ISSN 100727626 CN 1123870ΠQ 2005 4 Chinese Journal of Biochemistry and Molecular Biology 21 (2) :164 170 ACB P5 cdna Π 1, 2) 1) 2) 1) 3) 1, 2) 1, 3) 3,,,,,, ( 1), 100875 ; 2), 310006 ; 3) Forsyth, 02115) ACB P5 RT2PCR, RT2PCR, A (acyl2coa binding protein,acbp) ACB P5 ACB P5 cdna 1083 bp 1 7,6 354 bp 118 ACB P5 RT2PCR,ACB P5 ACB P5 ACBP5,, A, Q74,Q78 Cloning and Characterization of a Novel Human Gene ACB P5 cd NA WANGLuan 1,2), XUE Peng 1), CHENG Rui 2), FU Jia2Qi 1), CHEN Wei 3), CI Hong2Liang 1,2), LI Yi2Ping 1,3 ) 3 ( 1) Biomedical Research Institute, College of Life Sciences, Beijing Normal University, Beijing 100875, China ; 3) 2) Zhejiang Cell Biomedical Research College, Hangzhou 310006, China ; Forsyth Institute, Harvard School of Dental Medicine, Boston, MA 02115, USA) Abstract Based on the bioinformatics, a novel human gene ACB P5 (acyl2coa binding protein 5) cdna was found and cloned into pcmv2sport6 The full length of ACB P5 cdna is 1 083 bp and contains 7 exons and 6 introns Its open reading frame (ORF) encodes a protein of 118 amino acid residues The whole2mount in situ hybridization (WISH) of mouse and chicken embryo showed that the gene was specially expressed in the brain and mainly in the isthmus The result of reverse transcriptase2polymerase chain reaction ( RT2PCR) of the mature mouse tissues showed that it was widely expressed in many organs The result indicates that ACB P5 gene may have an essential role in the development of brain and the maintenance of the organs normal functions Key words ACB P5 gene, bioinformatics, acyl2coa binding protein domain, brain A (acyl2coa) 3, [1 ] ACBP A (acyl2coa2binding protein,acbp) :2004204202 :2004205227 ACBP 90 3 Tel :010258809071,E2mail : YPLi @forsyth org 10 kd,nmr ACBP 5 Received :April 2 2004 ; Accepted : May 27,2004 3 Corresponding author Tel :010258809071,E2mail : YPLi @forsyth org 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
2 : ACB P5 cdna Π 165 A [2 ], ; [3 ] 112 ACB P5, RIKEN (peroxisome proliferator2activated receptor gamma,ppar2 motif2containing protein cdna ), 13 PPAR2 PPAR2 ACB P5 BRL49653 [4 ] : 24 ( hepatocyte nuclear factor24alpha, HNF24 ) [5 ] sirna HeLa, Hep G2 Chang ACBP ( http :ΠΠwww ncbi nlm nih govπgenomeπseqπpage cgi? F = HsBlast html && [6 ],ACBP ORG= Hs) ; (3) 2 ( gamma2aminobutyric acid2 [7 ergic, GABAergic) ] ( http :ΠΠgenes mit eduπ,acbp GENSCAN html) ; ACBP ; ; RT2 PCR RT2PCR RIKEN pcmv2sport6 cdna 113 ACB P5 1083 bp ACB P5 118, : ACBP cdna 85 %, ncbi nlm nih govπgorfπgorf html) (2) : ( http :ΠΠwww ncbi nlm nih govπgenomeπseqπ page cgi? F = HsBlast html &&ORG= Hs) 1 111 ;M2 (4) : ( http :ΠΠgenome MLV Invitrogen ; PFU DNA ; Roche ; (5) : ExPASy 2 ; ProtParam ; QIAquick Gel Extration Kit QIAGEN ; Trizol pcmv2 embl2heidelberg deπ) SPORT6 Stratagene ; DH5 (1) motif2containing protein (2) BLAST GenScan (4) EST (1) (ORF) : (http :ΠΠwww (3) : (http :ΠΠwww expasy orgπcgi2binπprotscale pl) cbs dtu dkπservicesπtmhmmπ) (6) : ( http :ΠΠsmart 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
166 21 114 RT2PCR cdna,rt2pcr 2 P1 (sense) : 5 2 TGAAAGATGAAGAGGGTAG2 3 3 P2 ( antisense ) : 5 2CAGAACTGATTTTATTAGCC2 HeLa 80 % Trizol ( Invitrogen) RNA, Fig11 011 gπl, M2MLV 212 ACB P5 (Invitrogen) mrna : oligo (dt) 18 21211 ORF finder ACB P5, RNase 1014 l,5 RT 410 l,dntp (250 molπl) 116 l,mrna (011 gπ L) 110 l,oligo (dt) 18 210 l, :65 MUΠL) 37 10 min PCR : 2 l :10 PCR 3 l,215 mmolπl dntps 3 l, 1 l (10 pmol), 1 l (10 pmol),ddh 2 O 10 l, 215 U Taq PCR :94 35 s,55 1 min,72 35 s,32 72, 7 min 115 [8 ] pcmv2sport6 N 42 125 1 kb ACB P5 cdna ACBP 83 (Fig14) DIG (Roche) 213 ACB P5 DIG RNA RT2PCR ACB P5 pcmv2sport6 9218 % ( ) [9,10 ] CNB P 116 RT2PCR acbp5 : 5 2TGAAAGATGAAGAGGGTAG23 5 2CAGAACTGATTTTATTAGCC23 412 bp dpc (Fig15 C) GA PDH 1015 dpc ( Fig15 D) 5 2ACCACAGTCCATGCCATCAC23 5 2TCCACCACCCTGTTGCTGTA23, 32,72 7 min PCR 10 l 2 % 211 ACB P5 ACB P5, cdna 1083 bp 118, 354 bp, ACB P5 cdna 35 388 ATG TGA 5 min,37 60 min,75 5 min,mmlv (200 Poly A AATAAA (Fig11 ) 21212 ACB P5 ACB P5 1 210 kb 7,6 (Fig12) ACB P5 AK002470 8417 %(Fig13) 21213 ACB P5 214 715 dpc (Fig15 A), ACB P5, 9125 dpc (Fig15 B),ACB P5 915 12 ( HH 452 bp 100 mg ) ( Fig15 G) Trizol ( Invitrogen) 17 ( Fig15 H), RNA M2MLV ( Invitrogen), 19 ( ) PCR : (Fig15 I) 94 5 min,94 45 s,5712 1 min,72 1 min 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
2 : ACB P5 cdna Π 167 Fig 1 cdna sequence of the human ACBP5 gene Coding sequences are shown together with the translated amino acid sequence Initiative code (ATG) and stop code (TGA) are underlined The polyadenylation signal sequences (AATAAA) are also underlined Fig 2 Genomic organization of ACB P5 gene The human ACB P5 gene is composed of 7 exons and 6 introns distributed over approximately 210 kb Solid bars represent exons The locations of initiative code ATG, stop code TGA and polyadenylation signal (PolyA signal) are indicated Fig 3 Alignment of human ACB P5 amino acid sequence with mouse AK002470 The consensus sequences are shadowed They share 84 7 % similarity 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
168 21 Fig 4 Predicted domains of ACBP5 protein The red one represents ACBP domain Fig 5 Whole2mount in2situ hybridization of mouse embryo and chicken embryo A D show the in2situ hybridization result of mouse embryo (according to day post coitum, dpc) A1 715 dpc ; B1 9125 dpc ; C1 915 dpc ; D1 1015 dpc ; E Negative control ; F Positive control (CNBP as probe) G J show the result of in2situ hybridization in the chicken embryo (following Hamburger & Hamilton Stages) G Stage 12 ; H Stage 17 ; I Stage 19 ; J Negative control Arrow shows the stained part 215 RT2PCR Fig 6 polya, 166 ACBP ( ),ACB P5 3 ACB P5 A A 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
