CD4 + T cell lineage integrity is controlled by the histone deacetylases HDAC1 and HDAC2

Supplementary Information, Boucheron et al., 1 Supplementary Information for the manuscript T cell lineage integrity is controlled by the histone deacetylases HDAC1 and HDAC2 Nicole Boucheron 1,11, Roland Tschismarov 1,11, Lisa Göschl 1,2, Mirjam A Moser 3, Sabine Lagger 3,10, Shinya Sakaguchi 1, Mircea Winter 3, Florian Lenz 4, Dijana Vitko 5, Florian P Breitwieser 5, Lena Müller 1, Hammad Hassan 1, Keiryn L Bennett 5, Jacques Colinge 5, Wolfgang Schreiner 4, Takeshi Egawa 6, Ichiro Taniuchi 7, Patrick Matthias 8,9, Christian Seiser 3,12 & Wilfried Ellmeier 1,12 1 Division of Immunobiology, Institute of Immunology, Center for Pathophysiology, Infectiology and Immunology, Medical University of Vienna, Vienna, Austria. 2 Division of Rheumatology, Medicine III, Medical University of Vienna, Vienna, Austria. 3 Department of Medical Biochemistry, Max F. Perutz Laboratories, Vienna Biocenter, Medical University of Vienna, Vienna, Austria. 4 Division of Biosimulation and Bioinformatics, Center for Medical Statistics, Informatics, and Intelligent Systems, Medical University of Vienna, Vienna, Austria. 5 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 6 Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, Missouri, USA. 7 Laboratory for Transcriptional Regulation, RIKEN Center for Integrative Medical Sciences-RIKEN Center for Allergy and Immunology, Yokohama, Kanagawa, Japan. 8 Friedrich Miescher Institute for Biomedical Research, Novartis Research Foundation, Basel, Switzerland. 9 University of Basel, Faculty of Sciences, Basel, Switzerland. 10 Present address: University of Edinburgh, Wellcome Trust Centre for Cell Biology, Edinburgh, UK. 11 These authors contributed equally to this work. 12 These authors jointly directed this work. Correspondence should be addressed to W.E. (wilfried.ellmeier@meduniwien.ac.at) or C.S. (christian.seiser@meduniwien.ac.at).

Supplementary Information, Boucheron et al., 2 Supplementary Figure 1 Characterization of T cells in HDAC2 cko mice. (a) Flow cytometry analysis of B220, TCRβ, CD4 and CD8α expression on splenocytes isolated from WT and HDAC2 cko mice. Flow cytometry analysis of CD4 and CD8α expression was performed on TCRβ + splenocytes. (b) Flow cytometry analysis of CD4, CD8α, CD24 and TCRβ expression on WT and HDAC2 cko thymocytes. The CD4 and CD8α plot to the right is gated on HSA lo TCRβ hi cells. (c) Flow cytometry showing intracellular HDAC2 expression levels in WT and HDAC2 cko mice DN, DP, CD4SP and CD8SP thymocyte subsets and in splenic and CD8 + T cells. CD4SP and CD8SP cells were gated on TCRβ hi subsets. The dotted vertical line separates HDAC2-negative and HDAC2-positive cells. (d) Flow cytometry analysis of CD44 and CD62L expression on TCRβ + splenic WT and HDAC2 cko and CD8 + T cells. (e) Flow cytometry analysis of CD25 and intracellular FoxP3 expression in splenic WT and HDAC2 cko T cells. (f) Flow cytometry analysis of intracellular HDAC1 and HDAC2 expression in splenic WT and HDAC2 cko and CD8 + T cells. (a,b,d-f) Numbers indicate the percentage of cells in the respective quadrants and regions. Data are representative of six (WT) and seven (HDAC2 cko mice) mice (a,b,d), of three mice (c) and of two mice (e,f) analyzed in four (a,b,d) and in one (c,e,f) experiments.

Supplementary Information, Boucheron et al., 3 Supplementary Figure 2 Characterization of T cell subsets in HDAC1-2 cko mice. (a) Flow cytometry analysis of TCRβ expression on WT and CD8 + T cells and on HDAC1-2 cko, CD8 + and CD8 + T cells. (b) Mean fluorescence intensity (MFI) of CD4 expression on WT T cells and on HDAC1-2 cko and CD8 + T cells. Per experimental staining group, wild-type MFI CD4 was set as 1 and the relative expression HDAC1-HDAC2-deficient and CD8 + T cells was calculated. (c) Flow cytometry analysis of CD25 and intracellular FoxP3 expression in T cells from WT T cells and in HDAC1-2 cko and CD8 + T cells (d) Percentages of CD44 hi splenic WT and CD8 + T cells and of HDAC1-2 cko, CD8 + and CD8 + T cells. (e) Flow cytometry analysis of intracellular IFN-γ and TNF-α expression in splenic WT and HDAC1-2 cko and CD8 + T cells and in HDAC1-2 cko CD8 + T cells activated ex vivo with PMA/ionomycin for 5 hours. (f) Flow cytometric bead assays showing IFN-γ, IL-4, TNFα and GM-CSF amount in the supernatant of WT and HDAC1-2 cko and CD8 + T cells and HDAC1-2 cko CD8 + T cells activated with anti-cd3 and anti-cd28 for 24 hours. (g) Flow cytometry analysis showing CD62L, CD122, CD127, CCR7 and CD27 expression on naïve (CD44 lo ) and effector/memory (CD44 hi ) splenic WT and HDAC1-2 cko and CD8 + T cells. The expression of these markers on total HDAC1-2 cko CD8 + splenocytes is shown as dashed line on top of each panel. (c,e,g) Numbers indicate the percentage of cells in the respective quadrant or regions. Data are representative (a,c,e,g) or show summary (b,d,f) of six mice (a), of seven mice (b), of two mice (c), of seven (WT) and eight (HDAC1-2 cko) mice (d), of four mice (e), of two independent samples (f) and of six mice except for CD27 (two mice) (g) that were analyzed in three (a,b), in one (c) in four (d) and in two (e,f,g) independent experiments. (b) *P < 0.05 (Wilcoxon signed rank test). Mean ± SD is shown. (d) *P < 0.05 (unpaired two-tailed Mann-Whitney test). NS, not significant.

Supplementary Information, Boucheron et al., 4 Supplementary Figure 3 T cell defects in HDAC1-2 cko T cells are cell-intrinsic and CD8 expression in HDAC1-2 cko T cells is dependent on Cd8 enhancer E8 I. (a) Flow cytometry analysis of B220, TCRβ, CD4 and CD8α on splenocytes isolated from CD45.1 + chimeric mice that received either WT or HDAC1-2 cko CD45.2 + BM cells that had been mixed at a 1:1 ratio with wild-type (WT, CD45.1 + ) BM cells. Cells were gated on CD45.1 + and CD45.2 + subsets. Flow cytometry analysis of CD4 and CD8α expression was performed on TCRβ + splenocytes. (b) Flow cytometry analysis of CD154 and CD69 expression on WT and CD8 + T cells and on HDAC1-2 cko, CD8 + and CD8 + T cells activated with anti-cd3 and anti-cd28 for 12 hours. (c) PCR analysis of DNA isolated from WT and CD8 + T cells and B220 + B cells, and from HDAC1-2 cko, CD8 + and CD8 + T cells and B220 + B cells to detect deletion of Hdac1 and Hdac2. The lower panel shows a PCR analysis of DNA isolated from WT B cells mixed with either HDAC1 cko or HDAC2 cko T cells at the indicated ratio to determine the sensitivity of the PCR assay. The size of the PCR fragments are for Hdac1: floxed (F): 567 bp; deleted (Δ): 535 bp; for Hdac2: floxed (F): 850bp; deleted (Δ): 670bp. (d) Flow cytometry analysis of CD4 and CD8α expression on E8 I +/+ WT and E8 I / HDAC1-2 cko T cells activated with anti-cd3 and anti-cd28 for 48 hours. (a,d) Numbers in the plots indicate the percentage of cells in the respective quadrants and regions. (a-d) Data are representative of three (a) and two (b,d) mice per group analyzed in two independent experiments (a-d).

Supplementary Information, Boucheron et al., 5 Supplementary Figure 4 Gene expression patterns in CD4 lineage T cells in the absence of HDAC1 and HDAC2. (a) Gene expression profiles from WT T cells and from HDAC1-2 cko and CD8 + T cells were determined using Agilent arrays. Data were analyzed using Genespring software. Scatter plots show HDAC1-2 cko (Y-axis) versus WT (X-axis) T cells. The scale on the X- and Y-axis indicate expression levels (log2). Numbers at the upper-right or lower-left corners show the number of genes up- or down-regulated (fold-difference 2, P 0.05) in the absence of HDAC1 and HDAC2, respectively. (b) qrtpcr analysis showing Cd4, Cd8a and Cd8b1 expression (relative to Hprt1) in WT and CD8 + T cells and in HDAC1-2 cko, CD8 + and CD8 + T cells. Arbitrary units are shown. RNA samples were identical to the ones used for microarrays in (a). The summary of 3 independent experiments is shown. *P < 0.05, **P < 0.01 and ***P < 0.001 (unpaired two-tailed Student s t-test). Mean with SD is shown. (c) Agilent microarray expression data of selected genes in WT T cells and HDAC1-2 cko and CD8 + T cells are shown. The expression levels in WT T cells were set as 1 and the relative expression in the other subsets was calculated. The numbers indicate the relative expression value. Only one representative Agilent array probe per gene is shown. The following probes are shown: Runx3 (A_55_P2130895), Eomes (A_55_P2150717), Prf1 (A_55_P2000039), Zbtb7b (A_55_P2020348), Cd4 (A_55_P2013655), Cd8a A_52_P443334), Cd8b1 (A_55_P2154982). Data show the summary of three arrays per cell population. *P < 0.05 (unpaired two-tailed Student s t-test). (d) qrtpcr analysis showing Eomes, Runx3, Tbx21 and Zbtb7b expression in naïve WT T cells and in naive HDAC1-2 cko and CD8 + ) T cells. Data show summary of 3 (for T cells) and 2 (for HDAC1-2 cko CD8 + T cells) independent biological replicas performed in two ( T cells) and one ( CD8 + T cells) experiment(s).

