer & Werren 1990, 1993). Τα γονίδια του βακτηρίου που εμπλέκονται στην επαγωγή του φαινομένου δεν έχουν χαρακτηριστεί έως σήμερα. Ωστόσο, το μοντέλο τροποποίηση διάσωση που προτάθηκε αρχικά από τον Werren το 1997 και υποστηρίχθηκε γενετικά από τους (Bourtzis et al. 1998, Mercot & Poisot 1998, Zabalou et al. 2008), παρέχει μια ικανοποιητική εξήγηση του φαινομένου. Το μοντέλο αυτό υποστηρίζει την ύπαρξη δύο ξεχωριστών λειτουργιών: η πρώτη είναι η τροποποίηση (mod, modification), η οποία συμβαίνει κατά τη σπερματογένεση και προκαλεί το μετασχηματισμό των πατρικών χρωμοσωμάτων, ενώ η δεύτερη είναι η λειτουργία της διάσωσης (resc, rescue), η οποία λαμβάνει χώρα μέσα στο έμβρυο αμέσως μετά τη γονιμοποίηση και αποκαθιστά τη φυσιολογική ανάπτυξη του εμβρύου. Αν και ο μοριακός μηχανισμός με τον οποίο το βακτήριο Wolbachia επάγει το φαινότυπο της ΚΑ παραμένει ακόμη άγνωστος, κυτταρογενετικές μελέτες φανερώνουν ότι το βακτήριο εμπλέκεται στη χρωματινική οργάνωση των πατρικών χρωμοσωμάτων κατά τη σπερματογένεση (Presgravas 2000). Αυτή η επίδραση συμβάλει στη μεταβολή της συμπεριφοράς των χρωμοσωμάτων κατά τη διάρκεια της πρώτης μιτωτικής διαίρεσης και οδηγεί στην απώλεια του μιτωτικού συγχρονισμού (Breeuwer & Werren 1990, O Neill & Karr 1990, Reed & Werren 1995, Lassy & Karr 1996, Tram & Sullivan 2002, Tram et al. 2003). Πιο αναλυτικά, κατά τα αρχικά στάδια της μίτωσης σημειώνεται μη συγχρονισμός μεταξύ των δύο προπυρήνων, του θηλυκού και του αρσενικού, ο οποίος οδηγεί στις μη συμβατές διασταυρώσεις. Συγκεκριμένα έχει παρατηρηθεί καθυστέρηση της αποδιοργάνωσης της πυρηνικής μεμβράνης των αρσενικών γαμετών καθώς και καθυστέρηση της φωσφορυλίωσης της ιστόνης Η3, μια τροποποίηση απαραίτητη για την έναρξη της μίτωσης (Tram & Sullival 2002, Tram et al. 2003, Landmann et al. 2009). Συνέπεια των παραπάνω είναι η ορθή συμπύκνωση μόνο των χρωμοσωμάτων μητρικής προέλευσης στο στάδιο της μετάφασης, και όχι αυτών της πατρικής. Στο επόμενο στάδιο της ανάφασης, τα μητρικά χρωμοσώματα διαχωρίζονται φυσιολογικά, ενώ αντιθέτως τα πατρικά χρωμοσώματα σχηματίζουν γέφυρες χρωματίνης μεταξύ των δύο πυρήνων και ποτέ δεν καταλήγουν σε κανονικό διαχωρισμό (Tram & Sullival 2002, Tram et al. 2003). Αυτό έχει ως αποτέλεσμα την 34

45 ΕΙΣΑΓΩΓΗ εμβρυική θνησιμότητα σε διπλοειδή είδη εντόμων ενώ στα απλοδιπλοειδή είδη, τα απλοειδή έμβρυα αναπτύσσονται ως αρσενικά άτομα (Reed & Werren 1995). Στο παρελθόν, τρεις θεωρίες είχαν αναπτυχθεί για να εξηγήσουν το μηχανισμό δράσης της ΚΑ (Poinsot et al. 2003). Η θεωρία της κατακράτησης και απελευθέρωσης (titration and restitution) συνιστά την πρώτη θεωρία και υποστηρίζει ότι η τροποποίηση είναι ουσιαστικά η κατακράτηση κάποιων πρωτεϊνών του χρωμοσώματος οι οποίες παίζουν καθοριστικό στην ανάπτυξη μετά τη γονιμοποίηση (Kose & Karr 1995, Werren 1997). Η δεύτερη θεωρία ονομάζεται κλειδιού και κλειδαριάς (lock and key) (Breeuwer & Werren 1990, Hurst 1991, Kose & Karr 1995, Werren 1997, Poinsot & Mercot 1999) και υποστηρίζει ότι το βακτήριο Wolbachia σχηματίζει έναν παράγοντα - κλειδαριά που δεσμεύεται σε κάποιο συστατικό του πατρικού προπυρήνα, εκτελεί την τροποποίηση και το παρεμποδίζει να συμπεριφερθεί φυσιολογικά μετά τη γονιμοποίηση του αυγού. Τέλος, η τρίτη θεωρία περιλαμβάνει τη θεωρία του λανθασμένου συγχρονισμού (mistiming) σύμφωνα με την οποία η εμβρυική θανάτωση προκύπτει από την έλλειψη συγχρονισμού μεταξύ του πατρικού και μητρικού προπυρήνα κατά την πρώτη ζυγωτική μίτωση (Callaini et al. 1997, Tram & Sullivan 2002, Tram et al. 2003). Πρόσφατα αναπτύχθηκε το μοντέλο τερματοφύλακας-goalkeeper (Bossan et al. 2011) που προσπαθεί να καλύψει το κενό της πλήρους κατανόησης του μηχανισμού της ΚΑ. Σύμφωνα με το μοντέλο αυτό, δύο παράγοντες x και y εμπλέκονται στη διαφορετική έκφραση της KA κατά τις διασταυρώσεις ατόμων που φέρουν ή όχι το βακτήριο Wolbachia. Η ποσότητα των παραγόντων αυτών είναι εξειδικευμένη για καθένα βακτηριακό στέλεχος. Στα αρσενικά που φέρουν το βακτήριο, οι παράγοντες συνεισφέρουν στην τροποποίηση του σπέρματος, ενώ στα μολυσμένα θηλυκά, συμβάλλουν στη διάσωση του ωαρίου. Επίσης, ένα στέλεχος Wolbachia θεωρείται ότι συνεισφέρει ισόποσα στα αρσενικά και θηλυκά άτομα που απαντάται, δηλαδή οι τιμές των παραγόντων τροποποίησης που συνεισφέρει στα αρσενικά είναι ίσες με τις αντίστοιχες των παραγόντων διάσωσης στα θηλυκά. Επιπλέον, ο ξενιστής υποστηρίζει τη διάσωση μέσω του δικτύου συνεισφοράς προσθέτοντας τους παράγοντες x h και y h, κάτι εξειδικευμένο για κάθε είδος ξενιστή. Αυτή η συνεισφορά από τον ξενιστή θεωρείται ότι υπάρχει ακόμα και στην περίπτωση απουσίας του βακτηρίου Wolbachia. Προκειμένου να αξιολογηθεί η έκφραση της ΚΑ μετά τη γονιμοποίηση, συγκρίνονται τα ποσά των παραγόντων τροποποίησης και διάσωσης. Εάν η τιμή ενός τουλάχιστον παράγοντα τροποποίησης υπερβαίνει την τιμή του αντίστοιχου παράγοντα διάσωσης, τότε εκφράζεται ΚΑ. Αυτοί οι δύο παράγοντες ισοδυναμούν με μια εκτίναξη του τερματοφύλακα η οποία γίνεται αρκετά μακριά (x) και αρκετά ψηλά (y), έτσι ώστε να μπορέσει να μπλοκάρει ένα γκολ (διάσωση). Αυτοί οι δύο παράγοντες, θα μπορούσαν να μεταβληθούν από τις συνθήκες του ξενιστή (ισοδύναμα εάν τοποθετηθεί ο τερματοφύλακας 35

46 ΕΙΣΑΓΩΓΗ σε λάσπη ή μέσα σε λακκούβα) και ως εκ τούτου, εξηγείται η εξάρτηση από τον ξενιστή. Το μοντέλο αυτό υποστηρίζεται από αρκετές ενδείξεις, ότι η διάσωση εξαρτάται από πολλαπλούς παράγοντες (Zabalou et al. 2008, LePage & Bordenstein 2013). Πέραν της ικανότητας του βακτηρίου να αναπτύσσει τόσο μεγάλη ποικιλία αλληλεπιδράσεων με τους ξενιστές του, οι οποίες κυμαίνονται από παρασιτισμό έως και αμοιβαία ωφέλεια, εξίσου αξιοσημείωτη είναι και η δυνατότητα μετάπτωσης των φαινοτύπων που προκαλεί. Σχετικά με το φαινόμενο της ΚΑ, χαρακτηριστική περίπτωση είναι αυτή των ειδών Drosophila yakuba, Drosophila teissieri και Drosophila santomea. Η παρουσία στελεχών Wolbachia στα παραπάνω είδη (σύμπλεγμα yakuba) δεν οδηγεί στην επαγωγή ΚΑ (mod-) (Zabalou et al. 2004a). Η μεταφορά τους, όμως, σε γενετικό υπόβαθρο Drosophila simulans προκαλεί μεταβολή του φαινοτύπου σε (mod+) και δυνατότητα επαγωγής ΚΑ η οποία μπορεί να φτάσει έως και 100% (Zabalou et al. 2008). Επίσης, στο είδος Nasonia longicornis έχει αναφερθεί ότι το γενετικό υπόβαθρο του ξενιστή μεταβάλει την ΚΑ από αμφίδρομη σε μονόδρομη (Raychoudhury & Werren 2012). Σε άλλες περιπτώσεις, παρατηρείται μετάπτωση μεταξύ διαφορετικών φαινοτύπων. Στο λεπιδόπτερο Cadra cautella, το στέλεχος Wolbachia wcau επάγει κανονικά ΚΑ αλλά όταν μεταφερθεί στο είδος λεπιδοπτέρου Anagasta kuehniella (πρώην Ephestia kuehniella) προκαλεί θανάτωση των αρσενικών (Sasaki & Ishikawa 2000). Παρόμοιο φαινόμενο έχει καταγραφεί στο είδος Drosophila recens. Όταν το ίδιο στέλεχος μεταφερθεί στο αδελφό είδος Drosophila subquinaria τότε ο φαινότυπος μεταπίπτει σε θανάτωση των αρσενικών ατόμων (Jaenike 2007b). Αντίθετα, η μεταφορά του στελέχους Wolbachia winn (που προκαλεί στο φυσικό του ξενιστή Drosophila innubila θανάτωση αρσενικών) στα είδη D. melanogaster και D. simulans (στα οποία η πλειοψηφία των φυσικών στελεχών Wolbachia επάγει ΚΑ), δεν οδήγησε ούτε στη μεταβολή του φαινοτύπου, σε έκφραση δηλαδή της ΚΑ, ούτε σε διατήρηση του ιδίου (Veneti et al. 2012). Τα αποτελέσματα αυτά καθιστούν σαφές ότι τόσο βακτηριακοί παράγοντες όσο και το γενετικό υπόβαθρο του ξενιστή παίζουν σημαντικό ρόλο στην έκφραση των Wolbachiaεπαγόμενων αναπαραγωγικών φαινοτύπων Το βακτήριο Wolbachia ως παράγοντας ειδογένεσης Η ευρεία εξάπλωση του βακτηρίου Wolbachia σε πλήθος αρθροπόδων και νηματωδών (Hilgenboecker et al. 2008), καθώς και η μεγάλη ποικιλία αλληλεπιδράσεων που έχει αναπτύξει με αυτούς, την καθιστούν ένα πολύ ενδιαφέρον σύστημα έρευνας για ενδεχόμενη συμβολή της σε ειδογενετικές και εξελικτικές διεργασίες. Με τον όρο ειδογένεση περιγράφουμε το σύνολο των διεργασιών κατά τις οποίες από ένα είδος προκύπτουν ένα ή περισσότερα νέα είδη 36

47 ΕΙΣΑΓΩΓΗ (Dobzhansky 1970). Η ανάπτυξη γενετικών φραγμών στη γονιδιακή ροή μεταξύ των πληθυσμών καθορίζει και την εξέλιξη νέων ειδών. Η γεωγραφική και αναπαραγωγική απομόνωση είναι οι βασικές αιτίες ειδογένεσης (Patterson & Stone 1952). Η διεύρυνση των μορφολογικών διαφορών μεταξύ των ειδών προκύπτει από την αναπαραγωγική απομόνωση σε συνδυασμό με τη δράση της φυσικής επιλογής και της γενετικής παρέκκλισης (Dobzhansky 1937). Σύμφωνα με τα παραπάνω, είναι σαφές ότι το βακτήριο Wolbachia παίζει σημαντικό ρόλο στις διαδικασίες ειδογένεσης αφού προκαλεί αναπαραγωγική απομόνωση, είτε μετά-συζευκτικά μέσω της ΚΑ, είτε προ-συζευκτικά επηρεάζοντας την επιλογή του σεξουαλικού συντρόφου ή μέσω της παρθενογένεσης (Werren 1998, Bordenstein et al. 2003, Bordenstein 2003, Koukou et al. 2006, Miller et al. 2010). Είναι χαρακτηριστικό ότι η πιθανή συμβολή του βακτηρίου Wolbachia στην ειδογένεση είχε προταθεί από τις πρώτες κιόλας μελέτες προσδιορισμού της ΚΑ (Laven 1959, Werren 1998, Hurst & Schilthuizen 1998, Bordenstein 2003). Από τις πρώτες παρατηρήσεις του φαινομένου της ΚΑ στο κουνούπι Culex pipiens, αυτό συσχετίστηκε με την ύπαρξη πλειάδας διαφορετικών πληθυσμών του κουνουπιού, οι οποίοι ενώ είναι αναπαραγωγικά απομονωμένοι μεταξύ τους δεν παρουσιάζουν κάποια μορφολογική διαφορά (Laven 1959). Η πρόταση αυτή ενισχύθηκε από τo γεγονός ότι σε διαφορετικές γεωγραφικές περιοχές πολλά είδη εντόμων φέρουν διαφορετικά στελέχη Wolbachia (Mercot et al. 1995, Baudry et al. 2003, Keller et al. 2004). Οι τρόποι με τους οποίους μπορεί να συμβάλει το βακτήριο Wolbachia στην ειδογένεση διακρίνονται σε προ-συζευκτικούς και μετά-συζευκτικούς (Brucker & Bordenstein 2012): Α. Προ-συζευκτική απομόνωση - ειδογένεση Α.1 Απομόνωση μέσω συμπεριφοράς (behavioral isolation) Οι προ-συζευκτικοί μηχανισμοί μπορούν να προκαλέσουν απομόνωση μέσω της συμπεριφοράς (behavioral isolation) ή της οικολογικής απομόνωσης (ecological isolation). Κατά την πρώτη περίπτωση το βακτήριο Wolbachia μπορεί να διαδραματίσει σημαντικό ρόλο στην προσυζευκτική απομόνωση δύο πληθυσμών με έμμεσο τρόπο, επηρεάζοντας την επιλογή συντρόφου (Koukou et al. 2006, Miller et al. 2010, Chafee et al. 2011). Ειδικότερα, η έρευνα των Koukou et al. (2006) έδειξε ότι τα άτομα ενός πληθυσμού Drosophila melanogaster που έφεραν το βακτήριο Wolbachia, προτιμούσαν το ζευγάρωμα με άτομα του ίδιου πληθυσμού που επίσης έφεραν το βακτήριο, παρά με άτομα του ίδιου πληθυσμού χωρίς το βακτήριο, ή με άτομα με το βακτήριο από διαφορετικό πληθυσμό. Η απομάκρυνση του βακτηρίου με αντιβιοτικά προκάλεσε τη δραστική μείωση της παραπάνω προτίμησης, γεγονός που αποδίδεται στην παρουσία του βακτηρίου Wolbachia. Επίσης, στη Drosophila paulistorum η παρουσία του 37

48 ΕΙΣΑΓΩΓΗ βακτηρίου Wolbachia διαπιστώθηκε ότι επηρεάζει τη σεξουαλική συμπεριφορά του ξενιστή προκαλώντας προ-συζευκτική απομόνωση (premating isolation) μέσω της επιλεκτικής αποφυγής ζευγαρώματος, όπως για παράδειγμα, αποφυγής ζευγαρώματος με άτομα που φέρουν διαφορετικό, ασύμβατο βακτηριακό στέλεχος (Miller et al. 2010). Αντίθετα, στην παρασιτοειδή σφήκα Nasonia giraulti τα μολυσμένα με το βακτήριο Wolbachia θηλυκά, εμφάνισαν μειωμένο, μεταξύ ειδών, βαθμό διάκρισης συντρόφου (mate discrimination), γεγονός που αποδόθηκε σε πιθανή παθογένεια του εγκεφάλου των θηλυκών, με συνέπεια την ελλειμματική διάκριση ζευγαρώματος με διειδικά αρσενικά (Chafee et al. 2011). Επιπλέον, το βακτήριο είναι πιθανό να συμβάλλει στην προ-συζευκτική απομόνωση συμπεριφοράς, μέσω της επίδρασής του στις φυλετικές φερομόνες του ξενιστή, είτε μέσω βακτηριακών ελκυστικών μορίων, είτε επηρεάζοντας τα γονίδια του ξενιστή που ευθύνονται για τις φυλετικές φερομόνες (Ringo et al. 2011). Η παρθενογένεση συνιστά έναν επιπλέον μηχανισμό αναπαραγωγικής απομόνωσης που εμπλέκεται το βακτήριο Wolbachia και μπορεί να οριστεί ως αγενής ειδογένεση (Bordenstein 2003, Brucker & Bordenstein 2012). Κατά τη διαδικασία αυτή, ένας αγενής πληθυσμός διαχωρίζεται από έναν εγγενή, και προκύπτει ένα είδος κλαδογένεσης. Η μετατροπή του τρόπου πολλαπλασιασμού ενός πληθυσμού από φυλετικό σε αφυλετικό δε συνεπάγεται αυτόματα τη διακοπή της γονιδιακής ροής μεταξύ αυτού του πληθυσμού και ενός άλλου που αναπαράγεται φυλετικά. Άλλωστε έχει παρατηρηθεί σε φυσικούς πληθυσμούς ότι τα παρθενογενετικά θηλυκά έχουν τη δυνατότητα να διασταυρωθούν και να δώσουν γόνιμους απογόνους με αρσενικά από φυλετικούς πληθυσμούς (Stouthamer et al. 1990, Stouthamer & Kazmer 1994). Ο διαχωρισμός δύο τέτοιων πληθυσμών και η ειδογένεση προϋποθέτουν την αναπαραγωγική τους απομόνωση. Η προ-συζευκτική απομόνωση είναι πιθανό να εμφανιστεί σε ένα αγενή αναπαραγόμενο πληθυσμό, αφού ο μηχανισμός αυτός πολλαπλασιασμού δύναται να προκαλέσει τον εκφυλισμό των χαρακτηριστικών εκείνων που απαιτούνται για την εγγενή αναπαραγωγή. Η συμπεριφορά κατά το ζευγάρωμα, η γονιμότητα των αρσενικών, η διαδικασία της γονιμοποίησης, της ωοαπόθεσης καθώς και οι αναπτυξιακές διαδικασίες αποτελούν τέτοια χαρακτηριστικά. Πιθανή συσσώρευση μεταλλάξεων σε γονίδια ενός θηλυκού ατόμου (πολλαπλασιάζεται με αγενή τρόπο) που ρυθμίζουν τη συμπεριφορά του κατά το ζευγάρωμα, ενδέχεται να οδηγήσει στην απώλεια της ικανότητας να διασταυρωθεί επιτυχώς με ένα αρσενικό άτομο, το οποίο αναπαράγεται εγγενώς (Bordenstein 2003). Επίσης, διαπιστώθηκε ότι τα θηλυκά χαρακτηριστικά εκφυλίζονται γρηγορότερα από τα αρσενικά. Αυτό μπορεί να εξηγηθεί είτε από τη φυσική επιλογή αυτών, διότι ενισχύουν πολύπλευρα την υγεία των αγενών θηλυκών, είτε από τη γενετική παρέκκλιση λόγω υψηλότερης αναλογίας των αντίστοιχων γονιδίων (υπεύθυνα για τα θηλυκά 38

49 ΕΙΣΑΓΩΓΗ χαρακτηριστικά) σε σχέση με τα γονίδια των αρσενικών, στα αντίστοιχα γονιδιώματα (Brucker & Bordenstein 2012). Α.2 Οικολογική απομόνωση (ecological isolation) Η οικολογική απομόνωση αποτελεί έναν επιπλέον μηχανισμό προ-συζευκτικής απομόνωσης και μέσω αυτής τα συμβιωτικά βακτήρια συμβάλλουν στην ειδογένεση. Αφορά κυρίως τα υποχρεωτικά συμβιωτικά βακτήρια, όπως το πρωτεύον βακτήριο Buchnera aphidicola των αφίδων (Favret & Voegtlin 2004), το πρωτεύον ενδοσυμβιωτικό βακτήριο (SOPE) του σκαθαριού του γένους Sitophilus (Nardon & Grenier 1991), καθώς και το προαιρετικό (PAUS) γάμμα-πρωτεοβακτήριο των αφίδων μπιζελιού Acyrthosiphon pisum (Tsuchida et al. 2004). Στην κατηγορία αύτη θα μπορούσε να συμπεριληφθεί και το βακτήριο Wolbachia, για τις περιπτώσεις διατροφικής ωφέλιμης αλληλεπίδρασης που έχει αναπτύξει με το κοινό κοριό Cimex lectularious (Hosokawa et al. 2010) και το φυτοφάγο είδος Phyllonorycter blancardella (Kaiser et al. 2010) (αναλυτικά στην ενότητα ). Είναι γνωστό ότι τα γονιδιώματα των συμβιωτικών βακτηρίων κωδικοποιούν για το μεταβολισμό αμινοξέων και σύνθεσης βιταμινών, καλύπτοντας το αντίστοιχο έλλειμμα των ξενιστών τους. Επομένως, ένα μεγάλο μέρος της επιτυχημένης εξελικτικής πορείας των αρθροπόδων αποδίδεται στη συμβίωσή τους με βακτήρια, τα οποία τους επιτρέπουν να ζουν σε φτωχά ή μη ισορροπημένα ενδιαιτήματα, διευρύνοντας έτσι τις διατροφικές τους ευκαιρίες για νέους οικοτόπους. Αυτή η συμβιωτική διατροφική προσαρμογή μπορεί να προσφέρει οικολογική-γεωγραφική απομόνωση μεταξύ των πληθυσμών ή των ειδών που φέρουν το συμβιωτικό βακτήριο και εκείνων που δεν το φέρουν (Brucker & Bordenstein 2012). Για παράδειγμα, πληθυσμοί αφίδων που φέρουν το βακτήριο (PAUS) έχουν τη δυνατότητα να τρέφονται κανονικά και από το τριφύλλι, ενώ αυτές που δεν το έχουν, περιορίζονται κυρίως στο βίκο (Tsuchida et al. 2004). Κάθε διατάραξη αυτής της τροφικής συμβίωσης μέσω του υβριδισμού με άλλα είδη, θα μπορούσε να επιφέρει κατάρρευση της γονιδιωματικής συμπληρωματικότητας ανάμεσα στον ξενιστή και το συμβιωτικό βακτήριο, και τελικά, την υποβάθμιση του υβριδίου (Brucker & Bordenstein 2012). Β) Μετά-συζευκτική απομόνωση - ειδογένεση B.1 Κυτταροπλασματική Ασυμβατότητα (ΚΑ) Η ΚΑ συνιστά μια μετά-συζευκτική ασυμβατότητα που τυπικά οδηγεί στη μη βιωσιμότητα της F1 γενεάς κατά τη διασταύρωση μολυσμένων αρσενικών με μη μολυσμένα θηλυκά ή με θηλυκά που φέρουν διαφορετικό βακτηριακό στέλεχος από αυτό των αρσενικών. Θεωρείται ότι οι πληθυσμοί με το ίδιο γενετικό υπόβαθρο συνιστούν εν δυνάμει διαφορετικά είδη εάν έχουν 39

50 ΕΙΣΑΓΩΓΗ απομονωθεί μέσω της αμφίδρομης ΚΑ (Brucker & Bordenstein 2012). Η ΚΑ παρεμποδίζει τη γονιδιακή ροή μεταξύ των πληθυσμών που διασταυρώνονται. Η έκφραση της ΚΑ μπορεί να επιλέξει επιπλέον μορφές της αναπαραγωγικής απομόνωσης μέσω της ενίσχυσης της απομόνωσης (reinforcement). Η ενίσχυση της απομόνωσης είναι η διαδικασία μέσω της οποίας η μετά-συζευκτική απομόνωση δρα άμεσα ως πίεση επιλογής για την εξέλιξη της προσυζευκτικής απομόνωσης στις περιοχές συμπατρίας. Η προ-συζευκτική απομόνωση επιλέχτηκε γιατί η μετά-συζευκτική απομόνωση είναι ανώφελη για τους πατρικούς γαμέτες, αφού οι απόγονοι είναι νεκροί ή στείροι, και επομένως δεν έχουν τη δυνατότητα της μετάδοσης του βακτηρίου. Θεωρητικά (Telschow et al. 2005) και πειραματικά δεδομένα (από μύγες που τρέφονται σε μανιτάρια) υποστηρίζουν ότι η Wolbachia-επαγόμενη ΚΑ συμβάλλει καταλυτικά στην ενίσχυση της προ-συζευκτικής απομόνωσης (Jaenike et al. 2006, Brucker & Bordenstein 2012). B.2 Ευαισθησία (hybrid susceptibility) - αυτοανοσία υβριδίων (hybrid autoimmunity) Ο υβριδισμός μπορεί να οδηγήσει είτε στη γενετική καινοτομία μέσω της σύνδεσης νέων συνδυασμών γονιδίων από διαφορετικά είδη είτε στην κατάρρευση συμπλεγμάτων γονιδίων που είχαν συν-προσαρμοστεί υποβαθμίζοντας έτσι την υγεία των υβριδίων, όπως είναι η στειρότητα και η μη βιωσιμότητα αυτών (Arnold & Hodges 1995, Burke & Arnold 2001). Οι συνέπειες του υβριδισμού επηρεάζονται από πολλούς παράγοντες. Σύμφωνα με τη θεωρία της ευαισθησίας των υβριδίων, το ανοσοποιητικό σύστημα υπόκειται σε εξάρσεις θετικής επιλογής και ταχεία εξέλιξη. Με τον τρόπο αυτό, το υβρίδιο επιχειρεί να παρεμποδίσει ένα παθογόνο μικροοργανισμό και να διατηρήσει έναν ωφέλιμο. Ως εκ τούτου, ο υβριδισμός δύναται να ωθήσει την αρνητική επίσταση (epistasis) μεταξύ των γονιδίων άμυνας από διαφορετικά είδη, και να μειώσει την ανθεκτικότητα των υβριδίων σε σχέση με τα πατρικά είδη. Επομένως, τα υβρίδια γίνονται πιο ευαίσθητα σε παθογόνα από ότι τα μη υβρίδια (Brucker & Bordenstein 2012). Χαρακτηριστικό παράδειγμα αποτελεί η αλληλεπίδραση του βακτηρίου Wolbachia και του είδους Drosophila paulistorum. Ο ρόλος του βακτηρίου Wolbachia, από ωφέλιμος που θεωρείται για την υγεία των φυσικών πληθυσμών των υποειδών της Drosophila paulistorum, μετατρέπεται σε επιβλαβή για τα αντίστοιχα τεχνητά υβρίδια. Οι αρνητικές επιπτώσεις που προκαλεί στα παραπάνω τεχνητά υβρίδια είναι εμβρυική θνησιμότητα και στειρότητα αρσενικών μέσω του υπερ-πολλαπλασιασμού (Miller et al. 2010). Επιπλέον, σε πρόσφατη εργασία των Schneider και συνεργατών στη μύγα τσε-τσε, επισημάνθηκε η σημαντική αύξηση των επιπέδων της Wolbachia στα υβρίδια της μύγας τσε-τσε σε σχέση με τα μη υβρίδια. Αυτό 40

51 ΕΙΣΑΓΩΓΗ πιθανά επηρεάζει τη φυσική κατάσταση του ξενιστή-υβριδίου, και ενδεχομένως συνιστά μια νεοφανή μορφή ειδογένεσης στη μύγα τσε-τσε (Schneider et al. 2013). Συνεπώς, η πίεση επιλογής, που συνδέεται με την αντιπαλότητα μεταξύ ξενιστή/παθογόνου ή τη διατήρηση ενός συμβιωτικού ωφέλιμου βακτηρίου, είναι σε θέση να επιφέρει την κατάρρευση της ανοσολογικής ικανότητας των υβριδίων και την εξέλιξη των εμποδίων της γονιδιακής ροής (Brucker & Bordenstein 2012). Επιπλέον, η υπερ-ρύθμιση των γονιδίων άμυνας των υβριδίων μέσω της αρνητικής επίστασης δύναται να οδηγήσει στην καταστολή των ωφέλιμων συμβιωτικών βακτηρίων, και εντέλει, σε αρνητικές συνέπειες για την υγεία των ιδίων. Το φαινόμενο αυτό ορίζεται ως αυτοανοσία υβριδίων (Hybrid autoimmunity) και μπορεί να εκδηλωθεί και κατά την απουσία παθογόνων. Τα ευρήματα ότι η συντριπτική πλειοψηφία των ανοσοποιητικών γονιδίων στα υβρίδια της Drosophila εκφράζονται ακανόνιστα (Ranz et al. 2004) στηρίζουν την άποψη ότι οι ασυμβατότητες υβριδίων μεταξύ των γονιδίων του ανοσοποιητικού συστήματος αποτελούν ουσιαστικά ένα σημάδι συμβιωτικό-επαγόμενης ειδογένεσης (Brucker & Bordenstein 2012) Οριζόντια ή πλευρική μεταφορά γονιδίων (Horizontal or Lateral Gene Tranfer, HGT or LGT) Σύμφωνα με τη θεωρία της Διαδοχικής Ενδοσυμβίωσης (Serial Endosymbiosis Theory, SET) τα κύτταρα των φυτών και των ζώων, καθώς και των μυκήτων και όσων οργανισμών αποτελούνται από κύτταρα με πυρήνα, προήλθαν μέσα από μια εξειδικευμένη ακολουθία συγχωνεύσεων διαφορετικών τύπων βακτηρίων. Θεωρείται ότι οι χλωροπλάστες κατάγονται από τα κυανοβακτήρια, τα μιτοχόνδρια από τα πρωτεοβακτήρια, και ο πυρήνας πιθανά από την εξέλιξη μιας συμβιωτικής σχέσης μεταξύ των αρχαίων (Thermoplasma-like) και των σπειροχαιτών (Spirochoeta-like) βακτηρίων (Margulis 1970, 1998). Κατά τη διάρκεια της εξέλιξης πλήθος γονιδίων προερχόμενα από τα οργανίδια ενσωματώθηκαν στον πυρήνα των κυττάρων των φυτικών και ζωικών οργανισμών (Blanchard & Lynch 2000, Dyall et al. 2004). Σε αυτό συνετέλεσαν η ύπαρξη των οργανιδίων σε όλα τα είδη κυττάρων (συμπεριλαμβανομένου και των αναπαραγωγικών), η μετάδοσή τους μέσω των γαμετικών κυττάρων και η στενή γειτνίασή τους με τον πυρήνα των κυττάρων. Είναι προφανές ότι τα παραπάνω χαρακτηριστικά μοιάζουν με αυτά του συμβιωτικού βακτηρίου Wolbachia κάτι που εξηγεί τη μεγάλη συχνότητα εμφάνισης φαινομένων Οριζόντιας Μεταφοράς Γονιδίων (Horizontal or Lateral Gene Transfer, HGT για το σκοπό της παρούσας διατριβής) από το βακτηριακό γονιδίωμα στο πυρηνικό γονιδίωμα των ευκαρυωτικών οργανισμών (Dunning Hotopp 2011). 41

