SUPPLEMENTARY MATERIALS AND METHODS: Generation of conditional Ada3 knockout targeting construct-to generate a conditional targeting construct, we

Transcript

1 SUPPLEMENTARY MATERIALS AND METHODS: Generation of conditional Ada3 knockout targeting construct-to generate a conditional targeting construct, we examined the genomic structure of the mouse Ada3 gene. According to the NCBI mouse genome resources (Build 32.1), mouse Ada3 gene is located on chromosome 6, is composed of 9 exons and spans approximately 11kb. We flanked exons 2 to 4 with loxp sequences so that these exons can be removed from the chromosome using Cre-dependent recombination. Exons 2 to 4 were targeted based on the following considerations. Targeting of these three exons will lead to deletion of 188 amino acids amounting to about 43% of protein coding sequence and the transcript from the remaining exons is unlikely to lead to a functional protein product. Limiting the gene manipulation to exons 2 to 4 also minimized potential effects on promoter/enhancer elements of neighboring genes ( Retrieve&dopt=Graphics&list_uids=70601). We used a probe from Ada3 genomic region to screen a BAC library (RPCI-22 (129S6/SvEvTac) (Children s Hospital Oakland Research Institute, bacpac.chori.org) and identified a clone that had the required genomic region of Ada3 locus to generate a targeting construct. LoxP sites were introduced using a recombineering technique, as previously described (1). Generation of Ada3 gene-targeted mice and isolation of mouse embryos and PCR genotyping-a duplex-pcr based strategy was developed to distinguish between the wild-type and Ada3 mutant alleles. The primers are as follows: a, 5 -CGGGAGGGGGAGCTCTATGAATCCTGATCTAT-3 ; b, 5 - TCAACATAATTTCTCTGTATAACAACTCTGGC-3 ; c, 5 - CAATATGACTAACTACATCTCTGG-3 (Supplementary Figure S1A). A 470-bp fragment indicates the presence of the wild type allele, whereas a 703-bp fragment is amplified from the mutated allele. For analysis of post implantation embryos, Ada3 +/- females were sacrificed at various time points (see Table 1) after being mated to Ada3 +/- males. Embryos were dissected from the uteri and washed in phosphate-buffered saline (PBS), and DNA was isolated after proteinase K (Roche) digestion. Genotyping was performed by a duplex PCR using the duplex-pcr mentioned above. For blastocyst isolation, plugged Ada3 +/- females were euthanized at 3.5 dpc, and their uteri were dissected and flushed with DMEM. Blastocysts were either directly genotyped or seeded singly onto 24-well plates and cultured in complete DMEM at 37 C with 5% CO 2. After 4 days, the medium was changed, and after 7 days in culture, blastocyst DNA was isolated and subjected to genotyping PCR Generation of Ada3 monoclonal antibody and Immunoblotting-Full length human Ada3 cdna was cloned into pgex 6P1 bacterial expression vector (that contain N-terminal GST tag followed by a precision protein). The recombinant protein (hada3) was purified from a large scale culture of BL21 E. coli using Glutathione Sepharose 4B beads (Pharmacia). GST tag was cleaved using Precision protease and purified hada3 was used as an antigen to produce monoclonal antibodies at the Monoclonal Antibody Core Facility, Lurie Cancer Center, Northwestern University, Chicago. The clones were screened by i) western blotting using 293T cell lysates as an endogenous Ada3 and using flag-tagged Ada3 overexpressing 293T cell lysates and also by ii) immunoprecipitation of endogenous or exogenous Ada3 from 293T cell lysates (data not shown). A few well reacting antibodies were selected among which the clone 5C9/C8 was used for subsequent experiments. Clone 5C9/C8 recognized a single band of estimated size in western blotting and immunoprecipitation. This clone was used for immunoblotting experiments conducted in the paper. Other primary antibodies used to perform immunoblotting were Rb (554136, Pharmingen); Cyclin A (sc-596), Cyclin E (sc-481), Cyclin D1 (sc-20044), Cdk2 (sc-6248), Cdk4 (sc- 260), Cdk6 (sc-53638), p27 (sc-1641), p21 (sc-6246), p16 (sc-1661), p300 (sc-585), PCAF (sc-15124) and Hsc-70 (sc-7298) (Santa Cruz Biotechnology, Santa Cruz, CA); c-myc (1472-1, Epitomics); H2B-K5 (07-382), H2B ( ), H3 (06-755), H3-K9 (07-352), H3-K56 (07-677) and H4 (05-858) (Millipore); histone Ab sampler kit (H2A-K5, H2A, H2B-K5, H3-K9, H4-K8) (9933, Cell Signaling) and β-actin (A5441, Sigma). Generation of recombinant baculoviruses and Ada3-His expression using Bac-to-Bac Expression System-Ada3 coding sequence was PCR amplified to contain 6X Histidine tag in the C-terminus and cloned into (SalI and NotI Sites) of pfastbac donor plasmid and 1

