ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1044 ~ 1050 AKT2 * 350025 AKT2 H 2 RT-PCR AKT2 cdna pcdna3 1 / myc-his - A AKT2 AKT2 DN-AKT2 MCF-7 AKT2 2 sirna TUNEL DNA ladder AKT2 AKT2 sirna WT-AKT2 DN-AKT2 Western WT-AKT2 DN-AKT2 MCF-7 AKT2 sirna AKT2 TUNEL DNA ladder WT-AKT2 MCF-7 DN-AKT2 P < 0 05 P > 0 05 AKT2 AKT2 sirna PI3K / AKT wortmannin WT-AKT2 QuikChange AKT2 DN-AKT2 WT- AKT2 AKT2 MCF- 7 Bβ RNA Q78 Overexpression of AKT2 Suppresses -induced Breast Cancer Cells Apoptosis LING Cai-Hong LAN Feng-Hua HAN Jun-Yong DONG Li-Hong HUANG Qiao-Jia * Research Center for Molecular Medicine Fuzhou General Hospital of Nanjing Command PLA Fuzhou 350025 China Abstract To study the effect of AKT2 gene on the apoptosis induced by in breast cancer cells the full length AKT2 cdna was amplified by RT-PCR and then inserted into pcdna3 1 / myc-his - A vector to construct pcdna3 1 / myc-his - A-AKT2 wild type WT-AKT2 Dominant negative mutant of AKT2 DN-AKT2 were generated by QuikChange site-directed mutagenesis and confirmed by sequencing The eukaryotic expression vector of WT-AKT2 or DN-AKT2 were transfected into MCF-7 breast cancer cells Clones stably expressing AKT2 or DN-AKT2 were obtained by neomycin selections Two sirnas targeted AKT2 were designed and synthesized then transfected into the same cell line 2011-08-29 2011-10-10 No 08MA100 No 2009J01181 * Tel 0591-22859102 E-mail huangqj100@ 126 com Accepted August 29 2011 Received October 10 2011 Supported by Medical Scientific Research Foundation of Nanjing Command No 08MA100 and Natural Science Foundation of Fujian Province No 2009J01181 * Corresponding author Tel 0591-22859102 E-mail huangqj100@ 126 com
11 AKT2 1045 Apoptosis with or without treatments was determined by TUNEL and DNA Ladder assays The expression of WT-AKT2 and DN-AKT2 as well as sirna inhibition in MCF-7 cells was demonstrated by Western blotting WT-AKT2 over-expression significantly increased the resistance of -induced apoptosis in MCF-7 cells but not DN-AKT2 The number of apoptotic cells following treatment was significantly lower in WT-AKT2 stably transfected cells than those in empty vector control or nontransfected cells P < 0 05 The inhibition of apoptosis was abolished in AKT2 sirna or PI3K / AKT2 inhibitor wortmannin treated cells Our study suggested that AKT2 inhibit -induced apoptosis in cancer cells and interference of AKT2 might be used as a therapeutic approach for breast cancers Key words protein kinase B beta Akt2 gene cloning RNA interference gene transfection cell apoptosis -3 PI3K / B protein kinase B PKB AKT AKT2 β-actin Western AKT2 β Cell 1 ~ 3 Signal Sigma PI3K / AKT SantaCruz TUNEL DNA Ladder AKT pcdna3 1 / myc-his - A Invitrogen AKT 3 AKT1 / PKBα AKT2 / PKBβ AKT3 / PKBγ AKT DMEM Invitrogen 4 ~ 6 AKT1 PCR DH5α AKT2 G418 Invitrogen 4 ~ 6 5 cm 7 cm AKT1 AKT2 X AKT2 1 2 RT-PCR Akt2 cdna Trizol NIH OVCAR- AKT2 3 RNA RNA M-MLV AKT2 sirna oligo T 25 μl AKT2 42 1 h 45 30 min 90 3 min AKT2 GenBank NM _001626 F 5'- CTAGCTAGCGATGAATGAGGT GTCTGTCATC -3' R 5'-GG 1 1 1 RIPA BCA PCR 94 4 min 94 45 s 50 45 s DNA DNA 68 100 s 25 68 7 min PCR OMEGA Nhe Ⅰ Kpn Ⅰ ECL Invitrogen NIH OVCAR-3 MCF-7 Mycco s 5A GGTACCCTCGCGGATGC TGGCCGA-3' NheⅠ KpnⅠ Platinum Taq DNA PCR 1 2% DpnⅠ T4-DNA New England Bio 1 3 AKT2 Lab M-MLV Platinum Taq WT- AKT2 DNA Kpn Ⅰ + NheⅠ RT-PCR Lipofectamine TM 2000 Lipofectamine LTX PVDF 7
