Nature Medicine doi: /nm.2772

Supplementary Table S1. Primary antibodies for Western blot analysis. Antibody name and specifications

Supplementary Table S1. Primary antibodies for Western blot analysis. Antibody name and specifications Manufacturer Actin (C-11) sc-1615, Santa Cruz, CA Akt1 (B-1) sc-5298 GAPDH (6C5) sc-32233 JAK2 (HR-758)

TFDP2 TFDP1 SUMO1 SERTAD1 RPA3 RBBP8 RAD9A RAD17 RAD1 NBN MRE11A MNAT1 KPNA2 KNTC1 HUS1 HERC5 GTSE1 GTF2H1 GADD45A E2F4 DNM2 DDX11 CUL3 SKP2 RBL1 RB1

-8-6 -4-2 CHEK2 MKI67 RB1 RBL1 SKP2 Fold-Change Fold-Change -3-2 -1 CCND1 CCNE1 CDK4 CDK5R1 5 1 15 ATM ATR BAX BCCIP BRCA1 BRCA2 BL1AT ABL1A ABL1 CCNG1 CCNG2 CCNH CCNT1 CCNT2 CDC2 CDC34 CDKN1A CDKN1B CDKN2A

RARα2 expression confers myeloma stem cell features. Ye Yang, Jumei Shi, Giulia Tolomelli, Hongwei Xu, Jiliang Xia, He Wang, Wen Zhou, Yi Zhou,

RARα2 expression confers myeloma stem cell features Ye Yang, Jumei Shi, Giulia Tolomelli, Hongwei Xu, Jiliang Xia, He Wang, Wen Zhou, Yi Zhou, Satyabrata Das, Zhimin Gu, Dana Levasseur, Fenghuang Zhan,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature22977 Supplementary Data 1 Fig. 4d + CM (no MDK) + CM (MDK) 10 15 30 1h 12h 24h 10 15 30 1h 12h 24h P- P- Fig. 4e CM GoF CM LoF-M5 CM GoF MDK - + + - + + + Vehicle - + + - + + + Rapamycin

LAPTM4B is associated with poor prognosis in NSCLC and promotes the. NRF2-mediated stress response pathway in lung cancer cells

LAPTM4B is associated with poor prognosis in NSCLC and promotes the NRF2-mediated stress response pathway in lung cancer cells Yuho Maki, Junya Fujimoto, Wenhua Lang, Li Xu, Carmen Behrens, Ignacio I.

Table S1. Full list of high-stringency HIF-1 binding sites

Table S1. Full list of high-stringency HIF-1 HIF-1 ( Nearest gene locus 1 chr7 156986147 156987039 314 N DNAJB6 NM_058246 2 chr8 134456859 134457261 180 N NDRG1 NM_006096 3 chr1 114156539 114157002 288

Lee et al., Suppl. Fig. 1

Lee et al., Suppl. Fig. 1 Lee et al., Suppl. Fig. 2 Lee et al., Suppl. Fig. 3 Lee et al., Suppl. Fig. 4 Lee et al., Suppl. Fig. 5 Lee et al., Supplementary Table 1 Markers Percentage of p75+ cells [Mean

Nature Immunology: doi: /ni Supplementary Figure 1. IL-6 reporter mice.

Supplementary Figure 1 IL-6 reporter mice. (a) Targeted Il6 locus. The reporter cassette including a floxed stop cassette was introduced into exon 2 of the Il6 locus. Since the locus is disrupted by this

Figure S1: Deletion of Dlx3 in the NC A) LacZ staining of Dlx3 LacZ/WT mice (a) and Wnt1- cre:r26r LacZ mice (b) at E11.5. The arrowhead points at

Figure S1: Deletion of Dlx3 in the NC A) LacZ staining of Dlx3 LacZ/WT mice (a) and Wnt1- cre:r26r LacZ mice (b) at E11.5. The arrowhead points at Dlx3 expression in the branchial arches. B) PCR and Southern

Product Name Code Size Application

6 His monoclonal antibody CSB-MA000011M0m 100μg ELISA, WB AADAT Antibody CSB-PA843276LA01HU 100μg ELISA, IHC AARSD1 Antibody CSB-PA863119LA01HU 100μg ELISA, WB, IHC AASDHPPT Antibody CSB-PA865121LA01HU

