C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is

Σχετικά έγγραφα
(A ntifreeze p roteins, A FP s) (afp ),

SOD SNP % Cu /Zn-SOD. DAM- BE DNAStar % Mn /Fe-SOD. 6 1SNP /17. 9 bp

Error ana lysis of P2wave non2hyperbolic m oveout veloc ity in layered media

Identification of Fish Species using DNA Method

Cytogenetics and RAPD Ana lysis of In terspec if ic Hybr ids from the Cross of F raga ria m andschu rica Staudt and F. ananassa D uch.

The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea

China B iotechnology, 2005, 25 (12) : pcamb IA21201 DH5 1. 2

SCIENTIA SILVAE SINICAE. a/ b. oldhamii). The length of cab2bo1 ( GenBank accession

( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;

Study on Wheat Heterotic Group

Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4

Aus dem Institut für Pflanzenzüchtung und Pflanzenschutz

LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing

Approximation Expressions for the Temperature Integral

Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene

Effects of Plan t Growth Regula tors on the Con ten t of Phenolics in Sweet Cherry D orman t Flower Buds and D ormancy

30s 56 60s 72 60s dntp cm s s s 23

8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,

Tan Xiaofeng Chen Hongpeng Zhang Dangquan Zeng Yanling Li Wei Jiang Yao Xie Lushan Hu Xiaoyi Hu Fangming. and Technology Changsha )

HIV HIV HIV HIV AIDS 3 :.1 /-,**1 +332

, -.

Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival

Quick algorithm f or computing core attribute

DNA, , DNA, 1 D NA . DNA

Archive of SID. نشانمند كردن ژنه يا برگرداننده باروري بوسيله تجزيه كلاس مغلوب در برنج چكيده مقدمه

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

D etection of S traw berry m ild yellow edge virus w ith RT2PCR and Ana lysis of the Sequences of 3π Term ina l Reg ion

Correction of chromatic aberration for human eyes with diffractive-refractive hybrid elements

A Preliminary Analysis of Genetic Relationships for Prunus mume Sieb. et Zucc. by AFLP

DNA2ITS, Iden tif ica tion of C o lle to trichum sp. from A n thu rium and raeanum and Its Sequenc ing of R ibosoma l D NA2ITS

Synthesis of Imines from Amines in Aliphatic Alcohols on Pd/ZrO 2 Catalyst at Ambient Conditions

Journal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %

( , ,

J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5

α 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN

ΠΑΡΑΜΕΤΡΟΙ ΕΠΗΡΕΑΣΜΟΥ ΤΗΣ ΑΝΑΓΝΩΣΗΣ- ΑΠΟΚΩΔΙΚΟΠΟΙΗΣΗΣ ΤΗΣ BRAILLE ΑΠΟ ΑΤΟΜΑ ΜΕ ΤΥΦΛΩΣΗ

O rnam en ta l Sunflower

Rapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application

svari Real-time RT-PCR RSV

Composition Analysis of Protein and Oil and Amino Acids of the Soybean Varieties in Heilongjiang Province of China

,,, (, ) , ;,,, ; -

cm cm 92. 0% DH S 917

1999, 17 (1): J ourna l of W uhan B otan ica l Resea rch ( ) ( ) 2, 3. (Celosia cristata L. ),

D etection on the Sen sitiv ity of Pota to Phytoph thora infestans to M eta laxyl and Cym oxan il

Science of Sericulture

Optimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology

CBF1. Study on CBF1 Gene Transferred from Transgenic Strawberry to Nontransgenic

Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone

Metal-free Oxidative Coupling of Amines with Sodium Sulfinates: A Mild Access to Sulfonamides

Table S1. Summary of data collections and structure refinements for crystals 1Rb-1h, 1Rb-2h, and 1Rb-4h.

A strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines

Effect of ultra son ic2a ssisted extraction on polysacchar ide structure from C oprinus com a tus character ized by FT IR and AFM

A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn

Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin

Stress Relaxation Test and Constitutive Equation of Saturated Soft Soil

Accumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk

Αξιολόγηση της αισθητικής αξίας δασογεωργικών και γεωργικών συστημάτων

Cellular Physiology and Biochemistry

WANG L i2na 1, YANG Feng2juan 1, WANG Xiu2feng 13, SH IQ ing2hua 1, W E IM in 1, and HU Xiang2yang 2

A summation formula ramified with hypergeometric function and involving recurrence relation

Enzymatic Synthesis of Dithiolopyrrolone Antibiotics Using Cell-Free Extract of Saccharothrix

ΜΑΘΗΜΑΤΙΚΗ ΠΡΟΣΟΜΟΙΩΣΗ ΤΗΣ ΔΥΝΑΜΙΚΗΣ ΤΟΥ ΕΔΑΦΙΚΟΥ ΝΕΡΟΥ ΣΤΗΝ ΠΕΡΙΠΤΩΣΗ ΑΡΔΕΥΣΗΣ ΜΕ ΥΠΟΓΕΙΟΥΣ ΣΤΑΛΑΚΤΗΦΟΡΟΥΣ ΣΩΛΗΝΕΣ ΣΕ ΔΙΑΣΤΡΩΜΕΝΑ ΕΔΑΦΗ

ACTA SCIENTIAE CIRCUMSTANTIAE. 16S rrna PNAN5 ( Rhodococcus sp. strain PNAN5). 20. ( Institute of Microbiology, Chinese Academy of Sciences,

Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica

Stem Character istics of W heat w ith Stem L odging and Effects of L odging on Gra in Y ield and Qual ity

Εφαρμογές της τεχνολογίας επίγειας σάρωσης Laser στις μεταφορές

Βιοπληροφορική. Ενότητα 2: Βάσεις Δεδομένων (1/3), 1 ΔΩ. Τμήμα: Βιοτεχνολογίας Όνομα καθηγητή: Τ. Θηραίου

Analysis on the Ratio of Flesh Content and Nutritional. Quality of Esox lucius

BL21 (D E3)2p E T28a ( + )2bgl 2

Stud ies on Spore Propaga tion of P teris cretica A lbo2linea ta

Genetic Rela tion sh ip of Som e Cultivars of Petun ia Hybr ids Using SRAP M arker

Nguyen Hien Trang* **

MSM Men who have Sex with Men HIV -

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

ER-Tree (Extended R*-Tree)

T IM P-1 cd NA CO S-7. Clon ing of Human T IM P-1 cd NA and its Expression in COS-7 Cells. 21 (tissue in2

ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

High order interpolation function for surface contact problem

Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo

Gro wth Properties of Typical Water Bloom Algae in Reclaimed Water

Vol. 38 No Journal of Jiangxi Normal University Natural Science Nov. 2014

Development of a Seismic Data Analysis System for a Short-term Training for Researchers from Developing Countries

Conductivity Logging for Thermal Spring Well

Mitomycin C application for the prevention of postoperative synechiae formation at the anterior commissure.

GPS, 0. 5 kg ( In tegrated Fertility Index, IF I) 1. 1 SPSS 10. IF I =

D-Glucosamine-derived copper catalyst for Ullmann-type C- N coupling reaction: theoretical and experimental study

Θωμάς ΣΑΛΟΝΙΚΙΟΣ 1, Χρήστος ΚΑΡΑΚΩΣΤΑΣ 2, Βασίλειος ΛΕΚΙΔΗΣ 2, Μίλτων ΔΗΜΟΣΘΕΝΟΥΣ 1, Τριαντάφυλλος ΜΑΚΑΡΙΟΣ 3,

ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΦΙΛΟΛΟΓΙΑΣ

The Research on Sampling Estimation of Seasonal Index Based on Stratified Random Sampling

Antimicrobial Ability of Limonene, a Natural and Active Monoterpene

Development of the Nursing Program for Rehabilitation of Woman Diagnosed with Breast Cancer

Comparison of Evapotranspiration between Indigenous Vegetation and Invading Vegetation in a Bog