Supplementary Information, Boucheron et al., 6 Supplementary Figure 5 HDAC1-HDAC2 binding to CD8 lineage genes, the effect of GATA-3 on MS-275-induced CD8 up-regulation and a proteomic versus transcriptomic comparison. (a) qrtpcr with primers specific for Cd8a, Cd8b1, Runx3 and Eomes promoter regions and for Cd8 enhancer E8 I from chromatin of non-activated (N) and activated (A; anti-cd3 with anti-cd28 for 60 hours) wild-type (left panel) and CD8 + (right panel) T cells immunoprecipitated with anti- HDAC1 or anti-hdac2 antibodies (or IgG and IgM as control). Mean of 2 independent experiments is shown. Dots display the results of the individual experiments. One representative result of 2 independent experiments is shown for E8 I in T cells. Values are shown as % input. (b) Flow cytometry analysis showing surface CD8α expression on GFP + wild-type T cells 48 hours after transduction with either "empty" MIGR-control or with a Gata3-containing retroviral vector. MS-275 (or DMSO as carrier control) was added 24 hours after transduction. Data are representative of 4 independent experiments. The summary of all experiments is shown at the bottom. For each experiment, the percentage of CD8 + MS275-treated MIGR-transduced GFP + cells was set to 1 and the relative value of the percentage of CD8 + MS275-treated GATA3- transduced cells was calculated. *P<0.05 (one sample two-tailed t-test). Mean ± SD is shown. (c) Correlation plot of the log2-ratios for microarray transcriptomic (WT/HDAC1-2 cko) and proteomic data (WT/HDAC1-2 cko). The pearson's correlation coefficient is 0.4357, and spearman's rank coefficient is 0.4219.

Supplementary Information, Boucheron et al., 7 Supplementary Table 1 Up-regulated genes 1 A_52_P108447 51.27 Glis2 2 A_55_P2103105 32.82 Ptpla 3 A_52_P251615 23.34 Arhgef40 4 A_51_P507801 19.19 F13a1 5 A_55_P2022211 17.90 Plxdc2 6 A_55_P2000553 17.66 Slc6a8 7 A_51_P234788 17.08 Cxxc5 8 A_55_P2004213 15.98 Gprasp2 9 A_55_P2123673 15.30 Trnp1 10 A_52_P476029 15.07 8430427H17Rik 11 A_55_P2007001 14.66 Ctnnbip1 12 A_55_P2167025 13.70 Pvrl2 13 A_51_P472608 13.23 Vangl2 14 A_55_P2072233 12.61 Zcchc12 15 A_52_P244193 12.59 Cd24a 16 A_55_P2069979 12.19 Large 17 A_52_P208521 12.06 Khdc1a 18 A_52_P387724 11.99 Tcf7l1 19 A_51_P116755 11.97 Cap2 20 A_55_P2019457 11.94 Eno2 21 A_51_P109144 11.37 Grtp1 22 A_55_P2153753 11.18 5830411N06Rik 23 A_55_P2174935 11.13 Mn1 24 A_55_P2023424 10.94 Trip10 25 A_51_P444447 10.53 Cebpd 26 A_55_P2164534 10.48 Dtl 27 A_51_P383991 10.26 Sept4 28 A_51_P138895 10.18 Ccdc102a 29 A_55_P1997595 9.87 Slc6a19 30 A_55_P1960989 9.86 Nlgn2 31 A_52_P706060 9.83 Mex3a 32 A_51_P341177 9.60 Ddah2 33 A_55_P2029106 9.50 Bmf 34 A_51_P397468 9.44 Rundc3a 35 A_51_P156857 9.34 2010002N04Rik 36 A_55_P2024461 9.22 Tbkbp1 37 A_52_P648424 9.03 Nedd4 38 A_55_P2307603 9.01 R74862 39 A_55_P2007500 8.71 Tmem151b 40 A_55_P1954276 8.71 Emid1 41 A_55_P2012478 8.68 Zfp618 42 A_51_P258766 8.58 Smo 43 A_51_P338031 8.48 Trpm1 44 A_55_P1983558 8.47 Tmed1 45 A_51_P337195 8.46 Pipox 46 A_55_P2044684 8.40 Rsph1 47 A_55_P2012815 8.38 Acvr2b 48 A_51_P270733 8.20 Syngr1 49 A_51_P324442 8.09 Wdr35 50 A_55_P1964638 7.98 Cxadr 51 A_55_P2121856 7.94 Ier5l 52 A_66_P128434 7.92 Kit 53 A_55_P2054350 7.72 Fbxo44 54 A_51_P257550 7.71 Marcksl1 55 A_51_P389895 7.39 Slc35f5 56 A_51_P438083 7.36 Slc6a13 57 A_55_P1969615 7.27 Pnck 58 A_55_P2101231 7.27 Aldh7a1 59 A_55_P1968295 6.98 Pacsin3 60 A_52_P79639 6.95 Vat1 61 A_51_P513530 6.94 Spag5 62 A_51_P450549 6.91 Padi3 63 A_51_P516085 6.72 Dntt 64 A_55_P1999790 6.68 Pkdcc 65 A_55_P1992079 6.65 Ptprf 66 A_52_P497534 6.64 Wipi1 67 A_51_P331003 6.57 Sema4g 68 A_55_P2002884 6.43 Zcchc24 69 A_55_P2110497 6.39 Ddc 70 A_55_P2044917 6.33 Gpr83 71 A_55_P2030030 6.33 Adssl1 72 A_51_P451516 6.31 Arhgef25 73 A_55_P1959174 6.30 Pmepa1 74 A_51_P327632 6.30 Igsf3 75 A_55_P2009121 6.22 Agrn 76 A_52_P609334 6.13 Klhdc8b 77 A_55_P2024337 6.11 Tmem53 78 A_55_P2077048 5.94 Itih5 79 A_55_P2040936 5.93 Eng 80 A_55_P2167112 5.88 Kank2 81 A_51_P303620 5.88 Whrn 82 A_55_P2118784 5.85 Rcor2 83 A_52_P137765 5.76 Lmna 84 A_66_P103398 5.76 Ogfrl1 85 A_55_P2231747 5.75 AW742560 86 A_52_P920158 5.70 Rbm24 87 A_51_P227718 5.69 Rasgrp4 88 A_55_P2111355 5.65 Egfl7