2 the recombinant baculovirus expressing Ada3-His protein was produced following manufacturer s instructions. Sf21 cells infected with recombinant baculovirus were lysed and the Ada3-His protein was purified using Ni-NTA column. HAT assay-hat assays were carried out in buffer containing 50 mm Tris HCl ph 8.0, 50 mm KCl, 5% glycerol, 0.1 mm EDTA, 1mM DTT, 10mM sodium butyrate, [ 3 H] Acetyl Coenzyme-A (Perkin- Elmer) and 1mM PMSF at 30 C using core histones or histone H3 alone as a substrate. Recombinant p300 catalytic domain was purchased from Active Motif. Purified core histones from chicken erthyrocytes were purchased from Upstate and purified. Histone H3 from calf thymus was purchased from Roche. Briefly, 10ng of p300 catalytic domain was incubated with varying concentrations of purified baculoviral Ada3 and either 1 ug of core histones or 1 ug of Histone H3 in HAT buffer for 15 min. The products were subjected to SDS-PAGE, transferred to PVDF membranes, and autoradiographed. The PVDF membranes were sprayed with EN 3 HANCE spray (Perkin Elmer) to enhance the signals from tritium prior to autoradiography. Microarray analyses-three days after infecting Ada3 FL/FL MEFs with Ctrl and Cre Adenoviruses, total RNA was isolated using the TRIzol reagent. Biotin labeled crna was generated from 200 ng of total RNA using the Ambion WT Expression Kit (Ambion) per manufacturer s instructions. Hybridization, scanning of the chip and initial scaling was performed as previously described (2); except that Affymetrix GeneChip Mouse Genome Array was used for crna hybridization. Intensities were imported into Affymetrix Expression console software using Robust Multi-chip Averaging (RMA) background correction and fold-change differences between samples were determined. Microarray analysis was performed using duplicate samples and the values represent average of the two independent experiments. Time Lapse Microscopy-24 h after control and Cre adenovirus infection, Ada3 FL/FL MEFs were plated in 6 well plates at 30% confluency. One day after plating, cells were placed on a robotized stage of an Olympus IX81 DSU Spinning Disk confocal microscope equipped with a chamber maintained at 37 o C with 5% CO 2. Movies were acquired over 24 h (10 min intervals) using Hamamatsu ORCA-ERG camera and automated acquisition software (Slidebook Software) at 10x magnification. 2

3 E F deleted allele wild type allele TE ICM TE ICM TE Supplementary Figure S1. Targeting of mada3 locus and PCR genotyping strategy. (A) Schematic representation of the targeting strategy used to disrupt mada3. (B) Southern blotting of DNA from ES cell clones digested with KpnI and probed with Ada3 locus specific probe; lanes 3-6 represent positive clones; lanes 1 and 2 represent wild type. (C) PCR strategy to screen for the deleted allele. (D) A representative gel picture showing genotyping of a litter from Ada3 +/- intercross. (E) Blastocysts isolated from 3.5 day post coitus from Ada3 +/- females mated with Ada3 +/- males were cultured in DMEM with 10% fetal calf serum for 7 days and the cells recovered from blastocyst outgrowth were subjected to genotyping PCR. A representative gel image showing PCR results of blasocyst outgrowths. (F) Representative microscopic images showing each of the three Ada3 genotype blastocysts. ICM, inner cell mass; TE, trophectoderm

4 Ada3 Hsc-70 Supplementary Figure S2. Analysis of Ada3 protein levels in mouse tissues. Protein lysates obtained from various tissues of an adult wild type mouse were subjected to immunoblotting to determine the expression levels of Ada3 protein.

5 Ctrl Cre mskp2 promoter Distal site (-5 kb) Supplementary Figure S3. Skp2 promoter occupancy by c-myc is reduced upon deletion of Ada3. Chromatin fragments from asynchronous control (Ctrl) and Cre Ada3 FL/FL MEFs cells were immunoprecipitated with anti c-myc antibody. The immunoprecipitated DNA was analyzed by PCR, using mouse Skp2 promoter specific primers. Primers amplifying a region that is 5 kb upstream of the mouse Skp2 promoter were used as a negative control.

6 Foxg1 Kntc1 Cyclin E2 Cdc6 Fbxo5 CenpF Cyclin A2 Anillin Smc2 Kif11 Icam1 Interleukin 6 Cdkn1c Keratin 18 Fold Change Microarray Q-PCR Supplementary Figure S4. Validation of microarray analysis by q-rt-pcr. Microarray data from Ctrl and Cre infected MEFs was verified by qrt-pcr by picking several deregulated genes from microarray. Error bars indicate mean ± S.E. from three independent experiments.

7 A Network 1: RNA Post-Transcriptional Modification, Cellular Assembly and Organization, Gastrointestinal Disease

8 B Network 2: Cellular Function and Maintenance, Molecular Transport, Cell Death

9 C Network 3: Cell Cycle, Endocrine System Development and Function, Cancer

10 D Network 4: Lipid Metabolism, Small Molecule Biochemistry, Cell Death

11 E Network 5: Cell Cycle, Cellular Assembly and Organization, DNA Replication, Recombination, and Repair Supplementary Figure S5. Ingenuity Pathway Analysis. (A-E) Top 5 networks affected upon Ada3 deletion as obtained by Ingenuity pathway analysis. All the genes that were induced or downregulated at least 1.5 fold were used for the analysis

12 Ctrl Nuclear fragmentation or 0 multi-nucleation occurs after cells try to divide Cre One of the daughter cell is anucleated Asymmetric nuclear division Supplementary Figure S6. Abnormal cell division of Ada3 deleted cells. Representative time lapse images of Ada3 FL/FL cells after 2 days of infection with control (Ctrl) or Cre adenovirus captured over 24 hours period. Note that cells infected with control virus express egfp in both cytoplasm and nucleus whereas expression of egfp in Cre infected cells is restricted to the nucleus. Figures in the upper left hand corner of each image indicate minutes.