Supporting Information. Asymmetric Binary-acid Catalysis with Chiral. Phosphoric Acid and MgF 2 : Catalytic

CorV CVAC. CorV TU317. 1

Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού

Evaluation of Resistance to Scab in Pear Germplasms

Supporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka

TABLE OF CONTENTS Page

Varietal Differences in Response of Main Root Traits to Nitrogen Application Time in Rice ( Oryza sativa L. )

Transcript:

2009, 36 (9) : 1375-1380 Acta Horticulturae Sinica 6 - (6PGDH ) 1, 2, 1, 1, 13 ( 1,, 210095; 2, 212400) : 6 - (62phosphogluconate dehydrogenase ) 6PGDH cdna ( GenBank : EU815934), 6PGDH, 3 6PGDH, 1 098 bp 936 bp 311 162 bp 3, DNAMAN 3, 22,, : ; ; 6 - ; ; : S 652 : A : 05132353X (2009) 0921375206 C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is W E I Yue 1, 2, WU Zhi2m ing 1, ZHANG Shu2ning 1, and CHEN J in2feng 13 ( 1 Key Laboratory of Southern V egetable C rop Genetics Im provem ent, N anjing A gricultural U niversity, N anjing 210095, China; 2 Polytechnical College of A griculture and Forestry, Zhenjiang, J iangsu 212400, China) Abstract: In order to demonstrate that the synthetic allotetrop loid species ( Cucum is hy tivus Chen and Kirkbride., 2n = 38) was the hybrids p rogeny originated from crossing between the wild Cucum is species (C. hystrix Chakr., 2n = 24) and the cultivated cucumber Beijing J ietou (C. sa tivus L., 2n = 14) in molecu2 lar level, p rimers were designed according to the 62phosphogluconate dehydrogenase ( 6 PGDH ) gene cdna sequence of cucumber ( GenB ank accession number: EU815934). The 6PGDH gene fragm ents were amp lified from allotetrop loid, the wild Cucum is and cultivated cucumber Beijing J ietou, respectively. Sequence analysis showed that the 6 PGDH fragments in three species were highly homologous, having 1 098 bp length each. It encompassed of 936 bp long open reading frame (ORF) encoding 311 am ino acids and had 162 bp non2translation 3 2term inal end region (3 UTR), no intron existed in 6 PGDH fragment. The sequences were analyzed by software p rogram DNAMAN, detected three variable am ino acid lociπs and twenty2two bases lociπs. The inheritance of variable lociπs were congruence w ith the M endelπs genetics law of inheritance, therefore, it is p roven at molecular level that this synthetic allotetrap loid species was the hybrid originated from C. and C. sativus Beijing J ietou crossing. Key words: cucumber; allotetrop loid; 6PGDH; hybrid; clone hystrix : 2009-03 - 13; : 2009-07 - 14 : (30830079) ; (30671419, 30700541) ; (2008AA10Z150, 2006AA10Z1A8, 2006AA100108) ; (2009CB119000) ; (2008BADB105, 2006BAD13B06, 2006BAD01A725211) 3 Author for correspondence ( E2mail: jfchen@njau1edu1cn)

