2009, 36 (9) : 1375-1380 Acta Horticulturae Sinica 6 - (6PGDH ) 1, 2, 1, 1, 13 ( 1,, 210095; 2, 212400) : 6 - (62phosphogluconate dehydrogenase ) 6PGDH cdna ( GenBank : EU815934), 6PGDH, 3 6PGDH, 1 098 bp 936 bp 311 162 bp 3, DNAMAN 3, 22,, : ; ; 6 - ; ; : S 652 : A : 05132353X (2009) 0921375206 C lon ing of 62phosphoglucona te D ehydrogena se Gene ( 6PGD H ) and M olecu2 lar Conf irma tion of A llotetraplo id in C ucum is W E I Yue 1, 2, WU Zhi2m ing 1, ZHANG Shu2ning 1, and CHEN J in2feng 13 ( 1 Key Laboratory of Southern V egetable C rop Genetics Im provem ent, N anjing A gricultural U niversity, N anjing 210095, China; 2 Polytechnical College of A griculture and Forestry, Zhenjiang, J iangsu 212400, China) Abstract: In order to demonstrate that the synthetic allotetrop loid species ( Cucum is hy tivus Chen and Kirkbride., 2n = 38) was the hybrids p rogeny originated from crossing between the wild Cucum is species (C. hystrix Chakr., 2n = 24) and the cultivated cucumber Beijing J ietou (C. sa tivus L., 2n = 14) in molecu2 lar level, p rimers were designed according to the 62phosphogluconate dehydrogenase ( 6 PGDH ) gene cdna sequence of cucumber ( GenB ank accession number: EU815934). The 6PGDH gene fragm ents were amp lified from allotetrop loid, the wild Cucum is and cultivated cucumber Beijing J ietou, respectively. Sequence analysis showed that the 6 PGDH fragments in three species were highly homologous, having 1 098 bp length each. It encompassed of 936 bp long open reading frame (ORF) encoding 311 am ino acids and had 162 bp non2translation 3 2term inal end region (3 UTR), no intron existed in 6 PGDH fragment. The sequences were analyzed by software p rogram DNAMAN, detected three variable am ino acid lociπs and twenty2two bases lociπs. The inheritance of variable lociπs were congruence w ith the M endelπs genetics law of inheritance, therefore, it is p roven at molecular level that this synthetic allotetrap loid species was the hybrid originated from C. and C. sativus Beijing J ietou crossing. Key words: cucumber; allotetrop loid; 6PGDH; hybrid; clone hystrix : 2009-03 - 13; : 2009-07 - 14 : (30830079) ; (30671419, 30700541) ; (2008AA10Z150, 2006AA10Z1A8, 2006AA100108) ; (2009CB119000) ; (2008BADB105, 2006BAD13B06, 2006BAD01A725211) 3 Author for correspondence ( E2mail: jfchen@njau1edu1cn)
1376 36 (C. hytivus Chen and Kirkbride., 2n = 38, HHCC) (Cucum is hystrix Chakr., 2n = 24, HH) (C. sativus Bei2 jing J ietou, 2n = 14, CC) (Chen et al., 1997, 2000, 2002, 2003; Chen & Adel2 berg, 2000), (, 2001) (, 2002) (, 2003, 2005, 2006) 2005) RAPD SSR AFLP (, 6 - ( 6PGDH ) (, 1990 ) 6PGDH ( Zea m ays AF061838) (Glycine m ax AB007907) (M edicago sati2 va U18239 ) (A rabidopsis tha liana AY084486 ) ( Spinacia oleracea AF295670 ) (O ryza sativa AY278362) 6PGDH ( GenBank : EU815934), 5, 6PGDH, 6PGDH, 3 6PGDH, 6PGDH 1 F 5, 28, 14 h, 2 3 