Supplementary Information, Boucheron et al., 8 89 A_55_P2083789 5.63 2810410L24Rik 90 A_55_P1966274 5.61 Pdzd4 91 A_51_P315904 5.57 Gadd45g 92 A_51_P456465 5.55 Cldn10 93 A_55_P2097553 5.55 C77080 94 A_55_P1991985 5.54 Ptprs 95 A_51_P152404 5.47 Ikbip 96 A_55_P2048588 5.43 Cdk1 97 A_51_P154753 5.39 Klc3 98 A_55_P1986486 5.37 Gtf2ird1 99 A_52_P420466 5.26 Hist1h2ab 100 A_55_P2296118 5.26 9630010G10Rik 101 A_52_P514061 5.23 Padi4 102 A_55_P2170813 5.22 Pkig 103 A_55_P2011146 5.19 Reep1 104 A_51_P275101 5.15 Chst11 105 A_55_P1977478 5.14 Zfp629 106 A_52_P481279 5.11 Ccdc164 107 A_52_P139650 5.10 Ska1 108 A_51_P256224 5.02 Zfp768 109 A_51_P184969 5.01 Rilpl1 110 A_66_P131979 5.00 Cdc6 111 A_55_P1961210 4.95 Trp53inp2 112 A_51_P449325 4.94 H2-Oa 113 A_52_P441294 4.94 Chl1 114 A_55_P2046393 4.88 Rcn3 115 A_51_P223709 4.87 Pask 116 A_55_P2110998 4.86 Gpr153 117 A_51_P421140 4.85 Tubb6 118 A_55_P2195157 4.85 Dbn1 119 A_55_P2270137 4.81 B930036G03Rik 120 A_55_P2138878 4.74 Lrfn4 121 A_66_P114333 4.74 Tlr12 122 A_51_P303749 4.71 Depdc1b 123 A_52_P70949 4.69 Khdc1c 124 A_55_P1967266 4.65 Plxnb2 125 A_51_P315673 4.64 Usp11 126 A_51_P282227 4.59 As3mt 127 A_51_P483473 4.57 St3gal5 128 A_55_P1961014 4.53 Selenbp1 129 A_51_P418935 4.49 Neurl2 130 A_55_P2058942 4.48 Aldh3b1 131 A_51_P452779 4.47 Pygl 132 A_51_P472249 4.46 Slc7a7 133 A_55_P1973783 4.45 Tex9 134 A_51_P293753 4.37 Cul7 135 A_55_P2028773 4.36 Slc22a17 136 A_51_P509971 4.36 Plekho1 137 A_55_P2115696 4.30 5930422O12Rik 138 A_51_P241457 4.27 Lilrb4 139 A_51_P416509 4.26 Hist1h1a 140 A_55_P1977468 4.23 Dab2ip 141 A_51_P123405 4.22 Bub1 142 A_55_P2031871 4.21 Plekhh3 143 A_52_P650387 4.20 Ccnjl 144 A_51_P251352 4.19 Slc25a13 145 A_55_P2165560 4.15 Plekhg5 146 A_51_P329928 4.06 Phlda3 147 A_55_P1991688 4.04 Rad51ap1 148 A_51_P240453 4.03 Nusap1 149 A_52_P166393 4.03 Art1 150 A_55_P2024903 4.02 Dnahc17 151 A_55_P2154982 4.01 Cd8b1 152 A_51_P259009 4.00 Cacnb3 153 A_52_P232580 3.99 Dyrk3 154 A_55_P1960916 3.99 Egln3 155 A_55_P2052016 3.98 Crispld2 156 A_52_P251366 3.96 Neil3 157 A_55_P1971963 3.96 Tmem176b 158 A_66_P100932 3.93 1810027O10Rik 159 A_55_P2088425 3.93 Tcn2 160 A_55_P2121608 3.91 Sox4 161 A_51_P295237 3.90 Lrp11 162 A_51_P149455 3.89 Acadl 163 A_55_P2168667 3.88 Rbpms2 164 A_51_P223443 3.85 Cd81 165 A_51_P176972 3.83 Amigo2 166 A_52_P459276 3.82 Ift81 167 A_52_P420357 3.81 Slc15a1 168 A_51_P184353 3.80 Nr2f6 169 A_55_P2176792 3.79 Sh3gl3 170 A_66_P132890 3.75 B930049P21Rik 171 A_51_P473272 3.70 Tspan6 172 A_55_P2074246 3.70 Zfp184 173 A_55_P2053266 3.66 St6galnac6 174 A_55_P2068723 3.62 Ccl27a 175 A_51_P444437 3.62 Ptgr1 176 A_55_P2087404 3.62 Mapre3 177 A_55_P1980883 3.60 Ephb6 178 A_52_P498208 3.59 Hist1h2ak 179 A_55_P2128672 3.59 Ikbip 180 A_55_P2159249 3.59 Gm5771

Supplementary Information, Boucheron et al., 9 181 A_55_P2035286 3.58 Uhrf1 182 A_51_P481398 3.56 Kif11 183 A_55_P1960074 3.55 Pafah1b3 184 A_55_P2186395 3.54 Gm6340 185 A_55_P2173982 3.54 Rrm2 186 A_51_P321531 3.53 Purg 187 A_55_P1968833 3.53 Rpgr 188 A_55_P2154709 3.53 Pter 189 A_52_P456750 3.52 Aph1b 190 A_55_P1983095 3.47 Adam19 191 A_51_P514256 3.47 Tubb2b 192 A_55_P2121521 3.46 Hist1h3i 193 A_51_P492830 3.45 Cenph 194 A_51_P158018 3.45 Bend5 195 A_52_P359621 3.44 Luzp1 196 A_51_P133060 3.43 Kif7 197 A_55_P2120615 3.43 Ssh3 198 A_55_P2105271 3.43 Pdlim7 199 A_52_P306305 3.41 Akap2 200 A_51_P508259 3.41 Ppm1n 201 A_51_P382347 3.40 Nphp3 202 A_51_P148105 3.37 Rad51 203 A_51_P253547 3.37 Ctsl 204 A_55_P1963863 3.34 Arhgef17 205 A_51_P346165 3.31 Agpat4 206 A_55_P2003793 3.31 Tspan3 207 A_55_P2173827 3.30 Tox2 208 A_55_P1977008 3.30 Gfi1 209 A_55_P2127303 3.28 Spsb2 210 A_55_P2030958 3.28 2610301B20Rik 211 A_51_P100174 3.27 Mns1 212 A_55_P2162935 3.26 Ntn1 213 A_55_P2099961 3.26 Hist1h2ag 214 A_51_P227004 3.26 Cks1b 215 A_52_P176619 3.24 Atat1 216 A_55_P2063096 3.23 Txnrd3 217 A_51_P204080 3.22 Hk2 218 A_55_P2210213 3.22 4732423E21Rik 219 A_52_P94521 3.21 2510009E07Rik 220 A_55_P1963529 3.19 Abcb10 221 A_51_P267239 3.19 Litaf 222 A_55_P2084631 3.19 Hist1h2an 223 A_55_P2105820 3.17 Wdr67 224 A_55_P2030578 3.17 Tns1 225 A_52_P502771 3.16 Rad54b 226 A_52_P255224 3.16 Gm5784 227 A_52_P177373 3.16 Intu 228 A_51_P344376 3.16 Gpr162 229 A_52_P436628 3.14 Vegfb 230 A_52_P558368 3.13 Zdhhc1 231 A_52_P360515 3.12 Celsr2 232 A_51_P423825 3.12 Morn1 233 A_52_P617636 3.11 Klf12 234 A_55_P2014319 3.10 Armcx6 235 A_51_P456857 3.10 Ift122 236 A_55_P2369191 3.09 Ggta1 237 A_51_P436817 3.08 Dos 238 A_52_P665675 3.08 Abca1 239 A_55_P2039637 3.07 Ift88 240 A_55_P2043337 3.06 Colq 241 A_51_P302458 3.04 Plscr3 242 A_51_P469008 3.04 Ehd1 243 A_55_P1967291 3.03 Ncaph 244 A_51_P507899 3.03 Ttc8 245 A_51_P191520 3.02 Stard10 246 A_51_P125135 3.01 Cdca5 247 A_52_P16931 3.00 Suv39h2 248 A_51_P308844 2.99 Nrn1 249 A_55_P2143851 2.99 Gm996 250 A_55_P2208961 2.98 4833419E13Rik 251 A_55_P2040863 2.98 Cnn3 252 A_55_P2149951 2.97 Prx 253 A_51_P468073 2.93 Ggt1 254 A_55_P2113683 2.93 Raph1 255 A_52_P27020 2.92 Sgol2 256 A_55_P1992745 2.91 Epb4,1l1 257 A_55_P2005838 2.91 5730590G19Rik 258 A_55_P2154049 2.90 Myo18a 259 A_51_P115626 2.89 Shank3 260 A_55_P1974019 2.88 Dapk1 261 A_55_P2031481 2.88 Fam131a 262 A_55_P2034300 2.87 Tmem40 263 A_51_P300506 2.86 Cox6b2 264 A_55_P2043554 2.86 Slc12a4 265 A_55_P1953503 2.84 Lrrc4b 266 A_55_P1985788 2.83 Usp2 267 A_51_P490795 2.83 Mxd1 268 A_51_P362959 2.82 Fbxo36 269 A_51_P472888 2.82 E130303B06Rik 270 A_51_P511482 2.80 Ift57 271 A_55_P2094966 2.79 Hist2h3c1 272 A_55_P2149654 2.79 Dtx3

