Registered Collected 62 Year / Male. Authenticated - TEST NAME RESULT PREVIOUS UNIT BIOLOGICAL RESULT

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "Registered Collected 62 Year / Male. Authenticated - TEST NAME RESULT PREVIOUS UNIT BIOLOGICAL RESULT"

Ιόλη Βυζάντιος
5 χρόνια πριν
Προβολές:

1 ا.د عبد العزیز النقلى د. ایات ابراھیم Visit Number: Patient Name: Age / Sex: Referred By: الا ستاذ/حمدى عبد الرحیم محمد. Registered Collected :00:00 62 Year / Male - Reported :02:28 TEST NAME PREVIOUS UNIT BIOLOGICAL Liver Function Tests Total Bilirubin N 0.40 mg/dl Direct Bilirubin N 0.20 mg/dl Indirect Bilirubin N 0.20 mg/dl SGPT (ALT) N 31 U/L 0-49 SGOT (AST) N 30 U/L 0-34 Serum Albumin N 4.7 g/dl Lipid Profile Lipid Profile (T.Cholesterol,Triglyceride,HDL,LDL) Serum Total Cholesterol H 203 mg/dl Normal: Up to 200 Borderline Risk : High Risk: >240 Serum Triglycerides N 127 mg/dl HDL Cholesterol 42 mg/dl "Low (high risk): < 40 Moderate risk : High (low risk): > 60" LDL Cholesterol 136 mg/dl VLDL Cholesterol N 25 mg/dl 0-30 HDL Risk Factor /2 Average : 3.9 Average : Average : Average : 11.0 Kidney Function Tests Serum Creatinine N 1.24 mg/dl Serum Urea H 60 mg/dl Serum Uric Acid N 5.7 mg/dl Dr.Abd El Aziz El Nokaly Professor of Medical Bio-Chemistry, Faculty of medicine, EL Azhar University 1-2

2 ا.د عبد العزیز النقلى د. ایات ابراھیم Visit Number: Registered :00:00 الا ستاذ/حمدى عبد الرحیم محمد. Name: Patient Collected Age / Sex: 62 Year / Male Referred By: - Reported :02:28 Blood Glucose Fasting Blood Glucose 124 mg/dl "Normal Prediabetes Diabetes more than 125" Glucose After 2 Hours 204 mg/dl "Normal: Prediabetes: Diabetes: more than 200" Tumor Markers Alpha-fetoprotein (AFP) N 0.7 ng/ml Up to 8 PSA (Total & Free) Prostatic Specific Antigen Total N ng/ml Prostatic Specific Antigen Free ng/ml PSA Ratio L 0.15 % Normal More Than 0.25 N.B. :"Screening Testing on Asymptomatic men : * PSA Screening may be carried out every two years. * An Alternative is Annual Testing for PSA levels above 2.5 ng/ml. ( American Cancer Society,2016 ) Screening for Diabetic Control Haemoglobin A1C 7.4 % Normal: less than 5.7 Prediabetes: Diabetes: more than 6.4 Dr.Abd El Aziz El Nokaly Professor of Medical Bio-Chemistry, Faculty of medicine, EL Azhar University 2-2

د. منى محسن Visit Number: 20917007426 Registered 23-04-2017 00:00:00 Name: Patient الا ستاذ/حمدى عبد الرحیم محمد.

3 د. منى محسن Visit Number: Registered :00:00 Name: Patient الا ستاذ/حمدى عبد الرحیم محمد. Collected Age / Sex: 62 Year / Male Referred By: - Reported :02:29 MOLECULAR BIOLOGY REPORT TEST NAME PREVIOUS UNIT BIOLOGICAL HCV RNA Quantitative by TaqMan Realtime PCR: <15 IU/ml < 15 N.B. :The COBAS Ampliprep/COBAS TaqMan (CAP/CTM), a fully automated real-time PCR used to monitor HCV viremia during treatment of patients with chronic hepatitis and patients undergoing antiviral therapy. The wide dynamic range of the (CAP/CTM) allowed for a better definition of viral kinetics for all HCV genotypes (1-6). Results are reported in international units (IU). 1 IU/ml Corresponds to approx. 5 Copies/ml. Interpretation of viremia: < 200,000 IU/ml Low 200,000-2,000,000 IU/ml Moderate > 2,000,000 IU/ml High HCV RNA < 15 IU/mL indicates that the result was valid and the concentration was below the limit of detection (Undetectable Viremia). HCV RNA >100,000,000 IU/mL indicates that the result was valid and the concentration was above the defined range of the test. Fibro-Acti test and Interleukin 28B are recommended for Positive HCV patients. Dr.Mona Mohsen Lecturer of Clinical and Chemical Faculty of Medicine, Pathology Cairo University

4 ا.د. ھالة شیبھ د. دعاء خمیس د. فاتن رمضان Visit Number: Registered :00:00 الا ستاذ/حمدى عبد الرحیم محمد. Name: Patient Collected Age / Sex: 62 Year / Male Referred By: - Reported :02:30 Client Name: 932 HEMATOLOGY REPORT TEST NAME UNIT BIOLOGICAL Haemoglobin N 14.0 g/dl Haematocrit (PCV) N 44.1 % RBCs Count N 5.14 millions/cmm MCV N 85.8 fl MCH N 27.2 pg MCHC N 31.7 g/dl RDW-CV N 14.6 % Platelet Count (EDTA Blood) N 183 thousands /cmm Total Leucocytic Count (EDTA Blood) Complete Blood Picture N 6.3 thousands /cmm 4-11 Percent Values Neutrophils 63.5 % Lymphocytes 27.0 % Monocytes 7.5 % Eosinophils 1.4 % Basophils 0.6 % Absolute Values 3.97 x10^9/l x10^9/l x10^9/l x10^9/l x10^9/l Comment : FOR AGE : NORMAL BLOOD PICTURE. Dr.Hala Sheba Professor of clinical pathology Faculty of medicine Cairo university

5 ا.د. ھالة شیبھ د. دعاء خمیس د. فاتن رمضان Visit Number: Registered :00:00 Name: Patient الا ستاذ/حمدى عبد الرحیم محمد. Collected Age / Sex: 62 Year / Male Referred By: - Reported :02:31 HEMATOLOGY REPORT TEST NAME PREVIOUS UNIT BIOLOGICAL Erythrocyte Sedimentation Rate (ESR) First Hour: H 50 mm Up to 12 Second Hour: 113 mm Dr.Hala Sheba Professor of clinical pathology Faculty of medicine Cairo university

6 ا.د. عزة العدوى د. ایمان یاسین Visit Number: Registered :00:00 Name: Patient الا ستاذ/حمدى عبد الرحیم محمد. Collected Age / Sex: 62 Year / Male Referred By: - Reported :02:32 PARASITOLOGY REPORT TEST NAME PREVIOUS UNIT BIOLOGICAL Urine Analysis MACROSCOPIC EXAMINATION MACROSCOPIC EXAMINATION Colour Yellow Yellow Aspect Slightly Turbid Clear Volume Voided sample ml Reaction Specific Gravity in urine Nitrite Negative Negative Albumin Negative Negative Sugar Negative Normal Acetone Negative Negative Bile Salts Negative Negative Bile Pigments Negative Negative Urobilinogen Normal Trace Normal Trace Leukocyte esterase Negative Negative MICROSCOPIC EXAMINATION MICROSCOPIC EXAMINATION RBCs 1-2 /H.P.F 0-5 Pus Cells 6-8 /H.P.F. 0-5 Epithelial Cells Nil Nil Casts Nil Nil Ova Nil Nil Crystals Nil Absent Mucus Nil Nil Yeast Cells Nil Nil - Few Trichomonas vaginalis Nil Nil Dr.Azza EL Adawy, MD Professor of Parasitology, Faculty of medicine, Cairo University

Σχετικά έγγραφα

5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R

5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC