http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology

ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 5 32 5 578 ~ 586 DOI 10. 13865 /j. cnki. cjbmb. 2016. 05. 14 α- * 030801 α- α-melanocyte-stimulating hormone α-msh 1 melanocortin 1 receptor MC1R camp α- MSH α-msh α-msh 0 0. 1 1 10 100 1 000 nmol /L PCR Western MC1R microphthalmia-associated transcription factor MITF tyrosinase TYR 10 nmol /L α-msh mrna ELISA camp cgmp 10 nmol /L α-msh camp cgmp 10 nmol /L α-msh α-msh camp MC1R MITF TYR 10 nmol /L α-msh α- α-msh 1 MC1R MITF TYR camp S852 Effect of α-msh on Proliferation and Melanogenesis in Sheep Melanocytes HAO Xiao-Juan REN Yu-Hong * FAN Rui-Wen ZHANG Qiu-Yue ZENG Qing-Bao WU Liang-Qi College of Animal Science and Veterinary Medicine Shanxi Agricultural University Taigu 030801 Shanxi China Abstract α-melanocyte-stimulating hormone α-msh combines with melanocortin 1 receptor MC1R to affect the production and distribution of melanin by camp pathway. However the effects of different concentrations of α-msh on the melanogenesis in sheep melanocytes have not been conclusive. Here we investigated the effects of α-msh with different concentrations on the proliferation and melanin synthesis in sheep skin melanocytes. Real-time quantitative PCR and Western blot showed that gene mrna and protein expression level of MC1R microphthalmia-associated transcription factor MITF and myrosinase TYR was the highest in the melanocytes with 10 nmol /L supplementary and then decreased compared with that in the control. ELISA method detected that total yield of camp was increased and the total yield of cgmp was decreased and camp production increased and cgmp production declined with significant difference of 10 nmol / L. Enzyme labeled revealed that melanin synthesis was the highest in the melanocytes with 10 nmol /L supplementary and then decreased. The 2015-12-25 2016-03-23 No. 20140311019-3 No. XB2009022 * Tel 13513325259 E-mail renyuhong1963@ 163. com Received December 25 2015 Accepted March 23 2016 Supported by Key Project of Science and Technology of Shanxi Province No. 20140311019-3 and Doctoral Research Project of Shanxi Agricultural University No. XB2009022 * Corresponding author Tel 13513325259 E-mail renyuhong1963@ 163. com

5 α- 579 results above suggested that α-msh affected melanins production in melanocytes by regulating the camp pathway of melanogenesis with downstream of MC1R MITF and TYR genes expression and α-msh of 10 nmol / L played the most important roles in the phenotype and melanogenesis of melanocytes. Key words α-melanocyte stimulating hormone α-msh melanocyte melanocortin 1 receptor MC1R microphthalmia-associated transcription factor MITF tyrosinase TYR camp pathway α- α-melanocyte-stimulating hormone α-msh 13 α- proopiomelanocortin POMC MSH α-msh MC1R MITF TYR Thody 1 camp cgmp α-msh α-msh 1 melanocortin 1 receptor MC1R Agouti 1 MC1R α-msh 1. 1 2 MC1R 3 7 317 G α-msh Sigma MC1R α-msh α-msh Sigma DMEM G MC1R G camp Green Master Roche ELISA camp /PKA tyrosinase 7 α-msh Hyclone FastStart Universal SYBR Neweastbio StepOnePlus Real Time PCR System TYR Life Technologies Thermo 4 5 camp Leica MC1R Abcam MITF camp /PKA TYR Abcam camp camp A β-actin HRP- PKA CREB camp IgG CREB 1. 2 CBP 7 microphthalmia-associated transcription factor MITF 37 6 MITF TYR TYRP1 4 1 000 r /min 10 min TYRP2 TYR CO 2 37 α-msh α-msh α-msh 5 0. 1 1 10 α-msh 100 1 000 nmol /L α-msh 1 10 5 /ml 3 6 α-msh 3 37 5% CO 2 72 h