Supplementary Information, Boucheron et al., 10 273 A_55_P2067453 2.78 Tspan17 274 A_51_P513661 2.77 Slc4a8 275 A_55_P2068356 2.74 1700016K19Rik 276 A_55_P2109152 2.73 Hist1h2bg 277 A_51_P463440 2.73 Elovl6 278 A_66_P128909 2.73 Numbl 279 A_52_P282741 2.72 Sdc3 280 A_55_P2031496 2.71 Rufy3 281 A_52_P360112 2.71 Clip2 282 A_55_P2004797 2.70 Tacc2 283 A_55_P2145696 2.70 Leprel4 284 A_55_P2068733 2.70 Gm13308 285 A_52_P219473 2.69 Cdc6 286 A_55_P2082929 2.69 H2-Ob 287 A_55_P2168692 2.68 Azi1 288 A_55_P2132902 2.68 Gprasp1 289 A_55_P2170978 2.67 Ankrd13d 290 A_51_P408071 2.67 Kntc1 291 A_51_P442719 2.67 Usp6nl 292 A_55_P2301312 2.65 Wdr78 293 A_51_P230347 2.65 Srsf12 294 A_55_P2046852 2.64 Gata1 295 A_55_P2114776 2.64 Greb1 296 A_55_P2161858 2.63 Pdlim7 297 A_55_P2002122 2.61 Rgs12 298 A_55_P2108773 2.60 4930427A07Rik 299 A_55_P2128526 2.60 Pfn2 300 A_55_P2021266 2.60 Hpse 301 A_55_P1991618 2.60 Ppp1r16a 302 A_51_P480119 2.59 Prelid2 303 A_55_P2055087 2.59 Prkar2b 304 A_55_P2099980 2.59 Cul9 305 A_55_P2084656 2.58 Hist1h2ah 306 A_55_P1971734 2.58 Reck 307 A_51_P228171 2.58 Cenpp 308 A_55_P2427685 2.58 Agl 309 A_55_P2182497 2.57 Maml3 310 A_51_P257065 2.56 Prpf40b 311 A_51_P217336 2.56 Scamp1 312 A_55_P2142575 2.55 Tdrd5 313 A_55_P2337706 2.55 1110065H08Rik 314 A_52_P330214 2.54 Fanca 315 A_66_P104390 2.53 Arl3 316 A_52_P540219 2.53 Timp2 317 A_52_P681391 2.52 G0s2 318 A_51_P337089 2.52 Gins1 319 A_55_P2017826 2.51 Myb 320 A_55_P2156293 2.51 Pcyox1 321 A_55_P2017764 2.49 Ccdc123 322 A_66_P121086 2.49 Map3k8 323 A_51_P269084 2.49 Chchd10 324 A_55_P1992655 2.49 Hdac6 325 A_51_P198775 2.48 BC055324 326 A_55_P1998892 2.48 Smox 327 A_52_P385606 2.48 Ckb 328 A_51_P401683 2.46 Tm6sf1 329 A_55_P1999361 2.46 Dip2a 330 A_51_P208680 2.46 Chtf18 331 A_51_P141071 2.46 Cand2 332 A_51_P422369 2.45 Odf3b 333 A_55_P1975430 2.45 St3gal3 334 A_51_P502872 2.44 2200002D01Rik 335 A_55_P2135271 2.44 Zfp358 336 A_51_P363556 2.44 Abi2 337 A_55_P2454521 2.43 Alms1 338 A_55_P2061341 2.43 Ift74 339 A_55_P2302577 2.43 AI426330 340 A_51_P105709 2.42 Trip13 341 A_55_P2133100 2.40 Ccdc50 342 A_51_P106527 2.40 Fam195a 343 A_55_P2013948 2.39 Gsn 344 A_51_P353882 2.38 Zfp580 345 A_55_P2128646 2.38 Gmnn 346 A_66_P129188 2.38 Hist2h2ac 347 A_51_P208931 2.37 N4bp3 348 A_51_P396917 2.37 Zfyve21 349 A_55_P2084666 2.37 Hist1h2af 350 A_55_P2014987 2.37 Gatsl2 351 A_55_P1995507 2.37 Aqp11 352 A_51_P430082 2.36 Tst 353 A_55_P1988148 2.36 Tox 354 A_51_P129464 2.35 Scd2 355 A_51_P242859 2.35 Akr1c12 356 A_51_P405606 2.35 Ndrg1 357 A_51_P441494 2.35 BC100451 358 A_55_P2099520 2.35 H2afv 359 A_55_P2114133 2.34 Garnl3 360 A_55_P1991605 2.33 Aplp1 361 A_55_P1982201 2.33 Sgsm2 362 A_51_P155142 2.32 Cdca8 363 A_55_P2111855 2.31 Gale 364 A_55_P2022181 2.31 Arvcf

Supplementary Information, Boucheron et al., 11 365 A_55_P2096834 2.31 Fbxl19 366 A_51_P252784 2.30 1500011H22Rik 367 A_55_P2057469 2.30 Caskin1 368 A_51_P487718 2.30 E2f3 369 A_55_P2027136 2.29 Hist1h3f 370 A_51_P202033 2.29 Wls 371 A_55_P2068731 2.29 Gm13308 372 A_51_P344566 2.28 Plk1 373 A_55_P2037662 2.28 Atp1a3 374 A_51_P239654 2.28 Nr4a1 375 A_55_P2045802 2.27 Nelf 376 A_51_P516870 2.27 Itm2a 377 A_55_P2113165 2.26 Camkk1 378 A_52_P266320 2.26 Akap17b 379 A_55_P1984098 2.26 Mst1 380 A_51_P140237 2.25 Fhl2 381 A_55_P2062190 2.25 Gstm1 382 A_55_P1955632 2.24 Trp53i11 383 A_51_P359237 2.24 Tmem9 384 A_55_P1985514 2.24 Dlg3 385 A_55_P2077343 2.24 Ahdc1 386 A_51_P330369 2.24 Ssx2ip 387 A_52_P427818 2.24 Zscan18 388 A_66_P106065 2.23 Ttc3 389 A_55_P1993128 2.22 Gas8 390 A_51_P357207 2.21 Zfp518b 391 A_51_P355434 2.21 Trib1 392 A_51_P328652 2.21 Acot7 393 A_51_P518488 2.20 Atpif1 394 A_55_P1987805 2.19 Rps6ka5 395 A_55_P2143251 2.18 Rims3 396 A_52_P384314 2.18 1110012D08Rik 397 A_51_P185846 2.17 Dnalc4 398 A_55_P2014174 2.17 9130004C02Rik 399 A_55_P1981544 2.17 Lactb 400 A_52_P407692 2.17 H2afj 401 A_51_P403334 2.16 Cuedc2 402 A_51_P452629 2.16 Tlr2 403 A_55_P1960291 2.16 Tjp3 404 A_51_P109541 2.16 E130308A19Rik 405 A_55_P1959425 2.16 Slc16a3 406 A_55_P2131438 2.16 Hist2h2aa2 407 A_55_P2019751 2.15 Paox 408 A_51_P423356 2.15 Katnal2 409 A_55_P2091147 2.15 Hist1h4k 410 A_55_P2146177 2.14 Cerk 411 A_51_P163261 2.14 Gm6985 412 A_52_P234354 2.13 Hic2 413 A_55_P1956223 2.13 Chka 414 A_52_P195798 2.13 Atp5s 415 A_66_P117786 2.12 Crxos1 416 A_51_P516705 2.12 Ern1 417 A_51_P367310 2.12 Chaf1b 418 A_55_P1976490 2.12 Lman2l 419 A_55_P2075140 2.11 Sirt3 420 A_55_P1994887 2.11 Zfpm1 421 A_55_P2013414 2.11 Dmwd 422 A_55_P2334942 2.11 1700093J21Rik 423 A_51_P202074 2.10 Ncapd2 424 A_51_P464900 2.10 Gabbr1 425 A_55_P2107367 2.10 Pbx3 426 A_51_P428754 2.09 Grik5 427 A_55_P2142580 2.07 Mark4 428 A_51_P474459 2.07 Socs3 429 A_55_P2151056 2.07 Rarg 430 A_51_P332141 2.07 Clcn2 431 A_55_P2013356 2.07 Renbp 432 A_66_P132888 2.07 Dhfr 433 A_55_P2104567 2.06 Casc1 434 A_51_P194377 2.06 Pcbp4 435 A_55_P2098354 2.06 Shf 436 A_55_P2156895 2.06 Tmem39b 437 A_55_P2071858 2.05 Mgmt 438 A_55_P2020461 2.04 Hmgn2 439 A_55_P2312124 2.04 A530028O18 440 A_55_P2060349 2.03 Lzts2 441 A_51_P243914 2.03 Skap2 442 A_55_P1967153 2.03 Ston1 443 A_55_P1992421 2.02 Hmgb3 444 A_55_P2317665 2.02 E2f1 445 A_55_P2148912 2.02 S100a16 446 A_52_P37498 2.02 Dpcd 447 A_55_P2103596 2.02 Slc30a4 448 A_66_P101423 2.01 1110031I02Rik 449 A_55_P2125013 2.01 Hist1h4j 450 A_55_P1967105 2.01 Bai2