Prostate-targeted radiosensitization via aptamer-shrna chimeras in human. tumor xenografts

SUPPLEMENTARY DATA Prostate-targeted radiosensitization via aptamer-shrna chimeras in human tumor xenografts Xiaohua Ni 1, Yonggang Zhang 2, Judit Ribas 1, Wasim H. Chowdhury 1, Mark Castanares 1, Zhewei

500 New CUSABIO Antibodies at MedStore!

BioMart 500 New CUSABIO Antibodies at MedStore! Purchase two or more units from the attached list of antibodies at MedStore and receive an extra unit for FREE! Valid for purchases made until January 31

NES: normalized enrichment score (analyzed using KEGG pathway gene sets in the GSEA software); FDR:

Supplementary table1. List of gene sets with simultaneously altered the enrichment upon SAP18 overexpression and knockdown. Gene sets enriched by SAP18 and reduced by shsap18 SAP18 against LacZ shsap18

Supplementary Fig. 1. Nature Medicine: doi: /nm z Donor # BB-z. 28- IL2RB-z (YXXQ) 28-IL2RBz (YXXQ) Control MFI: 1866 MFI:

Supplementary Fig. 1 a Donor # 28-IL2RB-z 28- IL2RB-z Control MFI: 1866 1394 612 1297 11 MFI: 1794 1294 566 1225 11 MFI: 1433 1157 327 1117 98.5 MFI: 1463 1224 352 111 126 MFI: 1441 1232 497 1268 151 MFI:

Elevated free fatty acid uptake via CD36 promotes epithelial-mesenchymal transition in. and *Christina Chan

Elevated free fatty acid uptake via CD36 promotes epithelial-mesenchymal transition in hepatocellular carcinoma Aritro Nath 1, Irene Li 2, Lewis R. Roberts 3 1, 2, 4 and *Christina Chan 1 Genetics Program,

Supplementary Appendix; Figures S1-S16.

Supplementary Appendix; Figures S1-S16. Supplementary Appendix; Figure S1. FACS-Purified reporter + T cells reveal greater transcriptional resolution than bulk CD4 cells. CD4 T cells were purified and

Supplemental Table S1. Tumor specific networks are enriched with somatically mutated genes (taken from the database COSMIC)

Additional file 1 Supplemental Table S1. Tumor specific networks are enriched with somatically mutated genes (taken from the database COSMIC) COSMIC genes in tumor network COSMIC genes not in tumor network

SUPPLEMENTARY INFORMATION MicroRNA-195 attenuates Epithelial-Mesenchymal-Transition (EMT) in breast cancer cells by targeting FASN, HMGCR, ACACA and CYP27B1 Richa Singh, Vikas Yadav, Sachin Kumar and Neeru

SUPPLEMENTARY MATERIALS AND METHODS: Generation of conditional Ada3 knockout targeting construct-to generate a conditional targeting construct, we

SUPPLEMENTARY MATERIALS AND METHODS: Generation of conditional Ada3 knockout targeting construct-to generate a conditional targeting construct, we examined the genomic structure of the mouse Ada3 gene.

Supplementary Online Content

Supplementary Online Content Chang K, Taggart MW, Reyes-Uribe L, et al. Immune profiling of premalignant lesions in patients with Lynch syndrome. JAMA Oncol. Published online April 16, 2018. doi:10.1001/jamaoncol.2018.1482

Epithelial to mesenchymal transition rewires the molecular path to PI3-Kinase-dependent

Supplemental material for Epithelial to mesenchymal transition rewires the molecular path to PI3-Kinase-dependent proliferation Megan B. Salt 1,2, Sourav Bandyopadhyay 1,3 and Frank McCormick 1 Authors

Burden of Disease Variants in Participants of the Long Life Family Study. Supplemental Online Material

Burden of Disease Variants in Participants of the Long Life Family Study Supplemental Online Material Note that in Tables S1-S3 the following scheme was used to denote each Genetic Risk Score (GRS) GRS1:

SUPPLEMENTARY INFORMATION. Supplemenary Figures Figure S1

doi: 10.1038/nature05939 SUPPLEMENTARY INFORMATION Supplemenary Figures Figure S1 wt MEF.1 wt MEF.2 wt MEF.Myc.1 wt MEF.Myc.2 wt MEF.Ras.1 wt MEF.Ras.2 wt MEF.E1A/Ras.1 wt MEF.E1A/Ras.2 p53-/- MEF.E1A/Ras.1

Supplementary Information Supplementary Materials and Methods Multiple myeloma specimens Primary bone marrow samples from 116 MM patients and 12 patients without tumors were obtained from the 4th Department

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10648 Supplementary Figure 1: Timing of CHIR99021 exposure determines induction of FOXA2/LMX1A midbrain floor plate precursors. a) Immunocytochemical analysis of FOXA2(red)/LMX1A(green)

The following primers were used for RT-PCR: GAPDH forward (Fw) 5 -GAA GGT GAA GGT

Supplementary Material and Methods RT-PCR Primers The following primers were used for RT-PCR: GAPDH forward (Fw) 5 -GAA GGT GAA GGT CGG AGT C-3, GAPDH reverse (Rev) 5 -GAA GAT GGT GAT GGG ATT TC-3, GPX3

Supplementary Material for. Disruption of Ttll5/Stamp gene in male mice causes sperm malformation and infertility

Supplementary Material for Supplementary Material for Lee et al., Page 1 Disruption of Ttll5/Stamp gene in male mice causes sperm malformation and infertility Geun-Shik Lee, Yuanzheng He, Edward J. Dougherty,

Supplementary Methods

Supplementary Methods Immunohistochemistry Five-micrometer-thick sections of formalin-fixed, paraffin-embedded tissue specimens were deparaffinized and dehydrated. All sections were incubated with anti-human

Supplementary Material: Phenotype-Genotype Association Analysis of ACTH-Secreting Pituitary Adenoma and Its Molecular Link to Patient Osteoporosis

S1 of S29 Supplementary Material: Phenotype-Genotype Association Analysis of ACTH-Secreting Pituitary Adenoma and Its Molecular Link to Patient Osteoporosis Renzhi Wang, Yakun Yang, Miaomiao Sheng, Dechao

Supplementary Information for. RRM2B Suppresses Activation of the Oxidative Stress Pathway and is. Up-regulated by P53 During Senescence

Supplementary Information for RRM2B Suppresses Activation of the Oxidative Stress Pathway and is Up-regulated by P53 During Senescence Mei-Ling Kuo 1,**, Alexander J. Sy 1, Lijun Xue 1, Martin Chi 1, Michelle

Supplementary Table 1. Primer sequences used for RT-qPCR validation of the microarray data. Primer. direction. Forward

Supplementary Table 1. Primer sequences used for RT-qPCR validation of the microarray data Gene Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) Cell death-inducing DFFAlike effector a (Cidea) Peroxisome

Supplementary Materials for

www.sciencemag.org/content/350/6266/1383/suppl/dc1 Supplementary Materials for RNA polymerase II associated factor 1 regulates the release and phosphorylation of paused RNA polymerase II Ming Yu, Wenjing

NCBI ID Symbol 2 A2M A4GALT A4GNT 8086 AAAS 13 AADAC AADACL AAGAB 15 AANAT 16 AARS AARS AASS 18 ABAT 19 ABCA1

NCBI ID Symbol 2 A2M 53947 A4GALT 51146 A4GNT 8086 AAAS 13 AADAC 344752 AADACL2 79719 AAGAB 15 AANAT 16 AARS 57505 AARS2 10157 AASS 18 ABAT 19 ABCA1 10349 ABCA10 26154 ABCA12 154664 ABCA13 20 ABCA2 21

Supplementary Table S1 Demographic characteristics of HCC patients

Supplementary Table S1 Demographic characteristics of HCC patients Age (year; mean ± SD) 53.950 ± 11.802 Gender (number; %) Male 79 (79%) Female 21 (21%) AFP (ng/ml; mean ± SD) 23928.571 ± 79577.084 Tumor

