C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is
|
|
- θάνα Κορωναίος
- 6 χρόνια πριν
- Προβολές:
Transcript
1 2009, 36 (9) : Acta Horticulturae Sinica 6 - (6PGDH ) 1, 2, 1, 1, 13 ( 1,, ; 2, ) : 6 - (62phosphogluconate dehydrogenase ) 6PGDH cdna ( GenBank : EU815934), 6PGDH, 3 6PGDH, bp 936 bp bp 3, DNAMAN 3, 22,, : ; ; 6 - ; ; : S 652 : A : X (2009) C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is W E I Yue 1, 2, WU Zhi2m ing 1, ZHANG Shu2ning 1, and CHEN J in2feng 13 ( 1 Key Laboratory of Southern V egetable C rop Genetics Im provem ent, N anjing A gricultural U niversity, N anjing , China; 2 Polytechnical College of A griculture and Forestry, Zhenjiang, J iangsu , China) Abstract: In order to demonstrate that the synthetic allotetrop loid species ( Cucum is hy tivus Chen and Kirkbride., 2n = 38) was the hybrids p rogeny originated from crossing between the wild Cucum is species (C. hystrix Chakr., 2n = 24) and the cultivated cucumber Beijing J ietou (C. sa tivus L., 2n = 14) in molecu2 lar level, p rimers were designed according to the 62phosphogluconate dehydrogenase ( 6 PGDH ) gene cdna sequence of cucumber ( GenB ank accession number: EU815934). The 6PGDH gene fragm ents were amp lified from allotetrop loid, the wild Cucum is and cultivated cucumber Beijing J ietou, respectively. Sequence analysis showed that the 6 PGDH fragments in three species were highly homologous, having bp length each. It encompassed of 936 bp long open reading frame (ORF) encoding 311 am ino acids and had 162 bp non2translation 3 2term inal end region (3 UTR), no intron existed in 6 PGDH fragment. The sequences were analyzed by software p rogram DNAMAN, detected three variable am ino acid lociπs and twenty2two bases lociπs. The inheritance of variable lociπs were congruence w ith the M endelπs genetics law of inheritance, therefore, it is p roven at molecular level that this synthetic allotetrap loid species was the hybrid originated from C. and C. sativus Beijing J ietou crossing. Key words: cucumber; allotetrop loid; 6PGDH; hybrid; clone hystrix : ; : : ( ) ; ( , ) ; (2008AA10Z150, 2006AA10Z1A8, 2006AA100108) ; (2009CB119000) ; (2008BADB105, 2006BAD13B06, 2006BAD01A725211) 3 Author for correspondence ( E2mail: jfchen@njau1edu1cn)
2 (C. hytivus Chen and Kirkbride., 2n = 38, HHCC) (Cucum is hystrix Chakr., 2n = 24, HH) (C. sativus Bei2 jing J ietou, 2n = 14, CC) (Chen et al., 1997, 2000, 2002, 2003; Chen & Adel2 berg, 2000), (, 2001) (, 2002) (, 2003, 2005, 2006) 2005) RAPD SSR AFLP (, 6 - ( 6PGDH ) (, 1990 ) 6PGDH ( Zea m ays AF061838) (Glycine m ax AB007907) (M edicago sati2 va U18239 ) (A rabidopsis tha liana AY ) ( Spinacia oleracea AF ) (O ryza sativa AY278362) 6PGDH ( GenBank : EU815934), 5, 6PGDH, 6PGDH, 3 6PGDH, 6PGDH 1 F 5, 28, 14 h, 2 3 M2MLV PMD192T Taq TaKaRa, TOP10, TR IZOL B IPEC DNA CTAB (Murray & Thomp son, 1980), RNA TR IZOL, O ligo ( dt) 14 : 5 2GACTCGAGTCGACATCGATTTTTTTTTTTTTT23 ( Hayashi et al., 2004), M 2MLV cdna : 6PGDH cdna ( GenBank : EU815934) 5 2GGGAATTTTGTGAAGATGGT23 ; : 5 2CTGCTATCTACTCCCCTAA23 cdna DNA PCR : 94 3 m in; s, s, m in, 35 ; m in, 4 PMD192T, TOP10, 1 ml LB ( 100 mg L - 1 ) r m in - 1 PCR,, NCB I BLAST, DNAMAN PGD H cdna DNA ( 1) bp 6PGDH NCB I B last, cdna 311 6PGDH 75%, 6PGDH cdna 311, TGA, 162 bp 3 (UTR) 3 6PGDH (ORF) cdna DNA,