Supplementary Information, Boucheron et al., 12 Supplementary Table 1 (continued) Down-regulated gene 1 A_55_P1966749-2.01 Cyp2s1 2 A_51_P400659-2.01 Bcap29 3 A_55_P2091191-2.01 Slc28a2 4 A_51_P261999-2.01 2410075B13Rik 5 A_52_P554536-2.01 Tnfrsf26 6 A_52_P491244-2.02 Zfp287 7 A_55_P2070546-2.02 1700037C18Rik 8 A_52_P599549-2.03 Rragb 9 A_55_P2015410-2.03 0610010K14Rik 10 A_51_P310254-2.03 Fam118a 11 A_52_P81630-2.03 2810001G20Rik 12 A_51_P253263-2.03 Zfp831 13 A_66_P100105-2.03 Inadl 14 A_55_P2198364-2.04 Tsen54 15 A_51_P502152-2.04 Slc19a1 16 A_51_P205968-2.04 Snx15 17 A_51_P299805-2.05 Slc46a3 18 A_52_P656714-2.06 Map3k5 19 A_52_P265811-2.07 Ccdc9 20 A_52_P18854-2.08 5430411C19Rik 21 A_66_P106861-2.09 B3galtl 22 A_55_P2065953-2.09 Btbd19 23 A_51_P143805-2.09 Tmem42 24 A_55_P1961993-2.10 Cryl1 25 A_51_P347961-2.10 Npc2 26 A_51_P459350-2.10 Dstn 27 A_51_P263377-2.12 Thnsl1 28 A_51_P158552-2.12 Zscan12 29 A_51_P198137-2.12 Ubxn8 30 A_51_P286946-2.13 Lhpp 31 A_51_P490678-2.13 Trim68 32 A_51_P140901-2.13 Pmm2 33 A_55_P2094574-2.14 Rapgef6 34 A_51_P215559-2.15 BC021614 35 A_51_P450169-2.15 Dnajb13 36 A_55_P2036250-2.15 Cr1l 37 A_55_P2024888-2.16 Ctss 38 A_55_P2107357-2.17 LOC100042049 39 A_51_P395555-2.18 Vkorc1 40 A_55_P2159026-2.18 Rpl22l1 41 A_55_P2110136-2.19 Arhgap29 42 A_51_P349727-2.20 Slc25a45 43 A_52_P527874-2.20 Rrp12 44 A_51_P121390-2.20 Anapc11 45 A_55_P2079890-2.21 LOC100044438 46 A_55_P2068892-2.21 Il6ra 47 A_55_P2024155-2.22 Zbtb16 48 A_55_P2008870-2.23 Gm4910 49 A_51_P279232-2.24 Dennd2d 50 A_51_P309501-2.25 Praf2 51 A_51_P247637-2.26 Rnf144a 52 A_55_P2151591-2.26 Pde3b 53 A_51_P187750-2.27 Neurl3 54 A_52_P619192-2.27 Rundc3b 55 A_55_P2062133-2.28 Etv3 56 A_52_P508999-2.29 Evi2b 57 A_55_P2104572-2.29 6330416G13Rik 58 A_55_P2006479-2.30 3300002I08Rik 59 A_52_P188042-2.31 Trat1 60 A_66_P107129-2.31 3300005D01Rik 61 A_51_P433615-2.32 Klhl6 62 A_52_P167382-2.32 Tmem8 63 A_65_P09523-2.33 Scrn3 64 A_51_P167105-2.33 B3galt4 65 A_51_P117640-2.33 5830468F06Rik 66 A_51_P249118-2.33 Abcb4 67 A_55_P2114908-2.35 Nek3 68 A_51_P383530-2.35 Mpzl3 69 A_55_P2068877-2.35 Ibtk 70 A_51_P350214-2.38 Amz2 71 A_51_P142153-2.39 Filip1l 72 A_55_P1984886-2.39 Hcst 73 A_55_P1957815-2.40 Tmub1 74 A_55_P1970775-2.42 Hdac1 75 A_51_P234253-2.42 Sdcbp2 76 A_55_P2064351-2.43 Vipr1 77 A_55_P2067719-2.44 Pcdhgb1 78 A_51_P214470-2.46 2610019F03Rik 79 A_55_P2015541-2.46 Hif3a 80 A_51_P127297-2.51 Hsd11b1 81 A_51_P307944-2.51 S1pr4 82 A_55_P1966977-2.52 Sntb1 83 A_55_P1959828-2.52 Tmem20 84 A_55_P2064686-2.53 Lrrc61 85 A_51_P267494-2.54 Cdc42ep3 86 A_51_P320105-2.55 Smyd2 87 A_51_P506674-2.55 Rpp38 88 A_52_P648688-2.55 Zc3h12d

Supplementary Information, Boucheron et al., 13 89 A_51_P122582-2.56 Daglb 90 A_55_P2009988-2.57 Trib3 91 A_51_P270364-2.58 Mmaa 92 A_51_P203955-2.60 Gbp2 93 A_51_P161086-2.60 Ppic 94 A_51_P510891-2.60 Afp 95 A_51_P202801-2.61 Abcb9 96 A_52_P162298-2.61 Ydjc 97 A_55_P2066301-2.62 Gpr137b-ps 98 A_55_P2050828-2.62 Olfr469 99 A_66_P125392-2.67 Atp8b4 100 A_52_P708792-2.68 Gm5547 101 A_55_P2081116-2.69 Fam89a 102 A_52_P132165-2.79 Hsd17b11 103 A_51_P396297-2.87 Hsdl1 104 A_55_P2060922-2.89 Unc5a 105 A_55_P2139221-2.91 4930594M22Rik 106 A_52_P193194-2.93 Slc35d2 107 A_51_P386503-2.96 Abhd15 108 A_51_P155152-2.96 Ank 109 A_55_P2108248-2.98 Art4 110 A_51_P291749-3.00 Pecr 111 A_51_P393305-3.02 Sidt1 112 A_55_P1962966-3.03 Nckap1 113 A_55_P1960828-3.04 Slc16a13 114 A_51_P471791-3.09 St8sia6 115 A_55_P2182433-3.09 Atg10 116 A_66_P118329-3.11 Ntrk3 117 A_52_P613643-3.11 Zfp3 118 A_51_P419246-3.21 5830416P10Rik 119 A_51_P324572-3.28 Ctnna1 120 A_51_P122035-3.28 Nipa1 121 A_52_P375312-3.31 Amica1 122 A_55_P2019113-3.34 Apol7b 123 A_51_P171200-3.40 Golm1 124 A_55_P1989738-3.44 4930426L09Rik 125 A_55_P2013928-3.44 Dhrs13 126 A_55_P1996504-3.48 Abcg2 127 A_51_P272876-3.49 Fam46a 128 A_51_P274124-3.51 Mansc1 129 A_55_P2101585-3.52 Cd55 130 A_55_P2119962-3.55 1110034G24Rik 131 A_55_P1973347-3.59 A130040M12Rik 132 A_55_P2402781-3.69 B230216N24Rik 133 A_52_P173442-3.75 Wscd2 134 A_55_P2066299-3.75 Gpr137b 135 A_52_P216613-3.76 Gpr18 136 A_51_P245368-3.77 Abcb1b 137 A_55_P1952920-4.10 AI854703 138 A_66_P106385-4.12 Daf2 139 A_55_P1990623-4.38 Grm6 140 A_51_P179907-4.70 Appl2 141 A_51_P263290-4.77 Galnt9 142 A_66_P119376-4.84 Kctd12 143 A_51_P215077-5.03 Mgst3 144 A_51_P412225-5.07 Tbc1d16 145 A_51_P501757-5.19 Rgmb 146 A_55_P2023637-5.29 Prg4 147 A_55_P2303473-5.43 2410133F24Rik 148 A_51_P114634-5.47 Amz1 149 A_55_P2016114-5.74 Fasl 150 A_51_P164203-6.14 Nme4 151 A_55_P2012201-6.27 App 152 A_51_P364657-6.70 Rnf32 153 A_55_P2031949-6.82 Bend6 154 A_52_P629895-7.92 Adh1 155 A_55_P2165191-7.93 Gm7420 156 A_55_P1994290-8.52 Gm10791 157 A_55_P2056533-9.75 Ntrk3 158 A_52_P900300-9.79 Gm6213 159 A_55_P2156304-9.92 Kcnj16 160 A_52_P316933-11.28 Sh3bgrl2 161 A_51_P477682-12.51 Prss12 162 A_55_P1962621-15.32 Chi3l7 Supplementary Table 1 lists all genes that are differentially expressed (>2 Fold change, P<0.05) between HDAC1-2 cko (cko) T cells and WT T cells. Positive and negative values indicate up- and down-regulation, respectively, in the absence of HDAC1/2. Gene expression profiles were determined using Agilent arrays and GeneSpring software. Only those probes with assigned gene names are listed (long intergenic non-coding (linc) RNAs are excluded from the list).