2 : ACB P5 cdna Π 169 Fig 6 RT2PCR result of matured mouse organs Upper pattern M:Marker ; 1 :Negative2control ;2 :eye ;3 :cerebella ;4 :uterus ;5 :heart ;6 :lung ;7 :muscle ;8 :brain ; 9 :testis ;10 :kidney ;11 :spleen ;12 :intestines ;13 :liver GAPDH was displayed lower to control for differences in loading 910 dpc ACBP5, [11 ] 9125 dpc, ACB P5, 915 dpc, 915 dpc, ( References) 1015 dpc 1015 dpc En21 FGF8 ACBP5 12 17 19 157 164 [12,13 ] RT2PCR, ACB P5, ACB P5, ACB P5, : ACB P5 A 1 Andersen KV, Poulsen F M Three2dimensional structure in solution of acyl2coenzyme A binding protein from bovine liver J Mol Biol,1992, 226 (4) :1131 1141 2 Cavagnari B M, Milikowski D, Haller J F, Zanek M C, Santome J A, Ermacora M R Optical characterization of armadillo acyl2coa binding protein Int J Biol Macromol, 2002, 31(123) :19 27 3 Li H Y, Chye M L Membrane localization of arabidopsis acyl2coa binding protein ACBP2, ( ) Plant Mol Biol, 2003, 51(4) :483 492 4 Ugale R R, Hirani K, Morelli M, Chopde C T Role of adipocyte lipid2 binding protein ( ALBP) and acyl2coa binding protein ( ACBP) in PPAR2mediated transactivation Mol Cell Biochem, 2002, 239 (122) : 5 Petrescu A D, Payne H R, Boedecker A, Chao H, Hertz R, Bar2Tana J, Schroeder F, Kier A B Physical and functional interaction of acyl2 CoA binding protein ( ACBP) with hepatocyte nuclear factor24alpha (HNF24alpha ) J Biol Chem,2003,278 (51) :51813 51824 6 Faergeman N J, Knudsen J Acyl2CoA binding protein is an essential protein in mammalian cell lines Biochem J, 2002, 368 ( Pt 3) :679 682 7 Marquardt H, Todaro GJ, Shoyab M Complete amino acid sequences of bovine and human endozepines Homology with rat diazepam binding inhibitor J Biol Chem,1986, 261 (21) :9727 9731 8 Wilkinson D G, In situ hybridization In : Stern C D, Holland P W H eds Essential Development Biology : A Pratical Approach Oxford : IRL Press, 1993 : 257 274 9 Chen, W, Liang, Y, Deng W, Shimizu K, Ashique A M, Li E, Li, Y P The zinc2finger protein, CNBP, is required for forebrain development Development,2003, 130 : 1367 1379 10 Shimizu, K, Chen, W, Liang Y, Shimizu K, Deng W, Li Y P 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet
170 21 Characterization of CNBP Gene, the Gene Promoter and the Gene Expression Gene,2003, 306 :1127 1135 11, :,1985 13 ( Yu Hui2zhu, Ye Bai2kuan ed Embryonic Development on Mice Beijing : Science Press) 12 Preparation and characterization of two oligopeptides linked by a (Ma Bai2Kun, Xu Dong2Gang,Wang Jia2 Xi,Pen Shan2Yun,Li Li,Wang Li2Hong, Zou Min2Ji Construction and expression of human angiogeninπgfp fusion gene and its biological function Chin J Biochem Mol Biol), 2002,18(4) :445 449 NGF 2 (Li Xian2Hui,Chen Gui2Ying,Dou He2 Rong, Zhang Qing2Peng, Zhao Guo2Fa, Niu Yun2Tong, Li Ji2Sheng disulfide bridge with nerve growth promoting activity Chin J Biochem Mol Biol),2002,18 (4) :129 133 2004 12 28 83,,1922 11 15,1949 8,1953 6,1956 4,, ( ) 60 1987 1984, 2000,2001 2002 1987 1996 1989! 2005 3 10 1994-2006 China Academic Journal Electronic Publishing House All rights reserved http://wwwcnkinet