Γελνηππηθή παξαιιαθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea θαη ε ζρέζε ηεο κε ηελ αλζεθηηθόηεηα ζε κπθεηνθηόλα

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Γελνηππηθή παξαιιαθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea θαη ε ζρέζε ηεο κε ηελ αλζεθηηθόηεηα ζε κπθεηνθηόλα"

Transcript

1 Αξηζηνηέιεην Παλεπηζηήκην Θεζζαινλίθεο Γεσπνληθή ρνιή Σνκέαο Φπηνπξνζηαζίαο Δξγαζηήξην Φπηνπαζνινγίαο Γελνηππηθή παξαιιαθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea θαη ε ζρέζε ηεο κε ηελ αλζεθηηθόηεηα ζε κπθεηνθηόλα Θεζζαινλίθε Ιαλνπάξηνο 2011 Μεηαπηπρηαθόο θνηηεηήο : ηπιηαλόο ακνπήι Δπηβιέπσλ : Γηώξγνο Καξανγιαλίδεο, Λέθηνξαο ΑΠΘ

2 Αξηζηνηέιεην Παλεπηζηήκην Θεζζαινλίθεο Γεσπνληθή ρνιή Σνκέαο Φπηνπξνζηαζίαο Δξγαζηήξην Φπηνπαζνινγίαο Γελνηππηθή παξαιιαθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea θαη ε ζρέζε ηεο κε ηελ αλζεθηηθόηεηα ζε κπθεηνθηόλα Θεζζαινλίθε Ιαλνπάξηνο 2011 Μεηαπηπρηαθόο θνηηεηήο : ηπιηαλόο ακνπήι Δπηβιέπσλ : Γηώξγνο Καξανγιαλίδεο, Λέθηνξαο ΑΠΘ

3 Δπραξηζηίεο Θα ήηαλ παξάιεηςή κνπ αλ δελ επραξηζηνχζα απηνχο πνπ κε νπνηνδήπνηε ηξφπν κε βνήζεζαλ λα δηεθπεξαηψζσ απηή ηελ εξγαζία. Καηαξρήλ, ζα ήζεια λα επραξηζηήζσ ζεξκά ηνλ επηβιέπνληα θαζεγεηή κνπ θ. Γηψξγν Καξανγιαλίδε, πνπ κνπ έδσζε ηε δπλαηφηεηα λα εθπνλήζσ ηε δηαηξηβή απηή θαη ν νπνίνο πέξαλ ηεο εκπηζηνζχλεο πνπ κνπ έδεημε, κε ππνκνλή θαη επαγγεικαηηζκφ κε θαζνδεγνχζε θαη κε ζπκβνχιεπε θαηά ηε δηάξθεηα ηνπ κεηαπηπρηαθνχ κνπ. Δπίζεο, ηνπο θαζεγεηέο κνπ, νη νπνίνη κε κχεζαλ ζηε γεσπνληθή επηζηήκε, κνπ έβαιαλ ηηο βάζεηο γηα λα κπνξψ ζήκεξα λα παξνπζηάδσ κηα κεηαπηπρηαθή δηαηξηβή, ηνπο επγλσκνλψ θαη ηνπο επραξηζηψ ηδηαίηεξα. Δπραξηζηίεο νθείινληαη θαη ζηελ νκάδα ηνπ Δξγαζηεξίνπ Φπηνπαζνινγίαο ηεο Γεσπνληθήο ρνιήο ηνπ ΑΠΘ γηα ηελ επράξηζηε ζπλεξγαζία θαη ηδηαίηεξα ζηνλ ππνςήθην δηδάθηνξα ηνπ Δξγαζηεξίνπ θ. Θσκά Βεινχθα, γηα ηε ζπκβνιή ηνπ ζηε ζπιινγή απνκνλψζεσλ ηνπ κχθεηα πνπ ρξεζηκνπνηήζεθαλ ζηε κειέηε. Δπίζεο, επραξηζηψ ηδηαηηέξα ηνπο ζπλαδέιθνπο Λάκπξν Παπαγηάλλε θαη Θενδψξα Καπαξή-Ζζαΐα θαζψο θαη φινπο ηνπο ζπλαδέξθνπο θαη ζπλεξγάηεο ηνπ Κιάδνπ Φπηνπξνζηαζίαο ηνπ Ηλζηηηνχηνπ Γεσξγηθψλ Δξεπλψλ Κχπξνπ, γηα ηελ ζπλερή ζηήξημε θαη θάζε είδνπο βνήζεηα. Σέινο, επραξηζηψ ηα κέιε ηεο ηξηκεινχο επηηξνπήο, ηνλ θ. Νηθφιαν Καηή, θαζεγεηή ηνπ ΑΠΘ θαη ηελ θ. Αλαζηαζία Λαγνπφδε, Δπ. Καζεγήηξηα ηνπ ΑΠΘ, γηα ηηο ζπζηάζεηο ηνπο θαη ην ρξφλν πνπ αθηέξσζαλ γηα ηε δηφξζσζε ηνπ θεηκέλνπ. Διπίδσ θαη εχρνκαη ζε κηα ζπλερή ζπλεξγαζία κε φινπο. Θεζζαινλίθε, Ηαλνπάξηνο Α. ακνπήι I