Supplementary Materials for

www.sciencemag.org/content/351/6273/613/suppl/dc1 Supplementary Materials for Foxc1 reinforces quiescence in self-renewing hair follicle stem cells Li Wang, Julie A. Siegenthaler, Robin D. Dowell, Rui

Nature Medicine doi: /nm.2457

ature Medicine doi:10.1038/nm.2457 ature Medicine doi:10.1038/nm.2457 ature Medicine doi:10.1038/nm.2457 ature Medicine doi:10.1038/nm.2457 ature Medicine doi:10.1038/nm.2457 Table S1 - Candidate genes

Retinoic Acid Mediates Visceral-specific Adipogenic Defects of Human Adipose-derived Stem Cells

Retinoic Acid Mediates Visceral-specific Adipogenic Defects of Human Adipose-derived Stem Cells Kosuke Takeda, Sandhya Sriram, Xin Hui Derryn Chan, Wee Kiat Ong, Chia Rou Yeo, Betty Tan, Seung-Ah Lee,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Materials and Methods Cell culture conditions My-La, SR-786, HuT 78 and HH were grown in RPMI 1640 medium (Sigma Chemical, St Louis, MO, USA) supplemented with 10%

GeneCopoeia provides five qpcr array formats (A, B, C, D, and E) suitable for use with the following realtime

GeneCopoeia TM Expressway to Discovery ExProfile TM Human Lung Cancer Gene qpcr Array For focused group profiling of human lung cancer related genes expression Cat. No. QG071-A (6 x 96-well plate, Format

Biological marks of early-life socioeconomic experience is detected in the adult inflammatory transcriptome

Biological marks of early-life socioeconomic experience is detected in the adult inflammatory transcriptome Raphaële Castagné 1,2,3, Michelle Kelly-Irving 2,3, Gianluca Campanella 1, Florence Guida 1,

Supplementary Figure 1.

Supplementary Figure 1. a 0.772% 0.0126% CD4 2.93% Lineage CD44 CD8 CD25 c-kit b WT Ly5.1 Bone marrow 1:1 Ltbr +/- or Ltbr -/- Ly5.2 10Gy WT % of CD45.2+ ETP among total ETPs 80 60 40 20 0 Ltbr +/- n.s.

Jmjd1c is Required for MLL-AF9 and HOXA9 Mediated AML Stem Cell Self- Renewal

Supplemental Information Jmjd1c is Required for MLL-AF9 and HOXA9 Mediated AML Stem Cell Self- Renewal Nan Zhu, Mo Chen, Rowena Eng, Joshua DeJong, Amit U. Sinha, Noushin F. Rahnamay, Richard Koche, Fatima

Supplementary Materials for

1 2 3 4 5 6 7 8 9 10 11 12 13 14 Supplementary Materials for PD-1 Marks Dysfunctional Regulatory T cells in Malignant Gliomas Daniel E. Lowther 1,, Brittany A. Goods 2,, Liliana E. Lucca 1,, Benjamin A.

Zhang et al., Supplemental figures, Methods, References and Tables

1 2 Zhang et al., Supplemental figures, Methods, References and Tables Supplemental figures 3 4 5 6 7 8 9 10 11 14 15 16 17 18 19 20 Supplemental Figure 1. Geminin interacts with FoxO3 (A and B) Cell lysates

Supplemental Information. A p53 Super-tumor Suppressor Reveals a Tumor. Suppressive p53-ptpn14-yap Axis. in Pancreatic Cancer

Cancer Cell, Volume 32 Supplemental Information A p53 Super-tumor Suppressor Reveals a Tumor Suppressive p53-ptpn14-yap Axis in Pancreatic Cancer Stephano S. Mello, Liz J. Valente, Nitin Raj, Jose A. Seoane,

SUPPLEMENTARY INFORMATION (ONLINE SUPPORTING INFORMATION) Characterization of the genomic features and expressed fusion genes in

1 SUPPLEMENTARY INFORMATION (ONLINE SUPPORTING INFORMATION) Characterization of the genomic features and expressed fusion genes in micropapillary carcinomas of the breast Natrajan et al. Supplementary

