2011 33 3 0578-0583 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com orfh79 1 2 1 1 2 1 2 2 1. / 330031 2. / 430072 orfh79 orfh79 pet - 28a - orfh79 pgex5x - 2 - orfh79 BL21 DE3 IPTG PET - 28a - orfh79 ORFH79 pgex5x - 2 - orfh79 ORFH79 N GST orfh79 Q943 S511 A 1000-2286 2011 03-0578 - 06 Expression of a Mitochondrial Gene orfh79 from the CMS-Honglian Rice Inhibiting the Growth of Escherichia coli PENG Xiao-jue 1 2 ZHANG Jian 1 ZHU You-lin 1 WANG Kun 2 LI Shao-bo 1 LI Shao-qing 2 ZHU Ying-guo 2 1. Key Laboratory of Molecular Biology and Gene Engineering College of Life Science Nanchang University Nanchang 330031 China 2. Key MOE for Plant Developmental Biology College of Life Science Wuhan University Wuhan 430072 China Abstract orfh79 is a mitochondrial gene responsible for the cotyplasm male sterility of Honglian rice. To study the molecular mechanism of this gene the sequence of orfh79 gene was cloned into pet - 28a and pgex5x - 2 vectors respectively and then expressed in BL21 DE3 strain. The results showed that weakly expressed native ORFH79 protein that induced from the recombinant PET - 28a - orfh79 strongly inhibits the growth of E. coli. However the expression recombinant ORFH79 protein which fuses a GST protein in N - terminal in Escherichia coli doesn t impair the growth of E. coli. These results may provide a clue to get some information about the mechanism on cytoplasmic male sterility of Honglian rice. Key words rice cytoplasim male sterile orfh79 prokaryotic expression growth of E. coli cytoplasmic male sterility CMS 2010-10 - 19 2011-03 - 04 973 2007CB109005 CJJ10044 1979 E - mail xiaojuepeng @ 163. com
3 orfh79 579 1 CMS CMS CMS 14 CMS 2 T Urf13 Urf13 13 ku BmT - methomyl T BmT - methomyl 3 orf138 4 orf79 5 orf522 6 CMS 7 atp6 orfh79 coxi orfh79 orfh79 8 orfh79 orfh79 1 1. 1 pet - 28a pgex5x - 2 DH5α BL21 DE3 1. 2 T4 - DNA Takara X - gene 1. 3 PCR orfh79 Nco1 BamH1 BamH1 Xho1 PCR Nco1 5' GCC CCA TGG CAA ATC TGC TCC GAT GGC TC 3' BamH1 5' GCC GGATCCATGACA AATCTGCTCCGATGGCTC3' BamH1 5'GCCGGATCCATGACA AATCTGCTCCGATGGCTC3' Xhol1 5'GC- CCTCGAGTTACTTAGGAAAGACACG3' 25 μl dntp 0. 5 μl 10 mmol /L 200 μl /L 10 Buffer 2. 5 μl Taq 0. 2 μl 5 μ /L 1 μl 1 μl 10 μmol /L 1 μl ddh 2 O 18. 8 μl 94 5 min 94 30 s 55 30 s 72 30 s 30 72 10 min10 g /L PCR PCR 5 h 1. 4 Nco1 BamH1 pet - 28a T4 orfh79 pet - 28a BamH1 Xho1 pgex5x - 2 T4 orfh79 pgex5x - 2 DH5α 37 PCR 1. 5 pet - 28a - orfh79 pgex5x - 2 - orfh79 BL21 DE3 BL21 DE3 5 μl 5 ml Kan Amp LB 37 1 100 1 ml 20 LB 37 2
