Methods for the Study of Virus Receptors
|
|
- Δωρίς Καραμήτσος
- 6 χρόνια πριν
- Προβολές:
Transcript
1 VIROLOGICA SINICA March 2006 * **, Methods for the Study of Virus Receptors DING Tian-bing ** REN Jun-ping MA Wen-yu (Department of Microbiology, The Fourth Military Medical University, Xi an, Shaanxi , China) Q7 A (2006) [1] HIV CD4CD46 DAF ICAM-1 EB CD21 CD134 [2~4] 1 Integrin 8 16 A HIV-1 CD46 6 Ad3, 11, 35, 37 [5,6] 16 6 HHV6CD46 HCV LDL-R CD81 [7] Rotavirus sialic acid, SA α2β1 [8] [9] 1 Table 1 Cell surface molecules acting as viral receptors HIV CD4, T CD46 EB CD21 B CD54 ICAM-I ECHO CD55 DAF CD49b β1 CD13 CD13 * ** Correspoding allthor. Tel: ; dingtb@fmmu.edu.cn
2 ng [10] HCV RNA LDL-R HCV LDL-R HCV [11~13] 2.2 Viral attachment protein, VAPSepherose4B [14] 2.3 CD4 HIV [15] CD46 [6] Dorig CD46 [16] [17, 18] 2.4 Jerne VAP Sindbis [19, 20] VOPBA 2.5 Virus overlay protein-binding assay VOPBA SDS-PAGE kD 67kD [21] VOPBA 3 cdna 3.1
3 ,. -6 L1 B PIII PIV PV PVII PVIIIPIII PVIII N PIII PVIII VAP - PCR Hong [23] DNA 3.2 cdna cdna [24] cdna VAP Rebecca [25] cdna β- X-Gal 3.3 Jeffrey [26] cdna 3.4 (Coimmunoprecipitation, Co-IP) X Y XY X A-SepharoseAgarose SDS-PAGEY Western Y SARS [27] 3.5 GST GST Pull-down GST Glutathione S transferase GSTGTH Glutathione VAP HBV [28] GST- VAP GTH-Sepharose GST GST affinity column chromatography GST- GTH-Sepharose GTH GST pull down GST GST Pull-down GST 3.6 DNA BD AD BD AD BD AD BD
4 [29] 2 Fig.2 Schema of double hybridization in yeast BD bait AD prey HIS3 URA3 LacZ ADE2 BDGAL4 LexABD [30] prey VAP bait cdna Ras recruitment system RRS 3.7 Mass Spectrometry 0.1Da Gaggar Ad35 VAP CD46 [31] TioVOPBA laminin receptor I [32] HSP90 HSP70 4 [33] Surface plasmon resonance, SPR Tandem affinity purification TAP TAP E References [1] Rajcani J. Molecular mechanisms of virus spread and virion components as tools of virulence [J]. Acta Microbiol Immunol Hung, 2003, 50 (4): [2] Schneider-Schaulies J. Cellular receptors for viruses: links to tropism and pathogenesis [J]. J Gen Virol, 2000, 81(Part6): [3] Mettenleiter T C. Brief overview on cellular virus receptors [J]. Virus Res, 2002; 82(1-2): 3-8. [4] Shimojima, Miyazawa T, Ikeda Y, et al. Use of CD134 as a primary receptor by the feline immunodeficiency virus [J]. Science, 2004, 303 (5661): [5] Cattaneo R. Four viruses, two bacteria, and one receptor: membrane cofactor protein (CD46) as pathogens' magnet [J]. J Virol, 2004, 78 (9): [6] Maurer K, Krey T, Moennig V, et al. CD46 is a cellular receptor for bovine viral diarrhea virus [J]. J Virol, 2004, 78 (4): [7] Masciopinto F, Campagnoli S, Abrignani S, et al. The small
5 ,. -6 L1 B- 193 extracellular loop of CD81 is necessary for optimal surface expression of the large loop, a putative HCV receptor [J]. Virus Research, 2001, 80 (1-2): [8] Arias C F, Isa P, Guerrero A, et al. Molecular biology of rotavirus cell entry [J]. Arch Med Res, 2002, 33 (4): [9] Jackson T, King A M, Stuart D I, et al. Structure and receptor binding. Virus Res, 2003, 91 (1): [10] Pandey A and Mann M. Proteomics to study genes and genomes [J]. Nature, 2000, 405: [11] Thomssen R, Bonk S, Propfe C, et al. Association of hepatitis C virus in human sera with β-lipoprotein [J]. Med Microbiol Immunol, 1992, 181 (5): [12] Monazahian M, Böhme I, Bonk S, et al. Low density lipoprotein receptor as a candidate receptor for hepatitis C virus [J]. J Med Virol, 1999, 57 (3): [13] Agnello V, Abel G, Elfahal M, et al. Hepatitis C virus and other Flaviviridae viruses enter cells via low density lipoprotein receptor [J]. Proc Nat Acad Sci USA, 1999, 96 (22): [14] Dalziel R G, Hopkins J, Watt N J, et al. Identification of a putative cellular