52 ΕΙΣΑΓΩΓΗ Η πρώτη αναφορά για HGT Wolbachia έγινε το 2002 από τους Kondo και συνεργάτες (Kondo et al. 2002) στην οποία περιγράφεται η ανίχνευση τμήματος του βακτηρίου Wolbachia ενσωματωμένο στο Χ χρωμόσωμα του σκαθαριού Callosobruchus chinensis του μπιζελιού adzuki, χωρίς ωστόσο να αποδοθεί κάποιος λειτουργικός ρόλος. Αυτό εξηγήθηκε από το ότι τα περισσότερα γονίδια Wolbachia πιθανά μετατράπηκαν σε ψευδογονίδια κατά ή μετά την οριζόντια μεταφορά τους. Παρόμοια μεταφορά μικρότερων τμημάτων του γονιδιώματος Wolbachia στο γονιδίωμα ευκαρυώτη ξενιστή διαπιστώθηκε στον παθογόνο νηματώδη Onchocerca volvulus, δίχως όμως δεδομένα για ενδεχόμενη έκφραση αυτών (Fenn et al. 2006). Η έκταση του φαινομένου HGT άρχισε να αναδεικνύεται από την εργασία των Dunning Hotopp και συνεργατών, σύμφωνα με την οποία τμήματα του βακτηρίου Wolbachia, ποικίλου μεγέθους (από 1 MB έως λίγες δεκάδες ζευγών βάσεων) ενσωματώθηκαν στο γονιδίωμα τουλάχιστον 4 ειδών εντόμων (Drosophila ananassae, Nasonia vitripennis, Nasonia giraulti και Nasonia longicornis) και 2 ειδών νηματωδών (Brugia malayi και Dirofilaria immitis) [Πίνακας 1.2]. Στον πυρήνα της φρουτόμυγας Drosophila ananassae ανιχνεύτηκε σχεδόν ολόκληρο το γονιδίωμα του βακτηρίου Wolbachia. Το ίδιο φαινόμενο (ενσωμάτωση σχεδόν του ίδιου βακτηριακού τμήματος) παρατηρήθηκε σε αρκετούς απομακρυσμένους γεωγραφικά πληθυσμούς Drosophila ananassae. Με βάση τα παραπάνω, το φαινόμενο αυτό πιθανά είναι αποτέλεσμα μιας κοινής ένθεσης στο παρελθόν, από κάποιον κοινό πρόγονο. Το σημαντικότερο ίσως εύρημα της εργασίας αυτής ήταν ότι το 2% των HGT γονιδίων μεταγράφονται, κάτι που σήμαινε ότι ενδεχομένως τα HGT γονίδια να προσδίδουν νέες λειτουργίες και νέα χαρακτηριστικά στον ξενιστή. Επιπλέον, στην ίδια μελέτη εντοπίστηκαν γεγονότα οριζόντιας μεταφοράς γονιδίων Wolbachia (μικρότερων όμως μεγεθών) στο γονιδίωμα των παρασιτοειδών ειδών Nasonia vitripennis, Nasonia giraulti και Nasonia longicornis, τα οποία εμφάνισαν εξειδίκευση ως προς το είδος σφήκας και πιθανά είχαν πρόσφατη σχετικά προέλευση (Dunning Hotopp et al. 2007). Μέχρι πρότινος η έκταση και σημασία τέτοιων γεγονότων είχε υποεκτιμηθεί. Τελευταίες μελέτες φανερώνουν ότι η HGT από το βακτήριο Wolbachia στα ασπόνδυλα είναι πολύ διαδεδομένη (Werren et al. 2008, Dunning Hotopp 2011). Γενικά, τμήματα από βακτηριακά γονίδια με μέγεθος που ποικίλει από λίγες βάσεις έως σχεδόν ολόκληρο γονιδίωμα (>1Mb) έχουν εισαχθεί στον πυρήνα του ξενιστή μέσω ενός άγνωστου έως τώρα μηχανισμού [Πίνακας 1.2]. Αυτά τα γονιδιακά τμήματα συνήθως καθίστανται ψευδογονίδια (pseudogenized) μέσω μεταλλάξεων θέσης, ενθέσεων ή και ελλειμμάτων (Kondo et al. 2002, Fenn et al. 2006, Dunning Hotopp et al. 2007, Nikoh et al. 2008, Aikawa et al. 2009, Klasson et al. 2009a, Nikoh & 42

53 ΕΙΣΑΓΩΓΗ Nakabachi 2009, Woolfit et al. 2009, McNulty et al. 2010, Doudoumis et al. 2012) ενώ άλλα έχουν κατακερματιστεί από μεταθέσιμα στοιχεία της Drosophila (Dunning Hotopp et al. 2007). Πίνακας 1.2. Μεταφορά γονιδίων του βακτηρίου Wolbachia σε χρωμοσώματα εντόμων και νηματωδών [Πηγή: Doudoumis et al. 2013] Μέγεθος Κυτταροπλασματική Βιβλιογραφία Επίπεδο Ξενιστής μεταφερόμενων έκφρασης γονιδίων Wolbachia Callosobruchus Kondo et al. 2002, Nikoh 380 kb + - chinensis et al Onchocerca volvulus 2 Kb + Άγνωστο Fenn et al Drosophila >1Mb Dunning Hotopp et al. ananassae 2007 Nasonia vitripentis Dunning Hotopp et al. 491 bp + Άγνωστο 2007, Nasonia longicornis Dunning Hotopp et al. 142 bp + Άγνωστο 2007 Nasonia giraulti Dunning Hotopp et al. 446 bp + Άγνωστο 2007 Brugia malayi Dunning Hotopp et al. >8 kb + Άγνωστο 2007 Dirofilaria immitis Dunning Hotopp et al. 978 bp + Άγνωστο 2007 Monochanus >180 kb + Άγνωστο Aikawa et al alternatus Aedes aegypt bp Woolfit et al. 2009, Klasson et al. 2009a Aedes mascarensis bp Woolfit et al. 2009, Klasson et al. 2009a Acyrthosiphon pisum bp Nikoh & Nakabachi 2009, Nikoh et al Acanthocheilonema >30 kb McNulty et al viteae Onchocerca flexuosa >30 kb McNulty et al Nasonia vitripentis μη (Pox virus) Werren et al προσδιορισμένο Onchocerca flexuosa >30 kb McNulty et al Brugia malayi >115.4 kbp + + Ioannidis et al : άγνωστη η κατεύθυνση της μεταφοράς 2 : μεταφορά από ένα βακτήριο παρόμοιο με Wolbachia 3 : πολύ χαμηλά επίπεδα έκφρασης 4 : υψηλά επίπεδα έκφρασης 5 : εμπλέκονται 3 οργανισμοί: Pox viruses, Wolbachia και Nasonia Αυτή η περικοπή και η αποικοδόμηση των HGT γονιδιακών τμημάτων πιθανά οφείλεται στην έλλειψη πίεσης επιλογής (McNulty et al. 2012, Ioannidis et al. 2013) ή όντως η μεταφορά αυτή μπορεί να πραγματοποιήθηκε σε επίπεδο συγκεκριμένων βακτηριακών περιοχών και όχι σε επίπεδο ολόκληρων βακτηριακών γονιδίων (McNulty et al. 2012). Ωστόσο, σε ορισμένες 43

54 ΕΙΣΑΓΩΓΗ περιπτώσεις αυτά τα εντεθειμένα γονίδια είναι μεταγραφικά ενεργά και πιθανά προσδίδουν νέες λειτουργίες-χαρακτηριστικά στον ξενιστή (Klasson et al. 2009a, Woolfit et al. 2009, Nikoh & Nakabachi 2009, McNulty et al. 2010, Nikoh et al. 2010, Werren et al. 2010, McNulty et al. 2012, Ioannidis et al. 2013). Ένα κύριο χαρακτηριστικό των HGT γονιδίων είναι η εμφάνιση πολλών αντιγράφων τους (Nikoh et al. 2010, Ioannidis et al. 2013). Αυτό μπορεί να οφείλεται στην επανάληψη εισδοχής του ίδιου γονιδιακού τμήματος ή/και από το διπλασιασμό του μετά την ενσωμάτωσή του στον ευκαρυωτικό πυρήνα (Ioannidis et al. 2013). Έχει προταθεί ότι η αντικατάσταση ενδογενών γονιδίων στο γονιδίωμα ενός οργανισμού (π.χ. ευκαρυωτικού) από ξένα γονίδια (π.χ. βακτηριακά), όπως συμβαίνει και στην περίπτωση των HGT, υποβαθμίζει αρχικά την υγεία του οργανισμού. Μέσω όμως της εξελικτικής πορείας, τα επίπεδα της υποβάθμισης μπορεί να εξισορροπηθούν από την αντισταθμιστική ενίσχυση των ξένων γονιδίων και να προκύψουν νέα γονίδια, νέες λειτουργίες (Lind et al. 2010). Αν και υπάρχει η υποψία ότι τα μικρά γονιδιώματα των υποχρεωτικών συμβιωτικών βακτηρίων (π.χ. Buchnera aphidicola) των αρθροπόδων οφείλονται σε εκτεταμένα γεγονότα HGT μεταξύ αυτών, η ανάλυση του γονιδιώματος της αφίδας του μπιζελιού Acyrthosiphon pisum δεν επαλήθευσε κάτι τέτοιο. Κανένα λειτουργικό γονίδιο προερχόμενο από το υποχρεωτικό βακτήριο Buchnera aphidicola δε φάνηκε ότι έχει ενσωματωθεί στο γονιδίωμα της αφίδας. Εντούτοις, τέσσερα λειτουργικά γονίδια που μοιάζουν με αυτά του βακτηρίου Wolbachia (rlpa, LdcA, ψldca και blys) βρέθηκαν στο γονιδίωμα της Acyrthosiphon pisum και συνδέονται με το μεταβολισμό της πεπτιδογλυκάνης. Τα επίπεδα έκφρασής τους παρουσίασαν εξειδίκευση ως προς τους ιστούς του ξενιστή και τα βακτηριόματα (bacteriocytes, εκεί εδρεύει το βακτήριο Buchnera) υποδηλώνοντας ότι πιθανά συνδράμουν αποφασιστικά στην προστασία του υποχρεωτικού συμβιωτικού βακτηρίου Buchnera, και γενικότερα στην εδραίωση των συμβιωτικών σχέσεων (Nikoh & Nakabachi 2009, Nikoh et al. 2010). Και σε άλλες περιπτώσεις HGT στους νηματώδεις, ο βαθμός έκφρασης φαίνεται να εξαρτάται από τον ιστό και το αναπτυξιακό στάδιο του ξενιστή (McNulty et al. 2010, McNulty et al. 2012, Ioannidis et al. 2013). Αν και κυτταροπλασματικά το βακτήριο Wolbachia απουσιάζει από το είδος Acyrthosiphon pisum, εντούτοις έχει ανιχνευτεί σε άλλα είδη αφίδων (Augoustinos et al. 2011). Το γεγονός αυτό σημαίνει ότι τα HGT γονίδια προήλθαν μάλλον από κάποιον πρόγονο του Acyrthosiphon pisum που είχε το βακτήριο Wolbachia στο παρελθόν (Nikoh & Nakabachi 2009, Nikoh et al. 2010). Επιπλέον δείχτηκε ότι τα λειτουργικά αυτά HGT γονίδια αποκτούν χαρακτηριστικά ευκαρυωτικών γονιδίων, όπως ιντρόνια τύπου ματισωμάτων (spliceosomal- 44

55 ΕΙΣΑΓΩΓΗ type) ή χιμαιρικές δομές μεταξύ προκαρυωτικών και ευκαρυωτικών περιοχών, μέσω π.χ. της ανακατανομής (shuffling) των εξονίων (Nikoh & Nakabachi 2009, Nikoh et al. 2010). Γεννιέται λοιπόν το ερώτημα εάν τα φαινόμενα οριζόντιας μεταφοράς γονιδίων προσφέρουν νέες λειτουργίες στους ευκαρυωτικούς ξενιστές. Τέτοια φαινόμενα, ασφαλώς δε συμβαίνουν στη φύση μόνο μεταξύ συμβιωτικών βακτηριών/εντόμων, αλλά και μεταξύ άλλων συνδυασμών οργανισμών, όπως μεταξύ μυκήτων/εντόμων (Moran & Jarvil 2010) και μυκήτωνβακτηρίων/οστρακοειδών (Yuan et al. 2013). Χαρακτηριστικό παράδειγμα αποτελεί η ανακάλυψη ότι το κόκκινο χρώμα των αφίδων Acyrthosiphon pisum του μπιζελιού οφείλεται στη βιοσύνθεση καροτενοειδών, η οποία αποδόθηκε σε γονίδια μύκητα τα οποία μεταφέρθηκαν, ενσωματώθηκαν, διπλασιάστηκαν και εκφράστηκαν στο γονιδίωμα της αφίδας (Moran & Jarvil 2010). Κλείνοντας, αξίζει να σημειωθεί ότι η πλατιά εξάπλωση του βακτηρίου Wolbachia μεταξύ των αρθροπόδων και η αυξημένη συχνότητα εμφάνισης γεγονότων οριζόντιας μεταφοράς γονιδίων, ενισχύουν την υπόθεση ότι κάποιες από αυτές τις περιπτώσεις δύναται να ενσωματωθούν και εξελιχθούν σταδιακά σε νέα λειτουργικά γονίδια (Dunning Hotopp 2011) Το γονιδίωμα του βακτηρίου Wolbachia Η αδυναμία να απομονωθεί μέχρι στιγμής το βακτήριο Wolbachia σε καθαρές καλλιέργειες (Bourtzis & O Neill 1998, Dobson et al. 2002a) και να μελετηθεί με τις κλασσικές μεθόδους γενετικής, καθιστά άκρως απαραίτητη τη συγκέντρωση και ανάλυση όσο το δυνατό περισσότερων δεδομένων από τη μερική ή πλήρη αποκωδικοποίηση του γονιδιώματός του. Απώτερος σκοπός είναι η κατανόηση των μοριακών μηχανισμών που χαρακτηρίζουν το συμβιωτικό βακτήριο Wolbachia. Το γονιδίωμα πλήθους στελεχών Wolbachia έχει πλήρως αποκωδικοποιηθεί ή βρίσκεται στα τελικά στάδια αποκωδικοποίησης [Πίνακας 1.3]. Μέχρι στιγμής έχει ολοκληρωθεί η αποκωδικοποίηση του γονιδιώματος επτά στελεχών του βακτηρίου [Πίνακας 1.4]: (α) πρώτα ολοκληρώθηκε το γονιδίωμα του στελέχους wmel που προκαλεί κυτταροπλασματική ασυμβατότητα στη Drosophila melanogaster (Wu et al. 2004), (β) του στελέχους wbm που έχει εγκαθιδρύσει υποχρεωτική και αμοιβαίας ωφέλειας αλληλεπίδραση με το νηματώδη Brugia malayi (Foster et al. 2005), (γ) του στελέχους wpip το οποίο επάγει κυτταροπλασματική ασυμβατότητα στο κουνούπι Culex pipients (Klasson et al. 2008), (δ) του στελέχους wri το οποίο επάγει κυτταροπλασματική ασυμβατότητα στη Drosophila simulans (Klasson et al. 2009b), (ε) του στελέχους woo που έχει αναπτύξει υποχρεωτική και αμοιβαίας ωφέλειας σχέση με το νηματώδη Onchocerca ochengi (Darby et al. 2012), και πρόσφατα, (στ) και (ζ) των στελεχών wha (υπερομάδα Α) και wno (υπερομάδα Β) τα 45

56 ΕΙΣΑΓΩΓΗ οποία απαντoύν στη φύση σε φυσικούς πληθυσμούς της Drosophila simulans από τις Seychelles και τη New Caledonia και επάγουν κυτταροπλασματική ασυμβατότητα (Ellegaard et al. 2013). Πίνακας 1.3. Προγράμματα αλληλούχισης στελεχών Wolbachia [Πηγές: Doudoumis et al. 2013, NCBI Genome October 2013] Ξενιστής Στέλεχος Μέγεθος Υπέρ Κατάγονιδιώομάδα σταση ματος (Kb) Αναφορά GenBankID Drosophila melanogaster wmel A 1267 GC-F Wu et al AE Brugia malayi wbm D 1080 GC-F Foster et al., 2005 AE Culex quinquefasciatus Pel wpip B 1482 CWG-F Klasson et al AM Drosophila simulans wri A 1445 GC-F Klasson et al. 2009b CP Onchocerca ochengi woo C 957 GC-F Dardy et al HE Drosophila simulans wha A 1295 GC-F Ellegaard et al CP Drosophila simulans wno B 1301 GC-F Ellegaard et al CP Culex quinquefasciatus JHB wpip B 1543 S-F Salzberg et al ABZA Nasonia vitripennis wvitb A 1107 S-F Kent et al AERW Drosophila willistoni wwil A 1145 S-F Salzberg et al. 2005a AAQP Diaphorina citri wdi B 1240 S-F Saha et al AMZJ Muscidifurax uniraptor wuni A 867 C-F Klasson et al. 2009a ACFP Culex pipiens molestus wpipmol B 1479 C-F Parkhill J CACK Drosophila simulans wsim A 1063 C-F Salzberg et al. 2005a AAGC Drosophila ananassae wana A 1440 C-F Salzberg et al. 2005a AAGB Onchocerca volvulus wov C 444 C-F Desjardins et al ADHE Wuchereria bancrofti ΜΟ D 1052 C-F Desjardins et al ADHD Aedes albopictus walbb Β 1162 C-F Mavingui et al CAGB Hypolimnas bolina wbol1-b B 1377 C-F Duplouy et al CAOH Drosophila suzukii (valsugana) wsuzi A 1415 C-F Siozios et al. 2013b CAOU Drosophila melanogaster w 1118 wmelpop A ΑΓ ΑΓ Sun et al ΑΓ Dirofilaria immitis wdim C ΑΓ ΑΓ Godel et al ΑΓ Glossina m. morsitans wgmm A 1021 ΑΓ Bresfoald et al Προς κατάθεση GC-F: ολοκληρωμένο γονιδίωμα-χρωμόσωμα χωρίς κενά. CWG-F: ολοκληρωμένο γονιδίωμα-χρωμόσωμα με κενά. S-F: επίπεδο συναρμολόγησης Scafford - πλήρης (Full) αντιπροσώπευση γονιδιώματος. C-F: επίπεδο συναρμολόγησης Contig - πλήρης (Full) αντιπροσώπευση γονιδιώματος. ΑΓ: άγνωστο. ΜΟ: μη ορισμένο. 46

57 ΕΙΣΑΓΩΓΗ Γενικά, τα στελέχη Wolbachia χαρακτηρίζονται από μικρού μεγέθους γονιδίωμα ( Μb), κάτι αναμενόμενο λόγω της ενδοσυμβίωσης και της εξάρτησης από τον ξενιστή (reductive evolution). Το γονιδίωμα του στελέχους woo μέχρι στιγμής έχει το μικρότερο μέγεθος, τη μικρότερη περιεκτικότητα σε GC (32.1%), τη χαμηλότερη πυκνότητα γονιδίων (gene density) και το μικρότερο ποσοστό μεταθετών στοιχείων από τα υπόλοιπα έξι πλήρως αποκωδικοποιημένα γονιδιώματα (Darby et al. 2012, Ellegard et al. 2013). Αν και τα μεγέθη των γονιδιωμάτων των στελεχών Wolbachia είναι στα επίπεδα των άλλων Rickettsiales ( Mb), εντούτοις περιέχουν απρόσμενα μεγάλο αριθμό μεταθετών στοιχείων, βακτηριοφάγων και επαναλαμβανόμενων περιοχών (Wu et al. 2004, Cordaux 2008, Cerveau et al. 2011, Leclercq et al. 2011, Ellegaard et al ). Μάλιστα, το ποσοστό του συνόλου των μεταθετών γενετικών στοιχείων μπορεί να αποτελεί έως και το 21% του γονιδιώματος του βακτηρίου Wolbachia (Wu et al. 2004, Klasson et al. 2008, 2009b, Kent & Bordenstein 2010, Duplouy et al. 2013, Ellegard et al. 2013). Αν στα παραπάνω ιδιαίτερα χαρακτηριστικά προσθέσουμε την ύπαρξη πληθώρας γονιδίων με επαναλήψεις αγκυρίνης και ενός λειτουργικού εκκριτικού συστήματος τύπου IV, τότε το γονιδίωμα του βακτηρίου καθίσταται ιδιαίτερα εύπλαστο γενετικά και ίσως αυτό να αποτελεί τον καθοριστικό παράγοντα για την τόσο ευρεία εξάπλωσή του σε πλήθος ξενιστών σε όλη τη γη (Wu et al. 2004, Klasson et al. 2008, 2009b, Saha et al. 2012, Duplouy et al. 2013, Ellegard et al. 2013). Πίνακας 1.4. Χαρακτηριστικά των διαθέσιμων 7 πλήρως αποκωδικοποιημένων γονιδιωμάτων στελεχών Wolbachia [Πηγή: Duplouy et al. 2013, NCBI Genome October 2013]. wha wno wmel wri wpip woo wbm Υπερομάδα A B A A B C D Τύπος συμβίωσης ΑΠ ΑΠ ΑΠ ΑΠ ΑΠ ΑΩ ΑΩ Μέγεθος (bp) 1295, , , , , , ,084 G+C ποσοστό % Γονίδια Πρωτεΐνες trna rrna ψευδογονίδια Αριθμός γονιδίων ΑΝΚ ΜΠ ΜΠ ΜΠ 5 ΑΠ: Αναπαραγωγικός Παρασιτισμός ΑΩ: Αμοιβαίας Ωφέλειας ΜΠ: Μη προσδιορισμένα 47

58 ΕΙΣΑΓΩΓΗ Γενετικός ανασυνδυασμός Ο όρος γενετικός ανασυνδυασμός αφορά τη φυσική ανταλλαγή γενετικού υλικού μεταξύ δύο γενετικών τόπων και διακρίνεται στον ομόλογο και στο μη ομόλογο ανασυνδυασμό. Ο ομόλογος ανασυνδυασμός αναφέρεται στην ανταλλαγή ομόλογων αλληλουχιών DNA από διαφορετικά γονιδιώματα ή από διαφορετικές θέσεις του ίδιου γονιδιώματος, ενώ ο μη ομόλογος αφορά γονιδιακές αλληλουχίες που δεν είναι σχετικές μεταξύ τους. Ο ομόλογος ανασυνδυασμός παίζει σημαντικό ρόλο στην αύξησης της γενετικής ποικιλομορφίας και του ρυθμού της γονιδιακής εξέλιξης των ευκαρυωτικών και των προκαρυωτικών οργανισμών. Φαινόμενα γενετικού ανασυνδυασμού συμβαίνουν τόσο μεταξύ διαφορετικών γονιδίων (διαγονιδιακός ανασυνδυασμός ή intergenic recombination) όσο και μεταξύ διαφορετικών αλληλομόρφων του ιδίου γονιδίου (ενδογονιδιακός ανασυνδυασμός ή intragenic recombination). Η μεταφορά νέων γονιδίων σε διαφορετικά γονιδιωματικά υπόβαθρα και ο σχηματισμός νέων γονιδιακών συνδυασμών, που επιτυγχάνεται μέσω του διαγονιδιακού ανασυνδυασμού, ευνοεί τη γονιδιωματική ποικιλία. Επιπρόσθετα, μέσω του ενδογονιδιακού ανασυνδυασμού δημιουργούνται νέες γονιδιακές παραλλαγές και έτσι προωθείται η εξέλιξη νέων φαινοτύπων (Rajalingam et al. 2004). Συχνά οι φυλογενετικές μελέτες βακτηριακών στελεχών αγνοούν την πιθανότητα ύπαρξης ανασυνδυασμού με αποτέλεσμα να υπάρχει κίνδυνος εξαγωγής λανθασμένων συμπερασμάτων στις αναλύσεις νουκλεοτιδικών περιοχών με διαφορετική εξελικτική ιστορία/προέλευση. Φαινόμενα γενετικού ανασυνδυασμού έχουν εντοπιστεί σε διάφορα βακτηριακά είδη, όπως Neisseria (Gibbs et al. 1989, Holmes et al. 1999), Anaplasma (Brayton et al. 2002, Meeus et al. 2003), Leptospira (Haake et al. 2004) και Borrelia (Cadavid et al. 1994, Rich et al. 2001). Ο γενετικός ανασυνδυασμός σε βακτήρια τα οποία χαρακτηρίζονται αποκλειστικά από μητρική κληρονόμηση είναι πολύ σπάνιος, αν όχι απόντας (Moran 1996, Tamas et al. 2002). Επίσης η ασθενής πίεση επιλογής που διέπει το σχετικώς σταθερό και προστατευόμενο ενδοκυττάριο περιβάλλον δεν ευνοεί το φαινόμενο του γενετικού ανασυνδυασμού (Frank et al. 2002). Επιβεβαίωση των παραπάνω αποτελούν η σταθερότητα και η παρουσία ελάχιστου γενετικού ανασυνδυασμού που χαρακτηρίζει τα γονιδιώματα διαφόρων ενδοσυμβιωτικών βακτηρίων εντόμων όπως των Buchnera aphidicola (ενδοσυμβιωτικό βακτήριο αφίδων), Wiggleworthia glossinidia (ενδοσυμβιωτικό βακτήριο μυγών τσε-τσε) και Blochmannia (ενδοσυμβιωτικό βακτήριο μυρμηγκιών) (Shigenobu et al. 2000, Akman et al. 2002, Tamas et al. 2002, van Ham et al. 2003, Degnan et al. 2005). Αντιθέτως, στην περίπτωση του βακτηρίου Wolbachia, ο ανασυνδυασμός μεταξύ διαφορετικών στελεχών φαίνεται να είναι σύνηθες φαινόμενο. Μάλιστα, το γονίδιο το οποίο 48

59 ΕΙΣΑΓΩΓΗ κωδικοποιεί την κύρια επιφανειακή πρωτεΐνη του βακτηρίου παρουσιάζει εκτεταμένα φαινόμενα ανασυνδυασμού (Werren & Bartos 2001, Reuter & Keller 2003, Keller et al. 2004, Baldo et al. 2005, Malloch & Fenton 2005). Επιπλέον, φαινόμενα ανασυνδυασμού έχουν εντοπιστεί και σε άλλες γενετικές περιοχές του βακτηρίου Wolbachia, όπως σε γονίδια βασικών λειτουργιών (Jiggings et al 2001b, Jiggins 2002, Baldo et al. 2006b; Klasson et al. 2009b), προφαγικά γονίδια (Bordenstein and Wernegreen 2004), αλληλουχίες ένθεσης (Duron et al. 2005), αγκυρίνες (Siozios et al. 2013a), γονίδια του εκκριτικού συστήματος τύπου 4 (Klasson et al. 2009b), την περιοχή έναρξης της αντιγραφής του βακτηρίου (Ioannidis et al. 2007) καθώς και στο γονίδιο 16S rrna που κωδικοποιεί για τη μικρή ριβοσωμική υπομονάδα (Ros et al. 2009). Ουσιαστικά, πολλά από τα στελέχη Wolbachia είναι χιμαιρικά μεταξύ των διάφορων υπερομάδων, όπως προέκυψε από τη μελέτη του διαγονιδιακού ανασυνδυασμού ο οποίος ευθύνεται για την ανταλλαγή μεγάλων τμημάτων DNA μεταξύ των στελεχών (Baldo et al. 2006b). Συμπερασματικά, τα φαινόμενα ανασυνδυασμού στο βακτήριο Wolbachia πιστεύεται πως επιδρούν καθοριστικά στην εξέλιξή του, στην προσαρμοστικότητά του καθώς και στην ανάπτυξη των πολλών αναπαραγωγικών φαινοτύπων που επάγει στους ξενιστές Το βακτήριο Wolbachia ως εργαλείο ελέγχου επιβλαβών εντόμων και ασθενειών Όπως ήταν αναμενόμενο, η τεράστια λίστα των εντόμων - ξενιστών του βακτηρίου Wolbachia περιλαμβάνει και επιβλαβή είδη μεγάλης γεωργικής, περιβαλλοντικής και ιατρικής σημασίας. Οι συνήθεις τρόποι αντιμετώπισης των εντόμων είναι η εφαρμογή χημικών εντομοκτόνων και η βιολογική καταπολέμηση (Bourtzis & Robinson 2006). Αν και η χρήση χημικών μέσων θεωρείται η πιο αποτελεσματική, εντούτοις εγκυμονεί κινδύνους για το φυσικό περιβάλλον, τον υδροφόρο ορίζοντα και τη δημόσια υγεία. Επιπλέον, το υψηλό κόστος και η ανάπτυξη ανθεκτικότητας από τα έντομα λόγω της παρατεταμένης χρήσης, τα καθιστούν αναποτελεσματικά (Curtis et al. 1993, Bourtzis & Robinson 2006). Από την άλλη πλευρά, οι βιολογικές μέθοδοι ελέγχου κερδίζουν όλο και περισσότερο έδαφος τα τελευταία χρόνια ανοίγοντας νέους ορίζοντες στον τομέα της καταπολέμησης ασθενειών και εντόμων. Χαρακτηριστικό παράδειγμα αποτελεί η Τεχνική Στείρου Εντόμου (Sterile Insect Technique SIT) ή οποία εφαρμόζεται σε πλήθος προγραμμάτων με σκοπό τη μείωση της γονιμότητας στον πληθυσμό στόχο (Bourtzis & Robinson 2006). Πρόσφατα το βακτήριο Wolbachia εξαιτίας της μεγάλης ποικιλίας ξενιστών που μολύνει και των πολλαπλών αναπαραγωγικών φαινοτύπων που προκαλεί σε αυτούς, έχει προσελκύσει το ερευνητικό ενδιαφέρον για ενδεχόμενη χρήση της σε φιλικές προς το περιβάλλον μεθόδους ελέγχου πληθυσμών φορέων ασθενειών και επιζήμιων ειδών εντόμων (Beard et al. 1993b, 1998, 49

60 ΕΙΣΑΓΩΓΗ Bourtzis & O Neill 1998, Bourtzis & Braig 1999, Sinkins & O Neill 2000, Dobson 2003, Zabalou et al. 2004b, Xi et al. 2005, Bourtzis & Robinson 2006, Dale & Moran 2006, Ioannidis & Bourtzis 2007, Bourtzis 2008, Brelsfoard & Dobson 2009, Zabalou et al. 2009, Apostolaki et al. 2011, Brelsfoard & Dobson 2011). Ιδιαίτερη έμφαση δίνεται στην πιθανή αξιοποίηση της ΚΑ, αφού αποτελεί την πλέον μελετημένη και διαδεδομένη αναπαραγωγική ανωμαλία που επάγει το βακτήριο. Συγκεκριμένα το βακτήριο Wolbachia μπορεί να χρησιμοποιηθεί σε πλήθος εφαρμογών βιολογικής καταπολέμησης μέσω τεσσάρων βασικών στρατηγικών: α) ως μηχανισμός καταστολής ενός πληθυσμού (suppression mechanism) β) ως εργαλείο εξάπλωσης επιθυμητών γενοτύπων (gene driving), γ) ως μέσο μείωσης της διάρκειας ζωής των εντόμων (life-shortening), και δ) ως μέσο παρεμπόδισης παθογόνων (pathogen interference) (Kambris et al. 2009, McMeniman et al. 2009, Moreira et al. 2009, Bian et al. 2010, Frentiu et al. 2010, Glaser & Meola 2010, Kambris et al. 2010, Hoffmann et al. 2011, Thomas et al. 2011, Walker et al. 2011, Andrews et al. 2012, Blagrove et al. 2012, Lu et al. 2012b, Osborne et al. 2012, Pan et al. 2012, Rancès et al. 2012, Shaw et al. 2012, Zele et al. 2012, Bian et al. 2013a, 2013b, Eleftherianos et al. 2013, Ye et al. 2013b, Zhang et al. 2013). Στη συνέχεια περιγράφουμε συνοπτικά αυτές τις τέσσερις στρατηγικές: α) Καταστολή πληθυσμών: Ο μηχανισμός αυτός βασίζεται στην αξιοποίηση της ΚΑ και ονομάζεται Τεχνική Ασύμβατου Εντόμου (Incompatible Insect Technique IIT) (Boller & Bush 1974). Έχει παρόμοια στρατηγική με αυτή του στείρου εντόμου, καθώς και οι δύο στοχεύουν να μειώσουν τη γονιμότητα στον πληθυσμό στόχο. Στην τεχνική αυτή εφαρμόζεται μαζική απελευθέρωση αρσενικών ατόμων που φέρουν το βακτήριο Wolbachia, και ζευγαρώνουν με τα θηλυκά άτομα του πληθυσμού στόχου. Σε περίπτωση που στα θηλυκά άτομα δεν απαντά βακτήριο Wolbachia επάγεται μονόδρομη ΚΑ, ενώ αν φέρουν διαφορετικό ασύμβατο στέλεχος Wolbachia προκαλείται αμφίδρομη ΚΑ. Και στις δύο περιπτώσεις το τελικό αποτέλεσμα είναι η εμβρυική θνησιμότητα και η μη παραγωγή απογόνων (Bourtzis & Robinson 2006, Bourtzis 2008). Η πρώτη απόπειρα εφαρμογής της ΙΙΤ έγινε το 1967 με επιτυχή αποτελέσματα από τον Laven σε χωριά της Ινδίας για να καταστείλει τους πληθυσμούς του κουνουπιού Culex pipiens, του φορέα της φιλαρίασης (Laven 1967). Έπειτα, εφαρμόστηκε σε πιλοτικά πειράματα τόσο σε εργαστηριακή κλίμακα όσο και στο πεδίο με ενθαρρυντικά αποτελέσματα, για την αντιμετώπιση σημαντικών επιβλαβών εντόμων όπως του λεπιδόπτερου Cadra cautella (Brower 1978), της μύγας του κερασιού Rhagoletis cerasi (Russ & Faber 1979), της μύγας της Μεσογείου Ceratitis capitata (Zabalou et al. 2004b, 2009) και του δάκου Bactocera oleae (Apostolaki et al. 2011). Το μεγαλύτερο πλεονέκτημα αυτής της μεθόδου, στο οποίο οφείλεται και το τεράστιο εύρος 50