580 33 ~ 3 h OD 600 0. 6 1 100 1 mol /L IPTG 1 mmol /L IPTG 1 ml Eppendoff 37 4 h 2 h 1 ml Eppendoff pet - 28a BL21 DE3 1. 6 SDS - PAGE 100 10 min 15% 20 ma 3. 5 h 1 ~ 2 h 1. 7 6 h SDS - PAGE 1. 8 Western - blot ORFH79 San Antonio Tex USA SDS - PAGE 5% PBS ph7. 4 1 h 2 h PBS 3 10 min 1 h TBS 3 10 min NBT /BCIP 1. 9 IPTG IPTG pet - 28a - orfh79 s pet - 28a 4 LB Kan + 0 0. 5 1 1. 5 2 3 4 5 6 h 600 nm IPTG IPTG pgex5x - 2 - orfh79 pgex - 5x - 2 LB Amp pet -28a - orfh79 2 2. 1 Nco1 BamH1 BamH1 Xhol1 orfh79 pet - 28a pgex5x - 2 1 2. 2 SDS - PAGE BL21 DE3 IPTG SDS - PAGE orfh79 pgex5x - 2 2a pet - 28a ORFH79 pgex5x - 2 - orfh79 2b a b M DNA 1 pet - 28a - orfh79 2 2. 3 Western blot pgex5x - 2 - orfh79 Western - blot a Construction of recombinant prokaryotic expression vectors b Verifications of positive prokaryotic expression vectors M. Marker 1 Verifi- 3 IPTG pet - 28a - orfh79 3a PGEX5x - 2 - orfh79 3b fication of positive pgex5x - 2 - orfh79 clone by enzyme cation of positive pet - 28a - orfh79 clone by enzyme digestion 2 Veri- digestion. pgex5x - 2 - orfh79 1 Western - blot Fig. 1 Construction of prokaryotic expression vector
3 orfh79 581 3c N GST ORFH79 GST - ORFH79 a b a pgex5x - 2 - orfh79 BL21 M 1 BL21 DE3 2 IPTG BL21 DE3 3 5 6 IPTG pegx5x - orfh79 BL21 DE3 4 pegx5x - orfh79 BL21 DE3 7 IPTG pgex5x - 2 BL21 DE3 8 pgex5x - 2 BL21 DE3 pgex5x - 2 - orfh79 b a Expression of the pgex5x - 2 - orfh79 transformant in BL21 strain M Maker 1 BL21 DE3 strain 2 TPTG induced BL21 DE3 strain 3 5 6 IPTG induced pgex5x - 2 - orfh79 transformant 7 IPTG induced empty plasmid pgex5x - 2 in BL21 DE3 strain 8 Control plasmind pgex5x - 2 in BL21 DE3 strain b Solubility analysis of the recombinant protein 1 precipitate 2 supernant. 2 Fig. 2 PGEX5x - 2 - orfh79 BL21 Induced expression of fused ORFH79 protein and the solubility analysis a Western blot pet - 28a - orfh79 BL21 DE3 1 IPTG 6 h pet - 28a - orfh79 BL21 DE3 2. IPTG 6 h BL21 DE3 b Western blot pgex5x - 2-79 BL21 DE3 1 IPTG 6 h pgex5x - 2 - orfh79 BL21 DE3 2. IPTG 6 h BL21 DE3 c Western blot pgex5x - 2 - orfh79 a Western blot analysis the expression of pet - 28a - orfh79 transformant in BL21 DE3 strain. 1 pet - 28a - orfh79 transformant induced for 6 h with IPTG 2 Empty plasmid pet - 28a induced for 6 h with IPTG. b Western blot analysis the expression of pgex5x - 2 - orfh79 transformant in BL21 DE3. 1 pgex5x - 2 - orfh79 transformant induced for 6 h with IPTG 2 Empty plasmid pgex5x - 2 induced for 6 h with IPTG c Western blot analysis the supernant of pgex5x - 2 - orfh79 recombinant after ultrasonication. 2. 4 ORFH79 3 Fig. 3 Western blot ORFH79 Western blot assay the fused ORFH79 protein pet - 28a - orfh79 4a IPTG pet - 28a - orfh79 IPTG pet - 28a - orfh79 pet - 28a S100 pet -28a - s100