1376 36 (C. hytivus Chen and Kirkbride., 2n = 38, HHCC) (Cucum is hystrix Chakr., 2n = 24, HH) (C. sativus Bei2 jing J ietou, 2n = 14, CC) (Chen et al., 1997, 2000, 2002, 2003; Chen & Adel2 berg, 2000), (, 2001) (, 2002) (, 2003, 2005, 2006) 2005) RAPD SSR AFLP (, 6 - ( 6PGDH ) (, 1990 ) 6PGDH ( Zea m ays AF061838) (Glycine m ax AB007907) (M edicago sati2 va U18239 ) (A rabidopsis tha liana AY084486 ) ( Spinacia oleracea AF295670 ) (O ryza sativa AY278362) 6PGDH ( GenBank : EU815934), 5, 6PGDH, 6PGDH, 3 6PGDH, 6PGDH 1 F 5, 28, 14 h, 2 3 M2MLV PMD192T Taq TaKaRa, TOP10, TR IZOL B IPEC DNA CTAB (Murray & Thomp son, 1980), RNA TR IZOL, O ligo ( dt) 14 : 5 2GACTCGAGTCGACATCGATTTTTTTTTTTTTT23 ( Hayashi et al., 2004), M 2MLV cdna : 6PGDH cdna ( GenBank : EU815934) 5 2GGGAATTTTGTGAAGATGGT23 ; : 5 2CTGCTATCTACTCCCCTAA23 cdna DNA PCR : 94 3 m in; 94 30 s, 50 30 s, 72 115 m in, 35 ; 72 10 m in, 4 PMD192T, TOP10, 1 ml LB ( 100 mg L - 1 ) 37 150 r m in - 1 PCR,, NCB I BLAST, DNAMAN 2 211 6PGD H cdna DNA ( 1) 1 098 bp 6PGDH NCB I B last, cdna 311 6PGDH 75%, 6PGDH cdna 311, TGA, 162 bp 3 (UTR) 3 6PGDH (ORF) cdna DNA,

9 : 6 - (6PGDH) 1377 F ig. 1 cd NA ( A) D NA ( B) 6PGDH PCR M: ; 1: ; 2: ; 3: 1 The electrophoresis results of 6PGDH gene PCR products using cd NA ( A) and D NA ( B) a s tem pla te M: Marker; 1: W ild species; 2: A llotetrop loid; 3: Cucumber Beijing Jietou. 212 6PGD H DNAMAN 6PGDH 311 ( 2), 3, 99168%, 0196%, 6PGDH F ig. 2 6PGDH 2 A lignm en t of pred icted am ino ac id sequences of 6PGDH from three spec ies 28 99, H A, R V; 183 F, L, 3 6PGDH DNA ( 3), (3 ), 1

1378 36 3 6PGD H D NA F ig. 3 A lignm en t of D NA ba se sequences of 6PGDH from three species 1 6PGDH D NA Table 1 The var iable loc i and ba se types of 6PGDH gene D NA sequences Locus number Samp le 3 9 12 54 83 105 201 219 294 296 300 396 411 444 549 636 744 795 837 962 1043 1071 G T G C G C T C T T G G C T T C C G G C T C Beijing Jietou G T G C A C T C T C A G C C T C C G G C N 3 N 3 A llotetrop loid A C T G A T C G C C A T G T G T G A A T C T W ild species 3 N =A + T + C + G

9 : 6 - (6PGDH) 1379 1 098 bp 22, 2%,, 22 19, 3 3 19 3, 16, 22, 16, 7217%, 3, 1316%, 444 T C, 1 043 1 071 4 8614%, 911%, 415%, 5 DNA 3 Chen (2002) (2003) 1 ; ( ) ; 1,,,, RAPD SSR AFLP (, 2003, 2005, 2006),,, 3,,,,,, 6PGDH ( Fahrendorf et al., 1995), ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ), 6PGDH,,,,, ;,,, DNA,, 6PGDH ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ),,,