13 Supplemental Table S1: Deregulated genes in Ada3-deleted cells Gene Symbol Representative Public ID Fold change Downregulated genes Hmox1 NM_ Cdkn2a NM_ Gsta1 /// Gsta2 NM_ Malat1 AW Ptprz1 BC Ptprz1 BC LOC /// Npm3 /// Npm3-ps1 BB Foxg1 NM_ Stmn2 BM Mex3b BG Fus AF Vcan BM Fam171a2 BB Cd80 X Prmt1 AK M20Rik AW Rian AK Ptk7 AK Psma3 C LOC /// Msl1 AW Zc3h7b BM Gpr124 NM_ Dok1 BC Rtn4 NM_ Vip AK Pik3r1 M Mmp14 BB Plec1 BM Mgp NM_ Rad18 AK G05Rik BB Fgf13 AF Setd5 BI Nrk AK Gja1 M Mycl1 BG Tcfec NM_ Prl8a9 AF

14 Hspa4 BE H21Rik AK Stxbp6 BC Col11a1 NM_ Kifc1 /// LOC NM_ Plau NM_ K19Rik BI Gas7 AI Cdc42ep3 BB Rab5c BC Dhrs3 NM_ Pip5k1a BC A630033H20Rik BB Nfkbil1 NM_ Cdc42ep3 BB Cd34 NM_ Arpc3 BC Col11a1 NM_ Dnajb4 AK LOC /// Msl1 AW Epha3 AV Cxcr7 BC D330050I23Rik BE Grb14 NM_ Plau NM_ D17H6S56E-5 NM_ D17H6S56E-5 NM_ Pik3r1 BB Lce1h NM_ Kitl BB Adra2a BB Sema3a NM_ C530008M17Rik BB S1pr1 BB Atp2b1 BI Adamts6 BB Thoc3 BE Myct1 AI Arl2bp NM_ Stmn2 BM Kitl BB Epha7 BC Tmem35 NM_

15 Cd80 AK K19Rik /// Rpl41 BI Stom AF Slfn9 BI Blnk AF Ptchd1 BB Samd4 BF Lpar4 AW Lmnb1 AA Aldh1a1 NM_ D23Rik AV C130021I20Rik AW Rnf25 NM_ Itgbl1 BC Dbc1 AB Hmgb3 NM_ Fbxo5 AK Rlf BF Jun NM_ Unc5c NM_ LOC /// Srrm2 BQ Tnfrsf11b AB N02Rik AW Arl2bp AK Slc20a2 BG Elavl2 BB Gap43 BB Cenpf BE Ing3 BB Nudt21 BG Edil3 BB Slc8a1 BB Hipk2 AF Maoa AW OTTMUSG AK H06Rik BB Arf6 BI Dhcr24 BG Alg8 BM Snap29 BF Fam110c NM_ Lpar4 BB Ncam1 BM

16 Lpar4 BB Tbx20 AK Myct1 W Npy1r NM_ Sprr2k NM_ Klf4 BG Cenpf BB Gpr149 BB D430042O09Rik BB Galntl4 AV Prim1 J Mcm7 NM_ A4galt BG Hcn1 NM_ Macc1 BB Dnajb4 BC Maoa AV Mirhg1 AK Pip5k1a BB OTTMUSG AK Vcan BM Sox4 AI Nes AK Psap BM Prpf19 BC Ccne2 AF Galnt2 AF Sema3d BB Cspg4 BB BC BB Kitl M Vcan NM_ Itga4 BB Sesn2 AV Enah AV Metrn BE Sdpr AV Pola1 NM_ OTTMUSG /// Ppp1r14c AK Lasp1 BC Dusp10 NM_ Fam110c NM_ St3gal6 NM_

17 Elavl2 BB Npnt AA Aff2 BB Abcc1 NM_ Cspg4 BB Serpinb1b AF Brd2 BI Dtl AV Sema3a NM_ Sprr1a NM_ Rbmx NM_ Nrn1 AK Swap70 AK H24Rik BQ F23Rik BB Utp6 BC Kif22 BC Cdc6 NM_ LOC BB D530037H12Rik BG C330027C09Rik AU Gjb2 AV /// /// EG /// EG /// EG /// EG /// Rpl30 BB Hspa1b M Gabra4 BB Gja1 BB Chtf18 BM Cbx6 BC Rab40c AF Kntc1 AW D18Rik AK F17Rik AK G20Rik AK D0H4S114 D Sdc1 BI Col10a1 NM_ Haus6 BB Areg NM_ Cd80 D Sdpr BE Arl5a BB Rpl12 BG

18 Fam134c BC Zdhhc21 BI Klf4 BG Gja1 BB Ddah1 BE D0H4S114 BB D2Ertd750e AU Nfib BB Psap BM Ung BC Melk NM_ Col1a2 BB Hspa1b M Fam65b BM Erf BB Slc7a11 BB Dhfr NM_ Pcdh18 BM Aldh1a7 NM_ C77370 AW Baz1b BB P18Rik AK Tcf19 BC Galnt2 BG Ywhag NM_ Uhrf1 BB Tmem121 AF Nrcam BB Nufip2 AV Sh3kbp1 AK Pappa AF Uhrf1 BB Sec61a1 BC Tcf20 AW Mcm7 NM_ Prim1 J Gja1 M Mfap3l AV /// EG /// EG /// EG /// ENSMUSG /// Hmg1l1 /// Hmgb1 /// LOC /// LOC /// LOC AV Cck NM_ Mtm1 BG

19 Foxp2 BM Tmtc2 AK Dpp8 BM Mlf1ip BB Myh10 BQ Fam131b AW D2Ertd750e AK Foxp2 AV Kif11 BB Ccna2 X Gpr149 BB Inhba NM_ OTTMUSG BB Slc40a1 AF Nes AI Zcchc5 BQ Orc1l BC Ncam1 BB Diras2 BM Nmt2 AV Sh3kbp1 AK Hoxb7 /// Hoxb8 X Dnm3os BB Rrm1 BB Swap70 AV Smc2 BI Itga5 AW Lmnb1 AA Megf10 AK Sgol1 BB Flrt2 BB Gorab BB Pcdh9 BB Nmt2 AI Npnt AA Kdm4a AA /// Sema3a NM_ Hoxb9 AA Kif22 BC Flnb BB Casc5 BB Pappa BB Kif2c BB