61 ΕΙΣΑΓΩΓΗ εφαρμογών της, είναι η δυνατότητα τεχνητής μεταφοράς στελεχών Wolbachia είτε μεταξύ πληθυσμών του ίδιου είδους είτε μεταξύ διαφορετικών ειδών. Με τον τρόπο αυτό ανοίγει ο δρόμος για την εφαρμογή της τεχνικής ΙΙΤ και σε επιβλαβή είδη εντόμων που οι πληθυσμοί τους στη φύση δε φέρουν το βακτήριο Wolbachia (Zabalou et al. 2004b, Xi et al. 2005, Ruang- Areerate & Kittayapong 2006, Zabalou et al. 2009, Apostolaki et al. 2011). β) Εξάπλωση επιθυμητών γενοτύπων: Και η τεχνική αυτή στηρίζεται στην ιδιότητα του βακτηρίου να εξαπλώνεται μέσω της ΚΑ, αφού τα θηλυκά άτομα που φέρουν το βακτήριο Wolbachia έχουν αναπαραγωγικό πλεονέκτημα έναντι αυτών που δε φέρουν. Απλά, την ιδιότητα αυτή στο δεύτερο μηχανισμό την εκμεταλλευόμαστε έμμεσα ώστε να κατευθύνουμε και εξαπλώσουμε ταχύτατα ένα επιθυμητό χαρακτηριστικό στον πληθυσμό στόχο (Hoffmann et al. 1998, Sinkins & O'Neill 2000, Dobson et al. 2002b, Sinkins & Godfray 2004, Sinkins & Gould 2006, Rasgon 2007, Bourtzis 2008, Rasgon 2008, Brelsfoard & Dobson 2009). Κάθε μητρικά κληρονομούμενος παράγοντας όπως τα μιτοχόνδρια, τα συμβιωτικά βακτήρια, οι ιοί, ή και τα γονίδια που εκφράζονται από αυτούς μπορούν να μεταδοθούν μαζί με το βακτήριο Wolbachia (Beard et al. 1993b, Bourtzis & O'Neill 1998). Όσο αφορά τον έλεγχο των φορέων ασθενειών, τα παραπάνω γονίδια μπορούν να δρουν είτε σκοτώνοντας το παράσιτο κατά την είσοδο του στο φορέα είτε μπλοκάροντας τη μετάδοσή του (Sinkins & Gould 2006). Οι παράμετροι που επηρεάζουν την εξάπλωση των επιθυμητών χαρακτηριστικών είναι η αρχική συχνότητα του βακτηρίου (και του εκάστοτε χαρακτηριστικού), τα επίπεδα κάθετης μετάδοσης του βακτηρίου, η ένταση της ΚΑ και οι ενδεχόμενες επιπτώσεις (fitness effects) στον ξενιστή (Bourtzis and Robinson 2006). Μια άλλη προσέγγιση για την έμμεση χρήση του βακτηρίου Wolbachia θα ήταν η ενσωμάτωση των επιθυμητών γονιδίων σε κασέτες μαζί με τα γονίδια που είναι υπεύθυνα για την έκφραση της ΚΑ όταν αυτά χαρακτηριστούν (Sinkins et al. 1997), κάτι που υποστηρίζεται και από θεωρητικά μοντέλα (Sinkins & Godfray 2004). Το βασικό πλεονέκτημα της τεχνικής της εξάπλωσης επιθυμητών φαινοτύπων αποτελεί η δυνατότητα εφαρμογής της σε πλήθος διαφορετικών ειδών ξενιστών, μιας και το βακτήριο Wolbachia απαντά ευρέως στη φύση (Bourtzis & Robinson 2006). γ) Μείωση διάρκειας ζωής των ξενιστών: Ένας άλλος τρόπος αξιοποίησης του βακτηρίου σε προσπάθειες βιολογικής καταπολέμησης επιβλαβών εντόμων είναι η χρήση συγκεκριμένων στελεχών του, τα οποία έχουν την ιδιότητα να μειώνουν το χρόνο ζωής των ξενιστών τους, όπως για παράδειγμα το στέλεχος Wolbachia wmelpop. Το στέλεχος αυτό υπάρχει σε φυσικούς πληθυσμούς D. melanogaster και μειώνει τη διάρκεια ζωής του ξενιστή του λόγω του ανεξέλεγκτου διπλασιασμού του στο νευρικό και μυϊκό σύστημα (Min & Benzer 1997). Η μεταφορά του στελέχους wmelpop στο συγγενές είδος D. simulans έδειξε ότι 51

62 ΕΙΣΑΓΩΓΗ διατηρείται αυτή η σημαντική ιδιότητα και στο νέο ξενιστή χωρίς να προκαλεί μακροπρόθεσμα σημαντικές παρενέργειες στη γονιμότητα και την εκκόλαψη αυγών (McGraw et al. 2002). Πρόσφατα οι Turley και συνεργάτες έδειξαν ότι η μεταφορά του στελέχους wmelpop στο Aedes aegypti δε ζημιώνει σημαντικά την αναπαραγωγική ικανότητα των αρσενικών διαμολυσμένων ατόμων (Turley et al. 2013). Τα παραπάνω ευρήματα ενθαρρύνουν την επιστημονική κοινότητα στις προσπάθειες εφαρμογής της τεχνικής αυτής σε πλήθος φορέων πολύ σημαντικών ασθενειών, όπου ο μολυσματικός παράγοντας χρειάζεται μεγάλο χρονικό διάστημα επώασης μέσα στο φορέα (Brownstein et al. 2003). Πράγματι, οι McMeniman και συνεργάτες κατέγραψαν ότι η μεταφορά του στελέχους wmelpop στο Aedes aegypti μειώνει τη διάρκεια ζωής του κουνουπιού (McMeniman et al. 2009). Παράλληλα παρατηρήθηκε από τους Kambris et al ότι το μολυσματικό αυτό βακτηριακό στέλεχος στο Aedes aegypti επάγει την υπέρέκφραση γονιδίων του ανοσοποιητικού συστήματος του κουνουπιού, γεγονός που πιθανά να σχετίζεται με την αρχική του ιδιότητα, δηλαδή της μείωσης του χρόνου ζωής του ξενιστή (Kambris et al. 2009). δ) Παρεμπόδιση παθογόνων (pathogen interference): Σειρά εργαστηριακών μελετών έδειξαν ότι το βακτήριο Wolbachia ενισχύει τον αμυντικό μηχανισμό του ξενιστή κατά παθογόνων ιών και παρασίτων. Αποτέλεσμα αυτής της αλληλεπίδρασης του βακτηρίου Wolbachia με το ξενιστή είναι η παρεμπόδιση των παθογόνων και ο περιορισμός της μετάδοσης πολύ βλαβερών ασθενειών (Iturbe-Ormaetxe et al. 2011, Eleftherianos et al. 2013, Sinkins 2013) (αναλυτικά στην ενότητα ). Χαρακτηριστικά παραδείγματα αποτελούν οι προσπάθειες περιορισμού των ιών Dengue (δάγκειος πυρετός), Chikungunya και West Nile (ο ιός του Δυτικού Νείλου), των νηματωδών της φιλαρίασης (π.χ. ελεφαντίαση) και του παρασιτικού πρωτόζωου Plasmodium (ελονοσία), μέσω της Wolbachia-επαγόμενης ενίσχυσης του ανοσοποιητικού συστήματος των αντίστοιχων φορέων-κουνουπιών (Kambris et al. 2009, Moreira et al. 2009, Bian et al. 2010, Glaser et al. 2010, Kambris et al. 2010, Mousson et al. 2010, Atyame et al. 2011b, Hughes et al. 2011a, Blagrove et al. 2012, Lu et al. 2012b, Mousson et al. 2012, Pan et al. 2012, Zele et al. 2012, Bian et al. 2013a, 2013b, Hussain et al. 2013, Turley et al. 2013, Ye et al. 2013b). Αξίζει να σημειωθεί ότι ιδιαίτερα ενθαρρυντικά ήταν τα αποτελέσματα από τις πρώτες εφαρμογές της τεχνικής αυτής σε ημι-ελεγχόμενες συνθήκες (Walker et al. 2011), καθώς και σε μικρής κλίμακας ελευθέρωση ανθεκτικών (λόγω της παρουσίας του βακτηρίου Wolbachia) εργαστηριακών σειρών κουνουπιών Aedes aegypti στην Αυστραλία με σκοπό το μπλοκάρισμα του ιού Dengue (Hoffmann et al. 2011). 52

63 ΕΙΣΑΓΩΓΗ Μύγα τσε-τσε Οι μύγες τσε-τσε ευθύνονται για την κυκλική μετάδοση των τρυπανοσωμάτων, τα οποία προκαλούν την ασθένεια του ύπνου ή Αφρικάνικη Τρυπανοσωμίαση (Human African Trypanosomiasis-HAT) στον άνθρωπο, και την αντίστοιχη τρυπανοσωμίαση στα ζώα (African Animal Trypanosomiasis-AAT), γνωστή ως nagana. Οι μύγες τσε-τσε απαντούν σε 38 χώρες της Αφρικής, και κατ επέκταση, 60 εκατομμύρια άνθρωποι κινδυνεύουν από τη νόσο στην υποσαχάρια περιοχή. Ο Παγκόσμιoς Οργανισμός Υγείας (ΠΟΥ) εκτιμά ότι περίπου άνθρωποι είναι αυτήν τη στιγμή μολυσμένοι από τρυπανοσωμίαση, παρ' όλο που είναι πολύ περισσότερες οι μολύνσεις και οι θάνατοι που δεν αναφέρονται (Cattand et al. 2001). Η ασθένεια του ύπνου προκάλεσε το θάνατο σε ανθρώπους το 2002 (πηγή: γιατροί χωρίς σύνορα). Η ασθένεια του ύπνου προκαλείται από το παράσιτο Trypanosoma brucei και μεταδίδεται από το τσίμπημα της μύγας τσε-τσε. Η ασθένεια τελικά εξαπλώνεται στο μυελό, οπότε και αρχίζουν να εμφανίζονται τα χαρακτηριστικά σημάδια της ασθένειας: αποπροσανατολισμός, αυξημένες διαταραχές ύπνου και σε τελικό στάδιο κώμα και θάνατος. Εξίσου δραματικές είναι και οι επιπτώσεις της τρυπανοσωμίασης στα ζώα αποτελώντας σημαντικό τροχοπέδη για την ανάπτυξη της τοπικής κτηνοτροφίας. Εκτιμάται ότι οι ετήσιες απώλειες στην παραγωγή βοοειδών φθάνουν τα εκατομμύρια δολάρια (Hursey & Slingenbergh 1995), ενώ οι ετήσιες ζημιές, συνολικά στην κτηνοτροφία και τη γεωργία κοστολογούνται στα 4750 εκατομμύρια δολάρια (Budd 1999, Vreysen et al. 2013). Οι μύγες τσε-τσε ταξινομούνται στην οικογένεια Glossinidae και στο γένος Glossina, με 31 αναγνωρισμένα, έως τώρα, είδη και υποείδη (Buxton 1955, Moloo 1993). Μεταξύ τους διακρίνονται σε τρεις ομάδες, με βάση τα μορφολογικά τους χαρακτηριστικά (Newstead 1911), τον τύπο ενδιαιτήματος (Glasgow 1970) και τους ξενιστές τους (Weitz 1970). Στην πρώτη ομάδα (fusca ή forest group) ανήκουν είδη με μικρή ή καθόλου οικονομική σημασία, τα οποία απαντούν σε δάση (π.χ. G. brevipalpis, G. longipennis, G. medicorum) (Haeselbarth et al. 1966, Ford 1970, Jordan 1986). Η δεύτερη ομάδα (palpalis ή riverine group) περιλαμβάνει παραποτάμια είδη που αποτελούν σημαντικούς φορείς των ΗΑΤ και ΑΑΤ στη δυτική Αφρική (G. tachinoides, G. palpalis palpalis και G. p. gambiensis), και της ΗΑΤ στην κεντρική Αφρική (G. fuscipes fuscipes και G. f. quanzensis) (Bouyer et al. 2010, Van den Bossche et al. 2010). Τα είδη που ζουν σε σαβάνα απαρτίζουν την τρίτη ομάδα (morsitans ή savannah group) (Jordan 1986). Τα δύο σημαντικότερα από αυτά είδη (G. morsitans spp. και G. pallidipes) συνιστούν κύριους φορείς των ασθενειών ΑΑΤ και ΗΑΤ στην ανατολική και νότια Αφρική (Vreysen et al. 2013). 53

64 ΕΙΣΑΓΩΓΗ Ένα από τα ξεχωριστά γνωρίσματα της μύγας τσε-τσε είναι ο ζωοτόκος τρόπος αναπαραγωγής της. Η προνύμφη αναπτύσσεται μέσα στη μήτρα και τρέφεται καθ όλη τη διάρκεια ανάπτυξής της με συστατικά προερχόμενα από τη μητέρα (Hagan 1951, Τobe & Langley 1978). Η ανάπτυξη του εμβρύου μέσα στη μήτρα διαρκεί ώρες με την επώαση του πρώτου σταδίου προνύμφης (L1, instar larva). Ακολουθεί ο σχηματισμός του δεύτερου σταδίου προνύμφης (L2, instar larva) και στη συνέχεια ολοκληρώνεται η δημιουργία του τελευταίου, τρίτου σταδίου προνύμφης (L3, instar larva). Αφού το θηλυκό γεννήσει τη L3 προνύμφη, η δεύτερη εισέρχεται στο έδαφος και η ανάπτυξη στο κουκούλι (pupa) διαρκεί περίπου 30 μέρες (Bursell 1961, Tobe et al. 1973). Το θηλυκό άτομο ζευγαρώνει μία ή δύο μέρες μετά την εμφάνιση του, πιθανότατα όταν παίρνει το πρώτο του γεύμα με αίμα (Saunders 1970). Το νεαρό αρσενικό άτομο, όταν εκδύεται από το κουκούλι, έχει ολοκληρωμένο αναπαραγωγικό σύστημα και μπορεί να συζευχθεί με το θηλυκό ανά 2-3 μέρες στη φύση, 6-10 φορές υπό εργαστηριακές συνθήκες (Jordan 1972, Pollock 1974). Στη φύση, πιστεύεται ότι τα θηλυκά μάλλον ζευγαρώνουν μόνο μια φορά στη ζωή τους. Ωστόσο, τόσο σε εργαστηριακές αποικίες σε μικρούς θαλάμους (Jordan 1986, Vreysen & Van der Vloedt 1990) όσο και πρόσφατα, σε φυσικούς πληθυσμούς G. f. fuscipes, παρατηρήθηκαν περισσότερα ζευγαρώματα (Bonomi et al. 2011). Η μύγα τσε-τσε διακρίνεται για το πολύ χαμηλό βαθμό αναπαραγωγής της, αφού η ωορρηξία συμβαίνει κάθε 9-10 μέρες, σε αντίθεση με τα περισσότερα έντομα. Εντούτοις, λόγω της στενής μητρικής φροντίδας και της ζωοτοκίας, το ποσοστό επιβίωσης και ενηλικίωσης των ολιγάριθμων απογόνων της είναι πολύ υψηλό (Leak 1998). Αν και υπό εργαστηριακές συνθήκες, το θηλυκό άτομο μπορεί να παράγει 10 απογόνους, στη φύση ο αριθμός αυτός είναι μικρότερος (Vreysen et al. 2013). Κάθε προσπάθεια ελέγχου των πληθυσμών μύγας τσε-τσε προϋποθέτει τη γνώση πληροφοριών σχετικά με την κινητικότητα και τη δυναμική των πληθυσμών, την εξάπλωση τους και τη χωροταξία-ανάγλυφο των ενδιαιτημάτων τους. Οι μύγες τσε-τσε, αν και είναι ικανές να πετούν με πολύ μεγάλη ταχύτητα, είναι άπραγες το μεγαλύτερο διάστημα. Μάλιστα, εκτιμάται ότι τα θηλυκά άτομα G. m. morsitans δεν πετούν περισσότερο από λίγα λεπτά ημερησίως, ενώ τα νεαρά αρσενικά γύρω στα 15 λεπτά και τα μεγαλύτερα λεπτά (Bursell & Taylor 1980). Η κινητικότητα των μυγών τσε-τσε καθορίζεται από την αναζήτηση ξενιστών-θηλαστικών ώστε να εξασφαλιστεί η απαραίτητη ποσότητα τροφής-αίματος (Colvin & Gibson 1992). Επιπλέον, ο ρυθμός διασποράς της μύγας τσε-τσε εξαρτάται από τα χαρακτηριστικά του εκάστοτε είδους του εντόμου και τη μορφή της περιοχής (Vreysen et al 2013). 54

65 ΕΙΣΑΓΩΓΗ Αφίδες Οι αφίδες (Hemiptera:Aphidoidea) που αναφέρονται επίσης με τα κοινά ονόματα μελίγκρες, ψείρες, φυτοφθείρες, μέλερη, ανήκουν στα νύσσοντα μυζητικά (piercing sucking) έντομα και διατρέφονται από τους φυτικούς χυμούς. Περίπου 250 από τα 4000 είδη αφίδων, που έχουν περιγραφεί, θεωρούνται εχθροί των καλλιεργειών (Pollard 1973, Dixon 1998, Blackman & Eastop 2000, Walling 2000). Προκαλούν σημαντικές απώλειες στη φυτική παραγωγή μέσω της εξάντλησης των θρεπτικών συστατικών των φυτών, της έγχυσης φυτικών διεγερτών (elicitors) και, κυρίως, με τη μετάδοση πολυάριθμων φυτοπαθογόνων ιών (Mittler & Sylvester 1961, Ng & Perry 2004, Girousse et al. 2005). Μάλιστα, η μόλυνση των φυτών από ιούς ευνοεί τη σφοδρότητα προσβολής από τις αφίδες (Ziebell et al. 2011, Gutiérrez et al. 2013). Μορφολογικά, πρόκειται για μικρά μαλακά έντομα, μήκους συνήθως 1-3 και σπάνια 7 mm. Έχουν λεπτά πόδια, μακρύ ρύγχος, κεραίες από 3 έως 6 άρθρα. Η πλειοψηφία των ειδών φέρει στα νώτα της κοιλίας ένα ζευγάρι σωληνόμορφων αποφύσεων, που λέγονται κεράτια ή σίφωνες, καθώς και μια απόφυση στην άκρη της κοιλιάς που λέγεται ουρίτσα ή ουρά (cauda). Μέσω των σιφώνων εκκρίνουν κηρώδεις φερομόνες ως άμυνα σε αρπακτικά έντομα ή άλλα ζώα. Το χρώμα των αφίδων ποικίλει από πράσινο έως μαύρο, με κάποια είδη να έχουν και διάφορους άλλους χρωματισμούς, ενώ ορισμένα αποκτούν ένα χρωματισμό γκρί ή ακόμα και άσπρο, λόγω των κηρωδών ουσιών που εκκρίνουν (Tzanakakis & Katsoyannos 2003). Τα στοματικά μόρια των αφίδων έχουν τη μορφή λεπτών στιλέτων (stylets) μέσω των οποίων διεισδύουν στα αγγεία των φύλλων και βλαστών και απομυζούν στοιχεία ηθμού. Κάθε στιλέτο φέρει και ένα σιελογόνο αγωγό που εκκρίνει σίελο στο φυτικό ιστό, και έτσι δημιουργείται ένα κανάλι πρόσληψης τροφής από το έντομο (Miles 1999, Walling 2000, Tjallingii 2006). Επίσης, έχει διαπιστωθεί σε ορισμένα είδη αφίδων, ότι οι εκκρίσεις αυτές ευθύνονται για την προστασία των εντόμων από τους μηχανισμούς άμυνας των φυτών-ξενιστών τους (Will et al. 2007). Ο βιολογικός κύκλος των αφίδων είναι αρκετά σύνθετος. Τα περισσότερα είδη αφίδων είναι πολυμορφικά. Στην αναπαραγωγή τους παρατηρείται συνήθως ζωοτοκία, παρθενογένεση, εγγενής αναπαραγωγή και γενεές με λίγα ή καθόλου αρσενικά. Τα διάφορα είδη αφίδων, από πλευράς ετήσιου κύκλου ζωής, κατατάσσονται σε μεταναστευτικά και σε μη μεταναστευτικά. Χαρακτηρίζονται από εναλλαγή φυτών-ξενιστών (ανάλογα με την εποχή, χειμώνας-καλοκαίρι) (Lankau 2007), διαφορετικούς τρόπους ζωής στο ίδιο είδος φυτού-ξενιστή (π.χ. φυλλόβιος, ριζόβιος) και διαφορετικούς τρόπους ζωής σε άτομα της ίδιας γενεάς. Την περίοδο του καλοκαιριού όλα τα ακμαία είναι θηλυκά και παράγουν αρκετές νέες αφίδες κάθε μέρα, οι οποίες ξεκινούν να διατρέφονται άμεσα, ενώ ήδη μέσα τους φέρουν τα έμβρυα της επόμενης γενεάς. Στην πλειοψηφία τους είναι άπτερα. Καθώς οι αποικίες μεγαλώνουν, δημιουργείται 55

66 ΕΙΣΑΓΩΓΗ συνωστισμός και η ποιότητα του φυτού υποβαθμίζεται. Αυτό έχει ως αποτέλεσμα την παραγωγή πτερωτών αφίδων, οι οποίες πετώντας αποικίζουν άλλα φυτά. Καθώς πλησιάζει ο χειμώνας, τα είδη αυτά παράγουν πτερωτά αρσενικά και θηλυκά άτομα. Τα θηλυκά αυτά και σε αυτό το στάδιο εναποθέτουν διαχειμάζοντα αυγά πριν πεθάνουν (Hille Ris Lambers 1966, Dixon 1998, (Tzanakakis & Katsoyannos 2003, Kindlemann et al. 2007, Williams & Dixon 2007). Την άνοιξη και το φθινόπωρο παρατηρείται πληθυσμιακή έξαρση των αφίδων, οι οποίες γενικά προτιμούν μετρίως θερμό και υγρό καιρό. Ζουν συνήθως ανά ομάδες, κυρίως σε τρυφερούς βλαστούς και τρυφερά φύλλα. Έχουν τεράστιο εύρος ξενιστών (κηπευτικά, σιτηρά, οπωροφόρα δένδρα, καλλωπιστικά), και είναι διαδεδομένες τόσο στον αγρό όσο και στα θερμοκήπια. Οι ζημιές που προκαλούν στα φυτά είναι χλώρωση, συστροφή (κατσάρωμα) και νέκρωση φύλλων, παραμόρφωση καρπών και λουλουδιών, πτώση ανθέων, υπερπλασίες (όγκους), κηλίδες, ανακοπή της ανάπτυξης. Επίσης, ευνοούν την ανάπτυξη καπνιάς (δευτερογενής παρουσία μύκήτων) πάνω στις μελιτώδεις εκκρίσεις τους. Οι συνήθως πυκνοί πληθυσμοί των αφίδων, ο μεγάλος αριθμός γενεών ανά έτος που συχνά ξεπερνά τις 10, και η μετάδοση τεράστιου αριθμού ιών στα φυτά, κατατάσσουν τις αφίδες ανάμεσα στους πιο επιβλαβείς εχθρούς των καλλιεργούμενων φυτών, παγκοσμίως (Tzanakakis & Katsoyannos 2003). Η καταπολέμηση των αφίδων γίνεται συνήθως με χημικά μέσα. Όμως η βιολογική καταπολέμηση, που στηρίζεται στη χρήση ωφέλιμων αφιδοφάγων εντόμων, εφαρμόζεται επίσης συχνά με ικανοποιητικά αποτελέσματα. Μεταξύ αυτών των φυσικών εχθρών των αφίδων συγκαταλέγονται αρπακτικά Νευρόπτερα των οικογενειών Chrysopidae και Hemerobiidae, αρπακτικά Κολεόπτερα της οικογένειας Coccinellidae, αρπακτικά Δίπτερα της οικογένειας Syrphidae και παρασιτοειδή Υμενόπτερα των οικογενειών Braconidae, Chalcididae και Proctotrypidae. Επίσης, υψηλά επίπεδα θνησιμότητας σε αφίδες δύναται να προκαλέσουν είδη της υποοικογένειας Aphidiinae, καθώς και εντομοπαθογόνοι μύκητες του γένους Entomophthora σε συνθήκες υψηλής σχετικής υγρασίας (Tzanakakis & Katsoyannos 2003) Καρπόκαψα καστανιάς Τα Λεπιδόπτερα Cydia splendana, Cydia fagiglandana και Pammene fasciana (Lepidoptera:Tortricidae) αποτελούν (μαζί με το Curculio elephas) τους σημαντικότερους ζωικούς εχθρούς των καστάνων στην Ευρώπη (Rotundo 1993, Den Otter et al. 1996, Aguin- Pombo et al. 2008). Συχνά αναφέρονται με το κοινό όνομα καρπόκαψα καστανιάς. Παρακάτω παραθέτουμε ορισμένα κύρια χαρακτηριστικά των τριών αυτών ειδών λεπιδοπτέρων. 56

67 ΕΙΣΑΓΩΓΗ Cydia splendana: Το ενήλικο άτομο έχει άνοιγμα πτερύγων mm. Το μέγεθός του ποικίλει με τον ξενιστή. Γενικά, μοιάζει με το συγγενές του, Cydia pomonella. Η προνύμφη αναπτυγμένη έχει μήκος 15 mm. Είναι υπόλευκη ή ρόδινη. Είναι είδος ολιγοφάγο, δηλαδή η προνύμφη του προσβάλλει μόνα κάστανα και βαλάνους όλων των ειδών δρυός. Πέρα από το βόρειο όριο εξάπλωσης της καστανιάς, προσβάλλει μόνο δρυς. Έχει μια γενεά το έτος. Διαχειμάζει ως αναπτυγμένη προνύμφη στο έδαφος, σε βομβύκιο. Η ανάπτυξη της νύμφης ολοκληρώνεται τον Ιούλιο και ενηλικιώνεται σε ημέρες. Η πτήση (περίοδος δραστηριότητας και παρουσίας) των ενηλίκων διαρκεί 1,5 μήνα, με το μέγιστο του πληθυσμού να παρατηρείται μέσα Αυγούστου έως μέσα Σεπτεμβρίου. Το θηλυκό άτομο ζευγαρώνει και αρχίζει να ωοτοκεί από τις πρώτες μέρες της ενήλικης ζωής του. Η περίοδος ωοτοκίας διαρκεί 10 περίπου μέρες και γεννά από κατά μέσο όρο αυγά. Τοποθετεί τα αυγά του μεμονωμένα στην άνω ή την κάτω επιφάνεια φύλλων που βρίσκονται κοντά σε καρπούς. Η επώαση διαρκεί 1-2 εβδομάδες. Η νεαρή προνύμφη περιφέρεται στο φύλλωμα χωρίς να φάει, εωσότου εντοπίσει ένα κατάλληλο καρπό και να εισέλθει. Στη συνέχεια διασχίζει το περικάρπιο στο μέρος της λεγόμενης ουλής, και αφού διανοίξει στοά μήκους 3-5 mm, μπαίνει σε ένα σπόρο όπου αναπτύσσεται σε βάρος των κοτυληδόνων. Τα κοκκώδη αποχωρήματά της συσσωρεύονται στη στοά πίσω της, μέσα στο κάστανο. Η ανάπτυξη της προνύμφης διαρκεί περίπου 1 μήνα. Στην Ελλάδα οι προνύμφες αναπτύσσονται στα κάστανα ή στα βαλανίδια, από Αύγουστο ως Οκτώβριο. Όταν ολοκληρώσει την ανάπτυξή της, η προνύμφη εγκαταλείπει το κάστανο ανοίγοντας μια σχετικά μικρή οπή 1,5mm. Τα προσβεβλημένα κάστανα συνήθως πέφτουν πρόωρα πριν, η προνύμφη ολοκληρώσει την ανάπτυξή της. Εάν υπάρχει επαρκής χρόνος, η προνύμφη θα ολοκληρώσει την ανάπτυξή της στο πεσμένο κάστανο και έπειτα θα μπει στο έδαφος (Bovey 1966, Tzanakakis & Katsoyannos 2003). Cydia fagiglandana: Το ενήλικο μοιάζει με τον ανοιχτόχρωμο τύπο του Cydia splendana, αλλά ξεχωρίζουν από τον χρωματισμό των πτερύγων, το μικρότερο μέγεθός του, την απουσία μικρών δοντιών στο φαλλό και από την αφθονία γαμψών τριχών στους λοβούς του ωοθέτη. Κύριος ξενιστής είναι η δασική οξυά Fagus silvatica και η αριά Quercus ilex. Αναφέρεται η παρουσία του και σε καρπούς άλλων ειδών Quercus, και κάστανα και φουντούκια. Εμφανίζει παρόμοιο κύκλο ζωής με το C. splendana (Bradley et al. 1979). Πιστεύεται ότι έχει μια γενεά το έτος (Tzanakakis & Katsoyannos 2003). Pammene fasciana: Οι πτέρυγες του ενήλικου ατόμου έχουν άνοιγμα mm, και χρώμα καστανόξανθο. Η χαρακτηριστική κηλίδα (speculum) έχει δύο πλευρικές ταινίες τεφρές που 57

68 ΕΙΣΑΓΩΓΗ πλαισιώνουν μια περιοχή καστανωπή με 4 μαύρες μικρές γραμμές, και στη συνέχειά του προς τη βάση της πτέρυγας υπάρχουν 3 μαύρες μικρές κηλίδες (Silvestri 1943, Bovey 1966, Baggiolini 1967, Tzanakakis & Katsoyannos). Διακρίνεται από το Cydia splendana από τον πιο έντονο χρωματισμό του και τα σχέδια των πρόσθιων πτερύγων. Το αυγό είναι υπόλευκο, η προνύμφη έχει χρώμα στην αρχή υπόλευκο ή ρόδινο και στη συνέχεια ανοιχτοκάστανο. Η νεαρή προνύμφη έχει μήκος 1,5-2 mm και η πλήρως αναπτυγμένη mm (Bovey 1966, Baggiolini 1967). Ο βασικός ξενιστής της είναι η καστανιά, η προνύμφη όμως μπορεί να αναπτυχθεί και σε βαλανίδια και σε καρπούς σφενδάμου (Bovey 1966). Το λεπιδόπτερο Pammene fasciana έχει μια γενεά το έτος. Διαχειμάζει ως αναπτυγμένη προνύμφη σε βομβύκιο και η ενηλικίωση γίνεται τον Ιούνιο-Ιούλιο. Το θηλυκό τοποθετεί τα αυγά του στην άνω επιφάνεια των φύλλων. Η νεαρή προνύμφη μετακινείται προς τους νεαρούς καρπούς (κύπελλα) στη βάση των οποίων ανοίγει μια οπή και μπαίνει μέσα, όπου τρώει τα νεαρά κάστανα. Η προνύμφη ολοκληρώνει την ανάπτυξή της σε 40 περίπου μέρες, στη συνέχεια εγκαταλείπει το κύπελλο και υφαίνει σε προστατευμένη θέση του φλοιού της καστανιάς το βομβύκιο. Εκεί θα διαπαύσει για να νυμφωθεί τα τέλη της επόμενης άνοιξης ή το καλοκαίρι. Σε αντίθεση με το είδος Cydia splendana που συνήθως προσβάλλει ένα κάστανο σε κάθε κύπελλο, η προνύμφη του Pammene fasciana προσβάλλει όλα τα κάστανα ενός κυπέλλου. Τα προσβεβλημένα κύπελλα πέφτουν νωρίς τον Ιούλιο και κατά τον Αύγουστο (Tzanakakis & Katsoyannos 2003). Οι προνύμφες και των τριών παραπάνω ειδών της οικογένειας Tortricidae προσβάλλουν κυρίως τα κάστανα κατατρώγοντας τη σάρκα αυτών. Τα προσβεβλημένα (σκουληκιασμένα) κάστανα είναι ελαφρότερα των άλλων, συχνά ζαρωμένα στο δίσκο και πολλά έχουν εμφανή την οπή εξόδου της προνύμφης. Γενικά, είναι ακατάλληλα για βρώση και για εμπορία (Branco et al. 2001, Jiménez 2003, Tzanakakis & Katsoyannos 2003, Yu et al. 2003, Leiva & Fernández-Alés 2005, Jimenez-Pino et al. 2011). Επιπλέον της καστανιάς, προσβάλλουν τους καρπούς της οξιάς, των διαφόρων ειδών δρυός ακόμη και του σφενδάμνου (Tzanakakis & Katsoyannos 1998) προκαλώντας έτσι σοβαρές ζημιές σε είδη μεγάλης δασικής σημασίας (Gilligan & Epstein 2012). Πρόσφατα, καταγράφηκε ευρεία κατανομή και των τριών ειδών Λεπιδοπτέρων στον Ελλαδικό χώρο αναδεικνύοντας τη σημασία των εχθρών αυτών για την εγχώρια καστανοκαλλιέργεια και τα δασικά οικοσυστήματα (Avtzis 2012, Avtzis et al. 2013). Η φύση των καστανεώνων και καστανοδασών, το μεγάλο ύψος των δένδρων και η ενδοκάρπια ανάπτυξη της προνύμφης, δυσκολεύουν γενικά τη χημική καταπολέμηση των ζωικών εχθρών των καστάνων (Mansilla & Salinero 1993, Den Otter et al 1996). Τα μέτρα φυτοπροστασίας που λαμβάνονται είναι συνήθως καλλιεργητικά, αν και σε ορισμένες περιπτώσεις μπορεί να εφαρμοστούν και χημικά εντομοκτόνα, ιδίως σε χαμηλού μεγέθους 58

69 ΕΙΣΑΓΩΓΗ δένδρα (5-6 m ύψους). Επίσης, ενθαρρυντικά ήταν τα αποτελέσματα από τη χρήση ελκυστικών φερομόνων φύλου για την παρακολούθηση των πληθυσμών των ειδών Cydia splendana και Cydia fagiglandana και την καταπολέμησή τους, μέσω της παρεμπόδισης της σύζευξης (Angeli et al. 1997). 59