receptor for the lentivirus visna virus [J]. J Gen Virol, 1991, 72 (Pt8): [15] Dalgleish A G, Beverley P C L, Clapham P R, et al. The CD4 antigen is an essential component of the receptor for the AIDS retrovirus[j]. Nature, 1984, 312: [16] Dorig R E, Marcil A, Chopra A, et al. The human CD46 molecule is a receptor for measles virus (Edmonston strain) [J]. Cell, 1993, 75 (2): [17] Yeager C L, Ashmun R A, Williams RK, et al. Human aminopeptidase N is a receptor for human coronavirus 229 E [J]. Nature, 1992; 357: [18] Naniche D, Varior-Krishnan G, Cervoni F, et al. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus [J]. J Virol, 1993, 67 (10): [19] Hanham C A, Zhao F S, Tignor G H. Evidence from the anti-idiotypic network that the acetylcholine receptor is a rabies virus receptor [J]. J Virol, 1993; 67(1): [20] Wang K S, Schmaljohn A L, Kuhn R J, et al. Anti-idiotypic 1991; 181 (2); [21] Salas-Benito J S, Del-Angel R M. Identification of two surface proteins from C6/36 cells that bind Dengue type 4 virus [J]. J Virol, 1997, 71(10): [22] Wu E, Trauger S A, Pache L, et al. Membrane cofactor protein is a receptor for adenoviruses associated with epidemic keratoc onjunctivitis [J]. J Virol, 2004, 78 (8): [23] Hong S S, Karayan L, Tournier J, et al. Adenovirus type 5 fiber knob binds to MHC class I α2 domain at the surface of human epithelial and B lymphoblastoid cells [J]. EMBO J, 1997, 16(9): [24] Sirena D, Lilienfeld B, Eisenhut M, et al. The human membrane cofactor CD46 is a receptor for the species B adenovirus serotype 3[J]. J Virol, 2004, 78(9): [25] Montgomery R I, Warner M S, Lum B J, et al. Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family [J]. Cell, 1996, 87 (3): [26] Grave J M, Davis G, Meyer A M, et al. The major human rhinovirus receptor is ICAM-1 [J]. Cell, 1989, 56 (5): [27] Li W H, Moore M J, Vasilieva N, et al. Angiotensin-converting enzyme 2 is a functional receptor for SARS coronavirus [J]. Nature, 2003, 426 (6965): [28] Ryu C J, Cho D Y, Gripon P, et al. An 80-kilodalton protein that binds to the Pre-S1 domain of hepatitis B virus [J]. J Virol, 2000, 74 (1): [29] White M A. The yeast two-hybrid system: forward and reverse [J]. Proc Natl Acad Sci USA, 1996; 93 (19): [30] Li L Y, Liu X, Zhang P, (,, ) et al. Cloning and functional identification of measles virus receptor on marmoset cells [J]. Chin Sci Bull ( ), 2002, 47 (16): [31] Gaggar A, Shayakhmetov D M, Lieber A. CD46 is a cellular receptor for group B adenoviruses[j]. Nat Med, 2003, 9(11): [32] Tio P H, Jong W W, Cardosa M J. Two dimensional VOPBA reveals laminin receptor (LAMR1) interaction with dengue virus serotypes 1, 2 and 3 [J]. Virology, 2005, 2 (1): [33] Reyes-Del Valle J, Chavez-Salinas S, Medina F, et al. Heat shock protein 90 and heat shock protein 70 are components of dengue virus receptor complex in human cells [J]. J Virol, 2005, 79(8): antibodies as probes for the Sindbis virus receptor [J]. Virology,
High mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
1., Specificity and Epitope Mapping of Four Monoclonal Antibodies. against SARS-CoV Nucleocapsid Protein
21 3 21 3 207-212 2006 5 VIROLOGICA SINICA May 2006 SARS-CoV N * 1** 1 1 1 1 1 2** 1 1 1., 100052 2., 361005 Specificity and Epitope Mapping of Four Monoclonal Antibodies against SARS-CoV Nucleocapsid
Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver
Nagoya Med. J., 137 Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver KAZUO IKEDA Department of Anatomy and Cell Biology, Graduate School of Medical Sciences, Nagoya City University
Abstract... I. Zusammenfassung... II. 1 Aim of the work Introduction Short overview of Chinese hamster ovary cell lines...