Supplementary Information, Boucheron et al., 14 Supplementary Table 2 Up-regulated proteins 1 Q8BH97 9.10 Rcn3 2 P28293 5.87 Ctsg 3 P70269 3.55 Ctse 4 Q9DBX3-1 2.97 Susd2 5 P02088 2.64 Hbb-b1 6 P01872-1, P01873-1 2.57 Igh-6 7 Q9Z126 2.49 Pf4 8 Q91WU5 2.47 As3mt 9 Q9WUU7 2.35 Ctsz 10 P28798 2.34 Grn 11 Q61096 2.28 Prtn3 12 Q8K023-[1,2] 2.24 Akr1c18 13 Q9D0J8 2.23 Ptms 14 P01592 2.21 Igj 15 P01942 2.20 Hba 16 P16110 2.12 Lgals3 17 P01837 2.03 18 P49935 2.02 Ctsh 19 Q8VCM7 2.00 Fgg 20 Q9DBF1-[1,2] 1.98 Aldh7a1 21 Q8K0E8 1.96 Fgb 22 P31996-[1,2] 1.91 Cd68 23 Q9D394-[1,2,3,4] 1.91 Rufy3 24 Q9BDB7-[1,2] 1.90 IFI44L 25 Q8K558-[1,2] 1.89 Treml1 26 P28667 1.88 Marcksl1 27 Q64339 1.83 Isg15 28 P23780 1.82 Glb1 29 Q64442 1.82 Sord 30 Q99L02 1.82 PAGR1 31 P14234 1.80 Fgr 32 Q8BG07-[1,2] 1.80 Pld4 33 P0CW03 1.79 Ly6c2 34 Q05117 1.77 Acp5 35 O35744 1.77 Chi3l3 36 P54116 1.76 Stom 37 P17710-[1,2,4] 1.76 Hk1 38 P17047-[1,2,3] 1.75 Lamp2 39 P21981 1.75 Tgm2 40 P47738 1.74 Aldh2 41 P10605 1.74 Ctsb 42 O35682 1.71 Myadm 43 Q9DAW9 1.71 Cnn3 44 P33174 1.70 Kif4 45 P14434, P14438 1.70 H2-Aa 46 P97360 1.69 Etv6 47 Q61646 1.69 Hp 48 Q9D8I1 1.68 Pacap 49 Q61207 1.68 Psap 50 P41245 1.68 Mmp9 51 Q62433 1.67 Ndrg1 52 P07091 1.66 S100a4 53 P50543 1.65 S100a11 54 Q62465 1.65 Vat1 55 Q3TRM8 1.63 Hk3 56 Q8VCI0 1.62 Plbd1 57 Q04447 1.62 Ckb 58 Q07133 1.62 Hist1h1t 59 Q91W40 1.61 Klc3 60 Q9WUL7 1.61 Arl3 61 P24638 1.61 Acp2 62 Q91XV3 1.60 Basp1 63 Q9QUM0 1.60 Itga2b 64 P45878 1.59 Fkbp2 65 Q61205 1.59 Pafah1b3 66 P13020-2 1.59 Gsn 67 Q8K4X7 1.58 Agpat4 68 Q8R2U6 1.58 Nudt4 69 O88531 1.58 Ppt1 70 Q8BTV1 1.57 Tusc3 71 Q8BV66 1.57 Ifi44 72 P35441 1.57 Thbs1 73 P18242 1.57 Ctsd 74 O88508-1 1.56 Dnmt3a 75 Q8VC28 1.56 Akr1c13 76 Q60611 1.56 Satb1 77 P28650-[1,2] 1.56 Adssl1 78 P48678-1 1.55 Lmna 79 O35143 1.55 Atpif1 80 Q9WVK4 1.55 Ehd1 81 Q8R127 1.54 Sccpdh 82 Q9ET01 1.54 Pygl 83 Q60992 1.53 Vav2 84 Q99LD8 1.53 Ddah2 85 Q8VEB4 1.53 Pla2g15 86 P10649 1.53 Gstm1 87 Q99PL5-1 1.53 Rrbp1 88 Q9JJV2-[1,2,3] 1.52 Pfn2

Supplementary Information, Boucheron et al., 15 89 Q9CQF9 1.51 Pcyox1 90 O35405 1.51 Pld3 91 P46935 1.51 Nedd4 92 Q9WV54 1.50 Asah1 93 Q9Z0H8-[1,2] 1.49 Clip2 94 P16675 1.49 Ctsa 95 Q9QYG0-[1,2] 1.48 Ndrg2 96 Q6DID7-[1,2] 1.48 Wls 97 Q6ZQ73 1.48 Cand2 98 Q920A5 1.47 Scpep1 99 P00920 1.47 Ca2 100 Q4FZC9-1 1.47 Syne3 101 Q921J4 1.46 Ube2s 102 Q8R059 1.46 Gale 103 P70677 1.46 Casp3 104 P54227 1.46 Stmn1 105 P97377-[1,2] 1.46 Cdk2 106 O35737 1.45 Hnrnph1 107 Q9CQM5 1.45 Txndc17 108 Q7TMR0-1 1.45 Prcp 109 Q64727 1.44 Vcl 110 P08113 1.44 Hsp90b1 111 O54890 1.44 Itgb3 112 Q9JJC6 1.44 Rilpl1 113 Q91W90 1.44 Txndc5 114 Q60848-[1,2] 1.44 Hells 115 O09046-1 1.43 Il4i1 116 Q3TB82 1.43 Plekhf1 117 Q9ER38 1.43 Tor3a 118 Q8BGA7 1.43 119 Q60928 1.43 Ggt1 120 Q05186 1.43 Rcn1 121 Q9D7V9 1.42 Naaa 122 Q64282 1.42 Ifit1 123 Q8BY71 1.41 Hat1 124 Q3U5Q7 1.41 Cmpk2 125 P70699 1.41 Gaa 126 O70480 1.41 Vamp4 127 Q8R2P1 1.41 Klhl25 128 P50427 1.40 Sts 129 Q7TMM9 1.40 Tubb2a 130 Q6DFV5-[1,2,3] 1.40 Helz 131 P13597-[1,2] 1.39 Icam1 132 Q9ER80 1.39 Rtp4 133 P11440 1.39 Cdk1 134 Q4QQM4 1.39 Trp53i11 135 Q8VDF2-1 1.39 Uhrf1 136 Q9CYL5 1.38 Glipr2 137 P56528 1.38 Cd38 138 Q9WVJ3-[1,2] 1.38 Cpq 139 Q01320 1.38 Top2a 140 Q9CPY1 1.37 Mrpl51 141 Q8C1B7-[1,2,3] 1.37 Sept11 142 Q8CAB8 1.37 Gatsl2 143 Q62178 1.37 Sema4a 144 O35448 1.36 Ppt2 145 Q91WC0-1 1.36 Setd3 146 Q2HXL6 1.36 Edem3 147 Q9ET22 1.36 Dpp7 148 P07607 1.36 Tyms 149 Q3UND0-[1,2] 1.36 Skap2 150 P70697 1.35 Urod 151 Q9R1Q7 1.35 Plp2 152 O08997 1.35 Atox1 153 Q9DC16 1.35 Ergic1 154 P70704 1.35 Atp8a1 155 Q9DBY5 1.35 Cbx6 156 Q91V12-1 1.35 Acot7 157 Q99KC8 1.35 Vwa5a 158 Q9WVQ5 1.35 Apip 159 P97822-[1,2] 1.34 Anp32e 160 Q8R3L2-[1,2,3,4,5] 1.34 Tcf25 161 O09159 1.34 Man2b1 162 P03958 1.34 Ada 163 P27546-1 1.34 Map4 164 Q9QZ85 1.34 Iigp1 165 P99024 1.34 Tubb5 166 Q62523 1,34 Zyx 167 E9Q355-[1.2,3] 1.33 Catsperg1 168 P09103 1.33 P4hb 169 Q9WVS8-[1,4,5] 1.33 Mapk7 170 Q07797 1.33 Lgals3bp 171 O54782 1.33 Man2b2 172 P28271 1.33 Aco1 173 Q07417 1.33 Acads 174 P0C7N9 1.33 Psmg4 175 P49138 1.33 Mapkapk2 176 Q8K3C0 1.33 Rnasek 177 P47857 1.33 Pfkm 178 P51863 1.33 Atp6v0d1 179 Q9D3G5 1.33 Stx11 180 Q8BP27-[1,2] 1.33 Sfr1

Supplementary Information, Boucheron et al., 16 181 Q922R8 1.33 Pdia6 182 Q8C0L6-1 1.33 Paox 183 P47811-1 1.32 Mapk14 184 O88693 1.32 Ugcg 185 P25446 1.32 Fas 186 Q60854 1.32 Serpinb6 187 P08003 1.32 Pdia4 188 O08900 1.32 Ikzf3 189 Q9Z0M5 1.32 Lipa 190 Q9QXT0 1.32 Cnpy2 191 Q8BIW1 1.32 Prune 192 P51660 1.31 Hsd17b4 193 O35604 1.31 Npc1 194 P12265 1.31 Gusb 195 Q9JKR6 1.31 Hyou1 196 Q9JJZ4 1.31 Ube2j1 197 Q62084 1.31 Ppp1r14b 198 Q8K2Q7-1 1.31 Brox 199 Q9CQU5 1.31 Zwint 200 A2AJI0-[1,2] 1.31 Map7d1 201 P51174 1.31 Acadl 202 Q64261 1.31 Cdk6 203 Q6ZQK0 1.31 Ncapd3 204 O08795-[1,2] 1.30 Prkcsh 205 Q6PAL7 1.30 Ahdc1 206 Q99L13 1.30 Hibadh Supplementary Table 2 (continued) Down-regulated proteins 1 Q9CY66-[1,2,3] -1.30 Gar1 2 Q8BGX2-1.31 3 Q9D1H6-1.31 Ndufaf4 4 Q3TC33-1 -1.31 Ccdc127 5 Q6AXF6-1 -1.31 Sidt1 6 P70429-1 -1.31 Evl 7 Q5M8N4-2 -1.31 Sdr39u1 8 Q9CQS2-1.32 Nop10 9 Q9DCT6-[1,2] -1.32 Bap18 10 Q8BMS9-1.33 Rassf2 11 Q9ESX5-1.33 Dkc1 12 Q9CRB2-1.33 Nhp2 13 Q9Z2I8-1 -1.33 Suclg2 14 P28352-1.33 Apex1 15 Q9Z0E6-1.34 Gbp2 16 Q8VE95-1.34 17 Q8BR65-1.34 Suds3 18 Q8BFP9-1.34 Pdk1 19 Q8BTX9-1.35 Hsdl1 20 P62075-1.36 Timm13 21 Q9CZL5-1.36 Pcbd2 22 Q9Z2L7-1 -1.37 Crlf3 23 Q9D757-1.38 Dapl1 24 P42125-1.38 Eci1 25 P31041-1.38 Cd28 26 Q9D110-1.39 Mthfs 27 O09106-1.39 Hdac1 28 Q91VV4-[1,2] -1.39 Dennd2 29 Q61823-1.40 Pdcd4 30 Q923B0-1 -1.40 Ggact 31 P16372-1.41 Zfp58 32 Q99KE1-1.41 Me2 33 Q91WE1-1.41 Snx15 34 Q9QYR9-1.42 Acot2 35 Q9EQ06-1 -1.43 Hsd17b11 36 Q8K370-1.44 Acad10 37 Q924K8-1 -1.48 Mta3 38 Q5DU31-[1,2] -1.48 Ipcef1 39 Q9Z2D8-[1,2] -1.49 Mbd3 40 Q8K2T4-1.50 41 P68181-4 -1.53 Prkacb 42 P70288-1.58 Hdac2 43 Q9WV84-1.58 Nme4 44 Q9D7S7-[1,2] -1.60 Rpl22l1 45 P19182-1.64 Ifrd1 46 Q8C5P7-1 -1.68 47 Q8R4N0-1.71 Clybl 48 P00329-3.51 Adh1 49 P15092-[1,2] -3.97 Ifi204 Supplementary Table 2 lists the proteins that are differentially expression (>1.3 Fold change, FC; P<0.05) between HDAC1-1 cko (cko) T cells and WT T cells.

