,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78

Transcript

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 18 (2) : HLA2B ) ( 2) ) HLA2B HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B % F0 HLA2B % F0 F HLA2B2704 mrna HLA2B HLA2 B2704 HLA2B2704 Q33 Q78 The Technique of Producing HLA2B2704 Gene Transgenic Mice CHEN Zhan2kun LΒ Hou2shan 3 J IANG Dong2fang WANG Dong AI Jing DING Hai2ming WANG Shen2wu 2) ( Arthritis Research Cencer 2) Central Laboratory Peking University People s Hospital Beijing China) Abstract To produce HLA2B2704 transgenic mice by microinjection 286 Kunming female mice were induced to give superovulation by injecting hormone The fertilized eggs were collected and microinjected with genomic DNA fragment containing HLA2B2704 DNA into their pronucleus After microinjection the survial and two2cell fertilized eggs were implanted into the oviducts of pseudopregnant female mice to let them develop and produce progeny The intergration of the target gene in F0 and F1 mice was analyzed by PCR The expression of HLA2 B2704 transgene at mrna level was comfirmed by RT2PCR fertilized eggs were collected of them were microinjected The number of survial and two2cell eggs was after microinjection The survial rate was 6417 % These eggs were implanted into 153 pseudopregnant female mice 26 of which were pregnant and 101 offsprings were obtained at last PCR analysis showed that genomes of 10 F0 transgenic mice were integrated with the HLA2B2704 gene The integration rate was 919 % Among 78 F1 of positive F0 transgenic mice 15 F1 mice carried the HLA2B2704 gene HLA2B2704 gene was expressed at the mrna level in skin colon testicle and spleen tissues of the transgenic mice In the positive HLA2B2704 transgenic mice six mice were detersile One mouse showed tumescent at podosoma and toes Two mice appeared photophobia One mouse arised diar2 : : (No ) 3 Tel : Tel : (010) Received :August ;Accepted :October Supported by National Natural Science Foundation of China No Corresponding author Tel : (010)

2 rhea The transgenic mice carrying the HLA2B2704 genotype and phenotype were produced successfully Key words transgene HLA2B2704 gene mice microinjection 1980 Gordon [1 ] 30 lπ gπml HSV2TK [4 ] ( HLA2B2704 [2 ] : g 4 5 ; d (2) : HLA2B IU PMS 46 h HLA2B IU HCG 1 1 (3) :6 8 ( 30 g ) ( 6 8 : 8 :00 30 min PMS ( ) ml ; (c) M16 20 ; (d) HCG( ) l M2 HLA2B2704 pbr % ( ) AutΩnoma Castro 1 cm M2 M16 SINGMA [3 ] DIAPHOT PBS PN230 TRANSTOMER SN MICRO2 10 g L l ( 013 g FORGE MF290 BURNER L - 1 ) 10 NIKON CO 2 ( SANYO) G GD21 (NARISHIGE) PCR (PE2480) HLA2B2704 DNA 9 M2 9 (3) :M2 HLA2B2704 DNA pbr322 EcoR M16 CO h 8 g L V 5 h 615 kb HLA2B2704 DNA Agarose Gel DNA Extraction kit (QIAGEN) DNA 20 : : ( (1 ( Fig 1 4 ) 2 ; (2) 2 ; (3) 1Π10 2 mol L - 1 NaCl 3-20 ; (4) 70 % ( ) 2 ; (5) [ 7 mmol L - 1 Tris (ph 714) 0115 mmol L CO 2 : (a) PBS 115 ml ; ( b) M2 2 5 min (2) : M2 4 (4) : 13 : EDTA] DNA ; (6) DNA ; (7) 0122 m M16

3 2 : HLA2B CO h 20 g L - 1 (5) : RT2PCR HLA2B2704 mrna 75 %( ) ( RNA : 015 cm 018 cm 018 HLA2B2704 cm Trizol Reagent ; (2) RT2PCR : HLA2B bp :5 2GGGTCTCACAC2 CCTCCAGAAT23 : 5 2CGGCGGTCCAGGAGCT2 3 : min 96 2 min :M2 M2 30 M2 (96 30 s 65 1 min s) min ( ; (2) ; (3) 1 ; (4) Table % Table 1 Number of used kunming mice and collected eggs per month Fig 1 A microinjection pipette was inserted into the male pronu2 cleus of a fertilized egg for injecting DNA solution (Light field 40 ) Month Number of injected kunming mice (a) Number of mating (b) bπa ( %) Number Number of collected of injectable egg(c) eggs(d) dπc ( %) ( DNA F0 F1 3 4 DNA ; 2 mm 200 l PCR ( nonionic detergents PBND) 115 ml ; l 10 g L - 1 K 55 3 h ; d min K; 50 l PCR 2 l DNA (2) PCR : Dominguez HLA2B d bp 3 5 2GGGTCTCACACCCTCCAGAAT CGGCGGTCCAGGAGCT23 PCR : 213 PCR 97 2 min ( s F0 HLA2B2704 DNA Fig F s s) % F min 10 l PCR F1

4 HLA2B2704 mrna Fig 3 Fig 2 Integration detection of HLA2B2704 gene by PCR in transgenic mice M:100 bp DNA ladder ; 1 2 :Negative control (genomic DNA of normal mice) ;3 4 : Genomic DNA of HLA2B2704 transgenic mice ; 5 : Positive control ( human genomic DNA containing HLA2B27 gene) ;6 :Blank control Fig 3 Tissue specific expression of HLA2B2704 gene by RT2PCR analysis M:100 bp DNA ladder ; : Total mrna extracted from co2 lon skin testicle and spleen of positive mice ;5 :Positive control (to2 tal mrna extracted from HLA2B27 positive human white blood cell) ; 6 : Negative control ( total mrna extracted from spleen of normal mice) ; 7 :Blank control 6 3 [5 ] 1 3 : 00 PM PMS 3 1 :00 2 :00 PM HCG 4 8 :00 AM ( HCG 215 ; (2) ( : 6 4 : :10 d 2 1 Table 1 2 :10 d 8 (2) :1 (3) : 2 (4) : : HLA2B ( PN230) 2 1 2

5 2 : HLA2B HLA2B2704 HLA2B2704 DNA HLA2B2704 ( References) DNA 210 gπml 1 3 pl 3515 % Pinkert [6 10 % ] :M2 M2 30 M2 : ( ; (2) ; (3) 1 Gordon J W Scangos G A Plotkin D J Genetic transformation of mouse embryos by microinjection of purified DNA Proc Natl Acad Sci : HLA2B27 (Lin Jian2hao L Hou2shan Chen Zhan2kun Jiang Dong2 fang Wang Shen2wu Feng Chuan2han Ankylosing spondylitis and HLA2 B27 subtypes :A disease2related research in Chinese Han nationality J Beijing Med Univ) (5) : Hogan B Beddington R Costantini F et al Manipulating the Mouse Embyro : A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Press 1994 : : ( Tian Xiao2li Chen Lan2ying Hu Rong2li2 ang(eds) : Principle Technology and Application of Transgenic Animal Jilin :Jilin Press of Science and Technology) 1994 : Ryan T M Townes T M Reibly M P et al Human sickle hemoglobin in2 transgenimice Science : Pinkert C A Transgenic Animal Technology : A Laboratory Handbook San Diego :Academic Press Inc 1994 :