III Contents I II III Abstract... I Zusammenfassung... II Contents... III 1 Aim of the work... 1 2 Introduction... 2 2.1 Short overview of Chinese hamster ovary cell lines... 2 2.2 Unspecific mutations:
Studies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS INTERDICIPLINARY POSTGRADUATE PROGRAMME "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
rp, ribosomal protein 60S rp mrna rpl30 rps14 RT-PCR mrna nonsense-mediated mrna decay smg-2 smg-2 mrna rp rpl-1 rpl-1
rp, ribosomal protein 60S 47 rpl 40S 32 rps rp mrna rpl30 rps14 rpl12 rpl3 rps13 rp mrna nonsense-mediated mrna decay (NMD) C. elegans smg-2 smg-2 mrna 50 rp 7 rp 4 rpl 4 rp NMD mrna 6 rp mrna rp mrna
JEV C RNA 11kb 3. Japanese encephalitis virus JEV JEV C 7. C E prm C 1 RNA. Gold pgbkt7 pgadt7- T pgbkt7-53 pgbkt7- JEV C PCR JEV C cdna
2012 12 4 CHINA TROPICAL MEDICINE Vol.12 No.4 April 2012 427 * JEV C PCR JEV C cdna pgbkt7 EcoRI/BamHI PEG/LiAc pgbkt7- JC pgbkt7 Gold Western- blotting BD- JC pgbkt7- JC Genebank JEV SA14-14- 2 JEV C
Chinese Journal of Biochemistry and Molecular Biology ERR . I2 (TNNI2) GST2TNNI2, 1. 1
ISSN 100727626 CN 1123870ΠQ 2005 10 Chinese Journal of Biochemistry and Molecular Biology 21 (5) :656 660 I2 ERR 1,,,,, (, 400038) 3 1 ( ERR 1) I2 (TNNI2) TNNI2 ERR 1, GST2TNNI2, 35 S ERR 1, GST,TNNI2
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Affinity chromatography for the purification of glutathione S-transferase from Oxya chinensis
20 48 4 826 830 * S - 2 **. 030006 2. 03080 GSH-agarose Oxya chinensis Thunberg 5 S - glutathione S-transferases GSTs 60% ~ 80% GSTs 90% 0. 3046 μmol / min / mg protein. 82 GSH-agarose 8. 585 μmol / min
Τεχρνο 9 ν - Άξζξν 6 ν
Τεχρνο 9 ν - Άξζξν 6 ν ΛΟΙΜΩΞΗ ΑΠΟ ΤΟΝ ΙΟ ΤΟΥ ΓΥΤΙΚΟΥ ΝΔΙΛΟΥ (WNV) Τζίληνπ Μαγδαιελή* Ιαηξηθή Σρνιή Παλεπηζηεκίνπ Θεζζαιίαο. *Editor in Chief, reviewer, webmaster. Περίληψη. Ο ηφο ηνπ Γπηηθνχ Νείινπ είλαη
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1
Τα ηπατικά επίπεδα του FOXP3 mrna στη χρόνια ηπατίτιδα Β εξαρτώνται από την έκφραση των οδών Fas/FasL και PD-1/PD-L1 Γ. Γερμανίδης, Ν. Αργέντου, Θ. Βασιλειάδης, Κ. Πατσιαούρα, Κ. Μαντζούκης, A. Θεοχαρίδου,
Electrolyzed-Reduced Water as Artificial Hot Spring Water
/-,**- + +/ 0 +, - + + +, - + +. ++,3 +/. +. Electrolyzed-Reduced Water as Artificial Hot Spring Water Shoichi OKOUCHI +, Daisuke TAKEZAKI +, Hideyuki OHNAMI +, Yuhkoh AGISHI,, Yasuo KANROJI -, and Shigeo
Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο
Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση
Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
College of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
NOVEL INTEGRAL MEMBRANE PROTEINS OF THE INNER NUCLEAR MEMBRANE
NOVEL INTEGRAL MEMBRANE PROTEINS OF THE INNER NUCLEAR MEMBRANE CHARACTERIZATION OF LUMA NATIVE LAP 2β COMPLEXES Inauguraldissertation zur Erlangung der Doktorwürde des Fachbereichs Biologie Chemie Pharmazie
Εθνικό Μετσόβιο Πολυτεχνείο ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ ΕΚΚΡΙΣΗΣ ΠΡΩΤΕΪΝΩΝ ΚΟΝΤΑ ΣΤΗ ΚΥΤΤΑΡΙΚΗ ΕΠΙΦΑΝΕΙΑ
Εθνικό Μετσόβιο Πολυτεχνείο Σχολή Μηχανολόγων Μηχανικών ΕΡΓΑΣΤΗΡΙΟ ΕΜΒΙΟΜΗΧΑΝΙΚΗΣ ΚΑΙ ΣΥΣΤΗΜΙΚΗΣ ΒΙΟΛΟΓΙΑΣ ΤΟΜΕΑΣ ΜΗΧΑΝΟΛΟΓΙΚΩΝ ΚΑΤΑΣΚΕΥΩΝ ΚΑΙ ΑΥΤΟΜΑΤΟΥ ΕΛΕΓΧΟΥ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΝΑΠΤΥΞΗ ΤΕΧΝΙΚΗΣ ΜΕΤΡΗΣΗΣ
Shiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
ER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Supplementary Information for
Supplentary Information for Aggregation induced blue-shifted ission molecular picture from QM/MM study Qunyan Wu, a Tian Zhang, a Qian Peng,* b Dong Wang, a and Zhigang Shuai* a a Key Loratory of Organic
DOI: /j.cnki.bingduxuebao
33 1 2017 1 CHINESEJOURNALOF VIROLOGY Vol.33 No.1 January 2017 PCR! ( 102206) : PCR(DigitalPCRdPCR) (InfluenzaAvi- rusflua) dpcr dpcr 64.4 ; FluA dpcr FluA 37.7~8.22 " 10 4 /#L 3.77 / dpcr R 2 = 0.9988
8Q5SAC) 8Q5SAC UV2Vis 8500 ( ) ; PHS23C ) ;721 ( ) :1 4. ;8Q5SAC : molπl ;Britton2Robinson Q5SAC BSA Britton2Robinson,
31 2003 8 (FENXI HUAXUE) 8 Chinese Journal of Analytical Chemistry 976 980 22( 82 252 272 )21,82 23,62 3 (, 510631) 22(82 252 272 )21,82 23,62 (BSA), 8Q5SAC BSA 298K, 35 40 6. 1 10 5 LΠmol 8Q5SAC, ph =
2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Supporting Information. Generation Response. Physics & Chemistry of CAS, 40-1 South Beijing Road, Urumqi , China. China , USA
Supporting Information Pb 3 B 6 O 11 F 2 : A First Noncentrocentric Lead Fluoroborate with Large Second Harmonic Generation Response Hongyi Li, a Hongping Wu, a * Xin Su, a Hongwei Yu, a,b Shilie Pan,
Molecular evolutionary dynamics of respiratory syncytial virus group A in
Molecular evolutionary dynamics of respiratory syncytial virus group A in recurrent epidemics in coastal Kenya James R. Otieno 1#, Charles N. Agoti 1, 2, Caroline W. Gitahi 1, Ann Bett 1, Mwanajuma Ngama
c Key words: cultivation of blood, two-sets blood culture, detection rate of germ Vol. 18 No
2008 245 2 1) 1) 2) 3) 4) 1) 1) 1) 1) 1), 2) 1) 2) 3) / 4) 20 3 24 20 8 18 2001 2 2 2004 2 59.0 2002 1 2004 12 3 2 22.1 1 14.0 (CNS), Bacillus c 2 p 0.01 2 1 31.3 41.9 21.4 1 2 80 CNS 2 1 74.3 2 Key words:
Research Papers. TNF-α. L929 LPS Carswell [1] BCG. pet-41d TNF).TNF. NEB TNF-α cdna Invitrogen DNA. 75 ku TNF TransTaq High %
Research Papers Progress in Biochemistry and Biophysics 2009, 36(4): 424~430 wwwpibbaccn * TNF-α 1, 2) 1) 1)** ( 1) 100101 2) 100039) TNF-α TNF-α TNF-α TNF-α TNF-α TNF-α 9C6 TNF-α 29~40 TNF-α 9C6 TNF-α
ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ
5 ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕΔΡΙΟ ΕΛΛΗΝΙΚΗΣ ΕΤΑΙΡΕΙΑΣ ΑΙΜΑΦΑΙΡΕΣΗΣ ΓΕΝΙΚΕΣ ΑΡΧΕΣ ΑΝΟΣΟΠΑΘΟΓΕΝΕΙΑΣ ΣΤΗ ΣΗΨΗ Θωμάς Τσαγανός, MD, PhD Πανεπιστημιακός Υπότροφος Δ Παθολογική Κλινική Πανεπιστημιακό Γενικό Νοσοκομείο
CPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Science of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
LUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Supporting information. An unusual bifunctional Tb-MOF for highly sensing of Ba 2+ ions and remarkable selectivities of CO 2 /N 2 and CO 2 /CH 4
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information An unusual bifunctional Tb-MOF for highly sensing
Fifty years of amphioxus study in China
20 1 2008 2 Chinese Bulletin of Life Sciences Vol. 20, No. 1 Feb., 2008 1004-0374(2008)01-0064-05 50, 266003 50, Q959.287A Fifty years of amphioxus study in China ZHANG Shi-cui*, GUO Bin, LIANG Yu-jun
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates
Electronic Supplementary Information DFT Characterization on the Mechanism of Water Splitting Catalyzed by Single-Ru-substituted Polyoxometalates Zhong-Ling Lang, Guo-Chun Yang, Na-Na Ma, Shi-Zheng Wen,
Μαρία Κατσιφοδήμου. Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα έμβρυα στην επιτυχία της εξωσωματικής γονιμοποίησης. Μεταπτυχιακή Διπλωματική Εργασία
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥΔΩΝ ΚΑΤΕΥΘΥΝΣΗ: ΕΦΑΡΜΟΣΜΕΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Ο ρόλος της έκκρισης HLA-G από τα ανθρώπινα
genomics, proteomics, metabolomics ELISA Enzyme-Linked ImmunoSorbent Assay ECL Electrochemi-luminescence SPR Surface Plasmon Resonance ECL
21 3 5 1) HPLC GC/MS LC/MS/MS 2), 3) genomics, proteomics, metabolomics 1. PK/TK 2. 3. ELISA Enzyme-Linked ImmunoSorbent Assay ECL Electrochemi-luminescence SPR Surface Plasmon Resonance ECL ECLSulfo-Tag
encouraged to use the Version of Record that, when published, will replace this version. The most /BCJ BIOCHEMICAL JOURNAL
Biochemical Journal: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Extract Isolation Purification and Identification of Polysaccharides from Exocarp of Unripe Fruits of Juglans mandshurica
35 1 2 0 1 7 1 DOI 10. 13193 /j. issn. 1673-7717. 2017. 01. 035 1 1 1 1 2 1. 150036 2. 150040 D101 DEAE Cellulose 52 Sephacryl S - 300 - - PJP - 1a PJP - 3a 1. 34 10 3 Da 1. 70 10 7 Da - PJP - 3a 4. 56
Βιολογικές Μεμβράνες και Μεταγωγή Σήματος
ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Τερματισμός σηματοδότησης Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό
The toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
ΜΔΗΕΟΝ ΤΜΠΛΔΓΜΑ ΗΣΟΤΜΒΑΣΟΣΖΣΑ
ΜΔΗΕΟΝ ΤΜΠΛΔΓΜΑ ΗΣΟΤΜΒΑΣΟΣΖΣΑ 5 Σε όια ζρεδόλ ηα ζπνλδπισηά, ηα νπνία έρνπλ έσο ζήκεξα κειεηεζεί θαη ηδίσο ζηα ζειαζηηθά, ζπκπεξηιακβαλνκέλνπ θαη ηνπ αλζξώπνπ, έρεη δηαπηζησζεί ε ύπαξμε κηαο ζηελά ζπλδεδεκέλεο
Développement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires
Développement de virus HSV-1 (virus de l herpes simplex de type 1) oncolytiques ciblés pour traiter les carcinomes hépatocellulaires Aldo Decio Pourchet To cite this version: Aldo Decio Pourchet. Développement
The effect of curcumin on the stability of Aβ. dimers
The effect of curcumin on the stability of Aβ dimers Li Na Zhao, See-Wing Chiu, Jérôme Benoit, Lock Yue Chew,, and Yuguang Mu, School of Physical and Mathematical Sciences, Nanyang Technological University,
ΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Supporting Information
Supporting Information Mitochondria-Targeting Polydopamine Nanocomposites as Chemophotothermal Therapeutics for Cancer Zhuo Wang *,, Yuzhi Chen, Hui Zhang, Yawen Li, Yufan Ma, Jia Huang, Xiaolei Liu, Fang
Πρόσκληση υποβολής προσφοράς
Αθήνα, 5 Μαρτίου 2014 Πρόσκληση υποβολής προσφοράς από φυσικά ή νομικά πρόσωπα για την προμήθεια υλικών στην Πράξη «ΘΑΛΗΣ Εθνικό Ίδρυμα Ερευνών Βιοσύνθεση και Γενετική Επιλογή Κυκλικών Πεπτιδίων με Εν
* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
(C) 2010 Pearson Education, Inc. All rights reserved.
Connectionless transmission with datagrams. Connection-oriented transmission is like the telephone system You dial and are given a connection to the telephone of fthe person with whom you wish to communicate.