GeneCopoeia provides five qpcr array formats (A, B, C, D, and E) suitable for use with the following realtime

GeneCopoeia TM Expressway to Discovery ExProfile TM Human Breast Cancer Gene qpcr Array For focused group profiling of human breast cancer related genes expression Cat. No. QG063-A (6 x 96-well plate,

Η γενετική πολυπλοκότητα του καρκίνου του παγκρέατος

Η γενετική πολυπλοκότητα του καρκίνου του παγκρέατος Δρ Αθανάσιος Αθανασιάδης Αθανάσιος Αθανασιάδης Δεν έχω αντικρουόμενα συμφέροντα προς γνωστοποίηση Καρκίνος παγκρέατος Θνητότης Επίπτωση Καθυστερημένη

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature20792 Sanger Mouse Genetics Project participants Agnieszka Swiatkowska, Amy Gates, Angela Green, Anna Karin Gerdin, Brendan Doe, Carl Shannon, Carmen Ballesteros

Comparative transcriptome analysis of peripheral blood mononuclear cells in

Comparative transcriptome analysis of peripheral blood mononuclear cells in hepatitis B-related acute-on-chronic liver failure Qian Zhou, Wenchao Ding, Longyan Jiang, Jiaojiao Xin, Tianzhou Wu, Dongyan

SABiosciences PCR Array Catalog #: PAHS-021 SA+ SCF 4h stimulaton AVG(Ct) Position Unigene Refseq Symbol Description shcontr shcontr-4h shgskβ A01

SABiosciences PCR Array Catalog #: PAHS-021 SA+ SCF 4h stimulaton AVG(Ct) Position Unigene Refseq Symbol Description shcontr shcontr-4h shgskβ A01 Hs.1274 NM_006129 BMP1 Bone morphogenetic protein 1 25.25

Supplementary Figure 1. Therapeutic efficacy of combined NDV and anti-ctla-4 therapy is attenuated with a larger tumor challenge.

Supplementary Figure 1. Therapeutic efficacy of combined NDV and anti-ctla-4 therapy is attenuated with a larger tumor challenge. Bilateral flank B16-F10 tumors were established as described and the animals

Blood hsa-mir-122-5p and hsa-mir-885-5p levels associate with fatty liver and related lipoprotein

1 Supplementary material Blood hsa-mir-122-5p and hsa-mir-885-5p levels associate with fatty liver and related lipoprotein metabolism The Young Finns Study Emma Raitoharju, Ilkka Seppälä, Leo-Pekka Lyytikäinen,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11847 WWW.NATURE.COM/NATURE 1 WWW.NATURE.COM/NATURE 2 WWW.NATURE.COM/NATURE 3 WWW.NATURE.COM/NATURE 4 WWW.NATURE.COM/NATURE 5 WWW.NATURE.COM/NATURE 6 WWW.NATURE.COM/NATURE 7 a SSC singlets

SUPPLEMENTARY INFORMATION. Michael Sun, Ngoc Ha, Duc-Hung Pham, Megan Frederick, Bandana Sharma, Chie

SUPPLEMENTARY INFORMATION Cbx3/HP1γ deficiency confers enhanced tumor-killing capacity on CD8 + T cells Michael Sun, Ngoc Ha, Duc-Hung Pham, Megan Frederick, Bandana Sharma, Chie Naruse, Masahide Asano,

Analysis Summary: Any Allergy

Analysis Summary: Any Allergy Phenotype Description The any_allergy phenotype includes cases identified from the union of the following sources: Allergies and Asthma survey: An allergic reaction (with

IL-7-dependent STAT1 activation limits homeostatic CD4 T cell expansion

Supplemental Material IL-7-dependent STAT1 activation limits homeostatic CD4 T cell expansion Cecile Le Saout 1, Megan A. Luckey 2, Alejandro V. Villarino 3, Mindy Smith 1, Rebecca B. Hasley 1, Timothy

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression.