70 ΕΙΣΑΓΩΓΗ 1.3 Σκοπός της παρούσας διατριβής Το βακτήριο Wolbachia συνιστά ένα πολύ διαδεδομένο και πολυποίκιλο άλφα-πρωτεοβακτήριο το οποίο μολύνει πλήθος αρθροπόδων και νηματωδών της φιλαρίασης. Ως ενδοκυττάριο και μητρικά κληρονομούμενο ενδοσυμβιωτικό βακτήριο, εντοπίζεται σε αμέτρητα είδη εντόμων, μιας και μεταδίδεται αποτελεσματικά και ταχύτατα εντός των πληθυσμών τους. Αποτέλεσμα των αλληλεπιδράσεων του βακτηρίου Wolbachia με τους ξενιστές είναι η μεταβολή των αναπαραγωγικών τους ιδιοτήτων, με την επαγωγή κυτταροπλασματικής ασυμβατότητας (ΚΑ), παρθενογένεσης, θανάτωσης αρσενικών και θηλυκοποίησης. Παράλληλα, έχει αναπτύξει ένα ευρύ φάσμα επιδράσεων στον ξενιστή που αφορούν μεταξύ άλλων τη διατροφή, το μεταβολισμό, τη μακροβιότητα και την αμυντική του ικανότητα έναντι παθογόνων. Λόγω αυτής της μεγάλης οικολογικής εξάπλωσης και της εντυπωσιακής ποικιλίας των αναπαραγωγικών φαινοτύπων και λειτουργικών παρεμβολών που προκαλεί, το βακτήριο Wolbachia θεωρείται σήμερα ένα πολλά υποσχόμενο εργαλείο για τον έλεγχο επιβλαβών εντόμων ιατρικής, γεωργικής και περιβαλλοντικής σημασίας. Στη λίστα αυτή των επιβλαβών εντόμων περιλαμβάνονται: (α) η μύγα τσε-τσε (Glossina spp.), η οποία είναι ο κύριος φορέας του αφρικανικού τρυπανοσώματος στην υπό-σαχάρια περιοχή της Αφρικής που προκαλεί την ασθένεια του ύπνου στον άνθρωπο και την αντίστοιχη στα ζώα, γνωστή ως nagana, (β) οι αφίδες (Aphids) οι οποίες μετρούν πάνω από είδη και προκαλούν τεράστιες ζημιές στα γεωργικά και δασικά οικοσυστήματα παγκοσμίως, και τέλος, (γ) τα Λεπιδόπτερα της οικογένειας Tortricidae που αποτελούν έναν από τους σημαντικότερους εχθρούς στα δάση και τις φυτείες καστανιάς σε ολόκληρη την Ευρώπη. Γίνεται αντιληπτό ότι η χρησιμοποίηση των ιδιοτήτων του βακτηρίου Wolbachia σε βιολογικές μεθόδους ελέγχου των προαναφερθέντων επιβλαβών εντόμων προϋποθέτει την πληρέστερη δυνατή μελέτη των συμβιωτικών σχέσεων βακτηρίου-ξενιστή. Ειδικότερα, είναι απαραίτητες οι πληροφορίες σχετικά με την κατανομή της παρουσίας του βακτηρίου σε όσο το δυνατόν περισσότερους φυσικούς ή/και εργαστηριακούς πληθυσμούς του εκάστοτε ξενιστή, τον χαρακτηρισμό των βακτηριακών στελεχών που ανιχνεύθηκαν, τις φυλογενετικές σχέσεις ανάμεσα στα βακτηριακά στελέχη και η συσχέτιση τους με το γενετικό υπόβαθρο του ξενιστή, η διερεύνηση φαινομένων οριζόντιας μεταφοράς γονιδίων καθώς και η συσχέτιση της παρουσίας του βακτηρίου με παθογόνους μικροοργανισμούς. Σκοπός της παρούσας διατριβής ήταν να συμβάλει στον εμπλουτισμό της γνώσης στα παραπάνω ερευνητικά πεδία. Πιο συγκεκριμένα: 60

71 ΕΙΣΑΓΩΓΗ α) Σε πρώτο επίπεδο (Κεφάλαιο 2) αναλύσαμε ένα μεγάλο αριθμό δειγμάτων (5339) από φυσικούς και εργαστηριακούς πληθυσμούς της μύγας τσε-τσε για την παρουσία του βακτηρίου Wolbachia μέσω της εξειδικευμένης PCR ενίσχυσης του γενετικού μάρτυρα 16S rrna. Παράλληλα, έγινε o μοριακός προσδιορισμός αντιπροσωπευτικών βακτηριακών στελεχών με τη χρήση του συστήματος MLST (Multi Locus Sequence Typing) και του γονιδίου wsp. Επίσης, αναλύθηκαν οι φυλογένειες των βακτηριακών στελεχών ανά γενετικό τόπο και η φυλογένεια των αντίστοιχων ατόμων του ξενιστή βάσει του μιτοχονδριακού γονιδίου COII. β) Στη συνέχεια μελετήθηκε η παρουσία φαινομένων οριζόντιας μεταφοράς βακτηριακών γονιδιακών τμημάτων στο γονιδίωμα της μύγας τσε-τσε, με διεύρυνση και περαιτέρω ανάλυση των αρχικών αποτελεσμάτων ενίσχυσης των 5 γονιδίων του MLST (gatb, coxa, hcpa, ftsz και fbpa), του γονιδίου wsp και του γονιδίου 16S rrna (Κεφάλαιο 3). γ) Στο Κεφάλαιο 4 παρουσιάζεται η μελέτη συσχέτισης της παρουσίας του βακτηρίου Wolbachia και του ιού SGHV (Salivary Gland Hypertrophy Virus-Ιός της Υπερτροφίας του Σιελογόνου Αδένα) σε μεγάλο αριθμό φυσικών πληθυσμών της μύγας τσε-τσε. δ) Στο Κεφάλαιο 5 εξετάσαμε φυσικούς πληθυσμούς αφίδων για την παρουσία του βακτηρίου Wolbachia με τη χρήση των γενετικών μαρτύρων 16S rrna, wsp, gatb, coxa, hcpa, ftsz και fbpα, στηριζόμενοι σε συμβατικές και μη μεθόδους PCR. ε) Το Κεφάλαιο 6 περιλαμβάνει τη μελέτη φυσικών πληθυσμών εντόμων της οικογένειας Tortricidae που προέρχονται από διάφορες περιοχές της Ελλάδας σχετικά με την παρουσία του βακτηρίου Wolbachia. Αρχικά πραγματοποιήθηκε η ανίχνευση του βακτηρίου και εν συνεχεία, ο χαρακτηρισμός ορισμένων στελεχών του, αντιπροσωπευτικών ως προς το είδος του ξενιστή, την περιοχή προέλευσης και το είδος του ενδιαιτήματος. στ) Στο έβδομο και τελευταίο κεφάλαιο (Κεφάλαιο 7) συνοψίζονται και σχολιάζονται τα ευρήματα σχετικά με τον χαρακτηρισμό της ποικιλότητας του συμβιωτικού βακτηρίου Wolbachia και την κατανόηση των πολύπλοκων αλληλεπιδράσεων του με τη μύγα τσε-τσε, τις αφίδες και τα λεπιδόπτερα της οικογένειας Tortricidae. Επίσης, προτείνονται μελλοντικές ερευνητικές μελέτες για την αξιοποίηση των αποτελεσμάτων της παρούσας διατριβής. 61

72 ΕΙΣΑΓΩΓΗ 1.4 ΒΙΒΛΙΟΓΡΑΦΙΑ Adachi-Hagimori T, Miura K, Stouthamer R (2008) A new cytogenetic mechanism for bacterial endosymbiontinduced parthenogenesis in Hymenoptera. Proc R Soc Lond B Biol Sci 275: Aguin-Pombo D, Arraiol A, Franquinho AM, Freitas E, Angeli G (2008) Large infestation of chestnut by Cydia moths in Madeira Island: monitorization of Cydia splendana populations with pheromone lures. Act Hort. 784: Aikawa T, Anbutsu H, Nikoh N, Kikuchi T, Shibata F, Fukatsu T (2009) Longicorn beetle that vectors pinewood nematode carries many Wolbachia genes on an autosome. Proc Biol Sci 276 (1674): Akman L, Yamashita A, Watanabe H, Oshima K, Shiba T, Hattori M, Aksoy S (2002) Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia. Nature Genetics 32: Aksoy S (2000) Tsetse - a haven for microorganisms. Parasitol Today 16: Albertson R, Casper-Lindley C, Cao J, Tram U, Sullivan W (2009) Symmetric and asymmetric mitotic segregation patterns influence Wolbachia distribution in host somatic tissue. Journal of Cell Science 122, Albertson R, Tan V, Leads RR, Reyes M, Sullivan W, Casper-Lindley C (2013) Mapping Wolbachia distributions in the adult Drosophila brain. Cellular Microbiology 15(9), Almeida Fd, Moura AS, Cardoso AF, Winter CE, Bijovsky AT, Suesdek L (2011) Effects of Wolbachia on fitness of Culex quinquefasciatus (Diptera; Culicidae). Infect. Genet. Evol. 11: Andreadis TG, Hall DW (1979). Significance of transovarial infections of Amblyospora sp. (Microspora: Thelohaniidae) in relation to parasite maintenance in the mosquito Culex salinarius. Journal of Invertebrate Pathology 34 (2): Andreadis T (1985). Experimental transmission of a microsporidian pathogen from mosquitoes to an alternate copepod host. PNAS 82 (16): Andrews ES, Crain PR, Fu Y, Howe DK, Dobson SL (2012) Reactive oxygen species production and Brugia pahangi survivorship in Aedes polynesiensis with artificial Wolbachia infection types. PLoS Pathog 8: e Angeli G, Antonaroli R, Nanni C, Rama F (1997) Prime esperienze di contenimento delle due tortrici del castagno Cydia fagiglandana e C. splendana con la tecnica della confusione sessuale. Inform. Fitopatologico. 1/1997: Apostolaki Α, Livadaras I, Saridaki A, Chrysargyris A, Savakis C, Bourtzis K (2011) Transinfection of the olive fruit fly Bactrocera oleae with Wolbachia: towards a symbiont-based population control strategy. Journal of Applied Entomology 135: Arakaki N, Oishi T, Noda H (2001a) Parthenogenesis induced by Wolbachia in Gronotoma micromorpha(hymenoptera: Eucoilidae). Entomological Science 4:9-15. Arakaki N, Miyoshi T, Noda H (2001b) Wolbachia-mediated parthenogenesis in the predatory thrips Fanklintothrips vespiformis (Thysanoptera : Insecta). Proc R Soc Lond B Biol Sci 268: Arnold ML, Hodges SA (1995) Are natural hybrids fit or unfit relative to their parents? Trends Ecol. Evol. 10, Atyame CM, Pasteur N, Dumas E, Tortosa P, Tantely ML, Pocquet N, Licciardi S, Bheecarry A, Zumbo B, Weill M, Duron O (2011b) Cytoplasmic Incompatibility as a Means of Controlling Culex pipiens quinquefasciatus Mosquito in the Islands of the South-Western Indian Ocean. PLoS Negl Trop Dis. 5, e1440. Augustinos AA, Santos-Garcia D, Dionyssopoulou E, Moreira M, Papapanagiotou A, Scarvelakis M, Doudoumis V, Ramos S, Aguiar AF, Borges PAV, Khadem M, Latorre A, Tsiamis G, Bourtzis K (2011) Detection and Characterization of Wolbachia Infections in Natural Populations of Aphids: Is the Hidden Diversity Fully Unraveled? PLoS ONE 6(12): e doi: /journal.pone Avtzis DN (2012) The distribution of Pammene fasciana L. (Lepidoptera: Tortricidae) in Greece: an underestimated chestnut-feeding pestinternational Journal of Pest Management Vol. 58, No. 2, April June 2012, Avtzis DN, Perlerou C, Diamandis S (2013) Geographic distribution of chestnut feeding insects in GreeceJ Pest Sci DOI /s Baggiolini M (1967) Tordeuse des chataignes, Pammene juliana Curt. In R. Bovey (ed.) La Defence des Plantes Cultivees. Ed. Payot, Lausanne, pp Baldo L, Lo N, Werren JH (2005) Mosaic nature of the Wolbachia surface protein. Journal of Bacteriology 187:

73 ΕΙΣΑΓΩΓΗ Baldo L, Hotopp JCD, Jolley KA, Bordenstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MCJ, Tettelin H, Werren JH (2006a) Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Applied and Environmental Microbiology 72: Baldo L, Bordenstein S, Wernegreen JJ, Werren JH (2006b) Widespread recombination throughout Wolbachia genomes. Molecular Biology and Evolution 23: Baldo L, Werren JH (2007) Revisiting Wolbachia supergroup typing based on WSP: Spurious lineages and discordance with MLST. Current Microbiology 55: Baldo L, Prendini L, Corthals A, Werren JH (2007) Wolbachia are present in Southern African scorpions and cluster with supergroup F. Current Microbiology 55: Baldo L, Ayoub NA, Hayashi CY, Russell JA, Stahlhut JK, Werren JH (2008) Insight into the routes of Wolbachia invasion: high levels of horizontal transfer in the spider genus Agelenopsis revealed by Wolbachia strain and mitochondrial DNA diversity. Molecular Ecology 17: Balmand S, Lohs C, Aksoy S, Heddi A (2013) Tissue distribution and transmission routes for the tsetse fly endosymbionts. Journal of Invertebrate Pathology 112 (2013) S116 S122. Baltanás A, Zabal-Aguirre M, Pita M, López-Fernández C (2007) Wolbachia identified in a new crustacean host: an explanation of the prevalence of asexual reproduction in non-marine ostracods? Fundam. Appl. Limnol. 169, Bandi C, Anderson TJ, Genchi C, Blaxter ML (1998a) Phylogeny of Wolbachia in filarial nematodes. Proc Biol Sci 265: Bandi C, McCall JW, Genchi C, Corona S, Venco L, Sacchi L (1998b) Effects of tetracycline on the filarial worms Brugia pahangi and Dirofilaria immitis and their bacterial endosymbionts Wolbachia. International Journal of Parasitology 29: Bandi C, Dunn AM, Hurst GDD, Rigaud T (2001) Inherited microorganisms, sex-specific virulence and reproductive parasitism. Trends in Parasitology 17: Baudry E, Bartos J, Emerson K, Whitworth T, Werren JH (2003) Wolbachia and genetic variability in the birdnest blowfly Protocalliphora sialia. Molecular Ecology 12: Baumann P, Baumann L, Lai CY, Rouhbakhsh D, Moran NA, Clark MA (1995) Genetics, physiology, and evolutionary relationships of the genus Buchnera: intracellular symbionts of aphids. Annu Rev Microbiol 49: Baumann P (2005) Biology of bacteriocyte-associated endosymbionts of plant sap sucking insects. Annual Review of Microbiology 59: Beard CB, O'Neill SL, Tesh RB, Richards FF, Aksoy S (1993b) Modification of arthropod vector competence via symbiotic bacteria. Parasitol Today 9: Bian G, Xu Y, Lu P, Xie Y, Xi Z (2010) The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti. PLoS Pathog 6:e Bian G, Joshi D, Dong Y, Lu P, Zhou G, Pan X, Xu Y, Dimopoulos G, Xi Z (2013a) Wolbachia invades Anopheles stephensi populations and induces refractoriness to Plasmodium infection. Science May 10;340(6133): doi: /science Bian G, Zhou G, Lu P, Xi Z (2013b) Replacing a Native Wolbachia with a Novel Strain Results in an Increase in Endosymbiont Load and Resistance to Dengue Virus in a Mosquito Vector. PLoS Negl Trop Dis 7(6): e2250. doi: /journal.pntd Blackman RL, Eastop VF (2000) Aphids on the world s crops: an identification and information guide. Chichester, West Sussex, England; New York: Wiley. Blagrove MS, Arias-Goeta C, Failloux AB, Sinkins SP (2012) Wolbachia strain wmel induces cytoplasmic incompatibility and blocks dengue transmission in Aedes albopictus. Proc. Natl. Acad. Sci. U.S.A. 109, Blanchard JL, Lynch M. (2000) Organellar genes why do they end up in the nucleus? TIG July 2000, volume 16, No. 7. Boller EF, Bush GL (1974) Evidence for genetic variation in populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera: Tephritidae) based on physiological parameters and hybridization experiments. Entomologia Experimentalis et Applicata 17: Bonomi A, Bassetti F, Gabrieli P, Beadell J, Falchetto M, Scolari F, Gomulski LM, Regazzini E, Ouma JO, Caccone A, Okedi LM, Attardo GM, Guglielmino CR, Aksoy S, Malacrida AR (2011) Polyandry is a common event in wild populations of the tsetse fly Glossina fuscipes fuscipes and may impact population reduction measures PLoS Negl. Trop. Dis., 5, p. e1190. Bordenstein S (2003) Symbiosis and the origin of species. In: Bourtzis K, Miller T (eds) Insect Symbiosis. CRC Press, Boca Raton, FL, pp Bordenstein S, Uy J, Werren JH (2003) Host Genotype Determines Cytoplasmic Incompatibility Type in the Haplodiploid Genus Nasonia. Genetics 164:

74 ΕΙΣΑΓΩΓΗ Bordenstein SR, Wernegreen JJ (2004) Bacteriophage flux in endosymbionts (Wolbachia): Infection frequency, lateral transfer, and recombination rates. Molecular Biology and Evolution 21: Bordenstein SR, Rosengaus RB (2005) Discovery of a novel Wolbachia supergroup in isoptera. Current Microbiology 51: Bordenstein SR, Paraskevopoulos C, Dunning Hotopp JC, Sapountzis P, Lo N, Bandi C, Tettelin H, Werren JH, Bourtzis K (2009) Parasitism and mutualism in Wolbachia: what the phylogenomic trees can and cannot say. Mol Biol Evol Jan;26(1): Bossan B, Koehncke Α, Hammerstein P (2011) A new model and method for understanding Wolbachia-induced cytoplasmic incompatibility. PLoS ONE 6, e Bouchon D, Rigaud T, Juchault P (1998) Evidence for widespread Wolbachia infection in isopod crustaceans: molecular identification and host feminization. Proc R Soc Lond B Biol Sci 265: Bouchon D, Cordaux R, Greve P (2008) Feminizing Wolbachia and the evolution of sex determination in isopods. In: Bourtzis K, Miller T (Eds) Insect Symbiosis, Volume 3. Taylor and Francis Group LLC, Boca Raton, FL, doi: / ch12. Bourtzis K, Nirgianaki A, Markakis G, Savakis C (1996) Wolbachia infection and cytoplasmic incompatibility in Drosophila species. Genetics 144: Bourtzis K, O'Neill SL (1998) Wolbachia infections and arthropod reproduction. Bioscience 48: Bourtzis K, Dobson SL, Braig HR, O'Neill SL (1998) Rescuing Wolbachia have been overlooked. Nature 391: Bourtzis K, Braig HR (1999) The many faces of Wolbachia. Pp in D. Raoult, and T. Hackstadt, ed. Rickettsiae and Rickettsial diseases at the turn of the third millelium. Elsevier, Amsterdam. Bourtzis K, Pettigrew MM, O Neill SL (2000) Wolbachia neither induces nor suppresses transcripts encoding antimicrobial peptides. Insect Mol. Biol. 9, Bourtzis K, Miller T (2003) Insect Symbiosis. CRC Press, Boca Raton, FL, pp Bourtzis K, Braig H, Karr T (2003) Cytoplasmic Incompatibility. In: Bourtzis K, Miller T (eds) Insect Symbiosis. CRC Press, Boca Raton, FL, pp Bourtzis K, Miller T (2006) Insect Symbiosis 2. CRC Press, Boca Raton, FL, pp Bourtzis K, Robinson A (2006) Insect pest control using Wolbachia and/or radiation. In: Bourtzis K, Miller T (eds) Insect Symbiosis 2. CRC Press, Boca Raton, FL, pp Bourtzis K (2008) Wolbachia-based technologies for insect pest population control. Adv Exp Med Biol 627: Bourtzis K, Miller T (2008) Insect Symbiosis 3. CRC press, Boca Raton, FL, pp Bouyer J, Seck MT, Sall B, Ndiaye EY, Guerrini L, Vreysen MJB (2010) Stratified entomological sampling in preparation for an area-wide integrated pest management program: the example of Glossina palpalis gambiensis (Diptera: Glossinidae) in the Niayes of Senegal J. Med. Entomol., 47, pp Bovey P (1966) Super-famille des Tortricoidea. In A.S. Balechowsky (ed.), pp Bradley JD, Tremewan WG, Smith A (1979) British Tortricoid moths. Tortricidae: Olethreutinae. The Ray Society, London. Branco M, Branco C, Merouani H, Almeida MH (2001) Germination success, survival and seedling vigour of Quercus suber acorns in relation to insect damage. Forest Ecol Manag 5716, 1-6. Brayton KA, Palmer GH, Lundgren A, Yi J, Barbet AF (2002) Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion. Molecular Microbiology 43: Brayton KA, Kappmeyer LS, Herndon DR, Dark MJ, Tibbals DL, Palmer GH, McGuire TC, Knowles Jr DP (2005) Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc Natl Acad Sci USA 102: Breeuwer JAJ, Werren JH (1990) Microorganisms associated with chromosome destruction and reproductive isolation between two insect species. Nature 346: Breeuwer JAJ, Stouthamer R, Barns SM, Pelletier DA, Weisburg WG, Werren JH (1992) Phylogeny of cytoplasmic incompatibility microorganisms in the parasitoid wasp genus Nasonia (Hymenoptera: Pteromalidae) based on 16S ribosomal DNA sequences. Insect Molecular Biology 1: Breeuwer JAJ, Werren JH (1993) Effect of genotype on cytoplasmic incompatibility between two species of Nasonia. Heredity 70: Breeuwer JAJ, Jacobs G (1996) Wolbachia: Intracellular manipulators of mite reproduction. Experimental & Applied Acarology 20: Brelsfoard CL, Dobson SL (2009) Wolbachia-based strategies to control insect pests and disease vectors. Asia Pac. J. Mol. Biol. Biotechnol. 17: Brelsfoard CL, Dobson SL (2011) Wolbachia effects on host fitness and the influence of male aging on cytoplasmic incompatibility in Aedes polynesiensis (Diptera: Culicidae). J. Med. Entomol. 48: Brelsfoard C, Tsiamis G, Falchetto M, Gomulski LM, Telleria E, Alam U, Doudoumis V, Scolari F, Swain M, Takac P, Malacrida A, Bourtzis K, Aksoy S (2013) Presence of extensive Wolbachia symbiont 64

75 ΕΙΣΑΓΩΓΗ insertions discovered in the genome of its host Glossina morsitans morsitans. Submitted to PLOS Neglected Tropical Diseases. Brennan LJ, Keddie BA, Braig HR, Harris HL (2008) The Endosymbiont Wolbachia pipientis Induces the Expression of Host Antioxidant Proteins in an Aedes albopictus Cell Line. PLoS ONE 3(5): e2083. Brower JH (1978) Suppression of laboratory populations of Ephestia cautella (Walker)(Lepidoptera: Pyralidae) by release of males with cytoplasmic incompatibility. Journal of Stored Products Research 15:1-4. Brownlie JC, Cass BN, Riegler M, Witsenburg JJ, Iturbe-Ormaetxe I, Elizabeth A. McGraw, O Neill SL (2009) Evidence for Metabolic Provisioning by a Common Invertebrate Endosymbiont, Wolbachia pipientis, during Periods of Nutritional Stress. PLoS Pathog 5(4). Brownstein JS, Hett E, O'Neill SL (2003) The potential of virulent Wolbachia to modulate disease transmission by insects. Journal of Invertebrate Pathology 84: Brucker RM, Bordenstein SR (2012) Speciation by symbiosis Trends in Ecology and Evolution, August 2012, Vol. 27, No. 8. Budd LT (1999) DFID-Funded Tsetse and Trypanosomosis Research and Development Since Department of International Development, United Kingdom. Burke JM, Arnold ML (2001) Genetics and the fitness of hybrids. Annu. Rev. Genet. 35, Bursell E (1961) The behaviour of tsetse flies (Glossina swynnerrtoni Austen) in relation to problems of sampling Proc. Roy. Entomol. Soc. Lond. A, 36, pp Bursell E, Taylor P (1980) An energy budget for Glossina (Diptera: Glossinidae) Bull. Entomol. Res., 70, pp Buxton PA (1955) The larva and puparium P.A. Buxton (Ed.), The Natural History of Tsetse Flies, London School of Hygiene and Tropical Medicine, London, pp Cadavid D, Thomas DD, Crawley R, Barbour AG (1994) Variability of a Bacterial Surface Protein and Disease Expression in a Possible Mouse Model of Systemic Lyme Borreliosis. Journal of Experimental Medicine 179: Callaini G, Riparbelli MG & Dallai R (1994) The Distribution of Cytoplasmic Bacteria in the Early Drosophila Embryo Is Mediated by Astral Microtubules. J Cell Sci 107: Callaini G, Riparbelli MG, Giordano R, & Dallai R (1996) Mitotic defects associated with cytoplasmic incompatibility in Drosophila simulans. J Invertebr Pathol 67: Callaini G, Dallai R, Riparbelli MG (1997) Wolbachia-induced delay of paternal chromatin condensation does not prevent maternal chromosomes from entering anaphase in incompatible crosses of Drosophila simulans. J Cell Sci 110 ( Pt 2): Caragata EP, Rance`s E, Hedges LM, Gofton AW, Johnson KN, O Neill SL, McGraw EA (2013) Dietary Cholesterol Modulates Pathogen Blocking by Wolbachia. PLoS Pathog 9(6): e doi: /journal.ppat Casiraghi M, Anderson TJC, Bandi C, Bazzocchi C, Genchi C (2001) A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitology 122: Casiraghi M, Bain O, Guerrero R, Martin C, Pocacqua C, Gardner SL, Franceschi A, Bandi C (2004) Mapping the presence of Wolbachia pipientis on the phylogeny of filarial nematodes: evidence for symbiont loss during evolution. Pp Pergamon-Elsevier Science Ltd. Casiraghi M, Bordenstein SR, Baldo L, Lo N, Beninati T, Wernegreen JJ, Werren JH, Bandi C (2005) Phylogeny of Wolbachia pipientis based on glta, groel and ftsz gene sequences: clustering of arthropod and nematode symbionts in the F supergroup, and evidence for further diversity in the Wolbachia tree. Microbiology-Sgm 151: Cattand P, Jannin J, Lucas P (2001) Sleeping sickness surveillance: an essential step towards eliminationtrop. Med. Int. Health, 6, pp Cerveau N, Leclercq S, Leroy E, Bouchon D, Cordaux R (2011) Short- and long-term evolutionary dynamics of bacterial insertion sequences: insights from Wolbachia endosymbionts. Genome Biol Evol. 3: Chafee ME, Zecher CN, Gourley ML, Schmidt VT, Chen JH, Bordenstein SR, Clark ME, Bordenstein SR (2011) Decoupling of host symbiont phage coadaptations following transfer between insect species. Genetics 187, Charlat S, Hurst GDD, Mercot H (2003) Evolutionary consequences of Wolbachia infections. Trends in Genetics 19: Charlat S, Reuter M, Dyson EA, Hornett EA, Duplouy A, Davies N, Roderick GK, Wedell N, Hurst GDD (2007) Male-killing bacteria trigger a cycle of increasing male fatigue and female promiscuity. Current Biology 17: Chen X, Li S, Aksoy S (1999) Concordant evolution of a symbiont with its host insect species: molecular phylogeny of genus Glossina and its bacteriome-associated endosymbiont, Wigglesworthia glossinidia. J Mol Evol. 48(1):

76 ΕΙΣΑΓΩΓΗ Chen WJ, Tsai KH, Cheng SL, Huang CG, Wu WJ (2005) Using In Situ Hybridization to Detect Endosymbiont Wolbachia in Dissected Tissues of Mosquito Host. Journal of Medical Entomology, 42(2): Cheng Q, Ruel TD, Zhou W, Moloo SK, Majiwa P, O'Neill SL, Aksoy S (2000) Tissue distribution and prevalence of Wolbachia infections in tsetse flies, Glossina spp. Med Vet Entomol. 14: Chiel E, Zchori-Fein E, Inbar M, Gottlieb Y, Adachi-Hagimori T, et al. (2009) Almost There: Transmission Routes of Bacterial Symbionts between Trophic Levels. PLoS ONE 4(3): e4767. doi: /journal.pone Chigira A, Miura K (2005) Detection of Candidatus Cardinium bacteria from the haploid host Brevipalpus californicus (Acari: Tenuipalpidae) and effect on the host. Exp. Appl. Acarol. 37: Clark MA, Baumann L, Thao ML, Moran NA, Baumann P (2001) Degenerative minimalism in the genome of a psyllid endosymbiont. J Bacteriol, 183: Clark ME, Anderson CL, Cande J, Karr TL (2005) Widespread Prevalence of Wolbachia in Laboratory Stocks and the Implications for Drosophila Research. Genetics 170: Colvin J, Gibson G (1992) Host-seeking behavior and management of tsetse Annu. Rev. Entomol., 37, pp Cordaux R, Michel-Salzat A, Bouchon D (2001) Wolbachia infection in crustaceans: novel hosts and potential routes for horizontal transmission. Journal of Evolutionary Biology 14: Cordaux R, Pichon S, Ling A, Perez P, Delaunay C, Vavre F, Bouchon D, Greve P (2008) Intense transpositional activity of insertion sequences in an ancient obligate endosymbiont. Molecular Biology and Evolution 25: Cordaux R, Bouchon D, Greve P (2011) The impact of endosymbionts on the evolution of host sex-determination mechanisms. Trends Genet 27: doi: /j.tig Cordaux R, Pichon S, Hatira HBA, Doublet V, Grève P, Marcadé I, Braquart-Varnier C, Souty-Grosset C, Charfi-Cheikhrouha F, Bouchon D (2012) Widespread Wolbachia infection in terrestrial isopods and other crustaceans. In: Štrus J, Taiti S, Sfenthourakis S (Eds) Advances in Terrestrial Isopod Biology. ZooKeys 176: doi: / zookeys Covacin C, Barker SC (2007) Supergroup F Wolbachia bacteria parasitise lice (Insecta : Phthiraptera). Parasitology Research 100: Curtis CF, Hill N, Kasim SH (1993) Are There Effective Resistance Management Strategies for Vectors of Human-Disease. Biological Journal of the Linnean Society 48:3-18. Czarnetzki AB, Tebbe CC (2004) Detection and phylogenetic analysis of Wolbachia in Collembola. Environmental Microbiology 6: Dale C, Moran NA (2006) Molecular interactions between bacterial symbionts and their hosts. Cell 126: Darby AC, Armstrong SD, Bah GS, Kaur G, Hughes MA, Kay SM, Koldkjær P, Rainbow L, Radford AD, Blaxter ML, Tanya VN, Trees AJ, Cordaux R, Wastling JM, Makepeace BL (2012) Analysis of gene expression from the Wolbachia genome of a filarial nematode supports both metabolic and defensive roles within the symbiosis. Genome Res. 22: De Bary A (1879) Die Erscheinung der Symbiose. Verlag von Karl J. Trubner, Strassburg. De Souza DJ, Bezier A, Depoix D, Drezen JM & Lenoir A (2009) Blochmannia endosymbionts improve colony growth and immune defence in the ant Camponotus fellah. BMC Microbiol. 9,29.doi: / Degnan PH, Lazarus AB, Wernegreen JJ (2005) Genome sequence of Blochmannia pennsylvanicus indicates parallel evolutionary trends among bacterial mutualists of insects. Genome Research 15: Den Otter CJ, De Christofaro A, Voskamp KE, Rotundo G (1996) Electrophysiological and behavioural responses of chestnut moths, Cydia fagiglandana and C. Splendana (Lep., Tortricidae) to sex attractants and odours of host plants. J Appl Entomol. 120: Desjardins CA, Cerqueira GC, Goldberg JM, Dunning Hotopp JC, Haas BJ, Zucker J, Ribeiro JMC, Saif S, Levin JZ, Fan L, Zeng Q, Russ C, Wortman JR, Fink DL, Birren BW, Nutman TB (2013) Genomics of Loa loa, a Wolbachia-free filarial parasite of humans. Nature Genetics, vol.45 (5), Dixon AFG (1998) Aphid ecology An optimization approach, Second Edition. London: Chapman and Hall. 312 p. Dobson SL, Bourtzis K, Braig HR, Jones BF, Zhou WG, Rousset F, O'Neill SL (1999) Wolbachia infections are distributed throughout insect somatic and germ line tissues. Insect Biochemistry and Molecular Biology 29: Dobson SL, Marsland EJ, Veneti Z, Bourtzis K, O'Neill SL (2002a) Characterization of Wolbachia host cell range via the in vitro establishment of infections. Appl Environ Microbiol 68: Dobson SL, Fox CW, Jiggins FM (2002b) The effect of Wolbachia-induced cytoplasmic incompatibility on host population size in natural and manipulated systems. Proc Biol Sci. 269: Dobson SL (2003) Reversing Wolbachia-based population replacement. Trends Parasitol. 19 : Dobzhansky T (1937) Genetics and the origin of species. pp New York: Columbia University Press. Dobzhansky T (1970) Genetics of the Evolutionary Process. New York: Columbia University Press. 66