Predicting Peptide Binding to. Major Histocompatibility Complex (MHC) molecules
MSc course BIOINFORMATICS Predicting Peptide Binding to Major Histocompatibility Complex (MHC) molecules ImmunoInformatics Computational Immunology Assist. Prof. Katerina Chlichlia 09.11.2014 Bioinformatics
Advances in the study of to0in in halobios
11 3 Vol.11 No.3 2002 9 J0URNAL 0F SHANGHAI FISHERIES UNIVERSITY Sep. 2002!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 1004-7271 2002 03-0283 - 06 Advances in the study of to0in in halobios
Introduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 2, 2005 Jonathan Pevsner, Ph.D. pevsner@jhmi.edu bioinformatics medical informatics Tool-users public health informatics databases algorithms Tool-makers
Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Solutions to the Schrodinger equation atomic orbitals. Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz
Solutions to the Schrodinger equation atomic orbitals Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz ybridization Valence Bond Approach to bonding sp 3 (Ψ 2 s + Ψ 2 px + Ψ 2 py + Ψ 2 pz) sp 2 (Ψ 2 s + Ψ 2 px + Ψ 2 py)
Quick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
The RNA interference efficiency of glutathione S-transferases from Locusta migratoria manilensis
Chinese Journal of Applied Entomology 2011 48 4 820 825 * S - RNA 1 1 2 1 1** 1. 030006 2. 030006 Locusta migratoria manilensis Meyen GST GST 4 RNA dsrna dsrna Real time RT-PCR mrna 4 GST delta LmGSTd1
Nucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
*,* + -+ on Bedrock Bath. Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G
J. Hot Spring Sci. /2 +.,.,**2 + + + +, - +3 ++ -*,* + -+ Evaluation of the E# ect of Hyperthermia on Bedrock Bath Hideyuki O, Shoichi O, Takao O, Kumiko Y, Yoshinao K and Tsuneaki G + + + HNAMI KOUCHI
MSM Men who have Sex with Men HIV -
,**, The Japanese Society for AIDS Research The Journal of AIDS Research HIV,0 + + + + +,,, +, : HIV : +322,*** HIV,0,, :., n,0,,. + 2 2, CD. +3-ml n,, AIDS 3 ARC 3 +* 1. A, MSM Men who have Sex with Men
Discovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents
Discovery of multi-target receptor tyrosine kinase inhibitors as novel anti-angiogenesis agents Jinfeng Wang, Lin Zhang, Xiaoyan Pan, Bingling Dai, Ying Sun, Chuansheng Li, Jie Zhang School of Pharmacy,
Supporting Information
Supporting Information for AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds Qiuping Ding 1, Dan Wang 1, Puying Luo* 2, Meiling Liu 1, Shouzhi Pu* 3 and
Vol. 34 No Journal of South-Central University for Nationalities Nat. Sci. Edition Mar MTT 3 CVB 4 R373 A
34 1 Vol 34 No 1 2015 3 Journal of South-Central University for Nationalities Nat Sci Edition Mar 2015 B 4 1 2 2 2 1 430074 2 430071 B 4 CVB 4 MTT 3 CVB 4 PCR CVB 4 mrna IC 50 = 14 10 ± 0 74 μm TI = 4
Figures Supplementary Figure 1. Tandem MS of yeast eif2b.
Figures Supplementary Figure 1. Tandem MS of yeast eif2b. Tandem MS of the 56+ charge state (shaded blue) of the eif2b dimer showing that two α subunits ( at 2000 m/z) dissociate from the dimer when collision
Basic & Clinical Medicine PLGA MUC1 MUC1 IC 50 MUC1 +
2011 7 31 7 1001-6325 2011 07-0751 -05 July 2011 Vol. 31 No. 7 MUC1 1 1 1 2 1 1* 1. 100005 2. 100190 MUC1 PLGA MUC1 MUC1 MUC1 MCF-7 HepG2 MTS IC 50 MUC1 225. 3 ± 9. 2 nm 83. 6% ± 1. 7% MUC1 + MCF-7 P
J. of Math. (PRC) 6 n (nt ) + n V = 0, (1.1) n t + div. div(n T ) = n τ (T L(x) T ), (1.2) n)xx (nt ) x + nv x = J 0, (1.4) n. 6 n
Vol. 35 ( 215 ) No. 5 J. of Math. (PRC) a, b, a ( a. ; b., 4515) :., [3]. : ; ; MR(21) : 35Q4 : O175. : A : 255-7797(215)5-15-7 1 [1] : [ ( ) ] ε 2 n n t + div 6 n (nt ) + n V =, (1.1) n div(n T ) = n
Chalkou I. C. [PROJECT] Ανάθεση εργασιών.
