Molecular Cloning of MUC1ΠY and Soluble Expression of Its

ISSN 100727626 CN 1123870ΠQ 2001 10 Chinese Journal of Biochemistry and Molecular Biology 17 (5) :579 584 MUC1ΠY, 3, ( 100039) MUC1ΠY cdna, RT2PCR HeLa MUC1ΠY cdna ;PCR, p GEX22T DH5a ; ; GST N ; MUC1ΠY cdna 759 bp, GenBank (AF125525) 9 bp 331 G2A 40 kd GST2Yex, 25 % 30 % 70 % 80 % > 90 %,GST 0121 UΠ g N ELISA 1 250 000, MUC1ΠY cdna MUC1ΠY MUC1ΠY Q78,Q513 Molecular Cloning of MUC1ΠY and Soluble Expression of Its :2000211229 :2001201219 (No 39830330) 3 Tel :010266931773,Fax :010-66931773,E2mail :Lich @nic bmi ac cn,1969 5 Received :November 29, 2000 ;Accepted :January 19,2001 Supported by National Natural Science Fundation of China,No 39830330 Extra2cellular Fragment in E coli ZHANGLi2xin, LI Chun2hai 3 3 Correspondence author Tel :010266931773,Fax :010266931773,E2mail :Lich @nic bmi ac cn, SUN Li2ya ( Department of Tumor Molecular Biology, Beijing North Taiping Hospital and Beijing Institute of Basic Medical Sciences, Beijing 100039, China) Abstract To clone MUC1ΠYfull length cdna and express and purify its extra2cellular fragment protein from E coli for further functional and tumor therapeutic research purposes MUC1ΠY cdna was amplified by RT2 PCR from HeLa cells and cloned into p GEM2T for sequence analysis MUC1ΠY extra2celluar fragment (MUC1Π Yex) was then amplified by PCR and cloned into p GEX22T fusion expression vector E coli DH5 was trans2 formed with the new constructed expression vector p GEX2Yex and induced by IPTG The fusion protein GST2 Yex was purified by affinity column and identified by thrombin digestion, GST activity and N2terminal protein sequencing Polyclonal antibody was prepared by immunizing rabbits The results showed that the open reading frame (ORF) of MUC1ΠY cdna from HeLa cells consisted of 759 bp with a 9 bp deletion in its signal peptide2 coding region and a G to A transition at the site of 331 bp which caused a V to M amino acid mutation ( Gen2 Bank access number AF125525) The expressed fusion protein GST2Tex was about 40 kd which was 25 % - 30 % of total host proteins 70 % - 80 % of the GST2Yex proteins existed as soluble ones and after one2step af2 finity purification the purity of GST2Yex was over 90 % with 0121 UΠ g GST activity MUC1ΠYex protein can be

580 17 cleaved from GST2Yex and N2terminal protein sequencing confirmed that is was consistent with the sequence published The titer of polyserum generated was 1 250 000 by ELISA In conclusion,muc1πy full length cd2 NA was cloned MUC1ΠYex protein and its polyclonal antibody were obtained for further research purposes Key words MUC1ΠY, clone, expression,purification MUC1 ( MUC1) ( > GGCGACGTGCCCCTACAAGT 3 P3 :5 CG2 205 kd) : GATCCACAGGTTCTGGTCAT 3, P4 : 5 1) 20 125 (variable GAATTCTTACCCAGCCCCAGACTG 3 P12P2 numbers of tandem repeats,vntrs) VNTR 20 Pro,Ser Thr ;2) P3 5 BamH,P4 50 % O VN2 5 Eco R HeLa TRs SerΠThr,MUC1 RNA :3 l (114 gπ l) RNA,1 [1 3, ] l P2,70,10 min 5 min 4 l 5, MUC1ΠY MUC1 MUC1 VNTRs [4 ] 60 min,95,5min P12P2 PCR,MUC1ΠY : 94 5 min ; 94,1 min,63,1 min, [4,5 ] MUC1ΠY 72,2 min 30 p GEM2T [6,7 ] ras, P32P4 MUC1ΠY, (MUC1ΠYex) cdna : 94,5 min ; 94,30 s ; 68,30 MUC1ΠY s ;72,45 s ; 25 [8 ],MUC1ΠY 11212 PCR P1 - P2, p GEM2T MUC1ΠY, JM109, LB 37 TaKaRa ( ) 1 11213 MUC1ΠYex P3 - P4 111 11111 HeLa Eco R DH5 JM109 ; GST p GEX2 p GEX22T 2T Pharmacia ;p GEM2T Promega p GEX2Yex ( Fig 1), DH5 11112 Trizol RNA GIBCOL, Ex Taq TaKaRa,DNA PCR AMV RNasin UP 200s Dr Hielscher GmbH,Photometer 4010 Boehringer Mannheim 5 10 min,15 %SDS2PAGE 112 11211 RT2PCR MUC1ΠY cdna, PCGENE : P1 :5 CTC2 CCCACCCATTTCACCAG 3, P2 : 5 MUC1ΠY cdna,p32p4 MUC1ΠY 5 l dntp,1 l AMV,1 l RNasin,5 l,42, p GEM2T, Bam H TaKaRa ( ) 11214 MUC1ΠYex p GEX2Yex DH5 LB Promega,PCR markers (100 mgπl ),37 1 10,IPTG X2gal Sigma LB (100 mgπl ), 11113 Gene Amp PCR System 2400 PE 37 A 600 016 IPTG 011 110 mmolπl 1 5 h 100 l 20 l 11215 MUC1ΠY 37 25 30 11216