3 9 : 6 - (6PGDH) 1377 F ig. 1 cd NA ( A) D NA ( B) 6PGDH PCR M: ; 1: ; 2: ; 3: 1 The electrophoresis results of 6PGDH gene PCR products using cd NA ( A) and D NA ( B) a s tem pla te M: Marker; 1: W ild species; 2: A llotetrop loid; 3: Cucumber Beijing Jietou PGD H DNAMAN 6PGDH 311 ( 2), 3, 99168%, 0196%, 6PGDH F ig. 2 6PGDH 2 A lignm en t of pred icted am ino ac id sequences of 6PGDH from three spec ies 28 99, H A, R V; 183 F, L, 3 6PGDH DNA ( 3), (3 ), 1
4 PGD H D NA F ig. 3 A lignm en t of D NA ba se sequences of 6PGDH from three species 1 6PGDH D NA Table 1 The var iable loc i and ba se types of 6PGDH gene D NA sequences Locus number Samp le G T G C G C T C T T G G C T T C C G G C T C Beijing Jietou G T G C A C T C T C A G C C T C C G G C N 3 N 3 A llotetrop loid A C T G A T C G C C A T G T G T G A A T C T W ild species 3 N =A + T + C + G
5 9 : 6 - (6PGDH) bp 22, 2%,, 22 19, , 16, 22, 16, 7217%, 3, 1316%, 444 T C, %, 911%, 415%, 5 DNA 3 Chen (2002) (2003) 1 ; ( ) ; 1,,,, RAPD SSR AFLP (, 2003, 2005, 2006),,, 3,,,,,, 6PGDH ( Fahrendorf et al., 1995), ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ), 6PGDH,,,,, ;,,, DNA,, 6PGDH ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ),,,
6 References B rover V, Troukhan M, A lexandrov N Features of A rabidopsis genes and genome discovered using full2length cdna s. PlantMol B iol, 60 (1) : Chen J F, Adelberg J Interspecific hybridization in Cucum is2progress, problem, and perspectives. Hortscience, 35 (1) : Chen J F, Adelberg J, Staub J E, Skoyup ska H T, Rhodes B B A new synthetic amphidip loid in Cucum is from C. sativus C. hystrix Chakr. F 1 interspecific hybrid McCreight J D. Cucurbitaceae 982evaluation and enhancement of cucurbit germp lasm. A lexandria, Va. USA. : ASHS Press: Chen J F, Joseph H, Kirkbride J A new synthetic species Cucum is (Cucurbitaceae) from interspecific hybridization and chromosome dou2 bling. B rittonia, 52: Chen Jin2feng, Ren Gang, Yu Ji2zhu Studies on performance of peroxidase isozyme in the progenies from selfing of backcross between Cuc2 um is hytivus and C. sativus. Journal ofw uhan Botanical Research, 20 (5) : ( in Chinese),, , 20 (5) : Chen J F, Staub J E, Adelberg J W Synthesis and p relimary characterization of a new species ( amphidip loid) in Cucum is, 123: Chen J F, Staub J E, Q ian C T Rep roduction and cytogenetic characterization of interspecific hybrids from C. hystrix Chakr. C. sativus L. Theor Appl Gent, 106: Chen J F, Staub J E, Tashiro Y Successful interspecific hybridization between Cucum is sativus L. and C. hystrix Chakr. Euphytica, 96: Chen Jin2feng, Zhuang Fei2yun, Q