580 32 1. 3 RNA cdna 1. 4 PCR PBS 3 FastStart Universal SYBR Green Trizol RNA RNA Master ROX 10 μl 30 μmol /L 20 μl 5 PrimeScript Buffer 4 μl PrimeScript RT Enzyme MixⅠ1 μl Oligo dt Primer 1 μl Random 6 mers 1 μl Total RNA 1 000 ng RNase 37 15 min 85 5 s 4 Table 1 cdna 2 μl water PCR-grade20 μl 95 10 min 95 15 s 60 30 s 72 15 s 40 3 Free dh 2 O up to 20 μl PCR CT Table 1 Quantitative PCR primer sequence of target and house-keeping genes Gene Accession No Primer Sequence 5'-3' Product size MC1R NM_001282528 F GCTGGAGACGGCAGTCAT R GTACCGCAGGGCGTAGAA 181 bp MITF JN208147 F AGACCTCCTCCAGCATCACG R GAGAAAGGGTATCGTCCATGAG TYR NM_001130027 F ATGAGTACATGGGAGGTCGC R GTCGTGGTTTCCAGGATTGC β-actin U39357. 1 F TCCGTGACATCAAGGAGAAGC R CCGTGTTGGCGTAGAGGT 176 bp 170 bp 267 bp 1. 5 PBS 3 10 5 /ml 3 6 α-msh 100 μg /ml PMSF 3 37 5% CO 2 72 h 1 ml 0. 25% 200 μg 3 min 1 ml SDS-PAGE 4 1 000 r /min 10 80 V 120 V min 1 ml PBS NC 3 3 2 NC 2 PBS 100 V 150 μl 1% Tritonx-100 0. 1 mol /L HCl NC 5% TBST 10 min 1 h ELISA NC 450 nm 4 30 min TBST 10 min 3 37 1 h TBST 5 min 6 NC 1 10 5 / TBST ECL ml 3 6 24 h α- X MSH 3 37 5% CO 2 1. 6 camp cgmp 1 1. 7 CO 2 72 h 1 ml 37 5% CO 2 3 min 1 PBS 3 3 37 PBS 0. 2 mol /L 1 min NaOH 1. 5 4 1 ml EP 80 5 min 000 r /min 10 min 96 100 μl 3 0. 2 mol /L NaOH

5 α- 581 475 nm 0. 1 ~ 10 nmol /L 100 1. 8 2 - CT mrna Fig. 1B C D E F β 2. 2 α-msh NC Marker MC1R MITF TYR Image J qrt-pcr α-msh MC1R = MITF TYR camp cgmp α-msh 10 nmol /L MC1R mrna ± Means ± SE 1. 89 P < 0. 051 SPSS17. 0 nmol /L 10 nmol /L MITF mrna 2 2. 1 α-msh 1 000 nmol /L TYR mrna α-msh 72 h P < 0. 01 α-msh α-msh Fig. 1A α- Fig. 2A MSH 72 h B C ~ 1 000 nmol /L 2. 34 3. 12 P < 0. 011 nmol /L 10 nmol /L 100 nmol /L 3. 24 3. 60 3. 15 2. 62 Fig. 1 The effect of different concentrations of α-msh on morphology of ovine melanocytes cultured for 72 hours α-msh was added in cultured melanocytes of ovine in vitro to the concentrations of 0 A 0. 1 B 1 C 10 D 100 E and 1 000 F nmol /L respectively. After cultured for additional 72 hours cell morphology were observed under inverted microscope. Bar = 100 μm Dendrites

582 32 Fig. 2 The relative mrna expression of MC1R MITF and TYR genes in melanocytes treated by different concentrations of α-msh α-msh was added in cultured melanocytes of ovine in vitro to the concentrations of 0 0. 1 1 10 100 and 1 000 nmol /L respectively. After cultured for additional 72 hours cells were collected and the relative mrna expression of the MC1R A MITF B and TYR C genes were determined by real-time quantitative PCR. Data present mean ± SE n = 3. * P < 0. 05 ** P < 0. 01 2. 3 α-msh camp cgmp MC1R MITF TYR Western Fig. 3 α-msh 1 nmol /L 10 nmol /L 100 nmol /L MC1R camp cgmp α-msh 10 1. 34 1. 69 1. 23 nmol /L camp Fig. 4A P < 0. 01 1 nmol /L 10 nmol /L 100 nmol /L MITF 1. 34 Fig. 4B 0. 46 P 1. 51 1. 48 P < 0. 01 1 nmol /L 10 nmol /L 100 nmol /L 1 000 nmol /L TYR 1. 27 1. 39 1. 25 1. 20 P < 0. 01 α-msh 5 α-msh α-msh Fig. 5 α-msh 0. 1 nmol /L ELISA camp cgmp α-msh 1. 37 P < 0. 01 cgmp < 0. 01 2. 5 α-msh 1 nmol /L 2. 4 α-msh 2. 44

5 α- 583 Fig. 3 The relative protein expression of the MC1R MITF and TYR genes in melanocytes treated by different concentrations of α-msh A α-msh was added in cultured melanocytes of ovine in vitro to the concentrations of 0 0. 1 1 10 100 and 1 000 nmol / L respectively. After cultured for additional 72 hours cells were collected. The proteins in lysates were separated by 10% or 12% SDS-PAGE. After transferring onto the membrane the blots were probed with anti-mc1r anti-mitf anti-tyr antibodies. β-actin was used as a control. The relative protein expression of the MC1R B MITF C and TYR D genes were analyzed by density analysis. Data present mean ± SE n = 3. * P < 0. 05 ** P < 0. 01 P < 0. 05 10 nmol /L α-msh 2. 55 P < 0. 01 100 nmol /L 2. 35 P < 0. 05 1 000 nmol /L 100 nmol /L Wakamatsu 9 α-msh α-msh Suzuki 10 α-msh MC1R 3 α-msh 3. 1 α-msh α-msh 8 α-msh

584 32 Fig. 4 Effect on camp and cgmp production of different concentrations of α-msh treatment on ovine melanocytes α-msh was added in cultured melanocytes of ovine in vitro to the concentrations of 0 0. 1 1 10 100 and 1 000 nmol / L respectively. After cultured for additional 72 hours cells were harvested and camp A and cgmp B production in melanocytes were measured by the method of ELISA. Data present mean ± SE n = 3. * P < 0. 05 ** P < 0. 01 12 α- MSH α-msh 10 nmol /L 3. 2 α-msh camp Fig. 5 Melanin synthesis of ovine melanocytes induced by different concentrations of α-msh α-msh was added in MC1R camp cultured melanocytes of ovine in vitro to the concentrations of 13 14 0 0. 1 1 10 100 and 1 000 nmol / L respectively. After α-msh cultured for additional 72 hours cells were harvested. The camp MC1R same amount ovine melanocytes were lysed in NaOH 0. 2 mol / cgmp α-msh L at 80 for 5 min. The melanin production in melanocytes camp cgmp α-msh MC1R was measured by the spectrophotometer at 475 nm. Data present camp mean ± SE n = 3. * P < 0. 05 ** P < 0. 01 camp cgmp 10 nmol /L α-msh camp cgmp α-msh camp cgmp 10 nmol /L α-msh α-msh camp A PKA 11 MC1R MITF 15 MITF MC1R 16 Saito 6