20 Trib2 BB Calhm2 NM_ Rpa1 BM Lmo4 NM_ Anp32a AF Pdgfc NM_ Cdt1 AF C77370 C Rai14 BB Herc3 AK Hspa4 BB /// EG /// EG /// Rps17 AA Ptprd BB Flrt2 AW Gja1 AV Serpinb1a AF Wdhd1 C Mcm7 BB Cd44 X Dis3 BM Ogn BB Hnrnpul2 BI Usp1 BC Rg9mtd2 AV Stom AF Plk1 NM_ Asb5 NM_ Pnn AV Atad5 BB Ccnd2 NM_ BB Klf7 BB Nudt21 BG F630043A04Rik BG Foxp1 BG Col6a3 AF Mtm1 BG Bub1b AU Aspm NM_ Hmgb1 BF Foxp1 BG Tnfrsf11b AB Kif4 NM_

21 Unc5b AK Hipk2 AF Anln BI Ppap2a NM_ Ankrd28 AV Zwilch BC Mki67 X Mad2l1 NM_ LOC /// Max AA Dpysl3 AV Uty BB Sec61a1 BC Shcbp1 NM_ Egln3 BC Fus AF Zfpm2 NM_ Rpa1 BB Hoxa3 BB Rad51ap1 BC Ncapg BB Hmga2-ps1 AV S1pr3 BB Ivns1abp NM_ Mtap4 BE Itga6 BM Zfp101 BC Smc4 AV Gins2 AW Pcdh18 BM LOC BB Cct4 NM_ Mmp14 NM_ Racgap1 AF Clspn BG Cdkn2c BC Matn2 BB H13Rik AK Usp1 BC Rgs16 U Foxs1 BB Rbbp4 BF LOC /// Rcc2 AV St3gal6 NM_

22 Chaf1b BC Kcnk2 NM_ Cdca7 AK Dnm3os BB A04Rik BB Abca5 BM Col5a2 AV Ncapg BB Alcam U Tead2 D Mfap3l AK A230058F20Rik AV Mcm7 BB Kdm2a BE Cdca8 BB Ccdc68 AV LOC /// Mmd AA B130021B11Rik BM Kif20b BB Malat1 AW D13Ertd787e AU Ddit4 AK Loxl3 NM_ Tacc3 NM_ Cct4 AV Tk1 NM_ E11Rik BB Pmm1 BI Ar AV Hells NM_ E2f8 BM Pcdh9 BQ Syncrip BG Rg9mtd2 BG Tnik AI Calu BB Hnrnpr BB Arih2 NM_ Ccnb1 AU Enah BQ Trim35 AB Pif1 AV Rrm1 BB

23 Sox4 AI Sema3c NM_ Klf6 AF Asph AF Ahctf1 BM Adam15 BC Fscn1 NM_ Flrt2 BG Rad54l AV Hspa1b M Cdca3 BI Ptn BC Ttll12 BB Dnajc7 NM_ Nr4a2 BB Nuf2 AK Sfrs5 AW Sema6d BB Ogn BB Cdca8 AV Fads2 NM_ Pdlim5 AK Btg1 BE Bbx BF Cdkn3 AK Sf3b3 AK Taf1d AV Pdlim5 NM_ Cdh3 X Haus6 BB Nrp1 AK Ndc80 NM_ Khdrbs3 AK Gins2 AW Arl15 BB Klf6 C D16Ertd780e BG Rabgap1 BM Mre11a NM_ Ctdsp2 /// ENSMUSG BB Gja1 BB Osr1 NM_ Rad51ap1 BC

24 Syncrip BG Ankrd28 BG Chek1 BB Sh3kbp1 BB Aspm BB Trim59 AK Nrp1 AK Usp1 BC Inppl1 BB Ncam1 NM_ Pdgfc NM_ Bat2 AK Slc16a4 AV Exo1 BE Pbk NM_ H2afy2 /// H2afy3 NM_ Dleu2 AA Cyp51 NM_ Klf7 BB Birc5 BC O08Rik BM Mfap3l AV Fusip1 NM_ B130021B11Rik BB Lman1 BE Alcam U Plxdc2 AK Ubtf BB Nfkbiz BM Smc2 NM_ Nrp1 AV Bub1 AF Metrnl BC Casp3 D Kpna6 BC Sfrs2 AK Usp47 BG Hmgb1 AI Gemin5 BB Socs2 NM_ BC AV Tmeff2 NM_ Srebf2 BM

25 Rnps1 NM_ Smc4 BI Agap3 AF Tulp4 BB Suv39h2 NM_ Epb4.1l2 BE Rtn4 BG Aurkb BC Dpy19l1 BM Lsm2 AF Ppp3r1 NM_ EG /// EG /// EG /// LOC /// Rps24 BM Klf7 BB D14Rik AK Vamp3 NM_ Plk4 AI Sprr2h NM_ Gyk BF Ssrp1 BC Rgs2 AF Klc1 AU Sdpr BE Pde4b BM Wee1 NM_ C03Rik BF AW AV Smoc2 AK Ccna2 X Hmga1 NM_ Prc1 BC Upregulated genes Bex1 NM_ Krt18 NM_ Plcxd1 BB Mpzl2 BC Crym NM_ Aard AV Mpzl2 BC Cadm4 AY Krt7 BC Clu /// LOC AV LOC /// Usp18 NM_