ian Chun2tao Synthesis and p relim inary characterization of a new species (Am phidiploid) in Cucum is. Journal ofw uhan Botanical Research, 19 (5) : ( in Chinese),, ( )., 19 (5) : Fahrendorf T, N iw, Shorroosh B S Stress responses in alfalfa (M edicago sativa L. ) X IX. Transcrip tional activation of oxidative pentose phosphate pathway genes at the onset of the isoflavanoid phytoalexin response. PlantMol B iol, 28: Hayashi H, Huang P, Takada S D ifferential expression of three oxidosqualene cyclase mrna s in Glycyrrhiza glabra L. B iol Pharm Bull, 27: Huang J, Zhang H S, W ang J F, Yang J S Molecular cloning of rice 62phosphogluconate dehydrogenase genes that is up regulated by salt2 stress. B iology Reports, 30: Karsten K, Marlies P, W illiam M Purification and cloning of chloroplast 62phosphogluconate dehydrogenase from spinach. Eur J B iochom, 268: L i Xiao2juan, W ang L iu2yang, Yang Hui2ling, L iu Jian2quan Confirmation of natural hybrids between Gentiana stram inea and G. sipho2 nantha ( Gentianaceae) based on molecular evidence. Acta Botanica Yunnanica, 29 (1) : ( in Chinese),,, ( )., 29 (1) : Murray H G, Thomp son W F Rapid isolation of higher weight DNA. Nucl Acids Res, 8: Shen Tong, W ang Jing2yan B iochem istry. Beijing: H igh Education Press. ( in Chinese), :. Zhuang Fei2yun, Chen Jin2feng RAPD analysis of cultivated cucumber, wild Cucum is species, interspecific hybrid and its p rogenies from backcrossing. Acta Horticulturae Sinica, 30 (1) : ( in Chinese), RAPD., 30 (1) : Zhuang Fei2yun, Chen Jin2feng, Q ian Chun2tao Cytological and molecular studies on genom ic exchange and reconstitution in the synthetic allotetrap loid Cucum is hytivus. Scientia Agricultura Sinica, 38 (3) : ( in Chinese),, (Cucum is hytivus)., 38 (3) : Zhuang Fei2yun, Chen Jin2feng, Wolucau J Introgressive hybridization between the synthetic allotetraploid in Cucum is and cultivated cu2 cumber and assessment of the genetic variation in the progenies. Acta Horticulturae Sinica, 33 (2) : ( in Chinese),, Wolucau J , 33 ( 2 ) :
(A ntifreeze p roteins, A FP s) (afp ),
29 1 ( )V ol. 29 N o. 1 2001 2 Jouṙ of N orthw est Sci2Tech U niv. of A gri. and Foṙ (N aṫ Sci. Ed. ) Feb. 2001 α 1, 1, 2, 3 (1, 712100; 2, 710032; 3, 712100) []A utum n K ing, CTAB DNA, PCR (Polym erase
SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp
2011 33 6 1206-1211 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com SOD SNP 1 2 3 2 2* 1. 330004 2. 330004 3. 510006 GenBank Cu /Zn-SOD Mn /Fe-SOD
Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media
28 1 2009 3 Vol128 No11 GLOBAL GEOLOGY Mar1 2009 : 1004 5589 (2009) 01 0098 05 P 1, 1, 2, 1 1., 130026; 2., 100027 :,,,, 1%,,, 12187%,, : ; ; ; : P63114 : A Abstract: Error ana lysis of P2wave non2hyperbolic
Identification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Cytogenetics and RAPD Ana lysis of In terspec if ic Hybr ids from the Cross of F raga ria m andschu rica Staudt and F. ananassa D uch.
