Research Paper. glda. glda AT glda-wt. glda-4 pet- 32a + E. coli U / ml E. coli-wt U / ml 3 A Q814

Transcript

1 Acta Microbiologica Sinica April 2011 ISSN CN / Q http / / journals. im. ac. cn / actamicrocn Research Paper * glda glda AT AT PCR glda-wt glda-4 pet- 32a + pet-glda-4 E. coli BL21 DE3 E. coli-4 glda-wt E. coli-wt glda-4 glda-wt AT 53. 3% 80. 0% E. coli U / ml E. coli-wt U / ml 3 AT Q814 A glycerol dehydrogenase GDH EC glda Klebsiella Citrobacters 6-9 Clostridia NAD dihydroxyacetone DHA Downstream Box DB NADH SD 1 3- DB A T DB DHA AT H6023 * Tel fbs@ xmu. edu. cn tang3433@ sina. com

2 . / Klebsiella pneumoniae pet-glda glda Escherichia coli PCR glda-4 E. coli-wt glda 94 5 min 94 1 min min 72 glda 1. 5 min min glda DB AT 1. 3 pmd-glda glda-4 pmd-18t PCR glda-4 E. coli-4 glda E. coli BL21 DE3 Ⅰ E. coli DH5α DH5α E. coli BL21 DE3 E. coli BL21 DE3 pet-32a + Novagen. Inc E. coli-4 E. coli-4 E. coli BL21 DE3 / pet-glda pmd18-t ExTaq DNA E. coli-4 BamHⅠ XhoⅠ T 4 DNA marker marker 2 mg / ml 5 h 1 g PCR Thermo 1. 6 GDH 1. 2 glda-4 glda AT glda-4 glda ATGCGCACTTATTTGAGG-3 glda ATGAGAACTTATTTAAGA-3 45 glda nm primer premier 5 1 min 6 s Primer ε 340nmNADH = 6. 3 L / m NADH / CGTCGGATCCTACATGAGAACTTATTTAAGAGTGAA cm AGGAAT-3 BamH Ⅰ 1 μmol 1 U Primer 2 5 -AATGCTCGAGCGAAT VT ΔA / Δt EA = 1 TAACGCGCCAGCCAC-3 XhoⅠ ε Vs primer1 primer2 E. coli DH5α BamHⅠ Xho 1. 4 pet-glda-4 glda-4 pet-32a + T 4 pet-glda-4 E. coli 75 μg / ml LB 2 h 5 ml ph Ahrens K mmol / L NH4 2 SO mol / L 2 mmol / L NAD + 1 μmol / L Fe NH4 2 SO mol / LK 2 CO 3 ph ml E A U / ml V T

3 506 Longpan Tang et al. / Acta Microbiologica Sinica V S V T V S ml ΔA / Δt 1. 7 Bradford E. coli BL21 DE3 E. coli-wt E. coli-4 10% R glda glda-4 E. coli-wt E. coli bp PCR 1% 1. 5 h 3 h 4 h 5 h 6 h bp h pmd-glda-4 pet-glda h 1. 5 h glda-4 glda glda SDS-PAGE glda-4 E. coli-wt E. coli Type glda glda-4 Table 1 Comparison of the expression product of E. coli-wt and E. coli-4 Enzyme activity / U / ml Protein concentration / mg / ml E. coli-wt E. coli Specific activity / U / mg Fig. 1 SDS-PAGE analysis of the crude extracts. M protein marker 1 product of E. coli BL21 DE3 2 product of E. coli - WT with glda 3 product of E. coli E. coli-wt E. coli h 3 h 4 h 5 h 6 h 1 SDS-PAGE 34 kda kda 2 E. coli-wt E. coli-4 54 kda 1 SDS- Fig. 2 Comparison of the speed of producing the GDH of PAGE glda glda-4 E. coli-wt and E. coli-4.

4 . / DB AT DB Stenstr m 17 E. coli 2 A E. coli DB S rrna AT DB mrna 16S rrna propandediol oxidoreductase on bioconversion of glycerol into 1 3-propandediol by Klebsiella pneumoniae under micro-aerobic conditions. Bioprocess and Biosystems Engineering Menzel K Ahrens K Zeng AP Deckwer W. Kinetic glda 2 6 AT PCR glda dynamic and pathway studies of glycerol metabolism by Klebsiella pneumoniae in anaerobic Continuous Culture IV. Enzymes and fluxes of pyruvate metabolism. glda-4 Biotechnology and Bioengineering U / ml E. 3 Lee W Dasilva NA. Application of sequential integration coli-wt for metabolic engineering of 1 2-propanediol production U / ml 15 3 in yeast. Metabolic Engineering Daniel 7 glda E. coli ECL U / mg coli for the efficient conversion of glycerol to ethanol and 2006 Yamada-Onodera 19 E. coli HB U / mg 351. thermophilus Nudix ndx3 3 6 Journal of Wuxi University of Light Industy 2005 AT AT % 41. 7% ndx3 E. coli 7 Daniel R Stuertz K Gottschalk G. Biochemical and 10 DB AT molecular characterization of the oxidative branch of 53. 3% 80. 0% glycerol utilization by Citrobacter freundii. Journal of AT DB E. coli-wt E. coli-4 1 Zhao L Zheng Y Ma X Wei DZ. Effects of overexpression of glycerol dehydrogenase and Shams Yazdani S Gonzalez R. Engineering Escherichia co-products. Metabolic Engineering glda-4 5 Kawashima K Itoh H Chgate J. Nonenzymatic browning reactions of dihydroxyacetone with amino acids or their U / mg 10 esters. Agricultural and Biological Chemistry glda DB AT E. coli 6. Nishikubo 20 Thermus. bacteriology