26 Ifi44 BB Cdkn1c NM_ Car3 NM_ Oasl2 BQ Clu /// LOC AV Bst1 AI Afp NM_ D630045M09Rik BG Trim30 AF Prom1 NM_ Ifit1 NM_ Tgtp /// Tgtp2 NM_ Dsp AV Clu /// LOC NM_ Pla1a NM_ Lyz1 AV K13Rik NM_ Itih5 AK Abhd3 NM_ H2-Q7 M Nefl M Xaf1 BB Apol9a /// Apol9b BC Synpo2l BB Dsp AV Iigp1 BM Rtp4 BC Cmpk2 AK Angpt4 AV AI /// Trim30 BG Iigp1 BM Frmd4b BB /// Isg15 AK Trim63 BG Spns2 BC Lyz1 AV Gbp3 NM_ Tnfsf9 NM_ Igtp NM_ Trim30 BM Slc2a3 BB Clu /// LOC BB Slc2a3 BB

27 Ifit3 NM_ Fxyd6 AB C3 K Loxl4 NM_ Irgm2 NM_ Aim1 BM Il18 NM_ F5 NM_ Prr9 BB Fgl2 BF AI BM F5 NM_ Clip4 BM Kng1 NM_ Rgs4 NM_ Hck NM_ Fbxo2 BB OTTMUSG AU Ms4a4d NM_ Vnn1 AV Afap1l2 BG Phlda2 NM_ Lyz2 AW Ifi203 BC Wnt4 NM_ Cntf /// Zfp91 /// Zfp91-cntf NM_ Cd38 BB LOC /// Plec1 BI Mogat2 BB Ccl8 NM_ Stat1 AW Adssl1 NM_ Angpt4 NM_ Rsad2 BB G530011O06Rik BB Vnn1 NM_ Wdr40b BB Sfrp1 BI H23Rik BB Acpp BB Gch1 BB Liph BB Ifi205 /// Mnda AI

28 Phyh NM_ Plscr2 NM_ Cox7a1 AF Ndrg1 AI E06Rik BB Ifih1 AY Parp14 BC Olr1 NM_ Gbp6 BM Igfbp4 BC Ecscr BB Mcpt8 NM_ Dock9 BB Cadm1 NM_ Il6 NM_ Pstpip1 U Ifi203 NM_ Lce3f /// LOC AV AI AV Rgs4 NM_ Cxcl14 AF Gal3st1 AK Ddx58 BB Gbp2 BE Tmem37 BC Rsad2 BB Slpi NM_ Aldh1a2 NM_ Lcn2 X H2-K1 BC LOC /// Tor3a AK Cyb561 BC Ndrg1 AV H23Rik NM_ Akr1c21 AW Mpa2l BG Rnf144b AV Pcdh21 NM_ Gbp2 NM_ H2-K1 S Tmem86a AK Upk1b BB Stat2 AF

29 Steap4 NM_ H2-D1 /// H2-K1 /// LOC L Igfbp3 AV Abat BF Syt13 BB Frmd4b BG Slc39a4 BC BC BE Pfkfb3 NM_ Cd38 NM_ Krt80 NM_ Mocos AK Bace2 NM_ Icam1 BC Smpdl3b NM_ Oas1a BC Trim21 BC Lgals3bp NM_ Stat1 AW Itga3 BI Crispld2 BB Dock9 BB Dtx3l BB Apcdd1 BB Tor3a NM_ Isg20 BC Dhx58 AF AK Il11 NM_ Cxcl14 AF Apcdd1 BB Taf9b AW Bst2 BC Adcy9 BB Cxcl10 NM_ Sox7 NM_ Ablim1 BG Ly6f NM_ C1qtnf2 BF Igfbp3 AI Stard5 BI Wdr40b BB F03Rik AK

30 Stat2 AF Ntf5 AI Psmb8 NM_ Exoc6 AV Parp9 NM_ Susd2 AK Gch1 NM_ E01Rik AK Timp3 BI Dtx3l AV Scel NM_ Wnt7a AK Stat1 AW Ehhadh NM_ Fam174b BG Slc9a3r1 BB Sord AV Csf1r AI Car2 NM_ Spon2 NM_ Mmp13 NM_ Timp3 BI Sema3b NM_ C920025E04Rik NM_ Nkd2 BB Sprr2a NM_ D14Ertd668e AV Igfbp4 BB Flt4 AI Crispld2 BB Aif1l BC Crispld2 AK Abca1 BB Mrgpre BB Prrg3 BB Loxl4 NM_ Ptx3 NM_ Hp NM_ Rab40b AV Ifi35 BC Abcc3 AK Afap1l1 BB AI BG

31 Axin2 BB Ifi204 NM_ Sema4f BB Crabp2 BC Maf AV Gzme NM_ Cxcl1 BB Reep6 AK Nppb NM_ Trim34 AF Cxcl1 NM_ Sgcb AI Ifi35 AW Rab3d BB Sep NM_ Ifi35 AW Timp3 BI Selp M Spink2 BE Dock9 AA Tnfaip8 NM_ Galnt12 AV E01Rik AK Cda AK Als2cl BM Igfbp4 BB G11Rik BQ Irf9 NM_ Sncg NM_ Nrip3 NM_ Tppp3 NM_ Gzme NM_ Acsl6 BC Ndrg1 NM_ AW BB /// Il11ra1 /// Il11ra2 /// OTTMUSG BC Rtn2 AF Dync1i1 NM_ Eif4e3 BC Irf7 NM_ Fndc3c1 /// LOC BG Pygl NM_

32 Arvcf BE Card10 NM_ Glt8d2 AK Ddx58 BG Gpr123 AU Sult4a1 AV H2-M3 NM_ Hrh1 /// LOC BB Cxcr6 NM_ Hs3st3b1 BG Nap1l2 NM_ Lifr AV Nfkbie BB Tnip1 AJ Aldh6a1 NM_ Cdkl2 NM_ Pmp22 NM_ Slco2a1 AI Pdlim4 NM_ Esrp2 BF Adcy7 NM_ Plat NM_ Parp12 BM Adam8 NM_ L24Rik AK Galnt3 AK Tspan9 AK Bace2 BB Herc5 AW S100a13 NM_ Bat2d BI Cxcr6 AF Tmem54 BC Socs3 BB Serpinb9g AF Slc9a3r1 BB Selp BB Tmem51 BC Trim54 NM_ Hint3 BM Slco1a5 NM_ Igfbp4 BC Arrb1 AK