582 33 IPTG IPTG pet28a pgex5x - 2 - orfh79 IPTG IPTG 4b N GST ORFH79 3 a pet - 28a b pgex - 5x - 2 pets100 pet - 28a - s100 peth79 pet - 28a - orfh79 5x - 2 - h pgex5x - 2 - orfh79 + IPTG - IPTG a Gowth curve of pet - 28a - orfh79 transformants. b Growth curve of pgex5x - 2 - orfh79 transformants + Induced with IPTG - Without IPTG. 4 Fig. 4 Growth curve of orfh79 transformants 9-10 Deway T URF13 Urf13 - T 13 ku BmT - methomyl CMS 11 - - T 12 Nakai 4 Duroc 6 ORF522 Orf138 5 orf79 ORF79 Nco1 PET - 28a His OrfH79 pet - 28a - orfh7 ORFH79 Western blot pet - 28a - orfh79 ORFH79 5 orf79 T ufr13 orfh79 pet - 28a - orfh79
3 orfh79 583 13-14 orfh79 ORFH79 ATP 8 orfh79 orfh79 orfh79 pgex ORFH79 N GST GST - ORFH79 Western - blot GST - ORFH79 OR- FH79 N GST 5 orfh79 orf79 C 5 ORF79 ORFH79 N ORFH79 1 Kaul M. Male sterility in higher plants J. Theor Appl Genet 1988 10 15-95. 2 Linke B Borner T. Mitochondrial effects on flower and pollen development J. Mitochondrion 2005 5 389-402. 3 Dewey R E Siedow J N Timothy D H et al. A 13 - kilodalton maize mitochondrial protein in E. coli conferssensitivity to Bipolaris maydis toxin J. Science 1988 239 293-295. 4 Duroc Y Gaillard C Hiard S et al. Biochemical and functional characterization of ORF138 a mitochondrial protein responsible for Ogura cytoplasmic male sterility in Brassiceae J. Biochimie 2005 87 1089-1100. 5 Wang Z Zou Y Li X et al. Cytoplasmic male sterility of rice with boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mrna silencing J. Plant Cell 2006 18 676-687. 6 Nakai S Noda D Kondo M. High - level expression of a mitochondrial orf522 gene from the male - sterile sun ower is lethal to E. coli. Terachi J. T Breed Sci 1995 45 233-236. 7 Yi P Wang L Sun Q et al. Discovery of mitochondrial chimeric gene associated with male sterility of HL - rice J. Chinese Sci Bull 2002 47 744-747. 8 Peng X Wang K Hu C et al. The mitochondrial gene orfh79 plays a critical role in impairing both male gametophyte development and root growth in CMS - Honglian rice J. BMC Plant Biology 2010 10 125. 9 Hanson M R Bentolila S. Interactions of mitochondrial and nuclear genes that affect male gametophyte development J. Plant Cell 2004 16 54-169. 10 Longo E B Laun P V D Pichova A et al. Cytoplasmic male sterility A window to the world of plant mitochondrial - nuclear interactions J. Trends Genet 2007 23 81-90. 11 Dewey R E Timothy D H Levings C S. Chimeric mitochondrial gens expressed in the C male - sterile cytoplasm of maize J. Curr Genet 1991 20 475-482. 12 Levings C Siedow J. Molecular basis of disease susceptibility in the texas of maize J. Plant Mol Biol 1992 19 135-147. 13 Wan C Li S Wen L et al. Damage of oxidative stress on mitochondria during microspores development in Honglian CMS line of rice. Plant Cell Rep J. 2007 26 373-382. 14 Li S Wan C Kong J. Programmed cell death during microgenesis in a Honglian CMS line of rice is correlated with oxidative stress in mitochondria J. Funct Plant Biol 2004 31 369-376.