2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene Zhang Zhen, Sun Aijun, Fang Jinggui and Sheng Bingcheng (College of Horticulture, Nanjing Agric Univ, Nanjing 210095, China) Abstract : The rolc gene cloned from Agrobacterium rhizogenes was inserted into the genome of tobacco plant using Agrobacterium Οmedi2 ated transformation method, and the result was verified by GUS analysis, PCR amplification and Southern hybridization. Compared to the control, the transgenic tobacco plants showed significantly dwarfer plant height, later bloom period, smaller flower and shorter androeci2 um. Key words : tobacco ; Agrobacteriun ; rolc gene ; transformation 1985, Horsch [1 ],,,,, ( Agrobacteriun Οmediated), ( Agrobacteriun rhizogenes),, (Ri ) [2 ] Ri T2DNA DNA, TL (T2left) TR (T2right) 2DNA [3 ] TL2 DNA (root loci, rol), rolab C D [4 ] [5,6 ], rolc,, [68 rolc ] rolc, rolc,, rolc, rolc 1 111 p GA2 GUS GF rolc (1) (LBA4404) npt ( ) GUS 2 ) npt GUS : 2000Ο02Ο29 ' 1994-2007 China Academic Journal Electronic Publishing House. All rights reserved. http://www.cnki.net
26 24 35S, rolc 1 rolc pga2gus GF rolc Fig. 1 Schematic partial map of rolc gene expression vector pga2gusgfrolc 112, (rif 50 mg L - 1 ) ( Km 50 mg L - 1 ) ( YEB ), 27,, YEB, 27 (200 r min - 1 ) 113 1 70 % 30 s, 2 %3 % ( ) 20 min,, 3, (1/ 2MS), (25 2),, ( (25 2), 14 h, 2 000 lx), (BA 1 mg L - 1 ) MS,, 3040 d 114,, (MS + BA 1 mg L - 1 ), 12 d 115, OD 600 = 015 4, 8 min (5 000 r min - 1 ), YEB,, 5 min, ( 23 ) 3 d 116 (Cb 500 mg L - 1 ) ( Km 100 mg L - 1 ),, 2030 d, 117 Cb Km (012 mg L - 1 1/ 2 MS),,,, 2025, 4 d, 118 11811 GUS ( ) Eppendorf, X2Gluc (5224 [9 232 2 ) ], 37 1 h 11812 PCR [10,11 ] DNA rolc DNA ( ), PCR PCR 50 L, 30 ng DNA5 ( 5 3: CGACCTGTGTTCTCTCTTTTTCAAGC) 3 ( 5 3: GCACTCGCCATGCCTCACCAACTCACC) [5,7 ] 1 L 5 U L - 1 Taq 1 L 10 Taq 5 L 15 mmol L - 1 MgCl 2 25 L 215 mmol L - 1 dntps 1 L, 50 L : 94 10 min, Taq, 94 30 s, 60 30 s, 72 90 s 30 PCR
1 : rolc 27 11813 Southern DNA 500 L 10g DNA, Hind, 1 g L - 1 [11 3 h ], rolc 119 20 g L - 1 (10 g L - 1 ),,, (25 ) 24 h, 2 211 ( ), 11 18 40 d, 11 %,, Km Cb Km (1 150 mg L - 1 ) Cb (500 mg L - 1 ),, 212 GUS, 20, GUS 12 GUS (2) 90 d, GUS 4 ( 2 ), GUS, GUS GUS, rolc, GUS 213 PCR 2 GUS ( 1 Fig. 2 GUS positive of rolc2transformed tobacco plant leaf ) 1, DNA, 3 rolc PCR Fig. 3 PCR amplification detection 1, 21 rolc DNA ; 31 DNA ; 41marker ; 51 rolc 1 and 2. DNA of rolc2transformed tobacco leaf ; 3. DNA of the control leaf ; 4. rying rolc gene Pgem27Zf ( hae ) marker ; 5. plasmid car2 2 rolc GUS rolc ( ) PCR, Hind 2DNA PCR (3), rolc DNA 458 bp 657 bp, DNA rolc (514 bp), rolc ; DNA, rolc, rolc ; DNA, rolc, DNA PCR, rolc GUS PCR, : GUS
28 24, GUS 214 Southern, Southern 2, DNA, Southern, (4), rolc 215 rolc 4 rolc Southern, Fig. 4 Southern hybridization pattern of rolc2transformed tobacco, 75 d, (1, 21 rolc DNA ; 31 DNA ; 41 rolc ), 90 d, 6, 7316 (1, 21DNA of rolc2transformed tobacco leaf ; 31DNA of the cm 90 d, 26 2 control leaf, 41 rolc gene), 2, 3618 cm, 5010 %, 514 cm (5),,, (6) rolc 3 rolc, rolc rolc,
1 : rolc 29 rolc, rolc rolc, 26, 2 514 cm,, rolc, rolc, ( ) ( ),, rolc, rolc,,,, : [1 ] Horsh R B, Fry J E, Hoffman N 1, et al. A simple and general method for transferring genes into plants [J ]. Science, 1985, 227 : 1229Ο1231. [2 ] Chilton M D, Tepfer D A, Petit A, et al. Agrobacterium rhizgenes inserts T2DNA into the genome of host plant root cells [J ]. Nature, 1982, 295 : 432Ο434. [3 ] Spena A, Schmulling, Koncz C, et al. Independent and synergistic activity of rola, B and C loci in stimulating abnormal growth in plants [J ]. The EMBO Journal, 1987, 13 : 3891Ο3899. [4 ] White F F, Taylor B H, Huffman GA, et al. Molecular and genetic analysis of the transferred DNA regions of the root2inducing plasmid of Agrobacterium rhizgenes [J ]. J Bacteriol, 1985, 164 : 33Ο44. [5 ] Fladung M. Transformation of diploid and tetraploid potato clones with the rolc gene of Agrobacterium rhizgenes and characterization of transgenic plants [J ]. Plant Breeding, 1990, 104 : 295Ο304. [6 ] Nillson O, Moritz T, Sundberg B, et al. Expression of the Agrobacterium rhizgenes rolc gene and development and leads to stem fasciation [J ]. Plant Physiol, 1996, 112 : 493Ο502. [7 ] Richard L B, Ralph S, Chinnathambi S, et al. Transformation of Beurre Boscpear with the rolc gene [J ]. J Amer Soc Hort Sci, 1999, 124 (6) : 570Ο574. [8 ] van der Salm T P M, van der Toorm C J G, ten Cate Hanisch CH H, et al. Introduction of rol genes in rootstocks of rose [J ]. Physiol Plant, 1992, 85 : 40. [9 ] Maliga P, Klessing D F, Cashmore A R. et al. Methods in plant molecular biology : A Laboratory Course Manual [M]. New York : Cold Spring Harbor Laboratory Press, 1995. [10 ] Dyole J J, Doyle J L. Isolation of plant DNA from fresh tissue [J ]. B RL Focus, 1990, 12 : 13Ο15. [ 11 ] Sambrook J, Frisch E F, Maisata T. Molecular cloning : A Laboratory Manual [M]. New York : Cold Spring Harbor Laboratory Press, 1989. :