33 Epb4.1l5 AW Tcp11l2 BM Xdh AV Cd274 NM_ B230311B06Rik BB Steap2 BB Ildr2 BG Radil BB C1r NM_ Gbp6 BC Arhgap18 BB /// Ifi203 /// Ifi204 /// Ifi205 /// LOC /// LOC /// Mnda AI Igfbp4 NM_ Aqp1 NM_ Ivl AV Upk1b BB Mtss1 BC Aldh1l1 /// LOC AK Plcxd1 BB Eif4e BQ Apcdd1 BB Llgl2 /// LOC AY Cand2 BM Slco2a1 NM_ Boc BB Stard5 BI Mmp3 NM_ Spint2 AV Fuca2 BM Pdcd6ip BC Cib2 NM_ Fhod3 BG Igf2 NM_ Serpini1 NM_ Hpse BG Nmi BC Pfkfb4 BE Ablim1 AK Ptplad2 AV Itih5 AV Fam117a AW Slc7a7 NM_

34 Sfmbt2 BM Krt20 AF Yipf2 AV Klc3 BC Creg1 BC Ttll7 BB O12Rik AK Pdlim2 BC Prg4 NM_ Mbp BB AI BB Lhx6 AB Ccl17 NM_ Mmp10 NM_ Phactr2 BE Mest AW Scn3b BE Peg3 AB Pla2g7 AK Isyna1 NM_ Peg3 AB S100a1 AI Lynx1 NM_ Sfrp1 BI Pdk1 BB B4galt4 AF C10Rik AV Lrpap1 D Tuft1 NM_ Hivep3 BB Calml4 AY E10Rik BI Sord BI Gstm6 NM_ Svep1 NM_ Lynx1 BB Rragd BF Ildr2 AI Pla2g16 BC Lor NM_ Rgs4 NM_ Larp6 NM_ Ehd4 NM_

35 Rdh10 BG Bace2 BB Tm7sf2 BC Gjb4 NM_ Ager NM_ Pla2g16 BB Smarca1 NM_ Chic1 BG Socs3 BB Optn BB Cxcl1 BB O05Rik BB M15Rik BG Selp M Bnc1 U Dgat2 AK J15Rik BI P14Rik C H14Rik NM_ Dach2 NM_ P2rx5 NM_ Speg NM_ Steap2 BB Slc9a3r2 AV LOC /// Pnp1 /// Pnp2 AK Vamp5 AK Rnasel BF Cyld AK Ccl20 AF Samd9l BB Rom1 NM_ Akr1c18 NM_ Rasgrp3 BB Sema3e AF LOC /// Ly6c1 /// Ly6c2 NM_ Acss2 NM_ Hdac11 BC Sfrp1 AK Smarca2 BM Tbcel BB Nnat AV Abcb1a M Chmp4c AK

36 Wnt4 AW Cdon AW Cisd3 AV Flywch2 BB Car12 AK Fam134b BC Rab3d BB Clip4 AK Nipal2 BC Cxadr BE Ube1l AK Pnkd NM_ Mmp19 AF Il13ra1 BI Akr1c12 /// Akr1c13 AF BC AK Wfs1 NM_ Entpd4 /// LOC BB Rec8 NM_ Arhgap28 BB Glt8d2 AK Limch1 AV Ckb BG Arhgef3 BC Abcg1 AW Npl BC Pde2a BG Atp8a1 AW H2-Ke6 AI Ctnnal1 BQ C1qtnf5 /// Mfrp BC Rasgrp3 BB Ppt1 AF Nlrc3 BB /// Mthfs NM_ Glt8d4 /// LOC AV Nkd2 BC Nts NM_ Fam49a AV Eif2ak2 AV M10Rik AK Acot11 AW Tnfrsf22 /// Tnfrsf23 BB

37 Snhg11 BI Lgals9 NM_ Nudt22 BC Tbc1d24 AA Sprr2a AV Ch25h NM_ Hsd3b7 NM_ Pgf NM_ Sh3bgrl2 BB H17Rik AK Ppbp NM_ Afap1l2 BG Fhit AF Ptges BB Tmem106a AV Znrf2 BG Sft2d2 AV LOC /// Pnp1 BC Speer3 NM_ Ddc AF Scrn1 BF Epas1 BI BI S100a3 AF Pld1 BM Fstl3 NM_ Sep BG Myo7a NM_ Maff BC C05 BQ F630110N24Rik AV Tapbp AF Fam134b NM_ Kifc3 NM_ H2-D1 M H2-D1 M Saa3 NM_ Tmem106a BC Calr3 AI Tmem176a BC Ccl2 AF Casp12 NM_ Upk1b BB

38 Tmem8 NM_ Zbp1 AK Rnf213 AW Wnt9a AV Herc1 BM Aifm2 AK Mitf BB C77080 BB Il13ra1 BB Hdac5 NM_ Nebl BM Nmb NM_ Gja3 BM Has2 NM_ Ube2l6 BC Rasgrp2 BE Ninj1 NM_ Apoe AK Mvp NM_ Plek2 NM_ Smpd3 BF Casp4 NM_ LOC BB Reck NM_ Nudt22 BC Ccl9 AF Trp53inp2 AK Eif2ak2 BE G06Rik NM_ Creg1 BC Kif5c BB C1s /// LOC BC Aoc3 NM_ Lgals3 X Mtm1 NM_ H17Rik AK Rnf207 BI D330022A01Rik /// Ube1l AK Trf AF As3mt AK Rrm2b BB Ap3m2 BC Sned1 BB

39 Cxcl16 BC Cd99l2 BB Optn AK H2-D1 L Rassf7 NM_ Mfsd6 BF Gstm2 NM_ Ninj1 AU M04Rik BM Serpinb8 BB Steap2 BE Tinagl1 BC Mpp7 AK C920025E04Rik /// H2-T23 NM_ Tbc1d24 BF Speg NM_ Sytl4 NM_ P14Rik BC Htra3 NM_ Adamts4 BG Sgcb AK Usp2 AI Dmxl2 AK N05Rik BC Enpp4 BG Olfml3 NM_ Ndrg1 AI Hsdl2 BM Mansc1 AK Brp44l AV Cd99l2 BB Hspa12a BQ H2-T10 /// H2-T17 /// H2-T22 /// H2-T9 NM_ Arvcf BE Naprt1 AI LOC /// Tmsb15b1-Tmsb15b2 AW Acaa1b BC Parp4 BB Atp9a AF Shroom3 NM_ Stard10 NM_ Tnfsf11 NM_ Cnp BB

40 Il13ra1 BB Stard8 BM Xkr8 AV Cd40 NM_ Elovl4 BB Acss2 NM_ Ndrg2 NM_ Stx11 BB Ppp2r2c AV Sdsl NM_ Ptprg AK Dusp2 L Slc9a3r1 BG Il13ra1 S Serping1 NM_ Obfc2a BE Ppfia3 BG Cxcl2 NM_ Zfp672 BC Chst11 AK Rbp1 NM_ Kcnmb1 BB Tgfbi BB Dner BB Mgat4a BB Mfsd9 AU Camk1 NM_ Morn4 BF OTTMUSG BM Dlk1 NM_ Adcy9 AW Kif21a NM_ Nudt11 BQ Taf7 AV Ccpg1 BC Fcgrt NM_ Nol3 BC Erap1 NM_ Shroom2 BQ Cyld BM Dync2li1 /// LOC AK Fam69b NM_ H2-L M

41 Ccl7 AF Endod1 BF Ifi27l2b BC Gpr116 AW Pdzd2 AV Golm1 BC Aifm2 AK Cpeb4 NM_ Cgnl1 BB Casp12 NM_ M10Rik AV Tgfbi BB Gm2a BC Sod3 NM_ Hfe AJ Aqp5 /// LOC NM_ Cyp27a1 NM_ A930005H10Rik AV Csf3 NM_ Herc3 BM Tlr3 NM_ Mtap7 NM_ Tgfbi NM_ Mkrn1 BC Cd40 BB Ostm1 AK Cotl1 BB Tmem154 BB ENSMUSG BB Nudt14 BC Slc2a13 BB B09Rik AV Napepld BB Ficd C Bicd1 BB Bscl2 BB BC BI Pion BB P15Rik AW Ikbke NM_ Scube3 BB Tspan13 BB Kif21a BB

42 LOC AI Chmp2a BC Timp3 BI Pcyox1 BB Klhl29 BI Phactr2 BB G13Rik AV Tmem141 AW N09Rik BC Nlrx1 BB Pgcp BB Lrpap1 D Commd9 AK Insl6 NM_ Gpm6b AK St14 NM_ D17Rik BC Arrdc4 BC Fbxo6 NM_ Tst BC Ninj1 BB Ank2 BQ Sbsn AI Cd40 AI Acat1 BG Cyb561d2 NM_ Rab3d BB Plekha2 BE Kif21b AV Vav3 BC Aifm2 BB Prkcz NM_ Plekhh2 AW Tmem38b BC Ctf1 NM_ Entpd5 NM_ Hagh BC Fam73a BB Rnaset2a /// Rnaset2b BI Prlr AW Lrpap1 AV N02Rik AK Adar AF

43 Ppfibp2 NM_ Adcy7 BB Sub1 BE Nme3 NM_ S100a16 AV Adamtsl1 AV Sema3e NM_ Bcl2l11 BM Bscl2 AF Adcy9 AW Hagh BC Clybl BC U90926 NM_ Adar BB Dgat2 AK Fars2 BB Depdc6 AK G11Rik AK ENSMUSG BB Casc4 AV Galnt10 BG D17Rik BC Ap1gbp1 C Hspa12a BB Mitd1 BC Slfn10 BB Ifi203 M Gpr123 BI Sesn3 NM_ D16H22S680E NM_ Gmpr /// LOC NM_ Ncoa7 BE Slc2a9 BB Clcn3 BI BI Endod1 BF Igf1 BG Cdk2ap2 NM_ Stx11 AK A830007P12Rik BC Cpeb3 BB Vdr AV E01Rik BB

44 Tln2 BQ Psph NM_ Bckdhb AW Mreg AV Ifi27l1 AW A530017D24Rik BQ Ifitm1 BC Nudt17 AK Syt11 BF Tmem38b C Kif5c AI Usp20 AK Lipa AI Ids BB Aadacl1 AV Enpp4 AV Tnfrsf18 AF Tmem173 AV S100a1 BC Fkbp11 NM_ Zfyve27 BB Rab20 BG Vgf BF Pdxk BG Fam122b AK Lipa AI A02Rik BG Camk2n2 AK Pcbd1 NM_ Mtss1 AV Enpp5 BC Rsph1 NM_ H6pd BC Wrn D Efna1 D Rap1gap AK Entpd5 NM_ Akr1c13 NM_ Pilrb1 NM_ J15Rik AK Ccdc23 BC G23Rik BC Dhrs11 BC