Supplementary Information, Boucheron et al., 17 Supplementary Table 3 List of up-regulated proteins with normal RNA expression 1 P28293 5.87 Ctsg 2 P70269 3.55 Ctse 3 Q9DBX3-1 2.97 Susd2 4 Q9Z126 2.49 Pf4 5 Q9WUU7 2.35 Ctsz 6 P28798 2.34 Grn 7 Q61096 2.28 Prtn3 8 Q8K023-1,Q8K023-2 2.24 Akr1c18 9 Q9D0J8 2.23 Fut4 10 P01592 2.21 Igj 11 P01837 2.03 12 P49935 2.02 Ctsh 13 Q8VCM7 2.00 Gng8 14 Q8K0E8 1.96 Fgb 15 P31996-1,P31996-2 1.91 Cd68 16 Q8K558-1,Q8K558-2 1.89 Treml1 17 Q64339 1.83 Isg15 18 P23780 1.82 Glb1 19 Q64442 1.82 Dmd 20 Q99L02 1.82 2900092E17 Rik 21 P14234 1.80 Fgr 22 Q8BG07-1,Q8BG07-2 1.80 Pld4 23 P0CW03 1.79 Ly6c1 24 Q05117 1.77 Acp5 25 O35744 1.77 Chi3l3 26 P54116 1.76 Stom 27 P17710-1,P17710-2,P17710-4 1.76 Hk1 28 P17047-1,P17047-2,P17047-3 1.75 Lamp2 29 P21981 1.75 Tgm2 30 P47738 1.74 Aldh2 31 P10605 1.74 Ctsb 32 O35682 1.71 Myadm 33 P14434,P14438 1.70 H2-Aa 34 P97360 1.69 Chrnd 35 Q61646 1.69 Hp 36 Q9D8I1 1.68 2010001M0 9Rik 37 Q61207 1.68 Psap 38 P41245 1.68 Mmp9 39 P07091 1.66 S100a4 40 Q3TRM8 1.63 Hk3 41 Q8VCI0 1.62 Plbd1 42 P24638 1.61 Acp2 43 Q91XV3 1.60 Basp1 44 Q9QUM0 1.60 Itga2b 45 P45878 1.59 Fkbp2 46 Q8R2U6 1.58 Nudt4 47 O88531 1.58 Entpd6 48 Q8BTV1 1.57 Tusc3 49 Q8BV66 1.57 Ifi44 50 P18242 1.57 Ctsd 51 O88508-1 1.56 Dnmt3a 52 Q8VC28 1.56 Akr1c13 53 Q60611 1.56 Satb1 54 Q8R127 1.54 Sccpdh 55 Q60992 1.53 Vav2 56 Q8VEB4 1.53 Pla2g15 57 P10649 1.53 Cmah 58 Q99PL5-1 1.53 Rrbp1 59 O35405 1.51 Pld3 60 Q9WV54 1.50 Asah1 61 P16675 1.49 Ctsa 62 Q9QYG0-1,Q9QYG0-2 1.48 Ndrg2 63 Q920A5 1.47 Scpep1 64 P00920 1.47 Car2 65 Q4FZC9-1 1.47 4831426I19 Rik 66 Q921J4 1.46 Ube2s 67 P70677 1.46 Casp3 68 P54227 1.46 Stmn1 69 P97377-1,P97377-2 1.46 Cdk2 70 O35737 1.45 Hnrnph1 71 Q9CQM5 1.45 Txndc17 72 Q7TMR0-1 1.45 Prcp 73 Q64727 1.44 Vcl 74 P08113 1.44 Hsp90b1 75 O54890 1.44 Itgb3 76 Q91W90 1.44 Txndc5 77 Q60848-1,Q60848-2 1.44 Hells 78 O09046-1 1.43 Il4i1 79 Q3TB82 1.43 Plekhf1 80 Q9ER38 1.43 Tor3a E130309D0 81 Q8BGA7 1.43 2Rik

Supplementary Information, Boucheron et al., 18 82 Q05186 1.43 Rcn1 83 Q9D7V9 1.42 Naaa 84 Q64282 1.42 Ifit1 85 Q8BY71 1.41 Hat1 86 Q3U5Q7 1.41 Cmpk2 87 P70699 1.41 Gaa 88 O70480 1.41 Vamp4 89 Q8R2P1 1.41 Klhl25 90 Q6DFV5-1.Q6DFV5-2.Q6DFV5-3 1.40 Helz 91 P13597-1.P13597-2 1.39 Icam1 92 Q9ER80 1.39 Rtp4 93 Q9CYL5 1.38 Glipr2 94 P56528 1.38 Cd38 95 Q9WVJ3-1.Q9WVJ3-2 1.38 Pgcp 96 Q01320 1.38 Top2a 97 Q9CPY1 1.37 Mrpl51 98 Q8C1B7-1.Q8C1B7-2,Q8C1B7-3 1.37 Sep-11 99 Q62178 1.37 Sema4a 100 O35448 1.36 Ppt2 101 Q91WC0-1 1.36 Setd3 102 Q2HXL6 1.36 Edem3 103 Q9ET22 1.36 Dpp7 104 P07607 1.36 Tyms 105 P70697 1.35 Urod 106 Q9R1Q7 1.35 Plp2 107 O08997 1.35 Atox1 108 Q9DC16 1.35 Ergic1 109 P70704 1.35 Atp8a1 110 Q9DBY5 1.35 Cbx6 111 Q99KC8 1.35 Vwa5a 112 Q9WVQ5 1.35 Apip 113 P97822-1,P97822-2 1.34 Anp32e 114 Q8R3L2-1,Q8R3L2-2,Q8R3L2-3,Q8R3L2-4,Q8R3L2-5 1.34 Tcf25 115 O09159 1.34 Man2b1 116 P03958 1.34 Ada 117 P27546-1 1.34 Mtap4 118 Q9QZ85 1.34 Cyp2f2 119 P99024 1.34 Tubb5 120 Q62523 1.34 Zyx 121 P09103 1.33 Dld 122 Q9WVS8-1,Q9WVS8-4,Q9WVS8-5 1.33 Mapk7 123 Q07797 1.33 Lgals3bp 123 Q07797 1.33 Lgals3bp 124 O54782 1.33 Man2b2 125 P28271 1.33 Hcn1 126 Q07417 1.33 Acads 127 P0C7N9 1.33 Psmg4 128 Q8K3C0 1.33 Rnasek 129 P49138 1.33 Mapkapk2 130 P47857 1.33 Pfkm 131 P51863 1.33 Atp6v0d1 Q8BP27-1,Q8BP27-6330577E15 132 2 1.33 Rik 133 Q8C0L6-1 1.33 Paox 134 P47811-1 1.32 Mapk14 135 O88693 1.32 Ugcg 136 P25446 1.32 Fas 137 Q60854 1.32 Serpinb6a 138 P08003 1.32 Pdia4 139 O08900 1.32 Ikzf3 140 Q9Z0M5 1.32 Lipa 141 Q9QXT0 1.32 Cnpy2 142 Q8BIW1 1.32 Gli3 143 P51660 1.31 Hsd17b4 144 O35604 1.31 Npc1 145 P12265 1.31 Gusb 146 Q9JKR6 1.31 Apoc3 147 Q9JJZ4 1.31 Ube2j1 148 Q62084 1.31 Ppp1r14b 149 Q9CQU5 1.31 Zwint 150 A2AJI0-1,A2AJI0-2 1.31 Mtap7d1 151 Q64261 1.31 Cdk6 152 O08795-1,O08795-2 1.30 Prkcsh 153 Q99L13 1.30 Hibadh