M2MLV PMD192T Taq TaKaRa, TOP10, TR IZOL B IPEC DNA CTAB (Murray & Thomp son, 1980), RNA TR IZOL, O ligo ( dt) 14 : 5 2GACTCGAGTCGACATCGATTTTTTTTTTTTTT23 ( Hayashi et al., 2004), M 2MLV cdna : 6PGDH cdna ( GenBank : EU815934) 5 2GGGAATTTTGTGAAGATGGT23 ; : 5 2CTGCTATCTACTCCCCTAA23 cdna DNA PCR : 94 3 m in; 94 30 s, 50 30 s, 72 115 m in, 35 ; 72 10 m in, 4 PMD192T, TOP10, 1 ml LB ( 100 mg L - 1 ) 37 150 r m in - 1 PCR,, NCB I BLAST, DNAMAN 2 211 6PGD H cdna DNA ( 1) 1 098 bp 6PGDH NCB I B last, cdna 311 6PGDH 75%, 6PGDH cdna 311, TGA, 162 bp 3 (UTR) 3 6PGDH (ORF) cdna DNA,
9 : 6 - (6PGDH) 1377 F ig. 1 cd NA ( A) D NA ( B) 6PGDH PCR M: ; 1: ; 2: ; 3: 1 The electrophoresis results of 6PGDH gene PCR products using cd NA ( A) and D NA ( B) a s tem pla te M: Marker; 1: W ild species; 2: A llotetrop loid; 3: Cucumber Beijing Jietou. 212 6PGD H DNAMAN 6PGDH 311 ( 2), 3, 99168%, 0196%, 6PGDH F ig. 2 6PGDH 2 A lignm en t of pred icted am ino ac id sequences of 6PGDH from three spec ies 28 99, H A, R V; 183 F, L, 3 6PGDH DNA ( 3), (3 ), 1
1378 36 3 6PGD H D NA F ig. 3 A lignm en t of D NA ba se sequences of 6PGDH from three species 1 6PGDH D NA Table 1 The var iable loc i and ba se types of 6PGDH gene D NA sequences Locus number Samp le 3 9 12 54 83 105 201 219 294 296 300 396 411 444 549 636 744 795 837 962 1043 1071 G T G C G C T C T T G G C T T C C G G C T C Beijing Jietou G T G C A C T C T C A G C C T C C G G C N 3 N 3 A llotetrop loid A C T G A T C G C C A T G T G T G A A T C T W ild species 3 N =A + T + C + G
9 : 6 - (6PGDH) 1379 1 098 bp 22, 2%,, 22 19, 3 3 19 3, 16, 22, 16, 7217%, 3, 1316%, 444 T C, 1 043 1 071 4 8614%, 911%, 415%, 5 DNA 3 Chen (2002) (2003) 1 ; ( ) ; 1,,,, RAPD SSR AFLP (, 2003, 2005, 2006),,, 3,,,,,, 6PGDH ( Fahrendorf et al., 1995), ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ), 6PGDH,,,,, ;,,, DNA,, 6PGDH ( Karsten et al., 2001; Huang et al., 2003; B rover et al., 2006 ),,,
1380 36 References B rover V, Troukhan M, A lexandrov N. 2006. Features of A rabidopsis genes and genome discovered using full2length cdna s. PlantMol B iol, 60 (1) : 71-87. Chen J F, Adelberg J. 2000. Interspecific hybridization in Cucum is2progress, problem, and perspectives. Hortscience, 35 (1) : 11-15. Chen J F, Adelberg J, Staub J E, Skoyup ska H T, Rhodes B B. 1998. A new synthetic amphidip loid in Cucum is from C. sativus C. hystrix Chakr. F 1 interspecific hybrid McCreight J D. Cucurbitaceae 982evaluation and enhancement of cucurbit germp lasm. A lexandria, Va. USA. : ASHS Press: 336-339. Chen J F, Joseph H, Kirkbride J. 2000. A new synthetic species Cucum is (Cucurbitaceae) from interspecific hybridization and chromosome dou2 bling. B rittonia, 52: 315-319. Chen Jin2feng, Ren Gang, Yu Ji2zhu. 2002. Studies on performance of peroxidase isozyme in the progenies from selfing of backcross between Cuc2 um is hytivus and C. sativus. Journal ofw uhan Botanical Research, 20 (5) : 333-337. ( in Chinese),,. 