Πληροφορική της Υγείας 2014 Chalkou I. C. [PROJECT] Ανάθεση εργασιών. Περιεχόμενα 1. Ομάδα ΣΤ... 3 1.1 ΜΑΡΚΟΠΟΥΛΟΥ- ΣΠΥΡΟΠΟΥΛΟΥ -ΚΩΝΣΤΑΝΤΟΠΟΥΛΟΥ... 3 1.2 ΜΑΡΚΟΣ- ΚΟΥΤΣΟΠΟΥΛΟΣ ΑΥΓΕΡΗ - ΜΠΟΥΖΑΛΑ... 3 1.3
Supporting Information
Supporting Information Aluminum Complexes of N 2 O 2 3 Formazanate Ligands Supported by Phosphine Oxide Donors Ryan R. Maar, Amir Rabiee Kenaree, Ruizhong Zhang, Yichen Tao, Benjamin D. Katzman, Viktor
1(a) moat. moat. moat. 1(b) moving magnetic feature
High Altitude Observatory, National Center for Atmospheric Research, P.O. Box 3000, Boulder, CO 80307 3000, USA e-mail: kubo@ucar.edu 1. km km 1 2 100 1) 2. 1(a) moat moat 1(a) moat 1(b) moat moat moat
Mouse Gene 2.0 ST Array Shn3. Runx2 Shn3. Runx2 Shn3 Runx2. adult. (Schnurri, Shn)3/Hivep3. Runx2 Shn/Hivep. ST2 BMP-2 Shn3
adult (Schnurri, Shn)3/Hivep3 Runx2 Shn/Hivep Shn3 Shn3 Shn3 Shn3 Shn1 Shn2 Shn3 gain-of-function loss-of-function Shn3 in vivo mimic MC3T3-E1 ST-2 ATDC5 C3H10T1/2 ALP RT-PCR alcian blue RT-PCR Affymetrix
Εκτεταμένη περίληψη Περίληψη
PENED Final Report In the frame of PENED program the research that has been conducted as part of the Hybrid Libraries Project had as an outcome the design of a complex software architecture for mobile
Distribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
ACTA LABORATORIUM ANIMALIS SCIENTIA SINICA ELISA. HBsAg HBeAg HBsAb HBeAb HBcAb PCR HBV DNA. raav8
2013 6 21 3 ACTA LABORATORIUM ANIMALIS SCIENTIA SINICA June 2013 Vol. 21 No. 3 檵 檵檵檵檵檵檵檵檵檵 8 HBV 1 1 1 1 1 1 2 1 1 1. 100071 2. 100850 8 1. 3 HBV 1. 3HBV ayw HBV 1. 3 HBV 8 recombinant adeno-associated
Inferring regulatory subnetworks through the analysis of genome-wide expression profiles
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE DEPARTMENT OF INFORMATICS AND TELECOMMUNICATIONS POSTGRADUATE PROGRAM "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY" MASTER S THESIS
Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ)
Ίδρυμα Τεχνολογίας & Έρευνας (ΙΤΕ) Ινστιτούτο Μοριακής Βιολογίας & Βιοτεχνολογίας (IMBB) Ηράκλειο, Κρήτη Σύντομη Ιστορία του ΙΜΒΒ Ιδρύθηκε το 1983 Ένα από τα Ινστιτούτα του Ερευνητικού Κέντρου Κρήτης (ΕΚΕΚ)
Derivation of Optical-Bloch Equations
Appendix C Derivation of Optical-Bloch Equations In this appendix the optical-bloch equations that give the populations and coherences for an idealized three-level Λ system, Fig. 3. on page 47, will be
α α Pneumocystis jirovecii
α α Key words α α Pneumocystis jirovecii I α Table 1. Biologics currently approved in Japan for autoimmune inflammatory diseases (as of Dec, 2016) Classification Preparations that target cytokines or cytokine
Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic acids with the assistance of isocyanide
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Copper-catalyzed formal O-H insertion reaction of α-diazo-1,3-dicarb- onyl compounds to carboxylic
Η χρήση των βλαστικών κυττάρων στη δημιουργία μοντέλων τοξικότητας φαρμακευτικών ουσιών
REVIEW ÁÑ ÅÉÁ ÅËËÇÍÉÊÇÓ ÉÁÔÑÉÊÇÓ 2016, 33(1):8-21 Η χρήση των βλαστικών κυττάρων στη δημιουργία μοντέλων τοξικότητας φαρμακευτικών ουσιών Τα τελευταία 20 έτη υπάρχει μια αλματώδης ανάπτυξη στις τεχνικές
Spherical Coordinates
Spherical Coordinates MATH 311, Calculus III J. Robert Buchanan Department of Mathematics Fall 2011 Spherical Coordinates Another means of locating points in three-dimensional space is known as the spherical
Prey-Taxis Holling-Tanner
Vol. 28 ( 2018 ) No. 1 J. of Math. (PRC) Prey-Taxis Holling-Tanner, (, 730070) : prey-taxis Holling-Tanner.,,.. : Holling-Tanner ; prey-taxis; ; MR(2010) : 35B32; 35B36 : O175.26 : A : 0255-7797(2018)01-0140-07
RS human respiratory syncytial virus
June 2014 THE JAPANESE JOURNAL OF ANTIBIOTICS 67 3 147 1 RS 1 2 3 1 2 3 2014 4 10 RS human respiratory syncytial virus COPD RS RS RS human respiratory syncytial virus RNA G A B 1 RS RS 0 1 70 2 100 1 COPD
Free Radical Initiated Coupling Reaction of Alcohols and. Alkynes: not C-O but C-C Bond Formation. Context. General information 2. Typical procedure 2