2007, 34 (3) : 597-604 Acta Horticulturae Sinica RAPD 13, 2, 1, 1 ( 1, 210014; 2, 210095) :,,, ;,, ;, F 1, 611+ 1016+ 211+ 0135, RAPD,, : ; ; ; ; ; RAPD : S 66814 : A: 05132353X (2007) 0320597208 Cytogenetics
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2
China B iotechnology, 2005, 25 (12) : 24 28 A tkup1 3 133 1 2 3 3 (1 150001 2 201106) (3 157011) RNA, RT2PCR,, Km ( ), A tkup1, PCR GUS Southern A tkup1 mrna PCR, PCR 2100bp, A tkup1 ( Genbank No: AF029876)
SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession
43 3 2 0 0 7 3 SCIENTIA SILVAE SINICAE Vol143, No13 Mar., 2 0 0 7 a/ b 3 1 1 2 1 (1. 100102 ; 2. 100091) : RT2PCR RACE a/ b cdna, cab2 BO1 ( GenBank : EF061137) 1 102 bp, 64 861 bp 1, 265 cab2bo1 64 232
( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Study on Wheat Heterotic Group
2002,22 (1) :59 Journal of Triticeae Crops. Ξ 1,2, 1, 1, 2, 1 (1., 100094 ; 2., 010031) :30 20, F 1, 0. 652, 0. 404, 111. 39 %, 11. 14 %,,,,, :; ; ; ; :S 512. 035 :A :100921041 (2002) 0120005205 Study
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz
Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz Advanced Backcross QTL analysis and genetic study of an introgressed powdery-mildew resistance gene derived from Avena macrostachya in oat (Avena
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Approximation Expressions for the Temperature Integral
20 7Π8 2008 8 PROGRSS IN CHMISRY Vol. 20 No. 7Π8 Aug., 2008 3 3 3 3 3 ( 230026),,,, : O64311 ; O64213 : A : 10052281X(2008) 07Π821015206 Approimation pressions for the emperature Integral Chen Haiiang
Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Effects of Plan t Growth Regula tors on the Con ten t of Phenolics in Sweet Cherry D orman t Flower Buds and D ormancy
2005, 32 (4) : Acta Horticulturae Sinica 584 588 3 (, 271018) : 7 ( Prunus avium L. ),,, ABA, 62BA GA 3 ; ABA, 62BA GA 3, ; ABA, 62BA GA 3 62BA CA 3, CA 3 ABA ( PAL) ( PPO), 62BA GA 3 PAL PPO, 62BA GA
30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha 410004)
44 3 2 0 0 8 3 SCIENTIA SILVAE SINICAE Vol144,No13 Mar.,2 0 0 8 FAD2 cdna ( 410004) : FAD2, EST, 5 RACE PCR FAD2 cdna 1 682 bp, 1 149 bp, 382, FAD2, FAD2 FAD2 : ; EST ; FAD2 ; RACE; PCR ; :S718146 ;Q94312
HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332
,**1 The Japanese Society for AIDS Research The Journal of AIDS Research +,, +,, +,, + -. / 0 1 +, -. / 0 1 : :,**- +,**. 1..+ - : +** 22 HIV AIDS HIV HIV AIDS : HIV AIDS HIV :HIV AIDS 3 :.1 /-,**1 HIV
athanasiadis@rhodes.aegean.gr , -.
παιδαγωγικά ρεύµατα στο Αιγαίο Προσκήνιο 88 - * athanasiadis@rhodes.aegean.gr -., -.. Abstract The aim of this survey is to show how students of the three last school classes of the Primary School evaluated
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
DNA, , DNA, 1 D NA . DNA
29 6 2005 11 ( ) Journal of Hebei Normal University (Natural Science Edition) Vol. 29 No. 6 Nov. 2005 Ξ DNA 1, 1, 1,2, 1, 1 (1., 050016 ; 2., 053000) :DNA. RFL P,RAPD,AFL P,DNA DNA,.,,. :DNA ; ; ; DNA
Archive of SID. نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه
نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج (-), 4 3 2 1 ياراحمدي محمد مهدي سوهاني * ابوبكر جوهرعلي بابك ربيعي (// : -// : ) سعيد و ع يل 5 اكبر عبادي چكيده WA. IR42686R IR58025A
IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion
2005, 32 (3) : Acta Horticulturae Sinica 403 407 RT2PCR 3π 3 (, 110161) : RT2PCR ( SMYEV ), SMYEV SMYEV RT2PCR, 19 2, 12 SMYEV SMYEV SY01 932 bp 3π, 86% 96% SMYEV 3, SY01, 1 RNA SMYEV 3π 3, : ; ; ( SMYEV)
Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
A Preliminary Analysis of Genetic Relationships for Prunus mume Sieb. et Zucc. by AFLP
2005,38(10):20842089 Scientia Agricultura Sinica AFLP 1 1 1 2 1 ( 1 430070 2 430074) AFLP 20 19 918 324 35.29% SAS AFLP 0.9759 20 4 AFLP DNA AFLP Prunus mume Sieb. et Zucc. AFLP A Preliminary Analysis
DNA2ITS, Iden tif ica tion of C o lle to trichum sp. from A n thu rium and raeanum and Its Sequenc ing of R ibosoma l D NA2ITS
2009, 36 (5) : 743-748 Acta Horticulturae Sinica DNA2ITS 1, 2, 2, 2, 13 ( 1, 510360; 2, 210095) : DNA2ITS, :, : ; ; ; DNA2ITS : S 68211 + 4 : A : 05132353X (2009) 0520743206 Iden tif ica tion of C o lle
Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions
This journal is The Royal Society of Chemistry 213 Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions Wenjing Cui, a Bao Zhaorigetu,* a Meilin Jia, a and Wulan
Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
( , ,
33 9 ( ) V o l. 33 N o. 9 2005 9 Jour. of N o rthw est Sci2T ech U niv. of A gri. and Fo r. (N aṫ Sci. Ed. ) Sep. 2005 Ξ 1, 2, 1, 1, 1, 1, 1, 2 (1 010018; 2 512005) [],, 8 8 9, () (),,,,,, ;, ;,, ;,,,
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ
ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕΔΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΚΠΑΙΔΕΥΤΙΚΗΣ ΚΑΙ ΚΟΙΝΩΝΙΚΗΣ ΠΟΛΙΤΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE
O rnam en ta l Sunflower
2009, 36 (1) : 73-80 Acta Horticulturae Sinica 1, 2, 1, 13, 1, 1, 1, 1 ( 1, 350002; 2, 510640) :, ( Helianthus annuus L. ) PAL CHS CH I F3 H D FR AN S 6, 6, 95% 97% 83% 99% 64% 80% 80% 82% 64% 85% 87%
Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
svari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Composition Analysis of Protein and Oil and Amino Acids of the Soybean Varieties in Heilongjiang Province of China
29 4 2003 7 551 556 ACTA AGRONOMICA SINICA Vol. 29, No. 4 pp. 551 556 July, 2003 (, 150030) 62,, ;,, 19 3, 9 6, Ξ, ; ; ; : S565 : A Composition Analysis of Protein and Oil and Amino Acids of the Soybean
,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
cm cm 92. 0% DH S 917
34 9 2010 9 JOURNAL OF FISHERIES OF CHINA Vol. 34 No. 9 Sep. 2010 1000-0615 2010 09-1354 - 09 DOI 10. 3724 /SP. J. 1231. 2010. 06963 1 2 2 2 2 1* 1. 361005 2. 361021 157 DH 24 SRAP 16 SSR 224 157 124 SRAP
1999, 17 (1): J ourna l of W uhan B otan ica l Resea rch ( ) ( ) 2, 3. (Celosia cristata L. ),
1999, 17 (1): 15 20 J ourna l of W uhan B otan ica l Resea rch Ξ ( 210013) (210095),, W HO g FAO, 3, 10, 3 ( ) 2317% 2714%,, 83147% 86194%, (EAA ) 4012% 4117%, (M et+ Cys) 10,,,,,,,,,,, 1 (Celosia cristata
D etection on the Sen sitiv ity of Pota to Phytoph thora infestans to M eta laxyl and Cym oxan il
, 2005, 7 (3) : 2372241 Chinese Journal of Pesticide Science 1, 1, 13, 2, 2 (1., 100094; 2., 100026) : 2003 2004 127 Phytoph thora infestans, : 2003 2003 2004 (MS) 86. 2% 13. 8% 17. 8% ; 10,, EC 50 0.
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic
2007 5 3 309 313 Molecular Plant Breeding, 2007, Vol.5, No.3, 309 313 Research Report CBF1 1,3 2 1 3 1 1* 1,, 100093; 2,, 1000871; 3,, 010019 *, jinwanmei@sohu.com CBF1 PCR 640 bpcbf1 20 16 2CBF1, CBF1,,
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Metal-free Oxidative Coupling of Amines with Sodium Sulfinates:
Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.