1046 27 PA28β LB UAGUCGAAGUCATT-3' sirna + AMP DNA KpnⅠ + Nhe Ⅰ CGUTT-3' 5'-ACGUGACACGUUCGG F 5'-TAATACGACTCAC TATAGGG-3' T7 promoter R 5'-TAGAA GGCACAGTCGAGG-3' BGH 1 4 AKT2 100 nmol / L sirna DN-AKT2 AKT2 181 Lys PCR AKT2 Met DN- 1 7 Western AKT2 4 Stratagene Quikchange WT-AKT2 1 5'-CTA 1 1 000 1 6 000 4 CTACGCCATGATGATCCTGCGGAAGG-3' 5'- CCTTCCGCAGGATCATCATGGCGTAGTAG-3' 1 2 000 ECL AAG X ATG 8 1 8 MCF-7 Quikchange 1 5 WT-AKT2 DN-AKT2 MCF-7 24 h MCF-7 3 mmol / L 8 h 5 10 5 6 24 h TUNEL DNA Ladder 2 ml Lipofectamine TM 2000 Lipofectamine LTX TUNEL WT-AKT2 DN-AKT2 DNA 3 μg / DNA Ladder MCF-7 DNA Ladder AKT2 DN-AKT2 MCF-7 T 7 Western RT-PCR AKT2 4 ~ 5 AKT2 MCF-7 / β GAPDH 1 6 AKT2 sirna AKT2 sirna 2 Genescript sirna AKT2 sirna 2 1 Akt2 AKT2 90 ~ 108 450 ~ 468 GAGCGACGGCT 5' UUCUCCGAACGUGUCA AGAATT-3' Lipofectamine TM 2000 100 nmol / L AKT2 2 sirna MCF-7 AKT2 / MCF-7 RT- 9 Western 1 AKT2 β HRP IgG 2 MCF-7 0 1% DMEM 16 h TUNEL DNA Ladder SPSS13 0 T P < 0 05 AKT2 T 1 2% RT-PCR 1 450 bp CCTTCATT TGACTTCGACTATCTCAAA Fig 1A sirna 1 2% KpnⅠ + Nhe MCF-7 WT- 5'- GAGCGACGGCUCCUUCAUUTT- 3' 5' UGA Ⅰ AKT2 RT- CUUCGACUAUCUCAAATT-3' 5'- PCR AAUGAAGGAGCCGUCGCUCTT-3' 5'-UUUGAGA Fig 1B
11 AKT2 1047 AKT2 2 2 AKT2 L181 M181 DN- Quikchange WT- Lys AAG Met ATG AKT2 181 Lys 4 pcdna3 1-myc-HisA - 181 Fig 2 Fig 1 RT-PCR amplification of AKT2 cdna and recombinant plasmid identified by Kpn Ⅰ + NheⅠ AKT2 cdna was amplified by RT-PCR and then inserted into pcdna3 1-myc-HisA - vector by KpnⅠ and Nhe Ⅰ sites to construct pcdna3 1 / myc-his - A-AKT2 A M DL2000 DNA marker 1 AKT2 cdna was obtained by RT-PCR B M DL2000 DNA marker 1 Recombinant plasmid digested by KpnⅠ + NheⅠ 2 Empty plasmid digested by KpnⅠ + NheⅠ 3 AKT2 cdna obtained by RT-PCR Fig 2 Part inserted sequences of DN-AKT2 before and after QuikChange site-directed mutagenesis DN-AKT2 compared with WT-AKT2 DN-AKT2 was obtained by changing the lysine residue at position 181 of AKT2 to a methionine residue using QuikChange site-directed mutagenesis A WT-AKT2 B DN-AKT2 2 3 AKT2 sirna MCF-7 AKT2 AKT2 AKT2 DN-AKT2 PVDF P < WT-AKT2 DN-AKT2 MCF-7 1 M r 60 kd AKT2 Fig 3 pcdna3 1 / myc-his - A MCF-7 AKT2 WT-AKT2 DN-AKT2 0 05 AKT2 P > 0 05 AKT2 Western AKT2 sirna MCF-7 MCF-7 AKT2
1048 27 Fig 3 AKT2 expression in MCF-7 cells analyzed by Western blotting A Over-expressed AKT2 and DN- AKT2 protein in MCF-7 cells were achieved by transfected WT-AKT2 and DN-AKT2 expression vector with Lipofectamine whereas control group was transfected with empty vector 1 Transfected with WT-AKT2 expression vector 2 Transfected with DN-AKT2 expression vector 3 Transfected with empty vector 4 Untransfected cells B sirna Total of 100 nmol / L of sirna1 plus sirna2 against AKT2 gene were transfected into MCF-7 cells by Lipofectamine to silence AKT2 expression 1 Untransfected cells 2 Transfected with sirna negative control 3 Transfected