5 : MUC1ΠY 581 GST2Yex 3 4 1 3 ELISA GST GST 2 211 MUC1ΠY cdna P12P2 HeLa RNA DNA ( Fig 2) 795 bp 759 bp (Fig 3) 3 9 bp ; 331 G A (V) (M) MUC1ΠY cdna GenBank(AF125525) Fig 2 RT2PCR of MUC1ΠY cdna from HeLa cell 1 DNA markers ; 2 MUC1ΠY Fig 1 Construction of MUC1ΠYex fusion expression vector p GEX2 Yex PBS ( 16 mmolπl Na 2 HPO 4, 4 mmolπl NaH 2 PO 4, 150 mmolπl NaCl,pH 714) 2, p GEX22T, p GEX2 Triton X2100 1 % 35 000 g,4 40 min Glutathione Sepharose 4B GST2Yex 11217 GST : 10 l GST2Yex 2199 ml (214 ml 01125 mmolπl K 2 HPO 4,pH 615,0139 ml H 2 O,011 ml 30 mmolπl GSH,011 ml 30 mmolπl CDNB),25 40 kd 1 min, 2 min 3 min A 340, ; p GEX22T 26 kd 31125 GST : GST (UΠ g) = ( Fig 4) IPTG (011 012 014 016 ( - ) 10Π ( g) 018 110 mmolπl) GST2Yex,SDS2PAGE N 212 MUC1ΠY MUC1ΠY cdna P32P4 418 bp MUC1ΠY cdna p GEM2T, Bam H Eco R, Yex DNA,p GEX2Yex 213 GST2Yex p GEX22T p GEX2Yex DH5 012 mmolπl IPTG 37 1 2 3 4 5 h SDS2PAGE,p GEX2Yex 37 11218 MUC1ΠY 100 gπml SDS2PAGE

582 17 Fig 3 Nucleotide sequence of cloned HeLa MUC1ΠY cdna Signal peptide is underlined and transmembrane region is marked by shadowed area,potential N2glycocylate site is indicated by asterisk, 30 kd ( GST) 15 kd( Yex) (Fig 6A) 25,012 mmolπl IPTG 30 GST(Fig 6B) MUC1ΠY ; 15 (70 % 80 %) ( Fig 5) kd N, GSTGS2 25 % 30 % GHASS, G S Bam H 8 MUC1ΠY N Fig 4 Induction of protein expression of p GEX2YexΠDH5 1 Protein markers ; 2 p GEX2YexΠDH5 without induction ; 3 7 Induced p GEX2YexΠDH5 ; 8 Induced p GEX22TΠDH5 214 GST2Yex Fig 5 Effect of induction temperature on the solubility of GST2Yex 1 Soluble proteins ; 2 Inclusion body Glutathione2 215 MUC1ΠY Sepharose 4B, 40 kd, > 1 250 000 90 % GST 0121 UΠ g ; GST GST, ( GST2Yex),SDS2PAGE 26 ELISA MUC1ΠYex

5 : MUC1ΠY 583 Fig 6 Affinity purification and enzyme digestion of GST2Yex 1,5 Protein markers ; 2,4 Affinity purified GST2Yex ; 3 Thrombin digested GST2Yex ; 6 Affinity purified GST V2 M V M [4 ] MUC1ΠY, MUC1ΠY cdna, ; p GEX22T [11 ], p GEX, : (1) ; (2) ; (3), GST MUC1ΠYex, 14 15 kd 3 PEST [ KET2 SATQR(32 39), REGTINVH (105 112), KTEAASR (122 128) ] [12 ],MUC1Π Yex [13 ] 3 (Pichia pastoris) MUC1 1q21 [9 ] (3 5 d), mrna p GEX22T GST MUC1 5 MUC1ΠYex MUC1ΠREP,MUC1ΠSEC,MUC1ΠX [8 ],MUC1ΠY MUC1ΠZ [10 ] MUC1ΠREP MUC1ΠSEC p GEX22T VNTRs, MUC1, ; MUC1ΠX MUC1ΠY MUC1ΠZ [14 ] VNTRs 5, [15 IPTG ] MUC1ΠY MUC1ΠY DNA p GEX22T DH5 IPTG GST2Yex MUC1ΠY 25 % 30 %, GST2Yex,,30 37, MUC1ΠY HeLa 30 > 25 > 37 [8 ] RT2PCR HeLa [4 ] MUC1ΠY cdna IPTG, GST2Yex GST2Yex MUC1ΠY

584 17 [5 ] MUC1ΠY, N2 MUC1ΠY MUC1ΠY ( References) and tumor2associated mucin glycoproteins expressed by human mammary 1 Taylor2Papadimitriou J,Finn O J Biology,biochemistry and immunology epithelium Proc Natl Acad Sci USA,1987,84(17) :6060 6064 of carcinoma2associated mucins Immunol Today,1997,18 (3) : 105 10 Oosterkamp H M,Scheiner L,Stefanova M C,Lloyd K O,Finstad C L 107 Comparison of MUC21 mucin expression in epithelial and nonepithelial 2 MUC1 ( Zhang Li2xin,Li Chun2 hai Immunological functions and its application in cancer biotherapy of MUC1 Chin J Cancer Biotherapy),2000,7(3) :165 170 3 Agrawal B,Gendler S J,Longenecker B M The biological role of mucins in cellular interactions and immune regulation :prospects for cancer im2 munotherapy Mol Med Today,1998,4 (9) :397 403 4 Zrihan2licht S,Vos H L,Baruch A, Elroy2stein O,Sagiv D, Keydar I, Hilkins J,Wreschner D H Characterization and molecular cloning of a novel MUC1 protein, devoid of tandem repeats, expressed in human breast cancer tissue Eur J Biochem,1994,224(2) :787 795 5 Hartman M,Baruch A,Ron I,Aderet Y,Yoeli M,Saggi2Assif O, Green2 stein S,Stadler Y,Weiss M,Yaakubovits M,Keydar I,Smorodinsky N I, Wreschner D H MUC1 isoform specific monoclonal antibody 6E6Π2 de2 tects preferential expression of the novel MUC1ΠY protein in breast and ovarian cancer Int J Cancer,1999,82 (2) :256 267 6 Zrihan2licht S,Baruch A, Elroy2stein O, Keydar I,Wreschner D H Ty2 rosine phosphorylation of MUC1 breast cancer membrane proteins2cyto2 kine receptor2like molecules FEBS Lett,1994,356(1) :130 136 7 Pandey P, Kharbanda S, Kufe D Association of the DF3ΠMUC1 breast cancer antigen with Grb2 and SosΠRas exchange protein Cancer Res, 1995,55(18) :4000 4003 8 Baruch A,Hartman M,Zrihan2licht S, Greenstein S,Burstein M, Keydar I,Weiss M,Smorodinsky NI,Wreschner D H Preferential expression of novel MUC1 tumor antigen isoforms in human epithelial tumors and their tumor potentiation function Int J Cancer,1997,71 (5) :741 749 9 Gendler S J,Burchell J M,Duhig T,Lamport D,White R, Parker M, Taylor2Papadimitriou J Cloning of partial cdna encoding differentiation cancer cell lines and demonstration of a new short variant form (MUC1Π Z) Int J Cancer,1997,72 (1) :87 94 11 Smith D B,Johnson K S Single step purification of polypetides expressed in Escherichia coli as fusions with glutathione S2transferase Gene,1998, 67 (1) :31 40 12 Rodgers S,Wells R,Rechsteiner M Amino Acid Sequences Common to Rapidly Degraded Proteins : The PEST Hypothesis Science, 1986, 234 (4774) :364 368 13 Zhang L X,Li C H,Sun L Y Cloning of MUC1ΠYfull length cdna and secrete expression of its extracellular fragment in P pastoris J Tumor Marker Oncol,2000,15(1) :32 33 14 Frangioni J V,Neel B G Solubilization and purification of enzymatically active glutathione S2transferase (pgex) fusion protein Anal Biochem, 1993,210(1) :179 187 15 Saluta M,Bell P A Troubleshooting GST2fusion protein expression in E coli Life Science News, 1997, issue 1, http : www apbiotech comπ productπpublicationπlsnπlsn2127πlsn2127 htm www bcmb net cn shxb @mail bjmu edu cn 2001 10