Supplemental Table 1. Oligonucleotides used to identify H-RAS, K-RAS and N-RAS mutations and PTEN gene expression. Gene Exon Forward primer Reverse primer Temp ( C) HRAS 2-3 ATGACGGAATATAAGCTGGT ATGGCAAACACACACAGGAA

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/9/444/ra87/dc1 Supplementary Materials for MuSK is a BMP co-receptor that shapes BMP responses and calcium signaling in muscle cells Atilgan Yilmaz, Chandramohan

Supplementary Table 1. Composition of the diets

Supplementary Table 1. Composition of the diets Standard diet High Fat diet Energy content (kcal/kg) 2508 3701 Protein (g/kg) 200 170 Carbohydrate (g/kg) 720 670 Total fat (g/kg) 80 160 Saturated fatty

Supplementary Information

Supplementary Information Recurrent PAX3-MAML3 Fusion in Biphenotypic Sinonasal Sarcoma Xiaoke Wang 1,, Krista L. Bledsoe 2,, Rondell P. Graham 1,, Yan W. Asmann 3, David S. Viswanatha 1, Jean E. Lewis

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Valk PJM, Verhaak RGW, Beijen MA, et al. Prognostically Useful

GeneTex Sonderaktion: Custom Antibody Panels

(Stand 01/2016) GeneTex Sonderaktion: Custom Antibody Panels Fünf Antikörper (in der 25 µl-größe) zum Sonderpreis von nur 420,00 (statt 545,00 ). Bitte geben Sie bei Ihrer Bestellung die Angebotsnummer

Correlation of nonsilent somatic mutations with the age and the disease stage of 25 people with NKTCL, subjected to whole-exome sequencing.

Supplementary Figure 1 Correlation of nonsilent somatic mutations with the age and the disease stage of 25 people with NKTCL, subjected to whole-exome sequencing. (a) Distribution of non-silent somatic

Increasing the level of Peroxisome Proliferator-Activated Receptor Gamma. Supplement Figure 1. Regulation of PGC1α expression in cultured podocytes.

Increasing the level of Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1 α in podocytes results in collapsing glomerulopathy Supplement Figure 1. Regulation of PGC1α expression in cultured

Supplemental Materials and Results

Supplementary Figures and Legends Supplemental Materials and Results Supplementary Figure 1. Metabolic parameters in Ad-mKO mice A. TG content in skeletal muscle of Ctrl and Ad-mKO mice on chow diet (CD)

Christopher Stephen Inchley, 2015

Christopher Stephen Inchley, 2015 Series of dissertations submitted to the Faculty of Medicine, University of Oslo No. 2009 ISBN 978-82-8264-990-2 All rights reserved. No part of this publication may be

Long intergenic non-coding RNA expression signature in human breast cancer

Long intergenic non-coding RNA expression signature in human breast cancer Yanfeng Zhang 1,5,#, Erin K. Wagner 2,#, Xingyi Guo 1, Isaac May 3, Qiuyin Cai 1, Wei Zheng 1, Chunyan He 2,4,*, Jirong Long 1,*

Single-site association results for 136 SCARB1 genotyped variants with HDL-C.

Table S9. Single-site association results for 136 SCARB1 genotyped variants with HDL-C. SNP Name a SNP ID b Chr12 Position c Location Amino Acid Change RegDB Score d MA, MAF Genotype Genotype Count Adjusted

(A) Rounds of replating (R) of MLL-AF9 transformed LSK colonies from initiation

upplemental Figure. (A) Rounds of replating (R) of LL-AF transformed LK colonies from initiation experiments (.E. of triplicate experiments, p=.)., p

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.

Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue. Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) Dopaminergic Markers TH CTG GCC ATT GAT GTA CTG GA ACA CAC ATG GGA

CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS

CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =

In utero vitamin D deficiency increases airway smooth muscle mass and impairs lung

1 Supplemental Information 2 Title 3 4 In utero vitamin D deficiency increases airway smooth muscle mass and impairs lung function 5 Authors 6 7 1 Rachel E Foong, 1 Anthony Bosco, 1 Anya C Jones, 1 Alex

ΤΖΕΤΗ Μ.

ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Πως η εφαρμογή στα μεταγεννητικά δείγματα διευκόλυνε την ΠΓΔ ΔΟΜΗ Εισαγωγή arrays/ CNVs-[MCA: molecular karyotype analysis] Είδη arrays, διαφορές Ανάλυση/ επεξήγηση αποτελεσμάτων

Supplemental Figure 1. Pathways associated with the most significantly altered FGF-8b-regulated

Supplemental Figure legends Supplemental Figure 1. Pathways associated with the most significantly altered FGF-8b-regulated genes. a) Mitotic roles of Polo-like kinase. b) Cell cycle regulation by BTG

ΚΛΑΙΚΗ ΚΤΣΣΑΡΟΓΕΝΕΣΙΚΗ ΜΟΡΙΑΚΗ ΚΤΣΣΑΡΟΓΕΝΕΣΙΚΗ ΜΟΡΙΑΚΗ ΓΕΝΕΣΙΚΗ ΜΟΡΙΑΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Χρόνοσ Απάντθςθσ

ΚΛΑΙΚΗ ΚΤΣΣΑΡΟΓΕΝΕΣΙΚΗ Χρωμοςωμικι ανάλυςθ αμνιακοφ υγροφ (καρυότυποσ και PCR) Χρωμοςωμικι ανάλυςθ CVS (καρυότυποσ και PCR) Χρωμοςωμικι ανάλυςθ εμβρυϊκοφ αίματοσ (καρυότυποσ και PCR) Χρωμοςωμικι ανάλυςθ

Aluminum Electrolytic Capacitors

Aluminum Electrolytic Capacitors Snap-In, Mini., 105 C, High Ripple APS TS-NH ECE-S (G) Series: TS-NH Features Long life: 105 C 2,000 hours; high ripple current handling ability Wide CV value range (47

Supporting Information. Property focused structure-based optimization of small molecule inhibitors of the proteinprotein

Supporting Information Property focused structure-based optimization of small molecule inhibitors of the proteinprotein interaction between menin and Mixed Lineage Leukemia (MLL) Dmitry Borkin a, Jonathan

Aluminum Electrolytic Capacitors (Large Can Type)

Aluminum Electrolytic Capacitors (Large Can Type) Snap-In, 85 C TS-U ECE-S (U) Series: TS-U Features General purpose Wide CV value range (33 ~ 47,000 µf/16 4V) Various case sizes Top vent construction

Nature Immunology: doi: /ni Supplementary Figure 1. Foxm1 loss leads to bone marrow hypocellularity.

Supplementary Figure 1 Foxm1 loss leads to bone marrow hypocellularity. (a-b) Analysis of ablation of Foxm1 as determined by semiquantitative PCR analysis of genomic DNA (a) as well as qrt-pcr analysis

http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology RT-PCR Runx d PCR RT-qPCR Western BMPs Wnt Ihh

ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 6 27 6 540 ~ 547 micrornas * / / 250062 microrna mrna β- RT-PCR Runx2 0 7 14 d micrornas

Original Article Genome-wide ChIP-seq analysis of TCF4 binding regions in colorectal cancer cells

Int J Clin Exp Med 2014;7(11):4253-4259 www.ijcem.com /ISSN:1940-5901/IJCEM0002259 Original Article Genome-wide ChIP-seq analysis of TCF4 binding regions in colorectal cancer cells Chen Chen 1, Yachun

Unique peptides 1 DHX9 ATP-dependent RNA Q MYBBP1A Myb-binding protein 1A Q9BQG ADAR Adenosine deaminase, Q59EC

SUPPLEMENTAL TABLES Supplemental Table 1: List of proteins identified by mass spectrometry. # Symbol Characteristics of proteins Accession number Molecular weight (kda) Unique peptides 1 DHX9 ATP-dependent

Activated Notch counteracts Ikaros tumor suppression in mouse and human T cell acute lymphoblastic leukemia

SUPPLEMENTAL MATERIAL FOR: Activated Notch counteracts Ikaros tumor suppression in mouse and human T cell acute lymphoblastic leukemia Matthew T. Witkowski, Luisa Cimmino, Yifang Hu, Thomas Trimarchi,

Supplemental Figure 1 Genechip data analysis. Three pairs of bulge and sub-bulge ORS Genechips were analyzed and compared by MASv5.0 and dchip 1.3 software algorithms in order to identify gene transcripts