Free Radical Initiated Coupling Reaction of Alcohols and Alkynes: not C-O but C-C Bond Formation Zhongquan Liu,* Liang Sun, Jianguo Wang, Jie Han, Yankai Zhao, Bo Zhou Institute of Organic Chemistry, Gannan
Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A. new Entry to N-Carbamate Protected Arylamines
Rh(III)-Catalyzed C-H Amidation with N-hydroxycarbamates: A new Entry to N-Carbamate Protected Arylamines Bing Zhou,* Juanjuan Du, Yaxi Yang,* Huijin Feng, Yuanchao Li Shanghai Institute of Materia Medica,
(Pseudorabies,PR) , ge. , ( Pichia pastoris) ppic9k, ,Multi2Copy Pichia Expression Kit Invitrogen, Vol. 42 October No. 5
42 5 2002 10 Acta Microbiologica Sinica Vol. 42 October No. 5 2002 Ea ge 3 33 ( 430070) : ge,, ge, GS115, G418, ge, Western blotting 33kD ELISA, ge, : ge,,, :Q93914 :A :000126209 (2002) 0520543207 (Pseudorabies,PR),
5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R
Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC
A Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Screening of Respiration-deficient Saccharomyces cerevisiae Strains with Sugar-and Thermo-tolerances
3 3 Vol3 No3 3 9 Life Science Research June 9 *,,, 535 :, 3, 5- (TTC), 3,, T,, ; (5~5 μ 375~5 μ),, 5% (W/V), 55,, 55% 9% : ; ; ; ; :Q39 + :A :7-77(9)3-99-5 Screening of Respiration-deficient Saccharomyces
SEN TRONIC AG 3-2 7 0 0 7 A 3 57 3 3 AB 93 :, C,! D 0 7 % 0 7 3 3 93 : 3 A 5 93 :
# 3-270 07A35733 AB93:,C,!D 07% 0733 93: 3A593:!"#$%% &%&''()*%'+,-. &%&''(/*%'+0. 1*23 '4# 54/%6%7%53 *323 %7 77# %%3#% 8908/"/*55 :1$;/ = 7?@ > 7= 7 %! "$!"#$%&#%'(%%)*#$%&#%'(%#++#,-."/-0-1222"/-0-1
An experimental and theoretical study of the gas phase kinetics of atomic chlorine reactions with CH 3 NH 2, (CH 3 ) 2 NH, and (CH 3 ) 3 N
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2015 An experimental and theoretical study of the gas phase kinetics of atomic chlorine
J. of Math. (PRC) Banach, , X = N(T ) R(T + ), Y = R(T ) N(T + ). Vol. 37 ( 2017 ) No. 5
Vol. 37 ( 2017 ) No. 5 J. of Math. (PRC) 1,2, 1, 1 (1., 225002) (2., 225009) :. I +AT +, T + = T + (I +AT + ) 1, T +. Banach Hilbert Moore-Penrose.. : ; ; Moore-Penrose ; ; MR(2010) : 47L05; 46A32 : O177.2
Dietary success of a new key fish in an overfished ecosystem: evidence from fatty acid and stable isotope signatures
The following supplement accompanies the article Dietary success of a new key fish in an overfished ecosystem: evidence from fatty acid and stable isotope signatures M. G. van der Bank 1, A. C. Utne-Palm
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ. Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου. Ερευνήτρια Β βαθμίδας. B.Sc.
ΒΙΟΓΡΑΦΙΚΟ ΣΗΜΕΙΩΜΑ Όνομα Τίτλος Ημερομηνία γέννησης (μήνας/ημέρα/έτο ς) Παρασκευή Κίτσιου Ερευνήτρια Β βαθμίδας 04/17/1962 ΣΠΟΥΔΕΣ-ΤΙΤΛΟΙ Πανεπιστημιακό Ίδρυμα Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης,
Structural and Biochemical Studies of Cotranslational Protein Transport across the Endoplasmic Reticulum
Structural and Biochemical Studies of Cotranslational Protein Transport across the Endoplasmic Reticulum Inaugural-Dissertation zur Erlangung des akademischen Grades Doktor der Naturwissenschaften - Dr.
Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA
2016 12 12 Ankylosing Spondylitis AS human leukocyte antigen HLA- AS NSAIDs NSAIDs B27 100% NSAIDs NSAIDs 90% NSAID ~ AS 0.25% 2~3 1 100% 1 AS CFDA FDA EMA 14 AS NSAIDs 2 CFDA non-ster- AS 1 oidal anti-inflammatory
Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)
«Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.36 Έκδοση ενημερωτικών φυλλαδίων Υπεύθυνος φορέας: Κέντρο Ελέγχου
TABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Supplemental tables and figures
Supplemental tables and figures Supplemental Table S1. Demographic and clinical parameters by quartiles of white Variables blood cell count. WBC quartiles( 1 9 cells/l) Q1(.6-5.3, n=2587) Q2(5.4-6.3, n=263)