5 508 Longpan Tang et al. / Acta Microbiologica Sinica Ruzheinikov SN Burke J Sedelnikova S Baker PJ Taylor R Bullough PA Muir NM Gore MG Rice DW. Glycerol Dehydrogenase Structure Specificity and Mechanism of a Family III Polyol Dehydrogenase Structure Malaoui H Marczak R. Separation and characterization of the 1 3-propanediol and glycerol dehydrogenase activities from Clostridium butyricum E5 wild-type and mutant D. Journal of Applied Microbiology Katrlík J Mastihuba V Vo tiar I efčovičová J tefucaa V Gemeiner P. Amperometric biosensors based on two different enzyme systems and their use for glycerol determination in samples from biotechnological fermentation process. Analytica Chimica Acta Gonzalez R Murarka A Dharmadi Y Yazdani SS. A new model for the anaerobic fermentation of glycerol in enteric bacteria trunk and auxiliary pathways in Escherichia coli. Metabolic Engineering Zhao L Zheng Y Ma X Zhang J Wei GD Wei DZ. Over-expression of glycerol dehydrogenase and 1 3- propanediol oxidoreductase in Klebsiella pneumoniae and their effects on conversion of glycerol into 1 3- propanediol in resting cell system. Journal of Chemical Technology and Biotechnology Sprengart ML Fuchs E Porter AG.. The downstream box an effcient and independent translation initiation signal in E. coli. The EMBO Journal Etchegaray JP Inouye M. Translational enhancement by an element downstream of the initiation codon in Escherichia coli. The Journal of Biologic Chemistry Chinese Journal of Biotechnology Gonzalez EI Isaksson LA. A codon window in mrna downstream of the initiation codon where NGG codons give strongly reduced gene expression in Escherichia coli. Nucleic Acids Research Qing G Xia B Inouye M. Enhancement of translation initiation by A / T-rich sequences downstream of the initiation codon in Escherichia coli. Journal of Molecular Microbiology and Biotechnology Yamada-Onodera K Nakajima A Tani Y. Purification characterization and gene cloning of glycerol dehydrogenase from Hansenula ofunaensis and its expression for production of optically active diol. Journal of Bioscience and Bioengineering Nishikubo T Nakagawa N Kuramitsu S Masui R. Improved heterologous gene expression in Escherichia coli by optimization of the AT-content of codons immediately downstream of the initiation codon. Journal of Biotechnology

6 . / Expression of glycerol dehydrogenase gene in Escherichia coli by codon optimization Longpan Tang 1 Jincong Yu 1 Danfeng Dai 1 Baishan Fang 1 2* 1 Key Laboratory for Industrial Biotechnology of Fujian Higher Education Huaqiao University Xiamen China 2 Department of Chemical and Biochemical Engineering College of Chemistry and Chemical Engineering Xiamen University Xiamen China Abstract Objective To improve expression level of glycerol dehydrogenase gene glda in Escherichia coli by means of codon optimization. Methods For immediately downstream region of initiation codon in glda we designed optimized sequence by choosing higher AT-content synonymous in order that this region's AT-content was increased without changing the corresponding amino acids. Then we had wild gene glda-wt site-directed mutagenesis depending on mega-primers PCR so that physically optimized gene glda-4 was acquired. We cloned glda-4 into pet-32a + to construct expression plasmid pet-glda-4 which was transformed into Escherichia coli BL21 DE3 for gaining engineering bacteria E. coli-4 by contrast engineering bacteria involved glda-wt named E. coli-wt. After E. coli-4 and E. coli-wt were fermented in shake flasks we measured enzyme activities of expression products with glycerol as substrate. Results Four glda-4's bases in the second fifth and sixth codon were different with glda-wt so AT-content of the optimized gene was up to 80. 0% higher than the wild gene's 53. 3%. Furthermore enzyme activity of E. coli-4's crude extract was U / ml more three times than E. coli-wt's U / ml. Conclusion This optimization scheme was quick and easy but indeed increased dehydrogenase's activity. It possible becomes a universal method to improve heterogenous expression level of target genes. Keywords glycerol dehydrogenase GDH AT- content heterologous expression codon optimization Escherichia coli Supported by the National Natural Science Foundation of China * Corresponding author. Tel fbs@ xmu. edu. cn Received 4 November 2010 / Revised 7 January 2011