77 ΕΙΣΑΓΩΓΗ Doudoumis V, Alam U, Aksoy E, Abd-Alla A, Tsiamis G, Brelsfoard C, Aksoy S, Bourtzis K (2013) Tsetse- Wolbachia Symbiosis: comes of age and has great potential for pest and disease control. J. Invertebr. Pathol. Volume 112, Supplement 1, March 2013, Pages S94 S103. Dumler JS, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, Rikihisa Y,Rurangirwa FR (2001) Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 51: Dunbar HE, Wilson ACC, Ferguson NR, Moran NA (2007) Aphid thermal tolerance is governed by a point mutation in bacterial symbionts. PLoS Biology 5: Dunn AK, Stabb EV (2005) Culture-independent characterization of the microbiota of the ant lion Myrmeleon mobilis (Neuroptera: Myrmeleontidae). Appl Environ Microbiol 71: Dunning Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, et al. (2006) Comparative genomics of emerging human ehrlichiosis agents. PLoS Genet 2(2): e21. Dunning Hotopp JC, Clark ME, Oliveira DC, Foster JM, Fischer P, Munoz Torres MC, Giebel JD, Kumar N, Ishmael N, Wang S, et al (2007) Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes. Science 317(5845): Dunning Hotopp JC (2011) Horizontal gene transfer between bacteria and animals Trends in Genetics, vol. 27, No. 4, Duplouy A, Iturbe-Ormaetxe I, Beatson SA, Szubert JM, Brownlie JC, McMeniman CJ, McGraw EA, Hurst GDD, Charlat S, O Neill SL, Woolfit M (2013) Draft genome sequence of the malekilling Wolbachia strain wbol1 reveals recent horizontal gene transfers from diverse sources. BMC Genomics :20. Duron O, Lagnel J, Raymond M, Bourtzis K, Fort P, Weill M (2005) Transposable element polymorphism of Wolbachia in the mosquito Culex pipiens: evidence of genetic diversity, superinfection and recombination. Molecular Ecology 14: Dyall SD, Brown MT, Johnson PJ (2004) Ancient Invasions: From Endosymbionts to Organelles. Science vol.304, Dyer KA, Jaenike J (2004) Evolutionarily stable infection by a male-killing endosymbiont in Drosophila innubila: Molecular evidence from the host and parasite genomes. Genetics 168: Dyson EA, Kamath MK, Hurst GDD (2002) Wolbachia infection associated with all-female broods in Hypolimnas bolina (Lepidoptera : Nymphalidae): evidence for horizontal transmission of a butterfly male killer. Heredity 88: Eleftherianos I, Atri J, Accetta J, Castillo JC (2013) Endosymbiotic bacteria in insects: guardians of the immune system? Front. Physiol. 4:46. doi: /fphys Ellegaard KM, Klasson L, Näslund K, Bourtzis K, Andersson SGE (2013) Comparative Genomics of Wolbachia and the Bacterial Species Concept. PLoS Genet 9(4): e doi: /journal.pgen Fast EM, Toomey ME, Panaram K, Desjardins D, Kolaczyk ED, Frydman HM (2011) Wolbachia Enhance Drosophila Stem Cell Proliferation and Target the Germline Stem Cell Niche. Science 18 November 2011: Vol. 334 no pp DOI: /science Favret C, Voegtlin DJ (2004) Speciation by host-switching in pinyon Cinara (Insecta: Hemiptera: Aphididae). Mol. Phylogenet. Evol. 32, Fenn K, Conlon C, Jones M, Quail MA, Holroyd NE, Parkhill J, Blaxter M (2006) Phylogenetic relationships of the Wolbachia of nematodes and arthropods. PLoS Pathog, 2(10):e94. Ferrari J, Vavre F (2011) Bacterial symbionts in insects or the story of communities affecting communities. Phil. Trans. R. Soc. B 366: doi: /rstb Ferree PM, Frydman HM, Li JM, Cao J, Wieschaus E & Sullivan W (2005) Wolbachia utilizes host microtubules and Dynein for anterior localization in the Drosophila oocyte. PLoS Pathog 1, e14. Ferree PM, Sullivan W (2006) A genetic test of the role of the maternal pronucleus in Wolbachia-induced cytoplasmic incompatibility in Drosophila melanogaster. Genetics 173: Ferree PM, Avery A, Azpurua J, Wilkes T, Werren JH (2008) A bacterium targets maternally inherited centrosomes to kill males in Nasonia. Curr. Biol. 18: Ferri E, Bain O, Barbuto M, Martin C, Lo N, Uni S, Landmann F, Baccei SG, Guerrero R, de Souza Lima S, Bandi C, Wanji S, Diagne M, Casiraghi M (2011) New insights into the evolution of Wolbachia infections in filarial nematodes inferred from a large range of screened species. PLoS One. 2011;6(6):e Fialho RF, Stevens L (2000) Male-killing Wolbachia in a flour beetle. Proc R Soc Lond B Biol Sci 267:

78 ΕΙΣΑΓΩΓΗ Ford J (1970) The practical application of sterile male control techniques. In: Fraga de Azevedo, J. (Ed.), 1st International Symposium on Tsetse Fly Breeding Under Laboratory Conditions and Its Practical Application, , Lisboa, Junta de Investigações do Ultramar, Ministério do Ultramar, Foster J, Ganatra M, Kamal I, Ware J, Makarova K, Ivanova N, Bhattacharyya A, Kapatral V, Kumar S, Posfai J, Vincze T, Ingram J, Moran L, Lapidus A, Omelchenko M, Kyrpides N, Ghedin E, Wang S, Goltsman E, Joukov V, Ostrovskaya O, Tsukerman K, Mazur M, Comb D, Koonin E, Slatko B (2005) The Wolbachia genome of Brugia malayi: Endosymbiont evolution within a human pathogenic nematode. PLoS Biology 3: Frank, A. C., H. Amiri, and S. G. E. Andersson Genome deterioration: loss of repeated sequences and accumulation of junk DNA. Genetica 115:1-12. Frentiu FD, Robinson J, Young PR, McGraw EA, O Neill SL (2010) Wolbachia-mediated resistance to dengue virus infection and death at the cellular level. PLoS ONE 5:e13398.doi: / journal.pone Frydman HM, Li JM, Robson DN, Wieschaus E (2006) Somatic stem cell niche tropism in Wolbachia. Nature 2006, 441: Fujii Y, Kageyama D, Hoshizaki S, Ishikawa H, Sasaki T (2001) Transfection of Wolbachia in Lepidoptera: the feminizer of the adzuki bean borer Ostrinia scapulalis causes male killing in the Mediterranean flour moth Ephestia kuehniella. Proc R Soc Lond B Biol Sci 268: Fytrou A, Schofield PG, Kraaijeveld AR, Hubbard SF (2006) Wolbachia infection suppresses both host defence and parasitoid counter-defence. Proc. Biol. Sci. 273, Gelbart ME, Kuroda MI (2009) Drosophila dosage compensation: a complex voyage to the X chromosome. Development 136: Ghelelovitch S (1952) Sur le determinisme ge ne tique de la ste rilite dans les croisements entre diffe rentes souches de Culex autogenicus Roubaud. Compt. Rend. Acad. Sci. Paris 234: Gherna RL, Werren JH, Weisburg WG et al. (1991) Arsenophonus nasoniae gen. nov., sp. nov., the causative agent of the son-killer trait in the parasitic wasp Nasonia vitripennis. International Journal of Systematic and Evolutionary Microbiology 41: Gibbs CP, Reimann BY, Schultz E, Kaufmann A, Haas R, Meyer TF (1989) Reassortment of Pilin Genes in Neisseria-Gonorrhoeae Occurs by 2 Distinct Mechanisms. Nature 338: Gilligan TM, Epstein ME (2012) Tortricids of Agricultural Importance by Todd M. and Marc E. Interactive Keys developed in Lucid 3.4. Last updated April Giorgini M (2001) Induction of males in thelytokous populations of Encarsia meritoria and Encarsia protransvena: A systematic tool. BioControl 46: Giorgini M, Monti MM, Caprio E, Stouthamer R, Hunter MS (2009) Feminization and the collapse of haplodiploidy in an asexual parasitoid wasp harboring the bacterial symbiont Cardinium. Heredity 102: Giorgini M, Bernardo U, Monti MM, Nappo AG, Gebiola M (2010) Rickettsia symbionts cause parthenogenetic reproduction in the parasitoid wasp Pnigalio soemius (Hymenoptera: Eulophidae). Appl. Environ. Microbiol. 76: Girousse C, Moulia B, Silk W, Bonnemain JL (2005) Aphid infestation causes different changes in carbon and nitrogen allocation in alfalfa stems as well as different inhibitions of longitudinal and radial expansion. Plant Physiol. 137, doi: /pp Glaser RL, Meola MA (2010) The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS One. 5, e Glasgow JP (1970) The Glossina community. In: Mulligan H.W. (Ed.) The African Trypanosomiasis, pp Godel C, Kumar S, Koutsovoulos G, Ludin P, Nilsson D, Comandatore F, Wrobel N, Thompson M, Schmid CD, Goto S, Bringaud F, Wolstenholme A, Bandi C, Epe C, Kaminsky R, Blaxter M, Mäser P (2012) The genome of the heartworm, Dirofilaria immitis, reveals drug and vaccine targets. FASEB J. 26(11): doi: /fj Epub 2012 Aug 13. Gorham CH, Fang QQ, Durden LA (2003) Wolbachia endosymbionts in fleas (Siphonaptera). Journal of Parasitology 89: Gotoh T, Noda H, Hong XY (2003) Wolbachia distribution and cytoplasmic incompatibility based on a survey of 42 spider mite species (Acari : Tetranychidae) in Japan. Heredity 91: Gotoh T, Noda H, Ito S (2007) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98: Graham RI, Grzywacz D, Mushobozi WL, Wilson K (2012) Wolbachia in a major African crop pest increases susceptibility to viral disease rather than protects. Ecol. Lett. 15, Grandjean F, Rigaud T, Raimond R, Juchault P, Soutygrosset C (1993) Mitochondrial-DNA polymorphism and feminizing sex factors dynamics in a natural population of Armadillidium vulgare (Crustacea, Isopoda). Genetica 92:

79 ΕΙΣΑΓΩΓΗ Gray MW, Doolittle WF (1982) Has the Endosymbiont Hypothesis Been Proven. Microbiological Reviews 46:1-42. Gronke S, Clarke D-F, Broughton S, Andrews TD, Partridge L (2010) Molecular Evolution and Functional Characterization of Drosophila Insulin-Like Peptides. PLoS Genet 6(2): e Groot TVM, Breeuwer JAJ (2006) Cardinium symbionts induce haploid thelytoky in most clones of three closely related Brevipalpus species. Exp. Appl. Acarol. 39: Gueguen G, Onemola B, Govind S (2012) Association of a new Wolbachia strain with, and its effects on, Leptopilina victoriae, a virulent wasp parasitic to Drosophila spp. Appl.Environ. Microbiol. 78, Gutiérrez S, Michalakis Y, Van Munster M, Blanc S (2013) Plant feeding by insect vectors can affect life cycle, population genetics and evolution of plant viruses. Funct. Ecol. doi: / Haake DA, Suchard MA, Kelley MM, Dundoo M, Alt DP, Zuerner RL (2004) Molecular evolution and mosaicism of leptospiral outer membrane proteins involves horizontal DNA transfer. Journal of Bacteriology 186: Haegeman A, Vanholme B, Jacob J, Vandekerckhove TTM, Claeys M, Borgonie G, Gheysen G (2009) An endosymbiotic bacterium in a plant-parasitic nematode: Member of a new Wolbachia supergroup. International Journal for Parasitology 39: Haeselbarth E, Segerman J, Zumpt F (1966) The Arthropod Parasites of Vertebrates in Africa South of the Sahara (Ethiopian region) (Insecta excl. Phthiraptera), vol. III. Publications of the South African Institute of Medical Research, Johannesburg, pp Hagan HR (1951) Embryology of the Viviparous Insects Ronald Press Company, New York, pp Hagimori T, Abe Y, Date S, Miura K (2006) The first finding of a Rickettsia bacterium associated with parthenogenesis induction among insects. Current Microbiology 52: Harris LR, Kelly SE, Hunter MS, Perlman SJ (2010) Population dynamics and rapid spread of Cardinium, a bacterial endosymbiont causing cytoplasmic incompatibility in Encarsia pergandiella (Hymenoptera: Aphelinidae). Heredity (Edinb) 104(3): doi: /hdy Hedges LM, Brownlie JC, O'Neill SL, Johnson KN (2008) Wolbachia and virus protection in insects. Science. 322, 702. Hertig M, Wolbach S (1924) Studies on rickettsia-like microorganisms in insects. Journal of Medical Research 44: Hertig M (1936) The Rickettsia, Wolbachia pipientis(gen. et sp. n.) and associated inclusions of the mosquito, Culex pipiens. Parasitology 28: Hetru C, Hoffmann JA (2009) NF-kappaB in the immune response of Drosophila. ColdSpringHarb. Perspect. Biol. 1:a doi: /cshperspect.a Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A, Werren JH (2008) How many species are infected with Wolbachia?--A statistical analysis of current data. FEMS Microbiol Lett 281: Hille Ris Lambers D (1966) Polymorphism in Aphididae. Annu Rev Entomol 11: Hiroki M, Kato Y, Kamito T, Miura K (2002) Feminization of genetic males by a symbiotic bacterium in a butterfly, Eurema hecabe (Lepidoptera : Pieridae). Naturwissenschaften 89: Hoffmann AA, Hercus M, Dagher H (1998) Population dynamics of the Wolbachia infection causing cytoplasmic incompatibility in Drosophila melanogaster. Genetics 148: Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, Greenfield M, Durkan M, Leong YS, Dong Y, Cook H, Axford J, Callahan AG, Kenny N, Omodei C, McGraw EA, Ryan PA, Ritchie SA, Turelli M, O'Neill SL (2011) Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature 476: Holmes EC, Urwin R, Maiden MCJ (1999) The influence of recombination on the population structure and evolution of the human pathogen Neisseria meningitidis. Molecular Biology and Evolution 16: Hosokawa T, Koga R, Kikuchi Y, Meng XY, Fukatsu T (2010) Wolbachia as a bacteriocyte-associated nutritional mutualist. PNAS 107(2): Hughes GL, Ren X, Ramirez JL, Sakamoto JM, Bailey JA, Jedlicka AE, Rasgon JL (2011a) Wolbachia infections in Anopheles gambiae cells: transcriptomic characterization of a novel host-symbiont interaction. PLoS Pathog. 7, e Hughes GL,Vega-Rodriguez J, Xue P, Rasgon JL (2012) Wolbachia strain walbb enhances infection by the rodent malaria parasite Plasmodium berghei in Anopheles gambiae mosquitoes. Appl. Environ. Microbiol. 78, Huigens ME, Stouthamer R (2003) Parthenogenesis associated with Wolbachia. In Insect Symbiosis (Bourtzis, K. and Miller, T., eds), pp , CRC Press. Hunter MS, Perlman SJ, Kelly SE (2003) A bacterial symbiont in the Bacteroidetes induces cytoplasmic incompatibility in the parasitoid wasp Encarsia pergandiella. Proc R Soc Lond B Biol Sci 270(1529):

80 ΕΙΣΑΓΩΓΗ Hursey BS, Slingenbergh J (1995) The tsetse fly and its effects on agriculture in sub-saharan Africa World Anim. Rev., 84 (85), pp Hurst LD (1991) The Incidences and Evolution of Cytoplasmic Male Killers. Proc R Soc Lond B Biol Sci. 244: Hurst GDD, Hammarton TC, Bandi C, Majerus TMO, Bertrand D, Majerus, MEN (1997a). The diversity of inherited parasites of insects: the male-killing agent of the ladybird beetle Coleomegilla maculata is a member of the Flavobacteria. Genetical Research Cambridge 70(1):1-6. Hurst GDD, Hurst LD, Majerus ME (1997b) Cytoplasmic sex-ratio distorters. In Influential passengers, pp Edited by S. L. O'Neill, A.A. Hoffmann and J.H. Werren. Oxford: Oxford University Press. Hurst GDD, Schilthuizen M (1998) Selfish genetic elements and speciation. Heredity 80:2-8. Hurst GDD, Jiggins FM, von der Schulenburg JHG, Bertrand D, West SA, Goriacheva II, Zakharov IA, Werren JH, Stouthamer R, Majerus MEN (1999a) Male-killing Wolbachia in two species of insect. Proc Biol Sci. 266(1420): Hurst GD, Bandi C, Sacchi L, Cochrane AG, Bertrand D, Karaca I, Majerus ME (1999b) Adonia variegata (Coleoptera: Coccinellidae) bears maternally inherited flavobacteria that kill males only. Parasitology 118: Hurst GDD, Johnson AP, von der Schulenburg JHG, Fuyama Y (2000) Male-killing Wolbachia in Drosophila: A temperature-sensitive trait with a threshold bacterial density. Genetics 156: Hurst GDD, Werren JH (2001) The role of selfish genetic elements in eukaryotic evolution. Nature Reviews Genetics 2: Hussain M, Frentiu FD, Moreira LA, O Neill SL, Asgari S (2011) Wolbachia uses host micrornas to manipulate host gene expression and facilitate colonization of the dengue vector Aedes aegypti. PNAS 108 (22) Hussain M, Lu G, Torres S, Edmonds JH, Kay BH, Khromykh AA, Asgari S (2013) Effect of Wolbachia on replication of West Nile virus in a mosquito cell line and adult mosquitoes. J Virol. 87(2): doi: /JVI Epub 2012 Oct 31. Ijichi N, Kondo N, Matsumoto R, Shimada M, Ishikawa H, Fukatsu T (2002). Internal spatiotemporal population dynamics of infection with three Wolbachia strains in the adzuki bean beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). Appl. Environ. Microbiol. Ikeya T, Broughton S, Alic N, Grandison R, Partridge L (2009) The endosymbiont Wolbachia increases insulin/igf-like signalling in Drosophila Proc. R. Soc. B , doi: /rspb Ioannidis P, Bourtzis K (2007) Insect symbionts and applications: The paradigm of cytoplasmic incompatibilityinducing Wolbachia. Entomological Research 36: Ioannidis P, Hotopp JCD, Sapountzis P, Siozios S, Tsiamis G, Bordenstein SR, Baldo L, Werren JH, Bourtzis K (2007) New criteria for selecting the origin of DNA replication in Wolbachia and closely related bacteria. BMC Genomics 8. Ioannidis P, Johnston KL, Riley DR, Kumar N, White JR, Olarte KT, Ott S, Tallon LJ, Foster JM, Taylor MJ, Dunning Hotopp JC (2013) Extensively duplicated and transcriptionally active recent lateral gene transfer from a bacterial Wolbachia endosymbiont to its host filarial nematode Brugia malayi. BMC Genomics :639. Ishikawa H (2003) Insect Symbiosis: An introduction. Pp in M. T. Bourtzis K, ed. Insect Symbiosis. CRC Press, Boca Raton, FL. Iturbe-Ormaetxe Ι, Walker Τ, O Neill SL (2011) Wolbachia and the biological control of mosquito-borne disease. EMBO reports (2011) 12, doi: /embor Jaenike J, Dyer KA, Cornish C, Minhas MS (2006) Asymmetrical reinforcement and Wolbachia infection in Drosophila. PLoS Biology 4: Jaenike J (2007b) Spontaneous emergence of a new wolbachia phenotype. Evolution 61: Jeong G, Stouthamer R (2005) Genetics of female functional virginity in the Parthenogenesis-Wolbachia infected parasitoid wasp Telenomus nawai (Hymenoptera : Scelionidae). Heredity 94: Jeyaprakash A, Hoy MA (2000) Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol Biol. 9: Jiggins FM, Hurst GDD, Schulenburg J, Majerus MEN (2001a) Two male-killing Wolbachia strains coexist within a population of the butterfly Acraea encedon. Heredity 86: Jiggins FM, von der Schulenburg JHG, Hurst GDD, Majerus MEN (2001b) Recombination confounds interpretations of Wolbachia evolution. Proc R Soc Lond B Biol Sci 268: Jiggins FM (2002) The rate of recombination in Wolbachia bacteria. Molecular Biology and Evolution 19: Jimenez A (2003) Bioecología y control de los principales insectos carpófagos de la encina. Tesis doctoral. Universidad de Sevilla, Spain. 282 pp. 70

81 ΕΙΣΑΓΩΓΗ Jimenez-Pino A, Maistrello L, Lopez-Martinez MA, Ocete-Rubio ME, Soria-Iglesias FJ (2011) Spatial distribution of Cydia fagiglandana (Zeller) in an exploited holm oak (Quercus ilex L.) forest. Spanish Journal of Agricultural Research 9(2), Jordan AM (1972) The insemination potential of male Glossina austeni Newstead and Glossina morsitans morsitans Westw. (Dipt.: Glossinidae) Bull. Entomol. Res., 62, pp Jordan AM (1986) Trypanosomiasis Control and African Rural Development Longman, London. Juchault P, LeGrand JJ (1985) Contribution a l'etude du mechanisme de l'etat refractaire a l'hormone androgene chez le Armadillidium vulgare herbergeant une bacterie feminisante. Gen Comp Endocrinol 62: Juchault P, Rigaud T, Mocquard JP (1992) Evolution of Sex-Determining Mechanisms in a Wild Population of Armadillidium-Vulgare Latr (Crustacea, Isopoda) - Competition between 2 Feminizing Parasitic Sex Factors. Heredity 69: Juchault P, Frelon M, Bouchon D, Rigaud T (1994) New evidence for feminizing bacteria in terrestrial Isopods - Evolutionary Implications. Comptes Rendus Acad Sci Ser III-Sci Vie-Life Sci 317: Kageyama D, Nishimura G, Hoshizaki S, Ishikawa Y (2002) Feminizing Wolbachia in an insect, Ostrinia furnacalis (Lepidoptera : Crambidae). Heredity 88: Kageyama D, Traut W (2004) Opposite sex-specific effects of Wolbachia and interference with the sex determination of its host Ostrinia scapulalis. Proc R Soc Lond B Biol Sci 271: Kageyama D, Narita S, Watanabe M (2012) Insect Sex Determination Manipulated by Their Endosymbionts: Incidences, Mechanisms and Implications. Insects 3: ; doi: /insects Kaiser W, Huguet E, Casas J, Commin C, Giron D (2010) Plant green-island phenotype induced by leaf-miners is mediated by bacterial symbionts. Proc. R. Soc. B, 277, Kambris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune activation by life-shortening Wolbachia and reduced filarial competence in mosquitoes. Science. 326: Kambris Z, Blagborough AM, Pinto SB, Blagrove MSC, Godfray CHJ, Sinden RE, Sinkins SP (2010) Wolbachia stimulates immune gene expression and inhibits plasmodium development in Anopheles gambiae. PLoS Pathog 6:e Keller GP, Windsor DM, Saucedo JM, Werren JH (2004) Reproductive effects and geographical distributions of two Wolbachia strains infecting the Neotropical beetle, Chelymorpha alternans Boh. (Chrysomelidae, Cassidinae). Molecular Ecology 13: Kent BN, Bordenstein SR (2010) Phage WO of Wolbachia: lambda of the endosymbiont world. Trends Microbiol. 18: Kent BN, Salichos L, Gibbons JG, Rokas A, Newton IL, Clark ME, Bordenstein SR (2011) Complete bacteriophage transfer in a bacterial endosymbiont (Wolbachia) determined by targeted genome capture. Genome Biol Evol. 3: Kikuchi Y, Fukatsu T (2003) Diversity of Wolbachia endosymbionts in heteropteran bugs. Applied and Environmental Microbiology 69: Kindlemann P, Jarošík V, Dixon AFG (2007) Population dynamics. In: Van Emden HF, Harrington R, editors. Aphids as crop pests. Wallingford: CAB International Klasson L, Walker T, Sebaihia M, Sanders MJ, Quail MA, Lord A, Sanders S, Earl J, O'Neill SL, Thomson N, Sinkins SP, Parkhill J (2008) Genome evolution of Wolbachia strain wpip from the Culex pipiens group. Molecular Biology and Evolution 25: Klasson L, Kambris Z, Cook PE, Walker T, Sinkins SP (2009a) Horizontal gene transfer between Wolbachia and the mosquito Aedes aegypti. BMC Genomics 10:33. Klasson L, Westberg J, Sapountzis P, Nasiund K, Lutnaes Y, Darby AC, Veneti Z, Chen LM, Braig HR, Garrett R, Bourtzis K, Andersson SGE (2009b) The mosaic genome structure of the Wolbachia wri strain infecting Drosophila simulans. Proc Natl Acad Sci USA 106: Kondo N, Nikoh N, Ijichi N, Shimada M, Fukatsu T (2002) Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect. Proc Natl Acad Sci USA 99: Kose H, Karr TL (1995) Organization of Wolbachia-Pipientis in the Drosophila Fertilized Egg and Embryo Revealed by an Anti-Wolbachia Monoclonal-Antibody. Mech Dev 51: Koukou K, Pavlikaki H, Kilias G, Werren JH, Bourtzis K, Alahiotis SN (2006) Influence of antibiotic treatment and Wolbachia curing on sexual isolation among Drosophila melanogaster cage populations. Evolution 60: Kozek WJ (1977) Transovarially-transmitted intracellular microorganisms in adult and larval stages of Brugia malayi. Journal of Parasitology 63: Kozek WJ, Marroquin HF (1977) Intracytoplasmic bacteria in Onchocerca volvulus. The American Journal of Tropical Medicine and Hygiene 26: Kremer N, Voronin D, Charif D, Mavingui P, Mollereau B, Vavre Fe (2009) Wolbachia Interferes with Ferritin Expression and Iron Metabolism in Insects. PLoS Pathog 5(10): e doi: /journal.ppat

82 ΕΙΣΑΓΩΓΗ Kremer N, Charif D, Henri H, Gavory F, Wincker P, Mavingui P, et al. (2012) Influence of Wolbachia on host gene expression in an obligatory symbiosis. BMC Microbiol. 12:S7. doi: / S1-S7. Kumar S, Christophides GK, Cantera R, Charles B, Han YS, et al. (2003) The role of reactive oxygen species on Plasmodium melanotic encapsulation in Anopheles gambiae. Proc Natl Acad Sci U S A 100: Landmann F, Orsi GA, Loppin B, Sullivan W (2009) Wolbachia-Mediated Cytoplasmic Incompatibility Is Associated with Impaired Histone Deposition in the Male Pronucleus. PLoS Pathogens 5. Langworthy NG, Renz A, Mackenstedt U, Henkle-Duhrsen K, Bronsvoort MBD, Tanya VN, Donnelly MJ, Trees AJ (2000) Macrofilaricidal activity of tetracycline against the filarial nematode Onchocerca ochengi: elimination of Wolbachia precedes worm death and suggests a dependent relationship. Proc R Soc Lond B Biol Sci 267: Lankau RA (2007) Specialist and generalist herbivores exert opposing selection on a chemical defense. New Phytol. 175, Lassy CW, Karr TL (1996) Cytological analysis of fertilization and early embryonic development in incompatible crosses of Drosophila simulans. Mech Dev 57: Laven H (1951) Crossing experiments with Culex strains. Evolution 5. Laven H (1959) Speciation by cytoplasmic isolation in the Culex pipiens-complex. Cold Spring Harb Symp Quant Biol 24: Laven H (1967) Eradication of Culex pipiens fatigans through cytoplasmic incompatibility. Nature 216: Leak SGA (1998) Tsetse Biology and Ecology: Their Role in the Epidemiology and Control of Trypanosomosis CABI Publishing, Wallingford. Leclercq S, Giraud I, Cordaux R (2011) Remarkable abundance and evolution of mobile group II introns in Wolbachia bacterial endosymbionts. Mol Biol Evol. 28: Leiva MJ, Fernandez-Ales R (2005) Holm-oak (Quercus ilex subs. ballota) acorns infestation by insects in Mediterranean dehesas and shrublands. Its effect on acorn germination and seedling emergence. Forest Ecol Manag 212, Lemaitre B, Hoffmann J (2007) The host defense of Drosophila melanogaster. Annu.Rev.Immunol. 25, LePage D, Bordenstein SR (2013) Wolbachia: Can we save lives with a great pandemic? Trends in Parasitology, August 2013, Vol. 29, No. 8. Lind PA, Tobin C, Berg OG, Kurland CG, Andersson DI (2010) Compensatory gene amplification restores fitness after inter-species gene replacements. Molecular Microbiology 75(5), Lo N, Casiraghi M, Salati E, Bazzocchi C, Bandi C (2002) How many wolbachia supergroups exist? Mol Biol Evol. 19: Lo N, Paraskevopoulos C, Bourtzis K, O'Neill SL, Werren JH, Bordenstein SR, Bandi C (2007) Taxonomic status of the intracellular bacterium Wolbachia pipientis. Int J Syst Evol Microbiol 57: Longdon B, Fabian DK, Hurst GD, Jiggins FM (2012) Male- killing Wolbachia do not protect Drosophila bifasciata against viral infection. BMC Microbiol. 12:S8. doi: / s1-s8. Louis C, Nigro L (1989) Ultrastructural Evidence of Wolbachia-Rickettsiales in Drosophila-Simulans and Their Relationships with Unidirectional Cross-Incompatibility. Journal of Invertebrate Pathology 54: Lu P, Bian G, Pan X, Xi Z (2012b) Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 6(7):e1754. Majerus MEN, Hinrich J, Schulenburg GVD, Zakharov IA (2000) Multiple causes of male-killing in a single sample of the two- spot ladybird, Adalia bipunctata (Coleoptera : Coccinellidae) from Moscow. Heredity 84: Majerus TM, Majerus ME (2010) Discovery and identification of a male-killing agent in the Japanese ladybird Propylea japonica (Coleoptera: Coccinellidae). BMC Evol. Biol. 2010, 10, 37. Malloch G, Fenton B (2005) Super-infections of Wolbachia in byturid beetles and evidence for genetic transfer between A and B super-groups of Wolbachia. Molecular Ecology 14: Mansilla JP, Salinero MC (1993) Pammene fasciana L. (Lep., Tortricidae) tortricido precoz del castano (Castanea sativa Mill.). Bol. San. Veg. Plagas 19: Margulis L (1970) Origin of Eukaryotic Cells. Yale University Press. Margulis L (1998) The symbiotic planet. London, UK. Weidenfield and Nicholson. Martinez J, Duplouy A, Woolfit M, Vavre F, O Neill SL, Varaldi J (2012) Influence of the virus LbFV and of Wolbachia in a host-parasitoid interaction. PLoS ONE 7:e35081.doi: /jour- nal.pone Mavingui P, Valiente Moro C, Tran-Van V, Wisniewski-Dyé F, Raquin V, Minard G, Tran FH, Voronin D, Rouy Z, Bustos P, Lozano L, Barbe V, González V (2012) Whole-genome sequence of Wolbachia strain walbb, an endosymbiont of tiger mosquito vector Aedes albopictus. J Bacteriol Apr; 194(7):1840. doi: /JB McEwen DG, Peifer M (2005) Puckered, a Drosophila MAPK phosphatase, ensures cell viability by antagonizing JNK-induced apoptosis. Development 132,

83 ΕΙΣΑΓΩΓΗ McGraw EA, Merritt DJ, Droller JN, O'Neill SL (2002) Wolbachia density and virulence attenuation after transfer into a novel host. Proc Natl Acad Sci USA 99: McGraw E and O Neill S (2004) Wolbachia pipientis: intracellular infection and pathogenesis in Drosophila. Current Opinion in Microbiology 7: McMeniman CJ, Lane RV, Cass BN, Fong AW, Sidhu M, Wang YF, O'Neill SL (2009) Stable introduction of a life-shortening Wolbachia infection into the mosquito Aedes aegypti. Science. 323: McNulty SN, Foster JM, Mitreva M, Dunning Hotopp JC, Martin J, Fischer K, Wu B, Davis PJ, Kumar S, Brattig NW, Slatko BE, Weil GJ, Fischer PU (2010) Endosymbiont DNA in Endobacteria-Free Filarial Nematodes Indicates Ancient Horizontal Genetic Transfer. PLoS ONE 5(6): e doi: /journal.pone McNulty SN, Abubucker S, Simon GM, Mitreva M, McNulty NP, Fischer K, Curtis KC, Brattig NW, Weil GJ, Fischer PU (2012) Transcriptomic and Proteomic Analyses of a Wolbachia-Free Filarial Parasite Provide Evidence of Trans-Kingdom Horizontal Gene Transfer. PLoS ONE 7(9): e doi: /journal.pone Meeus PFM, Brayton KA, Palmer GH, Barbet AF (2003) Conservation of a gene conversion mechanism in two distantly related paralogues of Anaplasma marginale. Molecular Microbiology 47: Mercot H, Llorente B, Jacques M, Atlan A, MontchampMoreau C (1995) Variability within the Seychelles Cytoplasmic Incompatibility System in Drosophila-Simulans. Genetics 141: Mercot H, Poinsot D (1998) Rescuing Wolbachia have been overlooked and discovered on Mount Kilimanjaro. Nature 391:853. Miles PW (1999) Aphid saliva. Biol. Rev. 74, Miller WJ, Riegler M (2006) Evolutionary Dynamics of wau-like Wolbachia Variants in Neotropical Drosophila spp. Appl. Environ. Microbiol. 72(1): Miller WJ, Ehrman L, Schneider D (2010) Infectious Speciation Revisited: Impact of Symbiont-Depletion on Female Fitness and Mating Behavior of Drosophila paulistorum. PLoS Pathog 6(12): e doi: /journal.ppat Min KT, Benzer S (1997) Wolbachia, normally a symbiont of Drosophila, can be virulent, causing degeneration and early death. Proc Natl Acad Sci USA 94: Mittler TE, Sylvester ES (1961) A comparison of the injury of alfalfa by the aphids Therioaphis maculata and Macrosiphum pisi. J. Econ. Entomol. 54, Molina-Cruz A, Dejong RJ, Charles B, Gupta L, Kumar S, et al. (2008) Reactive oxygen species modulate Anopheles gambiae immunity against bacteria and Plasmodium. J Biol Chemistry 283: Moloo SK (1993) The distribution of Glossina species in Africa and their natural hosts Insect Sci. Appl., 14, pp Montagna M, Sassera D, Epis S, Bazzocchi C, Vannini C, Lo N, Sacchi L, Fukatsu T, Petroni G, Bandi C (2013) "Candidatus Midichloriaceae" fam. nov. (Rickettsiales), an ecologically widespread clade of intracellular alphaproteobacteria. Appl Environ Microbiol May;79(10): Moran NA, Munson MA, Baumann P, Ishikawa H (1993) A Molecular Clock in Endosymbiotic Bacteria Is Calibrated Using the Insect Hosts. Proc R Soc Lond B Biol Sci 253: Moran NA (1996) Accelerated evolution and Muller's rachet in endosymbiotic bacteria. Proc Natl Acad Sci USA 93: Moran NA, Russell JA, Koga R, Fukatsu T (2005) Evolutionary relationships of three new species of Enterobacteriaceae living as symbionts of aphids and other insects. Applied and Environmental Microbiology 71: Moran NA (2006) Symbiosis. Current Biology 16:R866-R871. Moran NA, McCutcheon JP, Nakabachi A (2008) Genomics and Evolution of Heritable Bacterial Symbionts. Annual Review of Genetics 42: Moran NA, Jarvik T (2010) Lateral transfer of genes from fungi underlies carotenoid production in aphids. Science, 328(5978): Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, Rocha BC, Hall-Mendelin S, Day A, Riegler M, Hugo LE, Johnson KN, Kay BH, McGraw EA, van den Hurk AF, Ryan PA, O'Neill SL (2009) A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell. 139: Mousson L, Martin E, Zouache K, Madec Y, Mavingui P, Failloux AB (2010) Wolbachia modulates Chikungunya replication in Aedes albopictus. Mol Ecol. 19: Mousson L, Zouache K, Arias-Goeta C, Raquin V, Mavingui P, Failloux AB (2012) The native Wolbachia symbionts limit transmission of dengue virus in Aedes albopictus. PLoS Negl Trop Dis. 6(12):e1989. Nakamura Y, Gotoh T, Imanishi S, Mita K, Kurtti TJ, Noda H (2011) Differentially expressed genes in silk worm cell cultures in response to infection by Wolbachia and Cardinium endosymbionts. Insect Mol. Biol. 20,

84 ΕΙΣΑΓΩΓΗ Nardon P, Grenier AM (1991) Serial endosymbiosis theory and weevil evolution: the role of symbiosis. In Symbiosis as a Source of Evolutionar Innovation (Margulis, L. and Fester, R., eds), pp , The MIT Press. Narita S, Kageyama D, Nomura M, Fukatsu T (2007) Unexpected mechanism of symbiont-induced reversal of insect sex: Feminizing Wolbachia continuously acts on the butterfly Eurema hecabe during larval development. Applied and Environmental Microbiology 73: Negri I, Pellecchia M, Mazzoglio PJ, Patetta A, Alma A (2006) Feminizing Wolbachia in Zyginidia pullula (Insecta, Hemiptera), a leafhopper with an XX/XO sex-determination system. Proc R Soc Lond B Biol Sci 273: Negri I, Franchini A, Gonella E, Daffonchio D, Mazzoglio PJ, Mandrioli M, Alma A (2009) Unravelling the Wolbachia evolutionary role: the reprogramming of the host genomic imprinting. Proc. Biol. Sci. 276, Negri I, Pellecchia M, Grève P, Daffonchio D, Bandi C, Alma A (2010) Sex and stripping: the key to the intimate relationship between Wolbachia and host? Commun. Integr. Biol. 3, Newstead R (1911) A revision of the tsetse flies (Glossina) based on a study of the male genital armature Bull. Entomol. Res., 2, pp Ng JCK, Perry KL (2004) Transmission of plant viruses by aphid vectors. Mol Plant Pathol 5: Nikoh N, Tanaka K, Shibata F, Kondo N, Hizume M, Shimada M, Fukatsu T (2008) Wolbachia genome integrated in an insect chromosome: Evolution and fate of laterally transferred endosymbiont genes. Genome Research 18: Nikoh N, Nakabachi A (2009) Aphids acquired symbiotic genes via lateral gene transfer. BMC Biol, 7:12. Nikoh N, McCutcheon JP, Kudo T, Miyagishima SY, Moran NA, Nakabachi A (2010) Bacterial genes in the aphid genome: absence of functional gene transfer from Buchnera to its host. PLoS genetics, 6(2):e Nirgianaki A, Banks GK, Frohlich DR, Veneti Z, Braig HR, Miller TA, Bedford ID, Markham PG, Savakis C, Bourtzis K (2003) Wolbachia infections of the whitefly Bemisia tabaci. Current Microbiology 47: Oliver KM, Russell JA, Moran NA, Hunter MS (2003) Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc Natl Acad Sci USA 100: Oliver KM, Degnan PH, Burke GR, Moran NA (2009) Facultative Symbionts of Aphids and the Horizontal Transfer of Ecologically Important Traits. Annual Review of Entomology 55. O'Neill SL, Karr TL (1990) Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348: O'Neill SL, Giordano R, Colbert AME, Karr TL, Robertson HM (1992) 16S rrna phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc Natl Acad Sci USA 89: Osborne SE, Leong YS, O'Neill SL, Johnson KN (2009) Variation in Antiviral Protection Mediated by Different Wolbachia Strains in Drosophila simulans. PLoS Pathogens. 5. Osborne SE, Iturbe-Ormaetxe I, Brownlie JC, O Neill SL, Johnsona KN (2012) Antiviral Protection and the Importance of Wolbachia Density and Tissue Tropism in Drosophila simulans. Appl. Environ. Microbiol. 2012, 78(19):6922. DOI: /AEM Pais R, Lohs C, Wu YN, Wang JW, Aksoy S (2008) The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly. Appl. Environ. Microbiol. 74: Pan X, Zhou G, Wu J, Bian G, Lu P, Raikhel AS, Xi Z (2012) Wolbachia induces reactive oxygen species (ROS)-dependent activation of the Toll pathway to control dengue virus in the mosquito Aedes aegypti. PNAS 109 (1), E23 E31. Panaram K, Marshall JL (2007) F supergroup Wolbachia in bush crickets: what do patterns of sequence variation reveal about this supergroup and horizontal transfer between nematodes and arthropods? Genetica 130: Pannebakker BA, Loppin B, Elemans CPH, Humblot L, Vavre F (2007) Parasitic inhibition of cell death facilitates symbiosis. Proc Natl Acad Sci U S A, 104(1): Paraskevopoulos C, Bordenstein SR, Wernegreen JJ, Werren JH, Bourtzis K (2006) Toward a Wolbachia multilocus sequence typing system: discrimination of Wolbachia strains present in Drosophila species. Curr Microbiol 53: Paraskevopoulos CV (2007) Genetic diversity, phylogenetic relationships and evolution of the bacterium wolbachia. Thesis, Patterson JT & Stone WS (1952) Evolution in the Genus Drosophila. New York: Macmillan. Pinto SB, Mariconti M, Bazzocchi C, Bandi C, Sinkins SP (2012) Wolbachia surface protein induces innate immune responses in mosquito cells. BMC Microbiol. 12:S11. doi: / s1-s11. 74

85 ΕΙΣΑΓΩΓΗ Poinsot D, Mercot H (1999) Wolbachia can rescue from cytoplasmic incompatibility while being unable to induce it in E. Wagner, J. Normann, H. Greppin, J. H. P. Hackstein, R. G. Herrmann, K. V. Kowallik, H. E. A. Schenk, and J. Seckbach, eds. From Symbiosis to Eukaryotism - Endocytobiology VII. Universities of Geneva and Freiburg im Breisgau. Poinsot D, Charlat S, Mercot H (2003) On the mechanism of Wolbachia-induced cytoplasmic incompatibility: confronting the models with the facts. Bioessays 25: Pollard DG (1973) Plant penetration by feeding aphids (Hemiptera: Aphidoidea): a review. Bull. Entomol. Res. 62, doi: /S Pollock JN (1974) Male accessory secretions, their use and replenishment in Glossina (Diptera, Glossinidae) Bull. Entomol. Res., 64, pp Pool JE, Wong A, Aquadro CF (2006) Finding of male-killing Spiroplasma infecting Drosophila melanogaster in Africa implies transatlantic migration of this endosymbiont. Heredity 97: Presgraves DC (2000) A genetic test of the mechanism of Wolbachia-induced cytoplasmic incompatibility in Drosophila. Genetics 154: Rajalingam R, Parham P, Abi-Rached L (2004) Domain shuffling has been the main mechanism forming new hominoid killer cell Ig-like receptors. Journal of Immunology 172: Rancès E, Ye YH, Woolfit M, McGraw EA, O Neill SL (2012) The relative importance of innate immune priming in Wolbachia-mediated dengue interference. PLoS Pathog. 8:e doi: /journal.ppat Ranz JM, Namgyal K, Gibson G, Hartl DL (2004) Anomalies in the expression profile of interspecific hybrids of Drosophila melanogaster and Drosophila simulans. Genome Res. 14, Rasgon J (2007) Population replacement strategies for controlling vector populations and the use of Wolbachia pipientis for genetic drive. J Vis Exp Rasgon JL (2008) Using predictive models to optimize Wolbachia-based strategies for vector-borne disease control. Adv Exp Med Biol. 627: Raychoudhury R, Werren JH (2012) Host genotype changes bidirectional to unidirectional cytoplasmic incompatibility in Nasonia longicornis. Heredity (Edinb). 108(2): Reed KM, Werren JH (1995) Induction of Paternal Genome Loss by the Paternal Sex-Ratio Chromosome and Cytoplasmic Incompatibility Bacteria (Wolbachia) - a Comparative-Study of Early Embryonic Events. Molecular Reproduction and Development 40: Reuter M, Keller L (2003) High levels of multiple Wolbachia infection and recombination in the ant Formica exsecta. Molecular Biology and Evolution 20: Rich SM, Sawyer SA, Barbour AG (2001) Antigen polymorphism in Borrelia hermsii, a clonal pathogenic bacterium. Proc Natl Acad Sci USA 98: Rigaud T, Juchault P (1993) Conflict between feminizing sex-ratio distorters and an autosomal masculinizing gene in the terrestrial isopod Armadillidium vulgare Latr. Genetics 133: Rigaud T, Juchault P (1995) Success and failure of horizontal transfers of feminizing Wolbachia endosymbionts in woodlice. J Evol Biol 8: Rigaud T (1997) Inherited microorganisms and sex determination of arthropod hosts. In Influential passengers, pp Edited by S. L. O'Neill, A.A. Hoffmann and J.H. Werren. Oxford: Oxford University Press. Ringo J, Sharon G, Segal D (2011) Bacteria-induced sexual isolation in Drosophila. Fly 5:4, ; October/November/December 2011; 2011 Landes Bioscience. Ros VID, Fleming VM, Feil EJ, Breeuwer JAJ (2009) How Diverse Is the Genus Wolbachia? Multiple-Gene Sequencing Reveals a Putatively New Wolbachia Supergroup Recovered from Spider Mites (Acari: Tetranychidae). Applied and Environmental Microbiology 75: Rottschaefer SM, Lazzaro BP (2012) No effect of Wolbachia on resistance to intracellular infection by pathogenic bacteria in Drosophila melanogaster. PLoS ONE 7:e doi: /journal.pone Rotundo G (1993) New control strategies on chestnut tortricoid moths by semiochemicals. In: Proceedings of the 1st International Congress on Chestnut, Spoleto (Italy), Oct p Rousset F, Bouchon D, Pintureau B, Juchault P, Solignac M (1992) Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proc R Soc Lond B Biol Sci 250: Rowley SM, Raven RJ, McGraw EA (2004) Wolbachia pipientis in Australian spiders. Current Microbiology 49: Ruang-Areerate T, Kittayapong P (2006) Wolbachia transinfection in Aedes aegypti: a potential gene driver of dengue vectors. Proc Natl Acad Sci USA 103: Russ K, Faber B (1979) The possible use of IIT to control Rhagoletis cerasi, the European cherry fruit fly in Austria. Bulletin SROP 2: Russell JA, Latorre A, Sabater-Munoz B, Moya A, Moran NA (2003) Sidestepping secondary symbionts: widespread horizontal transfer across and beyond the Aphidoidea. Mol Ecol 12:

86 ΕΙΣΑΓΩΓΗ Saha S, Hunter WB, Reese J, Morgan JK, Marutani-Hert M, Huang Η, Lindeberg Μ (2012) Survey of Endosymbionts in the Diaphorina citri Metagenome and Assembly of a Wolbachia wdi Draft Genome. PLoS ONE 7(11): e doi: /journal.pone Sakamoto JM, Rasgon JL (2006) Geographic distribution of Wolbachia infections in Cimex lectularius (Heteroptera : Cimicidae). Journal of Medical Entomology 43: Salzberg SL, Hotopp JCD, Delcher AL, Pop M, Smith DR, Eisen MB, Nelson WC (2005a) Serendipitous discovery of Wolbachia genomes in multiple Drosophila species. Genome Biology 6. Salzberg SL, Puiu D, Sommer DD, Nene V, Lee NH (2009) Genome sequence of the Wolbachia endosymbiont of Culex quinquefasciatus JHB. J Bacteriol. 191, Saridaki A, Bourtzis K (2010) Wolbachia: more than just a bug in insects genitals. Curr Opin Microbiol, 13(1): Sasaki T, Ishikawa H (2000) Transinfection of Wolbachia in the Mediterranean flour moth, Ephestia kuehniella, by embryonic microinjection. Heredity 85: Sasaki T, Kubo T, Ishikawa H (2002) Interspecific transfer of Wolbachia between two lepidopteran insects expressing cytoplasmic incompatibility: A Wolbachia variant naturally infecting Cadra cautella causes male killing in Ephestia kuehniella. Genetics 162: Sasaki T, Massaki N, Kubo T (2005) Wolbachia variant that induces two distinct reproductive phenotypes in different hosts. Heredity (Edinb) 95(5): Saunders DS (1970) Mating, ovulation and oöcyte development in Glossina morsitans Trans. Roy. Soc. Trop. Med. Hyg., 64, pp Scarborough CL, Ferrari J, Godfray HCJ (2005) Aphid protected from pathogen by endosymbiont. Science 310: Schaible U, Kaufmann H (2004) Iron and microbial infection. Nature review microbiology 2: Schneider DI, Garschall KI, Parker AG, Abd-Alla AMM, Miller WJ (2013) Global Wolbachia prevalence, titer fluctuations and their potential of causing cytoplasmic incompatibilities in tsetse flies and hybrids of Glossina morsitans subgroup species. Journal of Invertebrate Pathology 112 (2013) S104 S115. Schröder D, Deppisch H, Obermayer M, Krohne G, Stackebrandt E, Hölldobler B, Goebel W, Gross R (1996) Intracellular endosymbiotic bacteria of Camponotus species (carpenter ants): Systematics, evolution and ultrastructural analysis. Mol Microbiol 21: Shaw AE, Veronesi E, Maurin G, Ftaich N, Guiguen F, Rixon F, Ratinier M, Mertens P, Carpenter S, Palmarini M, Terzian C, Arnaud F (2012) Drosophila melanogaster as a Model Organism for Bluetongue Virus Replication and Tropism. J. Virol. 2012, 86(17):9015. DOI: /JVI Shigenobu S, Watanabe H, Hattori M, Sakaki Y, Ishikawa H (2000) Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp APS. Nature 407: Silvestri F (1943) Compendio di Entomologia Applicata. Parte Spec., Portici. Vol. II Sinkins SP, Curtis CF, O'Neill SL (1997) The potential application of inherited symbiont systems to pest control. Pp in S. L. O'Neill, A.A. Hoffmann and J.H. Werren, ed. Influential passengers. Oxford University Press, Oxford. Sinkins SP, O'Neill SL (2000) Wolbachia as a vehicle to modify insect populations. Pp Insect transgenesis: Methods and Applications. Sinkins SP, Godfray HCJ (2004) Use of Wolbachia to drive nuclear transgenes through insect populations. Proc R Soc Lond B Biol Sci 271: Sinkins SP, Gould (2006) Gene drive systems for insect disease vectors. Nature Reviews Genetics 7: Sinkins SP (2013) Wolbachia and arbovirus inhibition in mosquitoes. Future Microbiol. 8(10), Siozios S, Ioannidis P, Klasson L, Andersson SGE, Braig HR, Bourtzis K (2013a) The Diversity and Evolution of Wolbachia Ankyrin Repeat Domain Genes. PLoS ONE 8(2): e doi: /journal.pone Siozios S, Cestaro A, Kaur R, Pertot I, Rota-Stabelli O, Anfora G (2013b) Draft genome sequence of the Wolbachia endosymbiont of Drosophila suzukii. Genome Announc. 1(1):e doi: /genomea Sironi M, Bandi C, Sacchi L, DiSacco B, Damiani G, Genchi C (1995) Molecular evidence for a close relative of the arthropod endosymbiont Wolbachia in a filarial worm. Molecular and Biochemical Parasitology 74: Sohal RS, Allen RG, Farmer KJ, Newton RK (1985) Iron induces oxidative stress and may alter the rate of aging in the housefly, Musca domestica. Mech Ageing Dev 32: Stevens L, Giordano R, Fialho RF (2001) Male-killing, nematode infections, bacteriophage infection, and virulence of cytoplasmic bacteria in the genus Wolbachia. Annual Review of Ecology and Systematics 32: Stouthamer R, Luck RF, HamiltonWD (1990) Antibiotics cause parthenogenetic Trichogramma (Hymenoptera/Trichogrammatidae) to revert to sex. Proc Natl Acad Sci USA 87:

87 ΕΙΣΑΓΩΓΗ Stouthamer R, Kazmer DJ (1994) Cytogenetics of microbe-associated parthenogenesis and its consequences for gene flow in Trichogramma wasps. Heredity 73: Stouthamer R (1997) Wolbachia-induced parthenogenesis. Pp in S. L. O'Neill, A.A. Hoffmann and J.H. Werren, ed. Influential passengers. Oxford University Press, Oxford Stouthamer R, Breeuwer JAJ, Hurst GDD (1999) Wolbachia pipientis: Microbial manipulator of arthropod reproduction. Annual Review of Microbiology 53: Strunov A, Kiseleva E,Gottlieb Y (2013) Spatial and temporal distribution of pathogenic Wolbachia strain wmelpop in Drosophila melanogaster central nervous system under different temperature conditions. Journal of Invertebrate Pathology 114, Sugimoto TN, Fujii T, Kayukawa T, Sakamoto H, Ishikawa Y (2010) Expression of a doublesex homologue is altered in sexual mosaics of Ostrinia scapulalis moths infected with Wolbachia. Insect Biochem. Mol. Biol. 40, Sun LV, Riegler M, O'Neill SL (2003) Development of a physical and genetic map of the virulent Wolbachia strain wmelpop. J Bacteriol. 185(24): Tabata J, Hattori Y, Sakamoto H, Yukuhiro F, Fujii T, Kugimiya S, Mochizuki A, Ishikawa Y, Kageyama D (2011) Male killing and incomplete inheritance of a novel spiroplasma in the moth Ostrinia zaguliaevi. Microb. Ecol. 61: Tagami Y, Miura K (2004) Distribution and prevalence of Wolbachia in Japanese populations of Lepidoptera. Insect Molecular Biology 13: Tamas I, Klasson L, Canback B, Naslund AK, Eriksson AS, Wernegreen JJ, Sandstrom JP, Moran NA, Andersson SGE (2002) 50 million years of genomic stasis in endosymbiotic bacteria. Science 296: Taylor MJ, Bandi C, Hoerauf A (2005) Wolbachia bacterial endosymbionts of filarial nematodes. Advances in Parasitology 60: Teixeira L, Ferreira A, Ashburner M (2008) The Bacterial Symbiont Wolbachia Induces Resistance to RNA Viral Infections in Drosophila melanogaster. PLoS Biology 6: Telschow, Hammerstein P, Werren JH (2005) The effect of Wolbachia versus genetic incompatibilities on reinforcement and speciation. Evolution 59, Terry RS, Smith JE, Dunn AM (1998) Impact of a Novel, Feminising Microsporidium on its Crustacean Host. J. Euk. Microbiol 45: Thomas F, Adamo S, Moore J (2005) Parasitic manipulation: where are we and where should we go? Behav Processes 68: Thomas P, Kenny N, Eyles D, Moreira LA, O Neill SL, Asgari S (2011) Infection with the wmel and wmelpop strains of Wolbachia leads to higher levels of melanization in the hemolymph of Drosophila melanogaster, Drosophila simulans and Aedes aegypti. Dev. Comp. Immunol. 35, Tinsley MC, Majerus MEN (2006) A new male-killing parasitism: Spiroplasma bacteria infect the ladybird beetle Anisosticta novemdecimpunctata (Coleoptera: Coccinellidae). Parasitology 132: Tjallingii WF (2006) Salivary secretions by aphids interacting with proteins of phloem wound responses. J. Exp. Bot. 57, Tobe SS, Davey KG, Huebner E (1973) Nutrient transfer during the reproductive cycle in Glossina austeni Newst: histology and histochemistry of the milk gland, fat body and oenocytes Tissue Cell, 5, pp Tobe SS, Langley PA (1978) Reproductive physiology of Glossina Annu. Rev. Entomol., 23, pp Toivonen JM, Walker GA, Martinez-Diaz P, Bjedov I, Driege Y, Jacobs HT, Gems D, Partridge L (2007) No influence of Indy on lifespan in Drosophila after correction for genetic and cytoplasmic background effects. PLoS Genet. 3, e95. Tram U, Sullivan W (2002) Role of delayed nuclear envelope breakdown and mitosis in Wolbachia-induced cytoplasmic incompatibility. Science 296: Tram U, Ferree PA, Sullivan W (2003) Identification of Wolbachia-host interacting factors through cytological analysis. Microbes and Infection 5: Tsuchida T, Koga R, Fukatsu T (2004) Host plant specialization governed by facultative symbiont. Science 303: Turley AP, Zalucki MP, O'Neill SL, McGraw EA (2013) Transinfected Wolbachia have minimal effects on male reproductive success in Aedes aegypti. Parasit Vectors. 6:36. doi: / Tzanakakis ME, Katsoyannos VI (1998) Insects of Fruit Trees and Vine. Athens, Greece: Agrotypos. Tzanakakis ME, Katsoyannos VI (2003) Insects of Fruit Trees and Vine. Athens, Greece: Agrotypos, 360p. ISBN Vaishampayan PA, Dhotre DP, Gupta RP, Lalwani P, Ghate H, Patole MS, Shouche YS (2007) Molecular evidence and phylogenetic affiliations of Wolbachia in cockroaches. Mol Phylogenet Evol 44(3):

88 ΕΙΣΑΓΩΓΗ Van den Bossche P, de La Rocque S, Hendrickx G, Bouyer J (2010) A changing environment and the epidemiology of tsetse-transmitted livestock Trypanosomiasis Trends Parasitol., 26 (5), pp Van Ham R, Kamerbeek J, Palacios C, Rausell C, Abascal F, Bastolla U, Fernandez JM, Jimenez L, Postigo M, Silva FJ, Tamames J, Viguera E, Latorre A, Valencia A, Moran F, Moya A (2003) Reductive genome evolution in Buchnera aphidicola. Proc Natl Acad Sci USA 100: Vandekerckhove TT, Watteyne S, Willems A, Swings JG, Mertens J, Gillis M (1999) Phylogenetic analysis of the 16S rdna of the cytoplasmic bacterium Wolbachia from the novel host Folsomia candida (Hexapoda, Collembola) and its implications for wolbachial taxonomy. FEMS Microbiol Lett 180(2): Veneti Z, Clark ME, Karr TL, Savakis C, Bourtzis K (2004) Heads or tails: host-parasite interactions in the Drosophila-Wolbachia system. Appl. Environ. Microbiol. 70, Veneti Z, Bentley JK, Koana T, Braig HR, Hurst GDD (2005) A functional dosage compensation complex required for male killing in Drosophila. Science 307: Veneti Z, Zabalou S, Papafotiou G, Paraskevopoulos C, Pattas S, Livadaras I, Markakis G, Herren JK, Jaenike J, Bourtzis K (2012) Loss of reproductive parasitism following transfer of male-killing Wolbachia to Drosophila melanogaster and Drosophila simulans. Heredity 109, Viljakainen L, Reuter M, Pamilo P (2008) Wolbachia transmission dynamics in Formica wood ants. BMC Evol Biol 8:55. doi: / Vreysen MJB, Van der Vloedt AMV (1990) The effect of intersubspecific of hybridization and gamma radiation on the reproductive biology of Glossina palpalis palpalis (Robineau-Desvoidy) and Glossina palpalis gambiensis Vanderplank Ann. Soc. Belge Med. Trop., 70, pp Vreysen MJ, Seck MT, Sall B, Bouyer J (2013) Tsetse flies: Their biology and control using area-wide integrated pest management approaches. Journal of Invertebrate Pathology Volume 112, Supplement 1, March 2013, Pages S15 S25. Walker T, Johnson PH, Moreira LA, Iturbe-Ormaetxe I, Frentiu FD, McMeniman CJ, Leong YS, Dong Y, Axford J, Kriesner P, Lloyd AL, Ritchie SA, O'Neill SL, Hoffmann AA (2011) The wmel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature. 476: Walling L (2000) The myriad plant responses to herbivores. J. Plant Growth Regul. 19, Weeks AR, Breeuwer JAJ (2001) Wolbachia-induced parthenogenesis in a genus of phytophagous mites. Proc R Soc Lond B Biol Sci 268: Weitz B (1970) The hosts of Glossina H.W. Mulligan (Ed.), The African Trypanosomiasis, George Allan and Unwin, London. Wernegreen JJ (2004) Endosymbiosis: lessons in conflict resolution. PLoS Biol 2, E68. Werren JH, Skinner SW, Huger AM (1986) Male-killing bacteria in a parasitic wasp. Science 231: Werren JH, Hurst GDD, Zhang W, Breeuwer JAJ, Stouthamer R, Majerus MEN (1994) Rickettsial relative associated with male killing in the ladybird beetle (Adalia bipunctata). J Bacteriol 176(2): Werren JH, Zhang W, Guo LR (1995) Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proc R Soc Lond B Biol Sci 261: Werren JH (1997) Biology of Wolbachia. Annual Review of Entomology 42: Werren J, O'Neill S (1997) The evolution of heritable symbionts. In: O'Neill S, Hoffmann A, Werren J (eds) Influential passengers. Oxford University Press, Oxford, pp Werren JH (1998) Wolbachia and speciation. Pp in D. Howard, and S. Berlocher, ed. Endless forms: Species and speciation. Oxford University Press, Oxford. Werren JH, Bartos JD (2001) Recombination in Wolbachia. Current Biology 11: Werren JH, Baldo L, Clark ME (2008) Wolbachia: master manipulators of invertebrate biology. Nature Reviews Microbiology 6: Werren JH, The Nasonia Genome Working Group (2010) Functional and Evolutionary Insights from the Genomes of Three Parasitoid Nasonia Species. Science vol.327, West SA, Cook JM, Werren JH, Godfray HCJ (1998) Wolbachia in two insect host-parasitoid communities. Molecular Ecology 7: Will T, Tjallingii WF, Thonnessen A, van Bel AJE (2007) Molecular sabotage of plant defense by aphid saliva. Proc Natl Acad Sci USA 104: Williams IS & Dixon AFG (2007) Life cycles and polymorphism. In: Van Emden HF, Harrington R, editors. Aphids as crop pests. Wallingford: CAB International. pp Wong ZS, Hedges LM, Brownlie JC, Johnson KN (2011) Wolbachia-mediated antibacterial protection and immune gene regulation in Drosophila. PLoS ONE 6:e25430.doi: /journal.pone Woolfit M, Iturbe-Ormaetxe I, McGraw EA, O Neill SL (2009) An ancient horizontal gene transfer between mosquito and the endosymbiotic bacterium Wolbachia pipientis. Mol Biol Evol 26: Wright JD, Sjostrand FS, Portaro JK, Barr AR (1978) Ultrastructure of Rickettsia-Like Microorganism Wolbachia- Pipientis and Associated Virus-Like Bodies in Mosquito Culex- Pipiens. Journal of Ultrastructure Research 63:

89 ΕΙΣΑΓΩΓΗ Wright JD, Barr AR (1980) The ultrastructure and symbiotic relationships of Wolbachia of the Aedes scutellaris group. Journal of Ultrastructure Research 72: Wright JD, Wang B-T (1980) Observations on Wolbachiae in mosquitoes. Journal of Invertebrate Pathology 35: Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, McGraw EA, Martin W, Esser C, Ahmadinejad N, Wiegand C, Madupu R, Beanan MJ, Brinkac LM, Daugherty SC, Durkin AS, Kolonay JF, Nelson WC, Mohamoud Y, Lee P, Berry K, Young MB, Utterback T, Weidman J, Nierman WC, Paulsen IT, Nelson KE, Tettelin H, O'Neill SL, Eisen JA (2004) Phylogenomics of the reproductive parasite Wolbachia pipientis wmel: A streamlined genome overrun by mobile genetic elements. PLoS Biology 2: Xi Z, Khoo CC, Dobson SL (2005) Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 310: Xi Z, Gavotte L, Xie Y, Dobson S (2008) Genome wide analysis of the interaction between the endosymbiotic bacterium Wolbachia and its Drosophila host. BMC Genomics 9:1.doi: / Xie R, Zhou L, Zhao Z, Hong X, Xiao-Yue H (2010) Male age influences the strength of Cardinium-induced cytoplasmic incompatibility expression in the carmine spider mite Tetranychus cinnabarinus. Appl. Entomol. Zool. 45: Ye YH, Woolfit M, Huttley GA, Rance`s E, Caragata EP, ean Popovici J, O Neill SL, McGraw EA (2013a) Infection with a Virulent Strain of Wolbachia Disrupts Genome Wide-Patterns of Cytosine Methylation in the Mosquito Aedes aegypti. PLoS ONE 8(6): e doi: /journal.pone Ye YH, Woolfit M, Rance`s E, O Neill SL, McGraw EA (2013b) Wolbachia-Associated Bacterial Protection in the Mosquito Aedes aegypti. PLoS Negl Trop Dis 7(8): e2362. doi: /journal.pntd Yen JH, Barr AR (1971) New hypothesis of the cause of cytoplasmic incompatibility in Culex pipiens L. Nature 232: Yu X, Zhou H, Luo T (2003) Spatial and temporal variations in insect-infested acorn fall in a Quercus liaotungensis forest in North China. Ecol Res 18, Yuan JB, Zhang XJ, Liu CZ, Wei JK, Li FH, Xiang JH (2013) Horizontally transferred genes in the genome of Pacific white shrimp, Litopenaeus vannamei. BMC Evolutionary Biology :165. Zabalou S, Charlat S, Nirgianaki A, Lachaise D, Mercot H, Bourtzis K (2004a) Natural wolbachia infections in the Drosophila yakuba species complex do not induce cytoplasmic incompatibility but fully rescue the wri modification. Genetics 167: Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C, Bourtzis K (2004b) Wolbachia-induced cytoplasmic incompatibility as a means for insect pest population control. Proc Natl Acad Sci USA 101: Zabalou S, Apostolaki A, Pattas S, Veneti Z, Paraskevopoulos C, Livadaras I, Markakis G, Brissac T, Mercot H, Bourtzis K (2008) Multiple rescue factors within a Wolbachia strain. Genetics 178: Zabalou S, Apostolaki A, Livadaras I, Franz G, Robinson AS, Savakis C, Bourtzis K (2009) Incompatible insect technique: incompatible males from a Ceratitis capitata genetic sexing strain. Entomologia Experimentalis et Applicata. 132: Zchori-Fein E, Roush RT, Rosen D (1998) Distribution of parthenogenesis-inducing symbionts in ovaries and eggs of Aphytis (Hymenoptera : Aphelinidae). Current Microbiology 36:1-8. Zchori-Fein E, Gottlieb Y, Kelly SE, Brown JK, Wilson JM, Karr TL, Hunter MS (2001) A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps. Proc Natl Acad Sci USA 98: Zchori-Fein E, Perlman SJ (2004) Distribution of the bacterial symbiont Cardinium in arthropods. Molecular Ecology 13: Zchori-Fein E, Bourtzis K (2011) Manipulative Tenants: Bacteria associated with Arthropods (a volume in the Frontiers in Microbiology Series). CRC Press, Taylor and Francis Group, LLC, Florida, USA pp Zeh DW, Zeh JA, Bonilla MM (2005) Wolbachia, sex ratio bias and apparent male killing in the harlequin beetle riding pseudoscorpion. Heredity 95: Zélé F, Nicot A, Duron A, Rivero A (2012) Infection with Wolbachia protects mosquitoes against Plasmodiuminduced mortality in a natural system. J. Evol. Biol. 25, Zhang G, Hussain M, O Neill SL, Asgari S (2013) Wolbachia uses a host microrna to regulate transcripts of a methyltransferase, contributing to dengue virus inhibition in Aedes aegypti. Proc. Natl Acad. Sci. USA 110(25), Zheng Y, Wang JL, Liu C, Wang CP, Walker T, Wang YF (2011) Differentially expressed profiles in the larval testes of Wolbachia infected and uninfected Drosophila. BMC Genomics.12:595.doi: / Zhou WG, Rousset F, O'Neill SL (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond B Biol Sci 265:

90 ΕΙΣΑΓΩΓΗ Zhu Y, Fournier PE, Eremeeva M, Raoult D (2005) Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii. BMC Microbiol 5:11 Zhukova MV, Kiseleva E (2012) The virulent Wolbachia strain wmelpop increases the frequency of apoptosis in the female germline cells of Drosophila melanogaster. BMC Microbiology,12(Suppl 1):S15. Ziebell H, Murphy AM, Groen SC, Tungadi T, Westwood JH, Lewsey MG, et al. (2011) Cucumber mosaic virus and its 2b RNA silencing suppressor modify plant-aphid interactions in tobacco. Sci. Rep. 1, 187. doi: /srep00187 Zientz E, Dandekar T, Gross R (2004) Metabolic interdependence of obligate intracellular bacteria and their insect hosts. Microbiology and Molecular Biology Reviews 68: Zouache K, Michelland RJ, Failloux AB, Grundmann GL, Mavinqui P (2012) Chikungunya virus impacts the diversity of symbiotic bacteria in mosquito vector. Mol. Ecol. 21, Zug R, Hammerstein P (2012) Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7(6):e doi: /journal.pone Epub 2012 Jun 7. PMID:

91 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. ΚΕΦΑΛΑΙΟ 2 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. 2.1 ΕΙΣΑΓΩΓΗ ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Συλλογή δειγμάτων και απομόνωση DNA Ανίχνευση του βακτηρίου Wolbachia με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης Χαρακτηρισμός των βακτηριακών στελεχών με τη χρήση MLST Γενετική ταυτοποίηση του ξενιστή μέσω του mt γονιδίου COII Επεξεργασία δεδομένων Φυλογενετική Ανάλυση - Ανίχνευση γενετικού ανασυνδυασμού ΑΠΟΤΕΛΕΣΜΑΤΑ Ανίχνευση του βακτηρίου Wolbachia σε πληθυσμούς της μύγας τσε-τσε Χαρακτηρισμός των πολλαπλών στελεχών Wolbachia Φυλογενετική ανάλυση στελεχών Wolbachia Φυλογενετική ανάλυση με βάση το γονίδιο gatb Φυλογενετική ανάλυση με βάση το γονίδιο coxa Φυλογενετική ανάλυση με βάση το γονίδιο hcpa Φυλογενετική ανάλυση με βάση το γονίδιο ftsz Φυλογενετική ανάλυση με βάση το γονίδιο fbpa Φυλογενετική ανάλυση με βάση το γονίδιο wsp Φυλογενετική ανάλυση με βάση το γονίδιο 16S rrna Συσχέτιση φυλογενειών Wolbachia-ξενιστή ΣΥΖΗΤΗΣΗ Ανίχνευση του βακτηρίου Wolbachia σε φυσικούς και εργαστηριακούς πληθυσμούς Glossina spp Γενετική ταυτοποίηση και φυλογενετική ανάλυση των στελεχών Wolbachia που απαντούν στα είδη Glossina Απόκλιση μορφολογικής-γενετικής ταυτοποίησης ξενιστή και ο ρόλος του βακτηρίου Wolbachia ΒΙΒΛΙΟΓΡΑΦΙΑ

92 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. 2.1 ΕΙΣΑΓΩΓΗ Οι μύγες τσε-τσε ανήκουν στο γένος Glossina και είναι οι κύριοι φορείς των Τρυπανοσωμάτων στην Αφρική, το οποίο προκαλεί την Ανθρώπινη Αφρικανική Τρυπανοσωμίαση (Human African Trypanosomiasis-HAT) ή ασθένεια του ύπνου στον άνθρωπο, και την αντίστοιχη ασθένεια στα ζώα, γνωστή ως nagana (Animal African Trypanosomiasis-AAT) (Welburn et al. 2001). Διεθνείς οργανισμοί εκτιμούν ότι η επιβάρυνση της υγείας των κατοίκων και η οικονομική απώλεια για την τοπική κτηνοτροφία είναι σε σημαντικά υψηλά και αβάσταχτα επίπεδα (Cattand 1995, Kioy et al. 2004, Simarro et al. 2011). Με στόχο τον περιορισμό τους, κρίνεται αναγκαία η ανάπτυξη και εφαρμογή μιας πιο αποτελεσματικής, βιώσιμης και φιλικής προς το περιβάλλον μεθόδου ελέγχου της μύγας τσε-τσε και των Τρυπανοσωμιάσεων (Rio et al. 2004, Aksoy & Rio 2005, Aksoy 2011). Η πρώτη περιγραφή του βακτηρίου Wolbachia στη μύγα τσε-τσε έγινε το 1993 από τους O Neill και συνεργάτες (O Neill et al. 1993). Βασίστηκε στη μέθοδο PCR και συγκεκριμένα στην ενίσχυση ενός τμήματος του γονιδίου 16S rrna, με τη χρήση εξειδικευμένων εκκινητών για Wolbachia. Το βακτήριο εντοπίστηκε στους αναπαραγωγικούς ιστούς των ειδών Glossina morsitans morsitans, G. m. centralis, G. austeni και G. brevipalpis, ενώ δε βρέθηκε στα είδη G. m. submorsitans, G. palpalis palpalis, G. p. gambiensis και G. fuscipes fuscipes. Σε μεταγενέστερη μελέτη των Cheng και συνεργατών, χρησιμοποιήθηκε η εξειδικευμένη PCR ενίσχυση τριών γονιδίων Wolbachia (16S rrna, ftsz και wsp) για την ανίχνευση του βακτηρίου. Το βακτήριο Wolbachia ανιχνεύθηκε σε εργαστηριακούς και φυσικούς πληθυσμούς των ειδών G. brevipalpis και G. swynnertoni, μόνο σε εργαστηριακούς πληθυσμούς των ειδών G. m. centralis, G. m. morsitans, G. pallidipes και G. longipinnis, και σε φυσικούς πληθυσμούς G. austeni. Αντίθετα, δεν εντοπίστηκε σε εργαστηριακούς και φυσικούς πληθυσμούς των ειδών G. tachinoides και G. fuscipes fuscipes, σε εργαστηριακούς πληθυσμούς G. palpalis palpalis και G. p. gambiensis, σε φυσικούς πληθυσμούς G. pallidipes και G. longipinnis (Cheng et al. 2000). Συνοπτικά, παρατηρήθηκε μεγάλη διακύμανση στην παρουσία του βακτηρίου Wolbachia (από 0-100%) τόσο μεταξύ των διαφορετικών ειδών Glossina όσο και μεταξύ φυσικών και εργαστηριακών πληθυσμών του ίδιου είδους. Με βάση τη φυλογενετική ανάλυση, τα στελέχη που ανιχνεύθηκαν στα διάφορα είδη Glossina ήταν διαφορετικά μεταξύ τους και κατατάχθηκαν στην υπερομάδα Α (Zhou et al. 1998, Cheng et al. 2000). Πιο αναλυτικά, τα στελέχη που βρέθηκαν στα είδη G. m. morsitans, G. m. centralis και G. brevipalpis ήταν αρκετά συγγενικά μεταξύ τους και ανήκουν στην ίδια υποομάδα της υπερομάδας Α, ενώ το στέλεχος από το G. austeni διέφερε σημαντικά 82

93 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. σχηματίζοντας διακριτή υποομάδα, αρκετά μακριά από τα υπόλοιπα στελέχη των ειδών Glossina, εντός της υπερομάδας Α (Zhou et al. 1998, Cheng et al. 2000). Λαμβάνοντας υπόψη την αναποτελεσματικότητα των έως τώρα μεθόδων καταπολέμησης (κυρίως χημικοί) της Τρυπανοσωμίασης και των αρνητικών επιπτώσεών τους στο περιβάλλον, το ερευνητικό ενδιαφέρον στρέφεται προς την ανάπτυξη νέων, αποδοτικών και φιλικών στο περιβάλλον μεθόδων περιορισμού των φορέων του τρυπανοσώματος, δηλαδή της μύγας τσε-τσε. Αφενός τα θετικά αποτελέσματα που προέκυψαν από τη χρήση του βακτηρίου Wolbachia σε μεθόδους καταπολέμησης φορέων ασθενειών π.χ. κουνούπι και δάγκειος ιός (Hoffmann et al. 2011, Walker et al. 2011), και αφετέρου τα πρώτα ευρήματα για την ύπαρξη στη φύση του βακτηρίου σε διάφορα είδη Glossina, ενίσχυσαν την ανάγκη εκτενής μελέτης της συμβιωτικής σχέσης Wolbachia-Glossina. Πιθανοί μηχανισμοί ελέγχου των πληθυσμών Glossina που στηρίζονται στις ιδιότητες του βακτηρίου Wolbachia είναι : α) η τεχνική του ασύμβατου εντόμου (Incompatible Insect Technique, ΙΙΤ) ως μηχανισμός καταστολής, κάτι αντίστοιχο με την τεχνική του στείρου εντόμου (Sterile Insect Technique, SIT), β) η χρήση του ως μέσο μετάδοσης επιθυμητών φαινοτύπων, γ) ως οδηγός παρα-διαγονιδιακών (paratransgenic) εργαστηριακών στελεχών από μύγες τσε-τσε (ανθεκτικών στο τρυπανόσωμα) πoυ θα τις κατευθύνει μέσα σε φυσικούς πληθυσμούς, αντικαθιστώντας αυτούς που είναι ευάλωτοι στο τρυπανόσωμα, και τέλος, δ) η πιθανή ενίσχυση της ανθεκτικότητας της μύγας τσε-τσε έναντι του τρυπανοσώματος από συγκεκριμένα βακτηριακά στελέχη Wolbachia σε συνδυασμό με τις μολυσματικές ιδιότητες ορισμένων από αυτών, όπως του στελέχους wmelpop (McMeniman et al. 2009, Doudoumis et al. 2013). Γίνεται αντιληπτό ότι οποιαδήποτε προσπάθεια ανάπτυξης των παραπάνω καινοτόμων μεθόδων ελέγχου της μύγας τσε-τσε και των Τρυπανοσωμιάσεων, προϋποθέτουν την πλήρη διερεύνηση των πολυσύνθετων αλληλεπιδράσεων μεταξύ Wolbachia-ξενιστή. Προς αυτή την κατεύθυνση, στην ενότητα αυτή μελετήθηκαν: α) η ανίχνευση του βακτηρίου Wolbachia σε φυσικούς και εργαστηριακούς πληθυσμούς Glossina spp. με τη μέθοδο της αλυσιδωτής αντίδρασης της πολυμεράσης, β) ο χαρακτηρισμός των βακτηριακών στελεχών με τη χρήση των MLST και wsp γενετικών μαρτύρων, γ) η φυλογένεια των στελεχών Wolbachia που βρέθηκαν στα διάφορα είδη Glossina, και τέλος, δ) η μοριακή ταυτοποίηση του ξενιστή μέσω της ενίσχυσης του mtcoii. Τα αποτελέσματα που προέκυψαν ανέδειξαν τη μεγάλη διακύμανση στη συχνότητα παρουσίας του βακτηρίου στη μύγα τσε-τσε τόσο μεταξύ ειδών όσο και μεταξύ πληθυσμών του ίδιου είδους, ενισχύοντας έτσι τα αποτελέσματα των αρχικών μελετών. Παράλληλα, βρέθηκε για πρώτη φορά στη μύγα τσε-τσε η παρουσία πολλαπλών στελεχών Wolbachia μέσα στο ίδιο 83

94 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. άτομο σε διάφορα είδη Glossina. Με βάση τη φυλογενετική ανάλυση, τα στελέχη Wolbachia που απαντούν στη μύγα τσε-τσε ανήκουν στις υπερομάδες Α (η πλειοψηφία), Β και F. Αυτή η τεράστια γενετική ποικιλότητα πιθανά μαρτυρά εκτεταμένα γεγονότα οριζόντιας μεταβίβασης στελεχών Wolbachia από μη συγγενικά είδη, σύνηθες φαινόμενο για το βακτήριο Wolbachia. Τέλος, η γενετική ταυτοποίηση του ξενιστή, σε ορισμένες περιπτώσεις έδειξε απόκλιση από την αντίστοιχη μορφολογική. Το εύρημα αυτό σε σχέση με την κατανομή των στελεχών Wolbachia στα αντίστοιχα είδη ξενιστών, ίσως καταδεικνύει φαινόμενα εισδοχικού υβριδισμού (introgressive hybridization) στο γένος Glossina και πιθανή συμβολή του βακτηρίου Wolbachia σε ειδογενετικές διαδικασίες. 84

95 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. 2.2 ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ Συλλογή δειγμάτων και απομόνωση DNA Η συλλογή των εντόμων των φυσικών πληθυσμών έγινε σε 13 χώρες της Αφρικής (Tanzania, South Africa, Zambia, Zimbabwe, Senegal, Guinea, Ethiopia, Mali, Ghana, Burkina Faso, Kenya, Uganda, and Democratic Republic of Congo). Αμέσως μετά την άφιξή τους στο εργαστήριο IPCL (Insect Pest Control Laboratory, Seibersdorf) του FAO / IAEA (Food and Agriculture Organization / International Atomic Energy Agency, Agriculture and Biotechnology Laboratory) έγινε η απομόνωση του γενετικού υλικού, και αυτό διατηρήθηκε στους -20ºC μέχρι τη χρήση του. Επίσης, τα εργαστηριακά στελέχη που αναλύθηκαν, προήλθαν από τις αποικίες των εργαστηριών: FAO / IAEA Seibersdorf (Insect Pest Control Laboratory), Yale LEPH (Yale University School of Public Health, Laboratory of Epidemiology and Public Health), Kenya KARI-TRC (Kenya Agricultural Research Institute-Trypanosomiasis Research Centre), Burkina Faso CIRDES (Centre International de Recherche-Développement sur l Elevage en zone Subhumide), SAS-Bratislava (Institute of Zoology, Department of Entomology, Slovak Academy of Science), Antwerp (Institute of Tropical Medicine), Lab-Malele (Tsetse and Trypanosomiasis Research Institute, Tanga, Tanzania) [Πίνακας 2.1]. Η απομόνωση ολικού DNA από τα ενήλικα άτομα έγινε στο εργαστήριο IPCL με τη χρήση του Qiagen DNeasy kit (Qiagen, Valencia, CA) ακολουθώντας τις οδηγίες του κατασκευαστή, εκτός από τα άτομα των αποικιών SAS-Bratislava και Antwerp, των οποίων η απομόνωση ολικού DNA πραγματοποιήθηκε στο εργαστήριο μας με τη μέθοδο CTAB (Cetyl trimethyl ammonium bromide) (Doyle & Doyle 1990) (Αναλυτικά το πρωτόκολλο στο Παράρτημα, Π.1). Πίνακας 2.1. Προέλευση δειγμάτων που μελετήθηκαν στην παρούσα διατριβή (φυσικοί πληθυσμοί από 13 Αφρικάνικες χώρες και εργαστηριακές αποικίες από 7 διαφορετικά εργαστήρια). Είδη Glossina Χώρα (Περιοχή, Έτος συλλογής) Tanzania (Jozani, 1997) Tanzania (Zanzibar, 1995) G. austeni South Africa (Zululand, 1999) Kenya (Shimba Hills, 2010) 85

96 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Coastal Tanzania (Muhoro, Rufiji Tanzania) Seibersdorf lab-colony (1995) Seibersdorf lab-colony (1995) G. brevipalpis Lab (Coastal Tanzania-Pangani, Tanga Tanzania) South Africa (Zululand, 1995) Coastal Tanzania (Muhoro, Rufiji Tanzania) Seibersdorf lab-colony (1995) G. f. fuscipes Uganda (Buvuma island, 1994) G. medicorum Burkina Faso (Comoe, 2008) G. m. centralis Yale lab-colony (2008) Burkina Faso (Nazinga, 2009) G. m. submorsitans Burkina Faso (Comoe Folonzo, 2007) Burkina Faso (Comoe, 2008) Seibersdorf lab-colony (1995) G. p. palpalis Democratic Republic of Congo (Zaire, 1995) Ghana Seibersdorf lab-colony (1995) Burkina Faso (Nazinga, 2009) Burkina Faso (Comoe Folonzo, 2007) G. tachinoides Burkina Faso (Comoe, 2008) Ghana (Pong Tamale, Walewale, 2008) Ghana (Walewale, 2008) Ghana (Fumbissi, 2008) Coastal Tanzania (Utete, Rufiji Tanzania) Zambia (MFWE, Eastern Zambia, 2007) KARI-TRC lab-colony (2008) Tanzania (Ruma, 2005) Zimbabwe (Gokwe, 2006) G. m. morsitans Zimbabwe (Kemukura, 2006) Zimbabwe (M.Chiuy, 1994) Zimbabwe (Makuti, 2006) Zimbabwe (Mukond, 1994) Zimbabwe (Mushumb, 2006) Zimbabwe (Rukomeshi, 2006) 86

97 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Yale lab-colony (2008) Antwerp lab-colony (2010) Bratislava lab-colony (2010) Zambia (MFWE, Eastern Zambia, 2007) KARI-TRC lab-colony (2008) Kenya (Mewa, Katotoi, Meru national park, 2007) Ethiopia (Arba Minch, 2007) Seibersdorf lab-colony (2008) Tanzania (Ruma, 2005) Tanzania (Mlembuli and Tunguli, 2009) G. pallidipes G. p. gambiensis Zimbabwe (Mushumb, 2006) Zimbabwe (Gokwe, 2006) Zimbabwe (Rukomeshi, 2006) Zimbabwe (Makuti, 2006) Lab (Mainland Uganda, UGA /IAEA) Mainland Tanzania (Death Valley Tanzania,Naitolia Arusha) Coastal Tanzania (Muhoro, Rufiji Tanzania) Coastal Tanzania (Muyuyu, Rufiji Tanzania) CIRDES lab-colony (1995) CIRDES lab-colony (2005) Senegal (Diacksao Peul and Pout, 2009) Guinea (Kansaba, Mini Pontda, Kindoya and Ghada Oundou, 2009) Guinea (Alahine, 2009) Guinea (Boureya Kolonko, 2009) Guinea (Fefe, 2009) Guinea (Kansaba, 2009) Guinea (Kindoya, 2009) Guinea (Lemonako, 2009) Guinea (Togoue, 2009) Guinea (Conakry, 2010) Burkina Faso (Comoe, 2008) Burkina Faso (Comoe Folonzo, 2007) 87

98 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Burkina Faso (Kenedougou, 2007) Burkina Faso (Houet Bama, 2007) Guinea (Fefe, Togoue, Alahine, Boureya Kolonko, ) Guinea ( Boureya Kolonko, Kansaba, Kindoya, Ghada Oundou, ) Mali (Fijira, 2009) Senegal (Diaka Madia, 2009) Senegal (Tambacounda, 2008) Senegal (Simenti, 2008) Senegal (Kédougou, 2008) Ανίχνευση του βακτηρίου Wolbachia με τη μέθοδο της αλυσιδωτής αντίδρασης της πολυμεράσης Η ανίχνευση του βακτηρίου βασίστηκε στη μέθοδο PCR και συγκεκριμένα στην ενίσχυση ενός τμήματος του γονιδίου 16S rrna μεγέθους 438 bp με τη χρήση των εξειδικευμένων για Wolbachia εκκινητών wspecf και wspecr (Werren & Windsor 2000) [Πίνακας εκκινητών 2.2]. Στα δείγματα του είδους G. f. fuscipes ακολουθήθηκε η μέθοδος της επανενίσχυσης (Reamplification). Κατά τη μέθοδο της επανενίσχυσης, και οι δύο ενισχύσεις έγιναν με τον ίδιο ακριβώς τρόπο και με τους ίδιους εκκινητές όπως η συμβατική PCR, η μόνη διαφορά ήταν ότι κατά την επαναληπτική (δεύτερη) PCR χρησιμοποιήθηκε ως template (εκμαγείο) DNA μικρή ποσότητα (1μl) του αρχικού PCR προϊόντος. Επιπλέον, ως θετικός μάρτυρας για τον έλεγχο της ποιότητας απομόνωσης του DNA χρησιμοποιήθηκε το μιτοχονδριακό γονίδιο 12S rrna. Συγκεκριμένα ενισχύθηκε τμήμα του γονιδίου μεγέθους 377 bp, με τους εκκινητές 12SCFR και 12SCRR (Hanner & Fugate 1997) [Πίνακας εκκινητών 2.2]. Οι αντιδράσεις PCR πραγματοποιήθηκαν σε τελικό όγκο 20 μl και κάθε αντίδραση περιείχε: 4 μl 5x ρυθμιστικό διάλυμα (Promega), 1.6 μl MgCl2 (25mM), 0.1 μl dntps (25 mm το καθένα), 0.5 μl από από κάθε εκκινητή (25 μm), 0.1 μl of Taq (Promega 1U/μl), 12.2 μl νερό και 1 μl από ολικό DNA (~50 ng). Οι αντιδράσεις έγιναν με τη χρήση του θερμοκυκλοποιητή PTC-200 της εταιρίας MJ Research ενώ το πρόγραμμα που ακολουθήθηκε ήταν το εξής: Αρχική αποδιάταξη της δίκλωνης αλυσίδας του DNA στους 95 o C για 5 min. 35 κύκλοι 88

99 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. o Αποδιάταξη στους 95 o C για 30 sec. o Υβριδοποίηση των εκκινητών για 30 sec χρησιμοποιώντας τις θερμοκρασίες που αναγράφονται στον Πίνακα 2.2 ανάλογα με το γονίδιο που ενισχύεται. o Ενίσχυση στους 72 o C για 1 min. Τελικό στάδιο στους 72 o C για 10 min. Διατήρηση των δειγμάτων στους 4 o C. Μετά το πέρας των αντιδράσεων ακολούθησε η ηλεκτροφόρηση των προϊόντων σε πήκτωμα αγαρόζης συγκέντρωσης 2% σε διάλυμα 1Χ Tris-Acetate-EDTA (0.04 Μ Tris-acetate, 0.001M EDTA) το οποίο περιείχε 100 ug βρωμιούχο αιθίδιο για τον προσδιορισμό του μεγέθους του ενισχυμένου γονιδιακού τμήματος. 89

100 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Πίνακας 2.2. Οι εκκινητές που χρησιμοποιήθηκαν για την ανίχνευση του βακτηρίου Wolbachia, το χαρακτηρισμό των στελεχών Wolbachia, καθώς και για την ταυτοποίηση του ξενιστή. Όνομα Αλληλουχία (5-3 ) Γονίδιο Προϊόν gatb_f1 gatb_r1 coxa_f1 coxa_r1 hcpa_f1 hcpa_r1 ftsz_f1 ftsz_r1 fbpa_f1 fbpa_r1 wsp_f1 wsp_r1 wspecf wspecr 12SCFR 12SCRR C2-N-3389 TL2-J SF1 16SR1 Τ7 SP6 GAKTTAAAYCGYGCAGGBGTT TGGYAAYTCRGGYAAAGATGA TTGGRGCRATYAACTTTATAG CTAAAGACTTTKACRCCAGT GAAATARCAGTTGCTGCAAA GAAAGTYRAGCAAGYTCTG ATYATGGARCATATAAARGATAG TCRAGYAATGGATTRGATAT GCTGCTCCRCTTGGYWTGAT CCRCCAGARAAAAYYACTATTC GTCCAATARSTGATGARGAAAC CYGCACCAAYAGYRCTRTAAA YATACCTATTCGAAGGGATAG AGCTTCGAGTGAAACCAATTC GAGAGTGACGGGCGATATGT AAACCAGGATTAGATACCCTATTAT TCATAAGTTCAGTATCATTG AATATGGCAGATTAGTGCA GCTGGCGGCAGGCCTAACA ACAACAGTATAGCACACAACAACACCA TAATACGACTCACTATAGGG ATTTAGGTGACACTATAGAATA α Βάσει του wmel γονιδιώματος gatb coxa hcpa glutamyl-trna(gln) amidotransferase, subunit B cytochrome c oxidase, subunit I conserved hypothetical protein Μέγεθος προϊόντος (bp) θερμοκρασία Υβριδοποίησης ( o C) Αναφορές 471 α 54 C Baldo et al. 2006a 487 α 55 C Baldo et al. 2006a 515 α 56 C Baldo et al. 2006a ftsz cell division protein 524 α 52 C Baldo et al. 2006a fbpa fructosebisphosphatealdolase 509 α 58 C Baldo et al. 2006a wsp Outer surface protein 606 α 58 C Baldo et al. 2006a 16S rrna 16S ribosomal RNA 438 α 54 C 12S rrna COII mtdna mitochondrial 12S ribosomal RNA mitochondrial cytochrome oxidase subunit II Werren & Windsor C Hanner & Fugate C Simon et al. 1994, Frati et al S rrna 16S ribosomal RNA C Μη δημοσιευμένοι T7promoter SP6 promoter C Dunn & Studier 1983 Brown et al

101 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp Χαρακτηρισμός των βακτηριακών στελεχών με τη χρήση MLST Η γενετική ταυτοποίηση των στελεχών Wolbachia έγινε βάσει του συστήματος MLST και του γενετικού τόπου wsp χρησιμοποιώντας τους εκκινητές: gatb_f1/gatb_r1, coxa_f1/coxa_r1, hcpa_f1/hcpa_r1, ftsz_f1/ftsz_r1, fbpa_f1/fbpa_r1 και wsp_f1/wsp_r1, σύμφωνα με τους Baldo και συνεργάτες (Baldo et al. 2006a) [Πίνακας εκκινητών 2.2]. Επιλέχθηκαν συνολικά 29 αντιπροσωπευτικά δείγματα από φυσικούς και εργαστηριακούς πληθυσμούς με κριτήρια το είδος του ξενιστή και την προέλευσή του. Οι αντιδράσεις PCR πραγματοποιήθηκαν στις ίδιες συνθήκες που περιγράφονται στην προηγούμενη ενότητα (2.2.2). Εξαιτίας της εμφάνισης προϊόντων ενίσχυσης με μη αναμενόμενα μεγέθη και τις ενδείξεις για την ύπαρξη πολλαπλών στελεχών Wolbachia, όλα τα PCR προϊόντα των γονιδίων 16S rrna, wsp και MLST (gatb, coxa, hcpa, ftsz και fbpa) των 29 επιλεγμένων δειγμάτων (με εξαίρεση το δείγμα G. m. centralis-gmcy για το οποίο έγινε απευθείας αλληλούχιση των προϊόντων ενίσχυσης) κλωνοποιήθηκαν στο φορέα pgem-t Easy vector (Pomega) σύμφωνα με τις υποδείξεις των κατασκευαστών. Ο ανασυνδυασμένος φορέας χρησιμοποιήθηκε για να μετασχηματίσει τα επιδεκτικά κύτταρα DH5α. Η ταυτοποίηση των ανασυνδυασμένων κλώνων έγινε με χρωματικό διαχωρισμό των αποικιών (blue white selection) σε στερεό θρεπτικό μέσο LB που περιείχε 100μg/ml αμπικιλίνη, 0.5mM IPTG και 80μg/ml X-Gal (Αναλυτικά το πρωτόκολλο παρουσιάζεται στο Παράρτημα, Π.2). Οι λευκές ανασυνδυασμένες αποικίες ελέγχθηκαν για την παρουσία του επιθυμητού ενθέματος μέσω colony PCR με τη χρήση των εκκινητών Τ7 και SP6 [Πίνακας εκκινητών 2.2]. Οι αντιδράσεις PCR πραγματοποιήθηκαν σε τελικό όγκο 50 μl και κάθε αντίδραση περιείχε: 5 μl 10x ρυθμιστικό διάλυμα (Homemade), 4 μl MgCl2 (25mM), 0.25 μl dntps (25 mm το καθένα), 0.25 μl από από κάθε εκκινητή (100 μm), 0.25 μl of Taq (Homemade 1U/μl) και 40 μl νερό. Οι αντιδράσεις έγιναν με τη χρήση του θερμοκυκλοποιητή PTC-200 της εταιρίας MJ Research ενώ το πρόγραμμα που ακολουθήθηκε ήταν το εξής: Αρχική αποδιάταξη της δίκλωνης αλυσίδας του DNA στους 95 o C για 5 min. 35 κύκλοι o Αποδιάταξη στους 95 o C για 30 sec. o Υβριδοποίηση των εκκινητών για 30 sec στους 53 o C o Ενίσχυση στους 72 o C για 2:00 min. Τελικό στάδιο στους 72 o C για 10 min. Διατήρηση των δειγμάτων στους 4 o C. 91

102 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Μετά το πέρας της αντίδρασης ακολουθούσε ηλεκτροφόρηση μικρής ποσότητας των προϊόντων (~5μl) σε πήκτωμα αγαρόζης 2% για την επαλήθευση της ύπαρξης DNA. Στη συνέχεια, τα PCR προϊόντα καθαρίζονταν, χρησιμοποιώντας ένα πρωτόκολλο επιλεκτικής κατακρήμνισης με polyethylene glycol (PEG) (Sambrook et al. 1989), για την απομάκρυνση των ολιγονουκλεοτιδίων (Αναλυτικά το πρωτόκολλο παρουσιάζεται στο Παράρτημα, Π.3). Η αντίδραση αλληλούχισης όλων των προϊόντων και για τις δύο αλυσίδες έγινε με τη χρήση του BigDye Terminator v3.1 Cycle Sequencing Kit (PE Applied Biosystems) και τους εκκινητές T7 και SP6, αντίστοιχα για κάθε μια αλυσίδα (Αναλυτικά το πρωτόκολλο παρουσιάζεται στο Παράρτημα, Π.4). Τέλος, η ανάλυση των αντιδράσεων αλληλούχισης πραγματοποιήθηκε στο γενετικό αναλυτή ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems) του εργαστηρίου μας. Σε ορισμένες περιπτώσεις ενίσχυσης γονιδίων και δειγμάτων (βλέπε συνέχεια Πίνακας 2.3), λόγω μικρής έντασης του αντίστοιχου προϊόντος, ακολουθήθηκε η μέθοδος της επανενίσχυσης (Re-amplification) ή η μέθοδος της εμφωλιασμένης PCR (Nested PCR). Κατά τη μέθοδο της επανενίσχυσης, και οι δύο ενισχύσεις έγιναν με τον ίδιο ακριβώς τρόπο και με τους ίδιους εκκινητές, η μόνη διαφορά ήταν ότι κατά την επαναληπτική (δεύτερη) PCR χρησιμοποιήθηκε ως template (εκμαγείο) DNA μικρή ποσότητα (1μl) του αρχικού PCR προϊόντος. Κατά την τεχνική της εμφωλιασμένης PCR, μικρή ποσότητα (1μl) του αρχικού PCR προϊόντος χρησιμοποιείται ως template DNA, για την ενίσχυση μικρότερου τμήματος από το αρχικό προϊόν. Η Nested PCR εφαρμόστηκε μόνο για το γονίδιο 16S rrna και για μόλις σε 5 δείγματα χρησιμοποιώντας τους εκκινητές 16SF1 / 16SR1 στην αρχική PCR με χρόνο επιμήκυνσης για κάθε κύκλο 90 sec, και τους εσωτερικούς εκκινητές wspecf / wspecr για την εμφωλιασμένη PCR [Πίνακας εκκινητών 2.2]. Όλες οι αντιδράσεις των επανενισχύσεων και των εμφωλιασμένων PCR πραγματοποιήθηκαν με τον ίδιο τρόπο που περιγράφηκε στην ενότητα Γενετική ταυτοποίηση του ξενιστή μέσω του mt γονιδίου COII Η γενετική ταυτοποίηση του εντόμου ξενιστή προσδιορίστηκε με την ενίσχυση του μιτοχονδριακού γονιδίου mtcoii χρησιμοποιώντας τους γενικούς εκκινητές C2-N-3389 (mtd- 15) (Simon et al. 1994) και TL2-J-3037 (mtd-13) (Frati et al.1997) [Πίνακας εκκινητών 2.2]. Οι αντιδράσεις PCR πραγματοποιήθηκαν όπως περιγράφεται στην ενότητα με τη διαφορά ότι ο τελικός όγκος της κάθε αντίδρασης ήταν 50 μl προκειμένου να παραχθεί ικανοποιητική ποσότητα DNA (~1-2 μg) για τον προσδιορισμό της νουκλεοτιδικής αλληλουχίας. Μετά το πέρας της αντίδρασης ακολουθούσε ηλεκτροφόρηση μικρής ποσότητας των προϊόντων (~5μl) σε 92