45 Prickle2 BQ Mfsd8 AV Lrpap1 D G12Rik AK Gpsm3 NM_ Cacng8 BQ Tmem40 BB Tgoln1 AI Tmem42 NM_ Asah2 NM_ Madd BM Smpdl3a NM_ B05Rik BC Ccdc74a BG Ddb2 AY Trpv2 NM_ Synpo BB Ereg NM_ Slco2a1 NM_ Aadacl1 AV Trim25 D Gdap1 AU Higd1a NM_ Kidins220 BB Actn3 NM_ Mpg AV Gcnt2 AB Pcyox1 BB Irak3 AV Amot BG Maob BB H2-D1 M Prss22 NM_ Pfkfb2 AV Paqr7 BC Slfn8 BC Ahcyl2 BG Ern1 BG Dtd1 /// LOC AI Pon3 NM_ Slc41a3 BC Cdadc1 BE Tmem141 AW

46 Aldh5a1 BQ Klc4 NM_ Ubxn2b NM_ I02Rik NM_ Fkbp1b NM_ Il13ra2 BC Mkrn1 BE Shb BI Abca3 AK Pdk4 NM_ Syt11 BC Dclk1 AW Usp11 AI Cacna1a AB Mpp5 AW Psmb10 NM_ Rab15 NM_ Sgcb AK Mpzl3 BM Ldhb AV Prkar1b BB Itga3 NM_ Fst NM_ Ube2z BB A230050P20Rik BB Rnaset2a /// Rnaset2b AV Sf3b5 AU Ebpl BC Cotl1 AI Rhbdf2 BB Commd9 BB Spata13 AV Gpc4 BB Nsf BB B02Rik NM_ A930005H10Rik BF Fam105a BM Psmf1 BC Ppp1r3c BQ Gmds AI Vav3 BC Xlr3a /// Xlr3b /// Xlr3c NM_ Ralgps2 AK

47 LOC BI Igfbp6 NM_ Fdx1 D Chchd6 BC Fads3 BM Gdf10 L Tdrd7 BC Fam102a BC Nudt6 BB Stap2 BC D730040F13Rik AF G20Rik BE Aldoc BC Mmp23 NM_ Mkrn1 BQ Retsat BB

48 Supplementary Table S2: Top Biological Functions affected in Ada3 cells as obtained from ingenuity pathway analysis Name p-value # Molecules Diseases and Disorders Cancer 7.02E E Dermatological Diseases and Conditions 2.53E E Genetic Disorder 2.53E E Gastrointestinal Disease 5.58E E Inflammatory Response 7.65E E Molecular and Cellular Functions Cell Death 1.76E E Cellular Growth and Proliferation 1.40E E Cellular Movement 2.48E E Cellular Assembly and Organization 3.71E E Cellular Function and Maintenance 3.71E E Physiological System Development and Function Tissue Development 9.91E E Organismal Survival 1.34E E Hematological System Development and Function 2.69E E Immune Cell Trafficking 2.69E E Cardiovascular System Development and Function 3.03E E

49 Supplementary Table S3: Primers used for Real Time-qPCR Oligo Name Sequence 5 to 3 p27 F p27 R Skp2 F Skp2 R c-myc F c-myc R β-actin F β-actin R Fbxo5 F Fbxo5 R Cenpf F Cenpf R Cdc6 F Cdc6 R Kntc1 F Kntc1 R Kif11 F Kif11 R Cyclin A2 F Cyclin A2 R Smc2 F Smc2 R Anillin F Anillin R Cdkn1c-F Cdkn1c-R Foxg1-F Foxg1-F Cyclin E2 F Cyclin E2 R Keratin 18 F Keratin 18 R Icam1 F Icam1 R CAGAATCATAAGCCCCTGGA GGGGAACCGTCTGAAACATT TCCGAGCTGATCGGGTGTGCT TCGGAAGCTGCACATGCGCA TGACCTAACTCGAGGAGGAGCTGGAATC AAGTTTGAGGCAGTTAAAATTATGGCTGAAGC GCGGACTGTTACTGAGCTGCGT TGCTGTCGCCTTCACCGTTCC GGCACAATGAGTTCGTGGAGGTGG AGTTCCAGGCAAAGGACCCACT GTGGCAGCAGATCACAAAAGGTCA TCCCCACAGGCAGGCTCCTT TGCCCAAAGAGGAGCGGCCT AGAGGGGAAGGAACTTGGCCCC CCCCTCAACGGTGCCCAGTG GGCGCATGCCCAGTGTACTTGT CCAGCAAGGAGACCAGTCAGGACA TGGAGGTGTGAAGCGGCAGT GAGCTGGCCTGAGTCATTGGCA TGTTGGGCATGTTGTGGCGCT GGTGGTCAGAGGTCTCTAGTGGCT TCTTCCCAGCTTGACTCTGCGT TGCCTGGCACCGAAGATGGTG TGCAGAGAGCCAGTTCTTGGTGA ACTGCTGCGGCCAATGCGAA TGGGCTGCTCTACGCAACCATCT TTCTAACACGGTGTGGAGTGTC TTGTCAGGTTTGAATGAAATGG AGGAATCAGCCCTTGCATTATC CCCAGCTTAAATCTGGCAGAG CAAGTCTGCCGAAATCAGGGAC TCCAAGTTGATGTTCTGGTTTT TGTCAGCCACTGCCTTGGTA CAGGATCTGGTCCGCTAGCT 39

50 Interleukin-6 F Interleukin-6 R CACAGAGGATACCACTCCCAACA TCCACGATTTCCCAGAGAACA SUPPLEMENTARY REFERENCES 1. Liu, P., Jenkins, N. A., and Copeland, N. G. (2003) Genome Res 13, Zhao, X., Malhotra, G. K., Lele, S. M., Lele, M. S., West, W. W., Eudy, J. D., Band, H., and Band, V. Proc Natl Acad Sci U S A 107,