Supporting Information [NH 3 CH 3 ] [In SbS 9 SH]: A novel methylamine-directed indium thioantimonate with Rb + ion-exchange property Kai-Yao Wang a,b, Mei-Ling Feng a, Jian-Rong Li a and Xiao-Ying Huang
A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Effect of ultra son ic2a ssisted extraction on polysacchar ide structure from C oprinus com a tus character ized by FT IR and AFM
8 1 2010 1 Chinese Journal of B iop rocess Engineering Vol. 8 No. 1 Jan. 2010 doi: 10. 3969 / j. issn. 1672-3678. 2010. 01. 011 1, 2, 1, 1, 1, 1 (1., 710062; 2., 710062) :, (WCP) (UCP) WCP UCP 871997%
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων
Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων Α. Σιδηροπούλου 1, M. Βραχνάκης 2, Γ. Φωτιάδης 3 και Δ. Μπούσμπουρας 4 1 Εργαστήριο Λιβαδικής Οικολογίας, Τ.Θ. 286, Α.Π.Θ., Τ.Κ. 54124,
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
WANG L i2na 1, YANG Feng2juan 1, WANG Xiu2feng 13, SH IQ ing2hua 1, W E IM in 1, and HU Xiang2yang 2
2010, 37 (1) : 47-52 Acta Horticulturae Sinica NO m RNA 1, 1, 13, 1, 1, 2 ( 1,,, 271018; 2, 650204) : (NO ) Cu mrna, 015 mmol L - 1 Cu 2 +,, 013 mmol L - 1 SNP (NO ) Cu 2 +, ( POD ) (APX) ( SOD ) (CAT)
A summation formula ramified with hypergeometric function and involving recurrence relation
South Asian Journal of Mathematics 017, Vol. 7 ( 1): 1 4 www.sajm-online.com ISSN 51-151 RESEARCH ARTICLE A summation formula ramified with hypergeometric function and involving recurrence relation Salahuddin
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix
Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix algeriensis NRRL B-24137 and Biochemical Characterization of Two Pyrrothine N-Acyltransferases in This Extract.
ΜΑΘΗΜΑΤΙΚΗ ΠΡΟΣΟΜΟΙΩΣΗ ΤΗΣ ΔΥΝΑΜΙΚΗΣ ΤΟΥ ΕΔΑΦΙΚΟΥ ΝΕΡΟΥ ΣΤΗΝ ΠΕΡΙΠΤΩΣΗ ΑΡΔΕΥΣΗΣ ΜΕ ΥΠΟΓΕΙΟΥΣ ΣΤΑΛΑΚΤΗΦΟΡΟΥΣ ΣΩΛΗΝΕΣ ΣΕ ΔΙΑΣΤΡΩΜΕΝΑ ΕΔΑΦΗ
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΤΜΗΜΑ ΑΞΙΟΠΟΙΗΣΗΣ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΚΑΙ ΓΕΩΡΓΙΚΗΣ ΜΗΧΑΝΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΑΕΙΦΟΡΙΚΗ ΔΙΑΧΕΙΡΙΣΗ ΥΔΑΤΙΚΩΝ ΠΟΡΩΝ Δημήτριος Πάντζαλης Πτυχιούχος Γεωπόνος Α.Π.Θ.
ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,
24 3 2004 5 ACTA SCIENTIAE CIRCUMSTANTIAE Vol. 24,No. 3 May,2004 :025322468 (2004) 0320482205 :X523 :A PNAN5 ( Rhodococcus sp. strain PNAN5),,, 3 (, 100080) :, 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5).