with AKT2 sirna sirna AKT2 sirna AKT2 2 4 AKT2 sirna MCF-7 AKT2 mrna P < 0 05 t AKT2 / MCF-7 DN-AKT2 / MCF-7 AKT2 mrna AKT2 sirna wortmannin P > 0 05 MCF-7 AKT2 / MCF-7 AKT2 sirna AKT2 mrna sirna P < 0 05 Fig 4 2 5 AKT2 AKT2 DNA MCF-7 TUNEL MCF-7 3 / MCF- 7 3 mmol / L 8 h reactive oxygen AKT2 ROS ROS AKT2 / MCF-7 / MCF-7 ± SD 17% ± 2 83% 18 5% ± 3 53% Fig 5A AKT2 / MCF-7 6% ± 2 56% Fig 5A P c < 0 05 t 12 100 nmol / L PI3K / Akt wortmannin 3 h 13 AKT2 sirna wortmannin 3 h 44% ± 4 24% 40 5% ± 2 12% P < 0 05 AKT2 / MCF-7 100 nmol / L AKT2 sirna MCF-7 AKT2 / MCF- 7 Akt2 sirna RT-PCR WT-AKT2 DN-AKT2 33% ± 4 24% AKT2 / MCF-7 DN- P < 0 05 AKT2 / MCF-7 AKT2 mrna P > 0 05 AKT2 DN- empty / MCF-7 AKT2 / MCF-7 H 2 31% ± 2 83% / MCF-7 P < 0 05 DNA Ladder 3 h AKT2 / MCF-7 AKT2 sirna DN-AKT2 / MCF-7 H 2 DNA Ladder Fig 5B AKT2 / MCF-7 Ladder species NADPH 10 ~ 11 ROS
11 AKT2 1049 Fig 4 Detection of AKT2 mrna expression by RT- PCR The expression of AKT2 mrna in AKT2 / MCF- 7 DN-AKT2 / MCF-7 and empty vector / MCF-7 stable transfectants and untransfected MCF-7 MCF-7 cells transfected with sirna negative control or AKT2 sirna and AKT2 / MCF-7 transfected with AKT2 sirna were detected by RT-PCR The results confirmed that these transfections resulted in elevated exogenous WT AKT2 and DN-AKT2 in AKT2 / MCF-7 and DN-AKT2 / MCF-7 stable transfectants groups and decreased AKT2 levels in AKT2 sirna transfected groups respectively A Electrophoretic analysis of AKT2 mrna expression M DL2000 DNA marker 1 Empty / MCF-7 stable transfectant 2 AKT2 / MCF-7 stable transfectant 3 untransfected MCF-7 4 MCF-7 cells transfected with sirna negative control fragment 5 MCF-7 cells transfected with AKT2 sirna 6 AKT2 / MCF-7 stable transfectant transfected with Akt2 sirna 7 DN-AKT2 / MCF-7 stable transfectant B The relative amount of the AKT2 mrna expression in different cell groups were showed in bar graph P < 0 05 vs empty vector / MCF-7 stable transfentant and untransfected cells P < 0 05 vs cells tranfected with control sirna and untransfected cells Fig 5 AKT2 decreased MCF-7 cells apoptosis in response to treatment MCF-7 cell apoptosis as revealed by TUNEL and DNA ladder were increased by Pre-treatment of cells with wortmannin before further increased cell apoptosis whereas over-expression of AKT2 decreased cell apoptosis and knocking down of AKT2 with sirna caused an increase in cell apoptosis too Similarly DN-AKT2 increased induced cell apoptosis A The average percentages of apoptotic cells detected by TUNEL method P < 0 05 vs cells transfected with empty vector or untransfected cells and treated with P < 0 05 vs cells tranfected with control sirna and treated with P < 0 05 vs untransfected cells treated with B -induced MCF-7 cell apoptosis was determined by DNA Ladder assay 1 Empty vector 2 Empty vector 3 AKT2 WT 4 Untransfected cells 5 Untransfected cells 6 Control sirna 7 Control sirna 8 AKT2 sirna 9 AKT2 WT + AKT2 sirna 10 Wortmannin 100 nmmol / L 11 DN-AKT2 O 2 AKT1 AKT2 4 15 AKT2 PI3K / AKT2 NIH OVCAR-3 AKT2 4 mrna BCL-2 NF-кB DNA 14 AKT1 RT-PCR AKT2 cdna AKT2 4 ~ 5 AKT pcdna3 1 / myc-his - A