Validità 31/01/2013 PROMO CODE

Validità 31/01/2013 PROMO CODE SCP-P100192 SC Cat # Protein Name Application Y71-30G 14-3-3α/β Protein Western Blot Y71-30N 14-3-3α/β Protein Western Blot Y75-30G 14-3-3ε Protein Western Blot Y75-30N 14-3-3ε

Table S2. Sequences immunoprecipitating with anti-hif-1α

Genome-wide analysis of HIF DNA-bdg-supplemental material Table S2. Sequences immunoprecipitatg with anti-α The table gives the chromosomal co-ordates of each anti-α immunoprecipitated locus meetg criteria

Supporting Information

Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid

SUPPLEMENTAL MATERIAL

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 SUPPLEMENTAL MATERIAL Biogenesis of Pro-senescent Microparticles by Endothelial Colony Forming Cells from Premature Neonates is driven

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου

CD4 + T cell lineage integrity is controlled by the histone deacetylases HDAC1 and HDAC2

Supplementary Information, Boucheron et al., 1 Supplementary Information for the manuscript T cell lineage integrity is controlled by the histone deacetylases HDAC1 and HDAC2 Nicole Boucheron 1,11, Roland

RHOA inactivation enhances Wnt signaling and promotes colorectal cancer

RHOA and colorectal cancer Paulo Rodrigues et al 2014 SUPPLEMENTARY INFORMATION RHOA inactivation enhances Wnt signaling and promotes colorectal cancer Paulo Rodrigues, Irati Macaya, Sarah Bazzocco, Rocco

Νόσος Parkinson-Νέοι ορίζοντες Ξηροµερήσιου Γεωργία Νευρολόγος-Μέλος ερευνητικής οµάδας Νευρογενετικής Αίτια της νόσου Parkinson Περιβαλλοντικοί παράγοντες Γενετικοί παράγοντες Γενετική βλάβη (παθογόνα

Analysis Summary: Hypermobility Beighton Score

Analysis Summary: Hypermobility Beighton Score Phenotype Description The beighton_hypermobility_qtl phenotype comes from: morphology survey: Can you bring your right thumb to reach your forearm (see above

ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ

5 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ ΕΛΛΗΝΙΚΗΣ ΕΤΑΙΡΕΙΑΣ ΑΙΜΑΦΑΙΡΕΣΗΣ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ Θωμάς Τσαγανός, MD, PhD Πανεπιστημιακός Υπότροφος Δ Παθολογική Κλινική Πανεπιστημιακό Γενικό Νοσοκομείο

Systematic Analysis of Candidate Genes for Alzheimer s Disease in a French, Genome-Wide Association Study

Journal of Alzheimer s Disease 20 (2010) 1 13 1 IOS Press Supplementary Material Systematic Analysis of Candidate Genes for Alzheimer s Disease in a French, Genome-Wide Association Study Geoffroy Laumet

Γενετική Προδιάθεση Ψωρίασης - Πού βρισκόμαστε?

Γενετική Προδιάθεση Ψωρίασης - Πού βρισκόμαστε? Κατερίνα Πατσατσή Λέκτορας Δερματολογίας Αφροδισιολογίας Β Κλινική Δερματικών & Αφροδισίων Νόσων ΑΠΘ Νοσοκομείο Παπαγεωργίου ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ Προσβάλλει 0.2

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing

Μοριακή βάση του καρκίνου της ουροδόχου κύστεως

Πανεπιστήμιο Αθηνών Τμήμα Βιολογίας Τομέας Βιοχημείας & Μοριακής Βιολογίας Μοριακή βάση του καρκίνου της ουροδόχου κύστεως Μαργαρίτης Αυγέρης, Ανδρέας Σκορίλας Τομέας Βιοχημείας και Μοριακής Βιολογίας,

Differentially expressed genes of HEK293/HeLa Myst4 sirna vs. controls.

Supplemental data - Content Supplemental figures Figure 1 Figure 2 Figure 3 Figure 4 Western blot analysis of MYST4. Expression pattern of MYST4 isoforms. Differentially expressed genes of HEK293/HeLa