103 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. πήκτωμα αγαρόζης 2% για την επαλήθευση της ύπαρξης DNA. Στη συνέχεια, τα PCR προϊόντα καθαρίζονταν χρησιμοποιώντας ένα πρωτόκολλο επιλεκτικής κατακρήμνισης με polyethylene glycol (PEG) (Sambrook et al. 1989) για την απομάκρυνση των ολιγονουκλεοτιδίων (Αναλυτικά το πρωτόκολλο παρουσιάζεται στο Παράρτημα, Π.3). Η αντίδραση αλληλούχισης, όλων των προϊόντων και για τις δύο αλυσίδες, έγινε με τη χρήση του BigDye Terminator v3.1 Cycle Sequencing Kit (PE Applied Biosystems) και τους εκκινητές (mtd-15) και (mtd-13) αντίστοιχα για κάθε μια αλυσίδα (Αναλυτικά το πρωτόκολλο παρουσιάζεται στο Παράρτημα, Π.4). Τέλος, η ανάλυση των αντιδράσεων αλληλούχισης πραγματοποιήθηκε στο γενετικό αναλυτή ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems) του εργαστηρίου μας Επεξεργασία δεδομένων Τα ανεπεξέργαστα αποτελέσματα της διαδικασίας αλληλούχησης (χρωματογραφήματα) ελέγχθηκαν για πολλαπλές κορυφές και υψηλό θόρυβο με το πρόγραμμα SeqManII του λογισμικού πακέτου DNAStar 5.0. Με το ίδιο πρόγραμμα προσδιορίστηκε επίσης η αμφίκλωνη συναινετική αλληλουχία (consensus sequence) για κάθε τμήμα γονιδίου που ενισχύθηκε, ενώνοντας τα διαφορετικής κατεύθυνσης επιμέρους γονιδιακά τμήματα που προέκυψαν με κάθε εκκινητή. Τουλάχιστον τρεις κλώνοι αλληλουχήθηκαν και αναλύθηκαν, για κάθε δείγμα και για κάθε γενετικό τόπο, ακολουθώντας την προσέγγιση majority-rule consensus. Επίσης, λόγω των πολλαπλών πολυμορφισμών, οι αλληλουχίες που δεν εντοπίστηκαν ακριβώς ίδιες σε τουλάχιστον δύο διαφορετικά δείγματα ή σε δύο κλώνους του ίδιου δείγματος απορρίφτηκαν ως πιθανά λάθη της πολυμεράσης ή/και της όλης πειραματικής διαδικασίας Φυλογενετική Ανάλυση - Ανίχνευση γενετικού ανασυνδυασμού Για κάθε γονίδιο ξεχωριστά, οι ομόλογες αλληλουχίες μεταφράστηκαν σε πρωτεϊνική αλληλουχία, ελέχθησαν για την ύπαρξη τυχόν κωδικονίων λήξης και ευθυγραμμίστηκαν χρησιμοποιώντας τα προγράμματα MUSCLE (Edgar 2004) και ClustalW (Thompson et al. 1994) μέσω της λογισμικής πλατφόρμας Genious (Drummond et al. 2008). Ακολούθησε οπτική επιβεβαίωση και διόρθωση των ευθυγραμμίσεων, όπου αυτό ήταν απαραίτητο, και στη συνέχεια οι ευθυγραμμισμένες πρωτεϊνικές αλληλουχίες χρησιμοποιήθηκαν για τη δημιουργία των αντίστοιχων ευθυγραμμίσεων σε νουκλεοτιδικό επίπεδο. Οι στοιχισμένες ομόλογες αλληλουχίες των υπό μελέτη γονιδίων εξετάστηκαν ξεχωριστά για την ύπαρξη φαινομένων γενετικού ανασυνδυασμού. Για το σκοπό αυτό χρησιμοποιήθηκε το πρόγραμμα RDP, έκδοση ν (Martin et al. 2010) και οι μέθοδοι MaxChi (Smith 1992, Posada & Crandall 2001), Chimaera (Smith 1992, Posada & Crandall 2001), Geneconv 93

104 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. (Padidam et al. 1999), RDP (Martin & Rybicki 2000) και Bootscan (Salminen et al. 1995). Οι γενικές ρυθμίσεις των παραμέτρων του προγράμματος ήταν οι παρακάτω: όλες οι ακολουθίες θεωρήθηκαν γραμμικές (sequences considered linear), σαν ανώτατο στατιστικά σημαντικό όριο επιλέχτηκε η τιμή 0.001, εφαρμόστηκε στατιστική διόρθωση κατά Bonferroni και η αξιολόγηση της σημαντικότητας έγινε χρησιμοποιώντας 1,000 αντιμεταθέσεις (permutations). Τα αποτελέσματα θεωρούνταν στατιστικά σημαντικά μόνο εάν επαληθεύονταν από δύο τουλάχιστον μεθόδους και προσδιορίζονταν δύο στατιστικά σημαντικά σημεία ρηγμάτων (break points) που να οριοθετούν με ακρίβεια το ανασυνδυασμένο τμήμα της ακολουθίας. Η εκτίμηση των φυλογενετικών σχέσεων μεταξύ των αναλυθέντων γονιδίων (gatb, coxa, hcpa, ftsz, fbpa, wsp, 16S rrna και mtcoii) έγινε με τη μέθοδο μέγιστης πιθανοφάνειας (Maximum-likelihood, ML). Πριν πραγματοποιηθεί η ανάλυση με τη μέθοδο ML επιλέχθηκε για κάθε ομάδα δεδομένων ένα κατάλληλο εξελικτικό μοντέλο χρησιμοποιώντας το πρόγραμμα Modeltest έκδοση 3.7 (Posada & Crandal 1998) με βάση το πληροφοριακό κριτήριο Akaike (Akaike information criterion, AIC) (Akaike 1974). Για τα γονίδια gatb, coxa, hcpa, ftsz, fbpa, wsp, 16S rrna και mtcoii επιλέχθηκαν τα εξής υπομοντέλα: TIM+I+G, TVM+I+G, TrN+G, TrN+I, K81uf+G, TVM+I+G, TrNef+G και TIM+G, αντίστοιχα. Επίσης, επιλέχτηκε η μέθοδος βασισμένη σε χαρακτήρες-ευρετικές μέθοδοι (heuristic methods) και ο έλεγχος αξιοπιστίας του δένδρου περιελάμβανε 1000 επαναληπτικές δοκιμές (bootstrap replicates). Η όλη ανάλυση πραγματοποιήθηκε με το πρόγραμμα PAUP, έκδοση 4.0b10 (Swofford 2002) μέσω της πλατφόρμας Geneious, έκδοση (Drummond et al. 2008). Τα δένδρα για τα γονίδια gatb, coxa, hcpa, ftsz, fbpa, wsp και 16S rrna κατασκευάστηκαν με τη χρήση παραομάδας. Επιλέχτηκε η αλληλουχία από την υπερομάδα D (Brugia malayi) ως παραομάδα σε όλα τα παραπάνω δένδρα εκτός του 16S rrna για το οποίο επιλέχτηκε η αλληλουχία από την υπερομάδα Ι. 94

105 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. 2.3 ΑΠΟΤΕΛΕΣΜΑΤΑ Ανίχνευση του βακτηρίου Wolbachia σε πληθυσμούς της μύγας τσε-τσε Συνολικά 5339 άτομα από 11 διαφορετικά είδη Glossina (G. m. morsitans, G. m. centralis, G. m. submorsitans, G. austeni, G. brevipalpis, G. pallidipes, G. p. palpalis, G. p. gambiensis, G. fuscipes fuscipes, G. tachinoides και G. medicorum) εξετάστηκαν για την παρουσία του βακτηρίου Wolbachia. Συγκεκριμένα, αναλύθηκαν 4778 άτομα από φυσικούς πληθυσμούς μύγας τσε-τσε που συλλέχτηκαν από 13 Αφρικανικές χώρες και 561 άτομα από 8 εργαστηριακά στελέχη. Η παρουσία του βακτηρίου Wolbachia διερευνήθηκε με μια εξειδικευμένη PCR αντίδραση για την ενίσχυση τμήματος του γονιδίου 16S rrna [Εικόνα 2.1], [Πίνακας 2.3]. Εικόνα 2.1. Γεωγραφική κατανομή του βακτηρίου Wolbachia σε φυσικούς πληθυσμούς ειδών Glossina ανά χώρα στην Αφρική. 95

106 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Πίνακας 2.3. Ποσοστά παρουσίας του βακτηρίου Wolbachia σε 8 εργαστηριακά στελέχη Glossina. Είδος εργαστηριακών στελεχών Ποσοστό % ατόμων θετικών σε Wolbachia G. m. morsitans 100% G. m. centralis 100% G. brevipalpis 35.9% G. f. fuscipes 11.1% G. pallidipes 3.3% G. p. gambiensis 0% G. p. palpalis 0% G. tachinoides 0% Το βακτήριο Wolbachia ανιχνεύθηκε σε όλα τα είδη Glossina που μελετήθηκαν. Αναλυτικά, το βακτήριο Wolbachia ανιχνεύθηκε στο 29.4% των ατόμων του morsitans (savannah) group, στο 20% των ατόμων του fusca (forest) group και μόλις στο 5% του palpalis (riverine) group. Στο morsitans group, τα υψηλότερα ποσοστά μόλυνσης βρέθηκαν στα είδη G. m. centralis, G. austeni και G. m. morsitans, με ποσοστά 100%, 88.5% και 88.4%, αντίστοιχα. Αντιθέτως, στα είδη G. pallidipes και G. m. submorsitans ανιχνεύθηκε σε πολύ μικρό ποσοστό των ατόμων. Στο forest group, το βακτήριο Wolbachia βρέθηκε στο 21.3% των ατόμων G. medicorum που μελετήθηκαν, και στο 18.7% των ατόμων G. brevipalpis. Τέλος στο riverine group, το βακτήριο Wolbachia ανιχνεύθηκε σε λίγα άτομα. Συγκεκριμένα, βρέθηκαν θετικά στο βακτήριο το 2.2% των ατόμων G. p. gambiensis που αναλύθηκαν, το 9.6% των ατόμων G. p. palpalis, το 8.4% των ατόμων G. tachinoides και το 12.4% των ατόμων G. f. fuscipes, αντίστοιχα [Εικόνα 2.2]. Σύμφωνα με τα ποσοστά των θετικών σε Wolbachia ατόμων των εργαστηριακών στελεχών, το βακτήριο Wolbachia βρέθηκε σε όλα τα άτομα του είδους G. m. morsitans και G. m. centralis, ενώ στα είδη G. p. gambiensis, G. p. palpalis και G. tachinoides απουσίαζε. Τέλος, στα εργαστηριακά στελέχη των ειδών G. brevipalpis, G. pallidipes και G. f. fuscipes το ποσοστό κυμάνθηκε από 3.3% έως 35.9% [Πίνακας 2.3]. 96

107 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Εικόνα 2.2. Συνολικά ποσοστά παρουσίας του βακτηρίου Wolbachia ανά είδος Glossina Επιπλέον, ιδιαίτερα ανομοιογενή ήταν τα ποσοστά παρουσίας του βακτηρίου μεταξύ διαφορετικών γεωγραφικά πληθυσμών του ίδιου είδους ξενιστή. Πιο συγκεκριμένα, στο είδος G. m. morsitans, αν και η μόλυνση ήταν καθολική στους πληθυσμούς από την Ζάμπια, στους πληθυσμούς από τις περιοχές Mushumb και Gokwe της Ζιμπάμπουε ήταν αρκετά πιο μικρή, 37.5% και 9.5%, αντίστοιχα. Παρομοίως, στους φυσικούς πληθυσμούς του είδους G. pallidipes, το βακτήριο ανιχνεύθηκε σε όλα τα άτομα από την παράκτια περιοχή Muyuyu της Τανζανίας ενώ απουσίαζε από τους πληθυσμούς της Κένυας, των περιοχών Mlembuli και Tunguli της Τανζανίας, καθώς και των περιοχών Mushumb και Gokwe της Ζιμπάμπουε. Επίσης, και στο είδος G. brevipalpis παρατηρήθηκε τεράστια απόκλιση στη συχνότητα του βακτηρίου Wolbachia, αφού στον πληθυσμό από την Νότια Αφρική ήταν μόλις 2%, ενώ στον πληθυσμό από την Τανζανία ήταν 100% [Πίνακας 2.4]. 97

108 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Πίνακας 2.4. Ποσοστά παρουσίας του βακτηρίου Wolbachia σε φυσικούς πληθυσμούς από 13 Αφρικάνικες χώρες και σε εργαστηριακές αποικίες από 7 διαφορετικά εργαστήρια (Οι αριθμοί στην παρένθεση δείχνουν τον αριθμό των θετικών σε Wolbachia ατόμων προς το συνολικό αριθμό των ατόμων που ελέχθησαν). Είδη Glossina Χώρα (Περιοχή, Έτος συλλογής) Ποσοστά ( 1997 (Jozani, Tanzania (22/42) 52.4% ( 1995 (Zanzibar, Tanzania (75/78) 96.2% G. austeni 1999) (Zululand, South Africa (79/83) 95.2% Kenya (Shimba Hills, 2010) (30/30) 100.0% Tanzania) Coastal Tanzania (Muhoro, Rufiji (2/2) 100.0% Seibersdorf lab-colony (1995) (13/33) 39.4% Seibersdorf lab-colony (1995) (1/1) 100% G. brevipalpis Lab (Coastal Tanzania-Pangani, Tanga Tanzania) (0/5) 0.0% 1995) (Zululand, South Africa (1/50) 2.0% Tanzania) Coastal Tanzania (Muhoro, Rufiji (2/2) 100.0% G. f. fuscipes Seibersdorf lab-colony (1995) 1 (4/36) 11.1%, 1 Uganda (Buvuma island, 1994) (7/53) 13.2% G. medicorum 2008) (Comoe, Burkina Faso (20/94) 21.3% G. m. centralis Yale lab-colony (2008) (3/3) 100.0% 2009) (Nazinga, Burkina Faso (0/3) 0.0% 2007) Folonzo, G. m. submorsitans Burkina Faso (Comoe (2/30) 6.7% 2008) (Comoe, Burkina Faso (4/109) 3.7% Seibersdorf lab-colony (1995) (0/36) 0.0% G. p. palpalis 1995) (Zaire, Democratic Republic of Congo (0/48) 0.0% Ghana (32/251) 12.7% Seibersdorf lab-colony (1995) (0/7) 0.0% 2009) (Nazinga, Burkina Faso (0/15) 0.0% 2007) Folonzo, Burkina Faso (Comoe (5/112) 4.5% G. tachinoides 2008) (Comoe, Burkina Faso (0/72) 0.0% 2008) Walewale, Ghana (Pong Tamale, 5/46) 10.9% ( 2008) (Walewale, Ghana (27/149) 18.1% 2008) (Fumbissi, Ghana (0/39) 0.0% G. m. morsitans Tanzania) Coastal Tanzania (Utete, Rufiji (2/3) 66.7% 98

109 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. ( 2007 Zambia, Zambia (MFWE, Eastern (122/122) 100.0% KARI-TRC lab-colony (2008) (89/89) 100.0% 2005) (Ruma, Tanzania (100/100) 100.0% ( 2006 (Gokwe, Zimbabwe (7/74) 9.5% 2006) (Kemukura, Zimbabwe (26/26) 100.0% 1994) (M.Chiuy, Zimbabwe (33/36) 91.7% 2006) (Makuti, Zimbabwe (95/99) 96.0% 1994) (Mukond, Zimbabwe (35/36) 97.2% 2006) (Mushumb, Zimbabwe (3/8) 37.5% 2006) (Rukomeshi, Zimbabwe (98/100) 98.0% Yale lab-colony (2008) (5/5) 100.0% Antwerp lab-colony (2010) (10/10) 100.0% Bratislava lab-colony (2010) (5/5) 100.0% 2007) Zambia, Zambia (MFWE, Eastern (5/203) 2.5% KARI-TRC lab-colony (2008) (3/99) 3.0% ( 2007 park, Kenya (Mewa, Katotoi, Meru national (0/470) 0.0% 2007) Minch, Ethiopia (Arba (2/454) 0.4% Seibersdorf lab-colony (2008) (0/138) 0.0% 2005) (Ruma, Tanzania (3/83) 3.6% 2009) Tunguli, Tanzania (Mlembuli and (0/94) 0.0% 2006) (Mushumb, Zimbabwe (0/50) 0.0% G. pallidipes 2006) (Gokwe, Zimbabwe (0/150) 0.0% ( 2006 (Rukomeshi, Zimbabwe (5/59) 8.5% 2006) (Makuti, Zimbabwe (4/96) 4.2% Lab (Mainland Uganda, UGA /IAEA) (5/5) 100.0% Mainland Tanzania (Death Valley Tanzania,Naitolia Arusha) (4/6) 66.7% Tanzania) Coastal Tanzania (Muhoro, Rufiji (3/4) 75.0% (3/3) 100.0% Tanzania) Coastal Tanzania (Muyuyu, Rufiji CIRDES lab-colony (1995) (0/32) 0.0% G. p. gambiensis CIRDES lab-colony (2005) (0/57) 0.0% (1/188) 0.5% 2009) Pout, Senegal (Diacksao Peul and 99

110 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Guinea (Kansaba, Mini Pontda, Kindoya and Ghada (0/180) 0.0% 2009) Oundou, 2009) (Alahine, Guinea (0/29) 0.0% 2009) Kolonko, Guinea (Boureya (0/36) 0.0% 2009) (Fefe, Guinea (0/29) 0.0% 2009) (Kansaba, Guinea (0/19) 0.0% 2009) (Kindoya, Guinea (1/12) 8.3% ( 2009 (Lemonako, Guinea (0/30) 0.0% 2009) (Togoue, Guinea (0/32) 0.0% 2010) (Conakry, Guinea (5/138) 3.6% 2008) (Comoe, Burkina Faso (0/12) 0.0% 2007) Folonzo, Burkina Faso (Comoe (1/53) 1.9% 2007) (Kenedougou, Burkina Faso (1/37) 2.7% 2007) Bama, Burkina Faso (Houet (1/69) 1.4% Guinea (Fefe, Togoue, Alahine, Boureya Kolonko, ( (5/94) 5.3% Guinea ( Boureya Kolonko, Kansaba, Kindoya, Ghada ) Oundou, (3/94) 3.2% 2009) (Fijira, Mali (0/14) 0.0% 2009) Madia, Senegal (Diaka (0/42) 0.0% 2008) (Tambacounda, Senegal (3/38) 7.9% 2008) (Simenti, Senegal (6/33) 18.2% 2008) (Kédougou, Senegal (1/15) 6.7% * Φυσικοί πληθυσμοί που εξετάστηκαν και για την παρουσία του ιού SGHV. 1 Εφαρμόστηκε η τεχνική της επανενίσχυσης (Re-amplification) Χαρακτηρισμός των πολλαπλών στελεχών Wolbachia Ο μοριακός χαρακτηρισμός των στελεχών Wolbachia στη μύγα τσε-τσε πραγματοποιήθηκε με τη χρήση του συστήματος MLST και του γενετικού μάρτυρα wsp, όπως αναφέρθηκε και στην ενότητα Επιλέξαμε συνολικά 29 μολυσμένα άτομα από αντιπροσωπευτικούς (ως προς το είδος του ξενιστή και την προέλευση τους) φυσικούς και εργαστηριακούς πληθυσμούς με στόχο να καλύψουμε όσο το δυνατόν περισσότερα είδη ξενιστών και γεωγραφικές περιοχές. Έτσι, πραγματοποιήθηκε η ενίσχυση των πέντε MLST συντηρημένων γονιδίων (gatb, coxa, hcpa, ftsz και fbpa) και του wsp γονιδίου (Baldo et al. 2006a) από τα παραπάνω επιλεγμένα δείγματα. 100

111 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Ειδικότερα, χαρακτηρίστηκαν τα στελέχη Wolbachia που ανιχνεύθηκαν σε 5 εργαστηριακά στελέχη και σε 24 φυσικούς πληθυσμούς 10 διαφορετικών ειδών του γένους Glossina. Τα άτομα αυτά προήλθαν από 10 διαφορετικές χώρες και τοποθεσίες της Αφρικής [Πίνακας 2.5]. Η κλωνοποίηση των προϊόντων ενίσχυσης των MLST, 16S rrna και wsp γονιδίων οδήγησε στον εντοπισμό πολλαπλών μολύνσεων Wolbachia μέσα στο ίδιο άτομο για αρκετούς πληθυσμούς Glossina [Πίνακας 2.5]. Συνολικά η ανάλυση αυτή ανέδειξε την ύπαρξη μεγάλου αριθμού αλληλομόρφων για όλους τους γενετικούς τόπους που μελετήσαμε: 16 για το gatb, 14 για το coxa, 11 για το hcpa, 15 για το ftsz, 10 για το fbpa, 15 για το wsp και 12 για το 16S rrna. Επιπρόσθετα, η πλειοψηφία των παραπάνω αλληλουχιών ήταν νέα αλληλόμορφα για όλους τους γενετικούς τόπους σύμφωνα με τη Wolbachia MLST και WSP βάση δεδομένων: 14 για το gatb, 12 για το coxa, 10 για το hcpa, 14 για το ftsz, 8 για το fbpa και 13 για το wsp. Σχετικά με την ύπαρξη πολλαπλών αλληλομόρφων του ίδιου γονιδίου στο ίδιο άτομο προέκυψαν τα εξής: για το γονίδιο gatb ανιχνεύθηκαν από 1 έως 4 αλληλόμορφα, για το coxa από 1 έως 3, για το hcpa από 1 έως 3, για το ftsz από 1 έως 5, για το fbpa 1 ή 2, για το wsp 1 έως 3 και το 16S rrna 1 έως 3 [Πινακας 2.5]. 101

112 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Πίνακας 2.5. MLST και wsp αλληλόμορφα γονίδια των στελεχών Wolbachia σε πολλαπλά μολυσμένα άτομα ειδών Glossina. Κωδικός Είδος Χώρα (Περιοχή, έτος συλλογής) 32.3D G. m. morsitans Zimbabwe (Makuti, 2006) 141, New1 30.9D G. m. morsitans Zimbabwe (Rukomeshi, 2006) GmmY G. m. morsitans Yale lab-colony (2008) MLST γονίδια gatb coxa hcpa ftsz fbpa 127, New1 23, New1, New2 114, 115, New1 15, New1 wsp 356, New1 New , , New1 115, , New1 8, 142, New2, New3 127, 128, New2 23, New3, New2 113, 115, New2, New3, New4 16S rrna Type2 Type2, Type4, Type Type2 24.4A G. m. morsitans KARI-TRC lab-colony 142, New2, (2008) New3, New , New , New3 Type4 12.3A G. m. morsitans Zambia (MFWE, Eastern 127, 128, 23, New3, 141, New1 Zambia, 2007) New1 New , New1 548, New2 Type2 34.7G G. m. morsitans Tanzania (Ruma, 2005) New4 New4 Type3** GmcY G. m. centralis Yale lab-colony (2008) Type2 24.1A G. pallidipes KARI-TRC lab colony (2008) New7 127, , New2 15 New3 Type E G. pallidipes Zambia (MFWE, Eastern Zambia, 2007) New2 128, New2 15 New3 Type3** 32.11G G. pallidipes Zimbabwe (Makuti, 2006) 141, New New7, New2 15, New4 New3 Type3** 30.10G G. pallidipes Zimbabwe (Rukomeshi, 2006) 141, New , New Typ3 34.4A G. pallidipes Tanzania (Ruma, 2005) , New1 15 New4 Type3** 15.5B G. pallidipes Ethiopia (Arba Minch, 2007) Type9 184.Gpp G. p. palpalis Ghana (NA, NA) New5 New4 New4 New5 New2 New6 Type F G. medicorum Burkina Fasso (Comoe, 2008) New6 New5 New6 New6 New3 New5 Type H G. brevipalpis South Africa (Zululand, 129, ) New7 New Type3 09.7G G. brevipalpis Seibersdorf lab-colony (1995) , New Type3 19.Brev G. brevipalpis Tanzania (Coastal Muhoro, Rufiji, F) 143, New , New7 56, New8 15, New5 11 Type7 102

113 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp F G. p. gambiensis Guinea (Kindoya, 2009) , New Type6 05.2B G. austeni South Africa (Zululand, 1999) Type B G. austeni Tanzania (Jozani, 1997, F) Type B G. austeni Tanzania (Zanzibar, 1995) Type B G. austeni Tanzania (Zanzibar, 1995) 128, New Type H G.m.submorsitans Burkina faso (Comoe, 14*, ΜΕΠ 2008) New6* ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ 537.8H G.m.submorsitans Burkina faso (Comoe Folonzo, 2007) ΜΕΠ ΜΕΠ ΜΕΠ New9* ΜΕΠ ΜΕΠ ΜΕΠ 525.5F G.m.submorsitans Burkina faso (Comoe, 2008) ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ New6* ΜΕΠ ΜΕΠ 537.6G G. p.gambiensis Burkina faso(comoe Folonzo, 2007) ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ 10* Type12** 579.6F G. tachinoides Ghana (Walewale, 2008) ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ New6* ΜΕΠ ΜΕΠ 579.7C G. tachinoides Ghana (Walewale, 2008) ΜΕΠ 129*, New7* ΜΕΠ ΜΕΠ ΜΕΠ ΜΕΠ Σύνολο αλληλομόρφων Αριθμός νέων MLST αλληλομόρφων γονιδίων ΜΕΠ: Μη ενίσχυση προϊόντος ικανοποιητική για επιτυχημένη αλληλούχιση * Στα δείγματα αυτά λόγω μικρής έντασης του αρχικού προϊόντος ακολουθήσαμε τη μέθοδο της επανενίσχυσης (Re-amplification) και στη συνέχεια έγινε κανονικά η διαδικασία της κλωνοποίησης όπως αναφέρεται στην ενότητα ** Στα δείγματα αυτά λόγω μικρής έντασης του αρχικού προϊόντος ακολουθήσαμε τη μέθοδο της εμφωλιασμένης PCR (Nested PCR) και στη συνέχεια έγινε η απευθείας αλληλούχιση (βλέπε ενότητα 2.2.3). 103

114 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp Φυλογενετική ανάλυση στελεχών Wolbachia Για καθένα από τα γονίδια MLST γονίδια (gatb, coxa, hcpa, ftsz και fbpa), wsp και 16S rrna δημιουργήθηκε ξεχωριστό φυλογενετικό δένδρο χρησιμοποιώντας όλα τα αλληλόμορφα που βρέθηκαν στα 29 επιλεγμένα δείγματα των πληθυσμών Glossina. Από τον έλεγχο φαινομένων γενετικού ανασυνδυασμού δεν προέκυψαν στατιστικά σημαντικά γεγονότα για τα γονίδια που αναλύθηκαν (gatb, coxa, hcpa, ftsz, fbpa και wsp). Δύο περιπτώσεις πιθανών φαινομένων γενετικού ανασυνδυασμού προέκυψαν για το γονίδιο wsp και αφορούν: α) τα αλληλόμορφα (Al.553), (Al.10) και (Al.551), και β) τα αλληλόμορφα (New5), (Al.10) και (Al.551). Παρόλα αυτά, με βάση την ανάλυση σε καμιά περίπτωση δεν προσδιορίστηκαν δύο στατιστικά σημαντικά σημεία ρηγμάτων (break points) που να οριοθετούν με ακρίβεια το ανασυνδυασμένο τμήμα της ακολουθίας. Συνεπώς, θεωρήθηκαν ανελλιπή τα στοιχεία και δε λήφθηκαν υπόψη σαν φαινόμενα γενετικού ανασυνδυασμού. Σύμφωνα με τη φυλογενετική ανάλυση των επτά γονιδίων προκύπτει ότι η πλειοψηφία των αλληλομόρφων ανήκει στην υπερομάδα Α σχηματίζοντας αρκετές διακριτές υποομάδες, ορισμένα κατατάσσονται στην υπερομάδα Β ενώ υπάρχει μικρός αριθμός αλληλομόρφων που ομαδοποιείται στην υπερομάδα F [Εικόνες ] Φυλογενετική ανάλυση με βάση το γονίδιο gatb Πιο αναλυτικά, για το γονίδιο gatb τα περισσότερα αλληλόμορφα ανήκουν στην υπερομάδα Α σχηματίζοντας 5 υποομάδες: gatb_a.1: περιλαμβάνει 9 αλληλόμορφα [Al.14: G. brevipalpis (011.4H), Al.141: G. m. morsitans (12.3A, 30.9D, 32.3D, 34.7G) - G. m. centralis (GmcY) - G. pallidipes (30.10G, 32.11G, 34.4A), Al.142: G. m. morsitans (24.4A, GmmY), Al.143: G. brevipalpis (09.7G, 19.Brev), New1: G. m. morsitans (12.3A, 32.3D), New2: G. m. morsitans (GmmY, 24.4A) - G. pallidipes (10.10E, 30.10G, 32.11G), New3: G. m. morsitans (GmmY, 24.4A), New4: G. austeni (013.11B) - G. m. morsitans (24.4A), New7: G. pallidipes (24.1A)]. gatb_α.2: περιλαμβάνει το αλληλόμορφο Al.128 που ανιχνεύθηκε σε 4 δείγματα G. austeni (05.2B, 015.1B, B, B). gatb_a.3: συνίσταται από το αλληλόμορφο Al.8 που βρέθηκε στο G. m. morsitans (GmmY). gatb_α.4: αυτή η υποομάδα σχηματίζεται από το αλληλόμορφο New5 που εντοπίστηκε στο άτομο G. p. palpalis (184Gpp). gatb_α.5: συνίσταται από το αλληλόμορφο Al.144 που ανιχνεύτηκε στο δείγμα G. pallidipes (15.5B). 104

115 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Στην υπερομάδα Β κατατάσσονται μόλις δύο αλληλόμορφα, το Al.145 από το δείγμα G. p. gambiensis (405.11F) και το αλληλόμορφο New6 του G. medicorum (523.4F). Στην υπερομάδα F ανήκει το αλληλόμορφο New8 από το άτομο G. brevipalpis (19.Brev) [Εικόνα 2.3]. Αξιοσημείωτο είναι το γεγονός ότι το άτομο G. brevipalpis (19.Brev) φέρει ένα αλληλόμορφο gatb (Al.143) από την υπερομάδα Α και ένα (New8) από την υπερομάδα F. Επίσης τα άτομα G. austeni (013.11B) και G. m. morsitans (GmmY)φέρουν αλληλόμορφα από διαφορετικές υποομάδες της υπερομάδας Α [το G. austeni (013.11B) από τις υποομάδες gatb_α.2 και gatb_α.1, το G. m. morsitans (GmmY) από τις gatb_α.1 και gatb_α.3] [Εικόνα 2.3]. 105

116 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp. Εικόνα 2.3. Φυλογενετικό δένδρο με βάση το γονίδιο gatb (369bp). Τα αλληλόμορφα που ανιχνεύτηκαν είναι με κόκκινα γράμματα (New 1-8, αφορά τα νέα αλληλόμορφα ως προς τη βάση δεδομένων MLST) και με έντονα γράμματα (έχουν καταχωρηθεί στη βάση δεδομένων MLST). Τα άλλα αλληλόμορφα αντιπροσωπεύουν τις υπερομάδες A, B, C, D, F και H. Το UD είναι μη προσδιορισμένη υπερομάδα. Τα στελέχη των αλληλομόρφων έχουν χαρακτηριστεί από το όνομα του ξενιστή, τον κωδικό ID και τον αριθμό ST από τη βάση δεδομένων MLST. Οι υπερομάδες Wolbachia φαίνονται δεξιά, στο τέλος του ονόματος. Επίσης αναγράφονται οι τιμές ML bootstrap βάσει των 1000 επαναλήψεων (μόνο αυτές που είναι >50%). Ο πίνακας αριστερά περιλαμβάνει αναλυτικά όλα τα δείγματα Glossina που μελετήθηκαν και στα οποία ανιχνεύθηκαν τα αντίστοιχα αλληλόμορφα των γονιδίων του βακτηρίου Wolbachia. Με πράσινες και μπλε και γραμμές τονίζονται τα πολύ διαφορετικά μεταξύ τους αλληλόμορφα για τα δείγματα G. austeni (013.11Β) και G. brevipalpis (19.Brev), αντίστοιχα. 106

117 Ανίχνευση και χαρακτηρισμός του συμβιωτικού βακτηρίου Wolbachia σε πληθυσμούς Glossina spp Φυλογενετική ανάλυση με βάση το γονίδιο coxa Οι αλληλουχίες coxa που ανακτήθηκαν από τα εξεταζόμενα δείγματα ανήκουν στις υπερομάδες Α, Β και F. Οι περισσότερες από αυτές κατατάσσονται στην υπερομάδα Α σχηματίζοντας 3 κύρια υποσύνολα: coxa_α.1: περιλαμβάνει 6 αλληλόμορφα [Al.128: G. m. morsitans (34.7G, 30.9D, 12.3A,GmmY, 24.4A) G. pallidipes (34.4A, 30.10G, 32.11G, 10.10E, 24.1A), Al.127: G. m. morsitans (12.3A, 30.9D, 32.3D, GmmY) - G. m. centralis (GmcY) - G. pallidipes (10.10E, 24.1A,), New1: G. m. morsitans (12.3A, 32.3D), New2: G. m. morsitans (GmmY), Al.129: G. brevipalpis (011.4H, 19.Brev, 09.7G) - G. tachinoides (579.7C), New7: G. tachinoides (579.7C) - G. brevipalpis (011.4H)]. coxa_α.2: περιλαμβάνει το αλληλόμορφο Al.47 που ανιχνεύτηκε στο δείγμα G. pallidipes (15.5B) και το αλληλόμορφο Al.109 των G. austeni (05.2B, 015.1B, B, B). coxa_α.3: η υποομάδα αυτή σχηματίστηκε από 2 αλληλόμορφα [Al.130: G. p. gambiensis (405.11F), New4: G. p. palpalis (184Gpp)]. Στην υπερομάδα Β ανήκουν 3 αλληλουχίες coxa (New5, New3 και Al.14) που εντοπίστηκαν στα δείγματα G. medicorum (523.4F), G. p. gambiensis (405.11F) και G. m. submorsitans (525.3H), αντίστοιχα. Στην υπερομάδα F ανήκει μόλις ένα αλληλόμορφο (New6) από το άτομο G. m. submorsitans (525.3H) [Εικόνα 2.4]. Αξίζει να σημειωθεί η περίπτωση του δείγματος G. m. submorsitans (525.3H) το οποίο φέρει δύο πολύ διαφορετικά αλληλόμορφα coxa: το Al.14 που ανήκει στην υπερομάδα Β και το New6 στην F. Παρομοίως, στο δείγμα G. p. gambiensis (405.11F) βρέθηκε ένα αλληλόμορφο από την υπ&epsi