1050 27 MCF-7 AKT2 mrna growth J AKT2 DN-AKT2 AKT2 sirna MCF-7 AKT2 / MCF-7 AKT2 mrna TUNEL DNA Ladder AKT2 WT-AKT2 DN-AKT2 sirna WT-AKT2 WT-AKT2 MCF-7 AKT2 sirna AKT2 AKT2 AKT2 / MCF-7 AKT2 8 sirna AKT2 PI3K / Akt wortmannin DN-AKT2 sirna AKT2 AKT2 J AKT2 AKT2 ROS AKT2 J 2002 16 1 111-113 AKT2 sirna References 1 Woodard J Sassano A Hay N et al Statin-dependent suppression of the Akt / mammalian target of rapamycin signaling cascade and programmed cell death 4 Up- regulation in renal cell carcinoma J Clin Cancer Res 2008 14 14 4640-4649 2 Zhang H Chen D Ringler J et al Disulfiram treatment facilitates phosphoinositide 3-kinase inhibition in human breast cancer cells in vitro and in vivo J Cancer Res 2010 70 10 3996-4004 3 Grimshaw K M Hunter L J Yap T A et al AT7867 is a potent and oral inhibitor of AKT and p70 S6 kinase that induces pharmacodynamic changes and inhibits human tumor xenograft Mol Cancer Ther 2010 9 5 1100-1110 4 Arboleda M J Lyons J F Kabbinavar F F et al Overexpression of AKT2 / protein kinase Bβ leads to up-regulation of β1 integrins increased invasion and metastasis of human breast and ovarian cancer cells J Cancer Res 2003 63 1 196-206 5 Vandermoere F El Yazidi-Belkoura I Demont Y et al Proteomics exploration reveals that actin is a signaling target of the kinase Akt J Mol Cell Proteomics 2006 6 1 114-124 6 Andrabi S Gjoerup O V Kean J A et al Protein phosphatase 2A regulates life and death decisions via Akt in a contextdependent manner J Proc Natl Acad Sci U S A 2007 104 48 19011-19016 7 Huang Q Huang Q Lin W et al Potential roles for PA28b in gastric adenocarcinoma development and diagnosis J J Cancer Res Clin Oncol 2010 136 8 1275-1282 TLR SRP54 SRP RNA J Huang Qiao-Jia Lan Feng-Hua Dong Li-Hong et al Role of TLR sequence in binding of SRP54 with SRP RNA and signal peptide J Chin J Biochem Mol Biol 2005 21 6 781-785 9 Huang Q Yang J Lin Y et al Differential regulation of interleukin-1 receptor and Toll-like receptor signaling by MEKK3 Nat Immunol 2004 5 1 98-103 10 Mackey A M Sanvicens N Groeger G et al Redox survival signalling in retina- derived 661 W cells J Cell Death Differ 2008 15 8 1291-1303 11 Yoon S O Kim M M Park S J et al Selenite suppresses hydrogen peroxide-induced cell apoptosis through inhibition of ASK1 / JNK and activation of PI3-K / Akt pathways J FASEB 12 Dossumbekova A Berdyshev EV Gorshkova I et al Akt activates NOS3 and separately restores barrier integrity in - stressed human cardiac microvascular endothelium J Am J Physiol Heart Circ Physiol 2008 295 6 H2417-H2426 13 Hirpara J L Cleomentú M V Pervaiz S Intracellular acidification triggered by mitochondrial-derived hydrogen peroxide is an effector mechanism for drug-induced apoptosis in tumor cells J J Biol Chem 2001 276 1 514-521 14 Qin S Chock P B Implication of phosphatidylinositol 3-kinase membrane recruitment in hydrogen peroxide-induced activation of PI3K and Akt J Biochemistry 2003 42 10 2995-3003 15 Cheng G Z Chan J Wang Q et al Twist transcriptionally upregulates AKT2 in breast cancer cells leading to increased migration invasion and resistance to paclitaxel J Cancer Res 2007 67 5 1979-1987