5 α- 585 camp MITF α-msh α-msh camp ASP Agouti Agouti MITF 10 nmol / α-msh MC1R MC1R L α-msh MITF camp camp TYR TYRP1 TYRP2 MITF 3 Abdel-Malek TYR TRP1 TRP2 17 α-msh ACTH α-msh 10 nmol /L α-msh TYR camp /PKA TYRP1 TYRP2 α-msh α-msh References α-msh 1 Thody AJ Ridley K Penny RJ in mammalian skin J. Peptides 1983 4 6 813-816 10 nmol /L TYR 2 Maresca V Flori E Bellei B 3. 3 α-msh periphery and dendrites J 23 2 263-275 3 Veier d MB Adami HO Lund E et al. 18 Kanetsky 19 Cardinli 20 characteristics and nevi J α-msh Prev 2010 19 1 111-120 21 α-msh pollinosis in a pollen allergy mouse model J Immunol 2010 153 1 13-18 α- 5 Yamaguchi Y Hearing VJ. MSH skin pigmentation J. Biofactors 2009 35 2 193-199 α-msh α-msh Pigment Cell Res 2003 16 3 261-265 10 nmol /L α- 7 J Progress in the study of melanocytes J MSH Med 2000 9 3 174-176 α-msh MC1R camp /PKA types J. PLoS One 2014 9 12 e1151717 α-msh MC1R camp MITF TYR melanocortin-1 receptor J 288-297 α-msh 10 Suzuki I Cone RD Im S et al. camp MC1R MITF TYR 10 Endocrinology 1996 137 5 1627-1633 nmol /L α-msh 11 α-msh J. α-msh camp PKA and canine coat color J et al. MSH peptides are present et al. MC1R stimulation by alpha- MSH induces catalase and promotes its re-distribution to the cell. Pigment Cell Melanoma Res 2010 Sun and solarium exposure and melanoma risk effects of age pigmentary. Cancer Epidemiol Biomarkers 4 Hiramoto K Hashimoto M Orita K et al. Alpha-melanocytestimulating hormone plays an important role in the onset of. Int Arch Allergy Physiological factors that regulate 6 Saito H Yasumoto K Takeda K et al. Microphthalmiaassociated transcription factor in the Wnt signaling pathway J.. Zhang LX.. Chin J Aesthetic 8 Reemann P Reimann E Ilmj rv S et al. Melanocytes in the skin-comparative whole transcriptome analysis of main skin cell 9 Wakamatsu K Graham A Cook D et al. Characterisation of ACTH peptides in human skin and their activation of the. Pigment Cell Res 1997 10 5 Binding of melanotropic hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis J.. 1 MC1R Yang QY Ye JH Ren J et al. Melanocortin 1 receptor MC1R gene phylogenetic tree. Hreditas 2006 28 3 357-361

586 32 12 Wu X Hammer JA. Melanosome transfer it is best to give and receive J. Curr Opin Cell Biol 2014 29 1 1-7 13 Wu DTs Chen JS Chang DC et al. Mir-434-5p mediates skin whitening and lightening J. Clin Cosmet Investig Dermatol 2008 1 19-35 14 Busc à R Ballotti R. Cyclic AMP a key messenger in the regulation of skin pigmentation J. Pigment Cell Res 2000 13 2 60-69 15 Roesler WJ Park EA Mcfie PJ. Characterization of CCAAT / enhancer-binding protein alpha as a cyclic AMP-responsive nuclear regulator J. J Biol Chem 1998 273 24 14950-14957 16 Kondo T Hearing VJ. Update on the regulation of mammalian melanocyte function and skin pigmentation J. Expert Rev Dermatol 2011 6 1 97-108 17 Abdel-Malek Z Swope VB Suzuki I et al. Mitogenic and melanogenic stimulation of normal human melanocytes by melanotropic peptides J. Proc Natl Acad Sci U S A 1995 92 5 1789-1793 18 Simon JD Peles DN. The red and the black J. Acc Chem Res 2010 43 11 1452-1460 19 Kanetsky PA Swoyer J Panossian S et al. A polymorphism in the agouti signaling protein gene is associated with human pigmentation J. Am J Hum Genet 2002 70 3 770-775 20 Cardinali G Ceccarelli S Kovacs D et al. Keratinocyte growth factor promotes melanosome transfer to keratinocytes J. J Invest Dermatol 2005 125 6 1190-1199 21. α-msh J. Yu ZH Bai R Fan RW et al. Effect of α-msh on proliferation and melanin synthesis of alpaca skin melanocytes in vitro J. Acta Vet Zootech Sin 2010 41 9 1095-1101