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Stem Character istics of W heat w ith Stem L odging and Effects of L odging on Gra in Y ield and Qual ity
2006, 26 (1): 87 92 Journal of T riticeae C rop s Ξ,,,,, ( g, 225009) : 6,,,,,,, : ; ; ; ; : S 512. 1; S 318 : A : 100921041 (2006) 0120087206 Stem Character istics of W heat w ith Stem L odging and Effects
Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές
Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές Ιουλία Μάρκου 1, Κωνσταντίνος Αντωνίου 12, Μαρία Τσακίρη 13 και Ανδρέας Γεωργόπουλος 14 1 Σχολή Αγρονόμων και Τοπογράφων Μηχανικών Εθνικό
Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου
Βιοπληροφορική Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου Μαθησιακοί Στόχοι Αναφορά στη χρησιμότητα των βιολογικών ΒΔ. Κατανόηση των χαρακτηριστικών, των ιδιαιτεροτήτων
Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius
Chinese Journal of Zoology 2009,44 (3) :7075 3 ( 830000) : 6 ( Esox lucius), :6418 %,1911 %114 %,17 17138 %,7 8114 %,6136 % 45173 %,,WHOΠFAO 76135,,,,, : ; ; ; ; :Q955 :A :025023263 (2009) 03270206 Analysis
BL21 (D E3)2p E T28a ( + )2bgl 2
28 2 2009 3 Journal of Food Science and Biotechnology 28 No. 2 Vol. Mar. 2009 :167321689 (2009) 0220250206 BL21 (D E3)2p E T28a ( + )2bgl 2,, 3, (, 214122) : 2E. coli BL21 (DE3)2p ET28a ( + )2bgl LB, p
Stud ies on Spore Propaga tion of P teris cretica A lbo2linea ta
2005, 32 (4) : Acta Horticulturae Sinica 658662 1, 2 13 2 1 ( 1, 100093; 2, 100083) : ( Pteris cretica A lbo2lineata ) :, 1 /2 MS, 8213% ; 2% ; MS, 5314% ; 80% + (1 1), 8912% ; 112 cm, + + +(4 2 2 1),,
Genetic Rela tion sh ip of Som e Cultivars of Petun ia Hybr ids Using SRAP M arker
2008, 35 (12) : 1837-1842 Acta Horticulturae Sinica SRAP 1, 1, 2, 2, 2, 13 ( 1, 100193; 2, 100102) : SRAP ( sequence2related amp lified polymorphism) 88 58, 20, 389, 1915, 13 40, Jaccardπs0155 0187 0167
Nguyen Hien Trang* **
152 Nippon Shokuhin Kagaku Kogaku Kaishi Vol.., No.., +,+3 (,**1) 10 Nguyen Hien Trang* ** * Department of Food Science and Technology, Hue University of Agriculture and Forestry ** Properties of "Shishibishio
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S
16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
T IM P-1 cd NA CO S-7. Clon ing of Human T IM P-1 cd NA and its Expression in COS-7 Cells. 21 (tissue in2
ISSN 100727626 CN 1123870gQ 16 3 Ch in. J. B iochem. M o l. B io l. 2000, V o l. 16, N o. 3, 306 311 2000 6 T IM P-1 cd NA 3 CO S-7 3 3 (,,, 100853) GenBank T IM P21, R T 2PCR T IM P21 cdna T 2A pcr R
ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή εργασία ΓΝΩΣΕΙΣ ΚΑΙ ΣΤΑΣΕΙΣ ΝΟΣΗΛΕΥΤΩΝ ΠΡΟΣ ΤΟΥΣ ΦΟΡΕΙΣ ΜΕ ΣΥΝΔΡΟΜΟ ΕΠΙΚΤΗΤΗΣ ΑΝΟΣΟΑΝΕΠΑΡΚΕΙΑΣ (AIDS) Αλέξης Δημήτρη Α.Φ.Τ: 20085675385 Λεμεσός
High order interpolation function for surface contact problem
3 016 5 Journal of East China Normal University Natural Science No 3 May 016 : 1000-564101603-0009-1 1 1 1 00444; E- 00030 : Lagrange Lobatto Matlab : ; Lagrange; : O41 : A DOI: 103969/jissn1000-56410160300
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014
38 6 Vol 38 No 6 204 Journal o Jiangxi Normal UniversityNatural Science Nov 204 000-586220406-055-06 2 * 330022 Nevanlinna 2 2 2 O 74 52 0 B j z 0j = 0 φz 0 0 λ - φ= C j z 0j = 0 ab 0 arg a arg b a = cb0
Development of a Seismic Data Analysis System for a Short-term Training for Researchers from Developing Countries
No. 2 3+/,**, Technical Research Report, Earthquake Research Institute, University of Tokyo, No. 2, pp.3+/,,**,. * * Development of a Seismic Data Analysis System for a Short-term Training for Researchers
Conductivity Logging for Thermal Spring Well
/.,**. 25 +,1- **-- 0/2,,,1- **-- 0/2, +,, +/., +0 /,* Conductivity Logging for Thermal Spring Well Koji SATO +, Tadashi TAKAYA,, Tadashi CHIBA, + Nihon Chika Kenkyuusho Co. Ltd., 0/2,, Hongo, Funabashi,
Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.