19 Supplementary Table 3 (continued) List of down-regulated proteins with normal mrna expression Q9CY66-1,Q9CY66-154 2,Q9CY66-3 -1.30 Gar1 1810026J23 155 Q8BGX2-1.31 Rik 156 Q9D1H6-1.31 Ndufaf4 157 Q3TC33-1 -1.31 Ccdc127 158 P70429-1 -1.31 Evl 159 Q5M8N4-2 -1.31 Sdr39u1 160 Q9CQS2-1.32 Nop10 161 Q8BMS9-1.33 Rassf2 162 Q9ESX5-1.33 Dkc1 163 Q9CRB2-1.33 Nhp2 164 Q9Z2I8-1 -1.33 Suclg2 165 P28352-1.33 Apex1 166 Q8VE95-1.34 C030006K1 1Rik 167 Q8BR65-1.34 Suds3 168 Q8BFP9-1.34 Pdk1 169 P62075-1.36 Timm13 170 Q9CZL5-1.36 Pcbd2 171 Q9Z2L7-1 -1.37 Hars 172 Q9D757-1.38 Dapl1 173 P42125-1.38 Eci1 174 P31041-1.38 Cd28 175 Q9D110-1.39 Gm2382 176 Q61823-1.40 Apoc2 177 Q923B0-1 -1.40 A2ld1 178 P16372-1.41 Zfp58 179 Q99KE1-1.41 Me2 180 Q9QYR9-1.42 Acot2 181 Q8K370-1.44 Acad10 182 Q924K8-1 -1.48 Mta3 183 Q5DU31-1.Q5DU31-2 -1.48 Ipcef1 184 Q9Z2D8-1.Q9Z2D8-2 -1.49 Mbd3 185 Q8K2T4-1.50 AI462493 186 P68181-4 -1.53 Prkacb 187 P70288-1.58 Hdac2 188 P19182-1.64 Ifrd1 189 Q8R4N0-1.71 Clybl Supplementary Table 3 lists the genes that are differentially expressed at the protein level (>1.3 Fold change, FC; P<0.05) but not at the mrna level (defined as >2 Fold change, P<0.05) between HDAC1-2 cko (cko) T cells and WT T cells.

20 Supplementary Table 4 List of antibodies used in this study Antigen/Name Clone Fluorochrome Vendor CD4 RM4-5 PE, PE-Cy7 ebioscience CD8α 53-6.7 APC ebioscience CD25 PC61 5.3 7 PE ebioscience CD45.2 104 FITC ebioscience CD69 H1.2F3 FITC ebioscience Eomesodermin Dan11mag APC ebioscience FoxP3 FJK-16s APC ebioscience TNFα MP6-XT22 FITC ebioscience TCRβ H57-597 APC-e780 ebioscience TCR Vα2 B20.1 PE ebioscience CD24 M1.69 PE-Cy5 Biolegend CD5 53-7.3 APC BD Bioscience CD8α 53-6.7 Biotin BD Bioscience CD8β H35-17.2 FITC BD Bioscience CD11b M1/70 Biotin BD Bioscience CD11c HL3 Biotin BD Bioscience CD16/CD32 2.4G2 - BD Bioscience CD44 IM7 V500 BD Bioscience CD45R/B220 RA3-6B2 Biotin, FITC BD Bioscience CD62L MEL-14 PE, APC BD Bioscience CD154 MR1 PE BD Bioscience GATA3 L50-823 PE BD Bioscience Gr-1 RB6-8C5 PE BD Bioscience Granzyme B GB11 V450, PE, APC BD Bioscience IFNγ XMG1.2 FITC, V450 BD Bioscience Mouse IgG1 A85-1 - BD Bioscience NK1.1 PK136 Biotin BD Bioscience T-bet 4B10 V450, APC BD Bioscience TCRβ H57-597 V450 BD Bioscience Ter119 TER-119 Biotin BD Bioscience HDAC1 ABE260 - Millipore HDAC2 3F3 - Millipore Anti-rabbit IgG1 (H+L) - FITC Invitrogen

Supplementary Information, Boucheron et al., 21 Supplementary Table 5 List of primers used in this study Locus Forward sequence (5 3 ) Reverse sequence (5 3 ) Method Ref # Cd4 TTCCTGGCTTGCGTGCTGGG TTCTGCATCCGGTGGGGGCA qrtpcr Cd8a AGCCAGTGCTGCGAACTCCCT TCGGCTCCTGTGGTAGCAGATGA qrtpcr Cd8b1 GGGACGAAGCTGACTGTGGTTGA GGGTGGGGGAACGGGCATTG qrtpcr Eomes GCCTACCAAAACACGGATA TCTGTTGGGGTGAGAGGAG qrtpcr 1 GzmB CCACTCTCGACCCTACATGG GGCCCCCAAAGTGACATTTATT qrtpcr 2 Hprt GATACAGGCCAGACTTTGTTG GGTAGGCTGGCCTATAGGCT qrtpcr 3 Prf1 TTTCGCCTGGTACAAAAACC CGTTCAGGCAGTCTCCTACC qrtpcr 1 Runx3 GTCAGCGTGCGACATGGCTTCCAACAG AGCACGTCCATCGAGCGCACTTCGG qrtpcr 4 Tbx21 CAACAACCCCTTTGCCAAAG TCCCCCAAGCAGTTGACAGT qrtpcr 5 Zbtb7b ACCCCGACCTGATGGCTTAC GCGTTCTCCTGTGTGCTTCC qrtpcr 6 Cd8a promoter CCACTTGCTCTGCAAGGGTGCA GTGGGGGAGGCGTGTAGGGT ChIP Cd8b1 promoter TCTTCATGGGTTCTTGATGGGGCTT AAAGTGAGGCAAAGCCAAACCTGG ChIP E8 I #26 GGGGTGCCTCAACCTGCTTTGT TGTGGCGGGCTTCATGGCATAG ChIP E8 I #33 ATGGCAAAGTCTGCCGGCTTCC TGGCCTGCTCCCAGGTTCCTTTT ChIP Runx3 promoter Eomes promoter Ifng promoter Gzmb promoter TCCTGTAGCCCCACTTTC TCGTCTATTCTGCCCTCG ChIP TATTAATTGGATCGGGTCGCCTGC ACCATGTTCGCAGACTTCAAACCC ChIP 7 ACTCTAACATGCCACAAAACCATAG CTTCCAGTTTTATACCTGATCGAAG ChIP 8 TGATGACGTCTTCTGAGTACTTGTG ACTCTGATACCATAGGCTACAAACC ChIP 8 Prf1 TSS CAGGGCAGGAAGTAGTAATGATATG CTTCCTCCTCCTTACCTGAAGTC ChIP 8 Tcrb enhancer AGAATGGCCACCTGCCATAG GATGTGGCAAGTGTGGTTCCCAAA ChIP 9 Hdac1 GATGTGGCAAGTGTGGTTCCCAAA CCTGTGTCATTAGAATCTACTT Genotyping Hdac2 CCCTTTAGGTGTGAGTACAT AACCTGGAGAGGACAGCAAA Genotyping Hdac1 deletion Hdac2 deletion GGTAGTTCACAGCATAGTACTT GTTACGTCAATGACATCGTCTT Genotyping CCACAGGGAAAAGGAAACAA AACCTGGAGAGGACAGCAAA Genotyping Primer pair E8 I #26: maps in close proximity to region g of Sato et al 10. Primer pair E8 I #33: overlaps with region i of Sato et al. 4 and region h from Hassan et al 11. References for primers 1. Tayade, C. et al. Differential transcription of Eomes and T-bet during maturation of mouse uterine natural killer cells. J Leukoc Biol 78, 1347-1355 (2005). 2. Zhu, Y. et al. T-bet and eomesodermin are required for T cell-mediated antitumor immune responses. J Immunol 185, 3174-3183 (2010).

Supplementary Information, Boucheron et al., 22 3. Bilic, I. et al. Negative regulation of CD8 expression via Cd8 enhancer-mediated recruitment of the zinc finger protein MAZR. Nat Immunol 7, 392-400 (2006). 4. Naoe, Y. et al. Repression of interleukin-4 in T helper type 1 cells by Runx/Cbf beta binding to the Il4 silencer. J Exp Med 204, 1749-1755 (2007). 5. Yang, Y., Ochando, J.C., Bromberg, J.S. & Ding, Y. Identification of a distant T-bet enhancer responsive to IL-12/Stat4 and IFNgamma/Stat1 signals. Blood 110, 2494-2500 (2007). 6. Sakaguchi, S. et al. The zinc-finger protein MAZR is part of the transcription factor network that controls the CD4 versus CD8 lineage fate of double-positive thymocytes. Nat Immunol 11, 442-448 (2010). 7. Qui, H.Z. et al. CD134 plus CD137 dual costimulation induces Eomesodermin in CD4 T cells to program cytotoxic Th1 differentiation. J Immunol 187, 3555-3564 (2011). 8. Cruz-Guilloty, F. et al. Runx3 and T-box proteins cooperate to establish the transcriptional program of effector CTLs. J Exp Med 206, 51-59 (2009). 9. Djuretic, I.M. et al. Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat Immunol 8, 145-153 (2007). 10. Sato, T. et al. Dual functions of Runx proteins for reactivating CD8 and silencing CD4 at the commitment process into CD8 thymocytes. Immunity 22, 317-328 (2005). 11. Hassan, H. et al. Cd8 enhancer E8I and Runx factors regulate CD8alpha expression in activated CD8+ T cells. Proc Natl Acad Sci U S A 108, 18330-18335 (2011).