1380 36 References B rover V, Troukhan M, A lexandrov N. 2006. Features of A rabidopsis genes and genome discovered using full2length cdna s. PlantMol B iol, 60 (1) : 71-87. Chen J F, Adelberg J. 2000. Interspecific hybridization in Cucum is2progress, problem, and perspectives. Hortscience, 35 (1) : 11-15. Chen J F, Adelberg J, Staub J E, Skoyup ska H T, Rhodes B B. 1998. A new synthetic amphidip loid in Cucum is from C. sativus C. hystrix Chakr. F 1 interspecific hybrid McCreight J D. Cucurbitaceae 982evaluation and enhancement of cucurbit germp lasm. A lexandria, Va. USA. : ASHS Press: 336-339. Chen J F, Joseph H, Kirkbride J. 2000. A new synthetic species Cucum is (Cucurbitaceae) from interspecific hybridization and chromosome dou2 bling. B rittonia, 52: 315-319. Chen Jin2feng, Ren Gang, Yu Ji2zhu. 2002. Studies on performance of peroxidase isozyme in the progenies from selfing of backcross between Cuc2 um is hytivus and C. sativus. Journal ofw uhan Botanical Research, 20 (5) : 333-337. ( in Chinese),,. 2002.., 20 (5) : 333-337. Chen J F, Staub J E, Adelberg J W. 2002. Synthesis and p relimary characterization of a new species ( amphidip loid) in Cucum is, 123: 315-322. Chen J F, Staub J E, Q ian C T. 2003. Rep roduction and cytogenetic characterization of interspecific hybrids from C. hystrix Chakr. C. sativus L. Theor Appl Gent, 106: 688-695. Chen J F, Staub J E, Tashiro Y. 1997. Successful interspecific hybridization between Cucum is sativus L. and C. hystrix Chakr. Euphytica, 96: 413-419. Chen Jin2feng, Zhuang Fei2yun, Q ian Chun2tao. 2001. Synthesis and p relim inary characterization of a new species (Am phidiploid) in Cucum is. Journal ofw uhan Botanical Research, 19 (5) : 357-362. ( in Chinese),,. 2001. ( )., 19 (5) : 357-362. Fahrendorf T, N iw, Shorroosh B S. 1995. Stress responses in alfalfa (M edicago sativa L. ) X IX. Transcrip tional activation of oxidative pentose phosphate pathway genes at the onset of the isoflavanoid phytoalexin response. PlantMol B iol, 28: 885-900. Hayashi H, Huang P, Takada S. 2004. D ifferential expression of three oxidosqualene cyclase mrna s in Glycyrrhiza glabra L. B iol Pharm Bull, 27: 1086-1092. Huang J, Zhang H S, W ang J F, Yang J S. 2003. Molecular cloning of rice 62phosphogluconate dehydrogenase genes that is up regulated by salt2 stress. B iology Reports, 30: 223-227. Karsten K, Marlies P, W illiam M. 2001. Purification and cloning of chloroplast 62phosphogluconate dehydrogenase from spinach. Eur J B iochom, 268: 2678-2686. L i Xiao2juan, W ang L iu2yang, Yang Hui2ling, L iu Jian2quan. 2007. Confirmation of natural hybrids between Gentiana stram inea and G. sipho2 nantha ( Gentianaceae) based on molecular evidence. Acta Botanica Yunnanica, 29 (1) : 91-97. ( in Chinese),,,. 2007. ( )., 29 (1) : 91-97. Murray H G, Thomp son W F. 1980. Rapid isolation of higher weight DNA. Nucl Acids Res, 8: 4321. Shen Tong, W ang Jing2yan. 1990. B iochem istry. Beijing: H igh Education Press. ( in Chinese),. 1990.. :. Zhuang Fei2yun, Chen Jin2feng. 2003. RAPD analysis of cultivated cucumber, wild Cucum is species, interspecific hybrid and its p rogenies from backcrossing. Acta Horticulturae Sinica, 30 (1) : 47-50. ( in Chinese),. 2003. RAPD., 30 (1) : 47-50. Zhuang Fei2yun, Chen Jin2feng, Q ian Chun2tao. 2005. Cytological and molecular studies on genom ic exchange and reconstitution in the synthetic allotetrap loid Cucum is hytivus. Scientia Agricultura Sinica, 38 (3) : 582-588. ( in Chinese),,. 2005. (Cucum is hytivus)., 38 (3) : 582-588. Zhuang Fei2yun, Chen Jin2feng, Wolucau J. 2006. Introgressive hybridization between the synthetic allotetraploid in Cucum is and cultivated cu2 cumber and assessment of the genetic variation in the progenies. Acta Horticulturae Sinica, 33 (2) : 266-271. ( in Chinese),, Wolucau J. 2006.., 33 ( 2 ) : 266-271.