Otorhinolaryngologia - Head and Neck Surgery Issue 50, October - November - December 2012, pages 18-22 ORIGINAL REVIEW ARITCLE Mitomycin C application for the prevention of postoperative synechiae formation
GPS, 0. 5 kg ( In tegrated Fertility Index, IF I) 1. 1 SPSS 10. IF I =
34 11 () V o l. 34 N o. 11 2006 11 Jour. of N o rthw est Sci2T ech U niv. of A gri. and Fo r. (N aṫ Sci. Ed. ) N ov. 2006 α 1, 1, 2, 1 (1, 450002; 2, 410007) [ ]12 () 1 612,, ( IF I ) : (1), ( ) ( ), ph
D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical
Θωμάς ΣΑΛΟΝΙΚΙΟΣ 1, Χρήστος ΚΑΡΑΚΩΣΤΑΣ 2, Βασίλειος ΛΕΚΙΔΗΣ 2, Μίλτων ΔΗΜΟΣΘΕΝΟΥΣ 1, Τριαντάφυλλος ΜΑΚΑΡΙΟΣ 3,
Αξιοποίηση Έξι Σεισμών στην Πελοπόννησο για την Συσχέτιση Φασματικών Επιταχύνσεων με την Απόκριση του Δομημένου Περιβάλλοντος Correlation of Spectral Accelerations with the Response of the Built Environment
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ
ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ Π.Μ.Σ: «Σύγχρονες Προσεγγίσεις στη γλώσσα και στα κείμενα» ΚΑΤΕΥΘΥΝΣΗ ΓΛΩΣΣΟΛΟΓΙΑΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΑΤΡΙΒΗ Το φωνηεντικό
The Research on Sampling Estimation of Seasonal Index Based on Stratified Random Sampling
5 7 008 7 Statistical Research Vol. 5, No7 Jul. 008 :,,, : ; ; ; :O :A :00 4565 (008) 07 0070 04 The Research on Sapling Estiation of Seasonal Index Based on Stratified Rando Sapling Deng Ming Abstract
Antimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer
Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer Naomi Morota Newman M Key Words woman diagnosed with breast cancer, rehabilitation nursing care program, the
Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog
J. Jpn. Soc. Soil Phys. No. +*-, p.-3.1,**0 ** * *** Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog Toshiki FUJIMOTO*, Ippei IIYAMA*, Mai SAKAI*, Osamu
Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic
Supporting Information Asymmetric Binary-acid Catalysis with Chiral Phosphoric Acid and MgF 2 : Catalytic Enantioselective Friedel-Crafts Reactions of β,γ- Unsaturated-α-Ketoesters Jian Lv, Xin Li, Long
CorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Evaluation of Resistance to Scab in Pear Germplasms
2012 13 4 571-576 Journal of Plant Genetic Resources / 125100 197 Evaluation of Resistance to Scab in Pear Germplasms DONG Xing-guangTIAN Lu-mingCAO Yu-fen Research Institute of PomologyChinese Academy
Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Varietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. )
29 6 2003 11 871 877 ACTA AGRONOMICA SINICA Vol. 29, No. 6 pp. 871 877 Nov., 2003 3 Ξ ( 225009) 8 6 63, 4 : (1) ; (2) N N, N ; (3), ; (4) ; (5) ; ; N : S511 ;S365 : A Varietal Differences in Response of