2002.., 20 (5) : 333-337. Chen J F, Staub J E, Adelberg J W. 2002. Synthesis and p relimary characterization of a new species ( amphidip loid) in Cucum is, 123: 315-322. Chen J F, Staub J E, Q ian C T. 2003. Rep roduction and cytogenetic characterization of interspecific hybrids from C. hystrix Chakr. C. sativus L. Theor Appl Gent, 106: 688-695. Chen J F, Staub J E, Tashiro Y. 1997. Successful interspecific hybridization between Cucum is sativus L. and C. hystrix Chakr. Euphytica, 96: 413-419. Chen Jin2feng, Zhuang Fei2yun, Q ian Chun2tao. 2001. Synthesis and p relim inary characterization of a new species (Am phidiploid) in Cucum is. Journal ofw uhan Botanical Research, 19 (5) : 357-362. ( in Chinese),,. 2001. ( )., 19 (5) : 357-362. Fahrendorf T, N iw, Shorroosh B S. 1995. Stress responses in alfalfa (M edicago sativa L. ) X IX. Transcrip tional activation of oxidative pentose phosphate pathway genes at the onset of the isoflavanoid phytoalexin response. PlantMol B iol, 28: 885-900. Hayashi H, Huang P, Takada S. 2004. D ifferential expression of three oxidosqualene cyclase mrna s in Glycyrrhiza glabra L. B iol Pharm Bull, 27: 1086-1092. Huang J, Zhang H S, W ang J F, Yang J S. 2003. Molecular cloning of rice 62phosphogluconate dehydrogenase genes that is up regulated by salt2 stress. B iology Reports, 30: 223-227. Karsten K, Marlies P, W illiam M. 2001. Purification and cloning of chloroplast 62phosphogluconate dehydrogenase from spinach. Eur J B iochom, 268: 2678-2686. L i Xiao2juan, W ang L iu2yang, Yang Hui2ling, L iu Jian2quan. 2007. Confirmation of natural hybrids between Gentiana stram inea and G. sipho2 nantha ( Gentianaceae) based on molecular evidence. Acta Botanica Yunnanica, 29 (1) : 91-97. ( in Chinese),,,. 2007. ( )., 29 (1) : 91-97. Murray H G, Thomp son W F. 1980. Rapid isolation of higher weight DNA. Nucl Acids Res, 8: 4321. Shen Tong, W ang Jing2yan. 1990. B iochem istry. Beijing: H igh Education Press. ( in Chinese),. 1990.. :. Zhuang Fei2yun, Chen Jin2feng. 2003. RAPD analysis of cultivated cucumber, wild Cucum is species, interspecific hybrid and its p rogenies from backcrossing. Acta Horticulturae Sinica, 30 (1) : 47-50. ( in Chinese),. 2003. RAPD., 30 (1) : 47-50. Zhuang Fei2yun, Chen Jin2feng, Q ian Chun2tao. 2005. Cytological and molecular studies on genom ic exchange and reconstitution in the synthetic allotetrap loid Cucum is hytivus. Scientia Agricultura Sinica, 38 (3) : 582-588. ( in Chinese),,. 2005. (Cucum is hytivus)., 38 (3) : 582-588. Zhuang Fei2yun, Chen Jin2feng, Wolucau J. 2006. Introgressive hybridization between the synthetic allotetraploid in Cucum is and cultivated cu2 cumber and assessment of the genetic variation in the progenies. Acta Horticulturae Sinica, 33 (2) : 266-271. ( in Chinese),, Wolucau J. 2006.., 33 ( 2 ) : 266-271.