4 Πεξίιεςε Ζ παξνχζα εξγαζία εθπνλήζεθε ζηα πιαίζηα ηεο κεηαπηπρηαθήο κνπ δηαηξηβήο θαη είρε σο αληηθείκελν κειέηεο ηε γελνηππηθή παξαιιαθηηθφηεηα ησλ πιεζπζκψλ ηνπ κχθεηα Botrytis cinerea θαη ηε ζπζρέηηζή ηεο κε ηελ αλζεθηηθφηεηα ζε κπθεηνθηφλα. Ζ εξγαζία δηαρσξίδεηαη ζε 2 μερσξηζηέο ελφηεηεο: ε πξψηε αθνξά ζηε κειέηε ηεο γελεηηθήο δνκήο πιεζπζκψλ ηνπ κχθεηα Botrytis cinerea απφ δηάθνξνπο μεληζηέο ζηελ Διιάδα θαη ε δεχηεξε ζηε κειέηε ηεο αλζεθηηθφηεηαο πιεζπζκψλ ηνπ κχθεηα ζε κπθεηνθηφλα κε έκθαζε ηνπο παξεκπνδηζηέο ηνπ ζπκπιφθνπ ΗΗΗ ηεο αλαπλνήο. Ζ εξγαζία εθπνλήζεθε ζην Δξγαζηήξην Φπηνπαζνινγίαο ηεο Γεσπνληθήο ρνιήο ηνπ Α.Π.Θ., ελψ κέξνο απηήο εθπνλήζεθε ζην Δξγαζηήξην Φπηνπαζνινγίαο ηνπ Ηλζηηηνχηνπ Γεσξγηθψλ Δξεπλψλ Κχπξνπ. ηα πιαίζηα ηεο εξγαζίαο απηήο, κειεηήζεθε έλα δείγκα 299 απνκνλψζεσλ ηνπ παζνγφλνπ νη νπνίεο ζπιιέρζεθαλ απφ δηάθνξνπο θαιιηεξγνχκελνπο μεληζηέο ηνπ ζηελ Διιάδα. Καηά ηε πξψηε ζεηξά πεηξακάησλ, ν πιεζπζκφο δηαρσξίζηεθε κε βάζε ηε παξνπζία ή φρη ησλ δχν κεηαζεηψλ ζηνηρείσλ (Boty ή/θαη Flipper) ζην γνληδίσκα ηνπ κχθεηα, ζε δχν ππνπιεζπζκνχο, transposa ή vacuma αληίζηνηρα. Απφ ηα απνηειέζκαηα πξνέθπςε φηη θαη νη ηέζζεξηο πηζαλνί γελφηππνη ζπλππήξραλ γεσγξαθηθά ζηνπο πιεζπζκνχο απφ φινπο ηνπο μεληζηέο ηνπ δείγκαηνο. Δπίζεο παξαηεξήζεθαλ ζεκαληηθέο δηαθνξέο ζηε ζπρλφηεηα ησλ γελνηχπσλ κεηαμχ ησλ πιεζπζκψλ. Δπηπιένλ, κε βάζε ην πνιπκνξθηζκφ ηνπ γνληδίνπ Bc-hch έγηλε δηαρσξηζκφο ησλ απνκνλψζεσλ ηνπ κχθεηα ζηηο νκάδεο Η θαη ΗΗ απ φπνπ πξνέθπςε φηη ην ζχλνιν ησλ απνκνλψζεσλ πνπ κειεηήζεθαλ αλήθαλ ζηελ Οκάδα ΗΗ ηνπ B. cinerea. ηε ζπλέρεηα κειεηήζεθε ε επίδξαζε ζεξκνθξαζίαο ζην ξπζκφ κπθειηαθήο αλάπηπμεο ησλ transposa θαη vacuma απνκνλψζεσλ θαζψο θαη ε παζνγφλνο δχλακή ηνπο ζε θαξπνχο αθηηληδίνπ. Με βάζε ηα απνηειέζκαηα πξνέθπςε φηη νη ξπζκνί κπθειηαθήο αλάπηπμεο ησλ transposa θαη vacuma απνκνλψζεσλ δελ παξνπζίαζαλ ζηαηηζηηθά ζεκαληηθέο δηαθνξέο ζε θακία απφ ηηο ηξεηο ζεξκνθξαζίεο επψαζεο. Αληίζεηα ηα απνηειέζκαηα απφ ηα πεηξάκαηα κνιπζκαηηθφηεηαο έδεημαλ φηη ππήξραλ ζεκαληηθέο δηαθνξέο ζηελ έληαζε πξνζβνιήο κεηαμχ transposa θαη vacuma απνκνλψζεσλ φηαλ νη θαξπνί επσάζηεθαλ ζηνπο 0 o C. ε κηα δεχηεξε ζεηξά πεηξακάησλ, έγηλε πξνζδηνξηζκφο ηεο ζπρλφηεηαο αλζεθηηθφηεηαο ζε έμη κπθεηνθηφλα (cyprodinil, fludioxonil, iprodione, carbendazim, fenhexamid θαη pyraclostrobin) ηα νπνία ρξεζηκνπνηνχληαη ζηελ Διιάδα γηα ηελ αληηκεηψπηζε ηνπ B. cinerea. Ο πξνζδηνξηζκφο ησλ ζπρλνηήησλ αλζεθηηθφηεηαο, ρξεζηκνπνηψληαο ηηο δηαθξηηέο δφζεηο ησλ κπθεηνθηφλσλ απηψλ, απνθάιπςε δηαδεδνκέλε χπαξμε αλζεθηηθφηεηαο ζηα βελδηκηδαδνιηθά, δηθαξβνμακηδηθά θαη αλίιηλνππξηκεδηληθά κπθεηνθηφλα. Δπίζεο, δηαπηζηψζεθε ε χπαξμε θαηλνηχπσλ αλζεθηηθψλ ζηηο ζηξνκπηινπξίλεο κφλν ζην πιεζπζκφ ηνπ κχθεηα απφ θαξπνχο θξάνπιαο. Δλδηαθέξνλ παξνπζίαζε ην γεγνλφο φηη, ζε φινπο ηνπο μεληζηέο ηνπ δείγκαηνο, νη ζπρλφηεηεο αλζεθηηθφηεηαο ήηαλ ζεκαληηθά ςειφηεξεο ζηνλ transosa ππνπιεζπζκφ ζε ζχγθξηζε κε ην vacuma. Δπηπιέσλ, πξνζδηνξίζηεθαλ νη αθξηβείο ηηκέο επαηζζεζίαο (ηηκέο EC 50 ) ησλ απνκνλψζεσλ ηνπ κχθεηα απφ θξάνπια ζην II

5 pyraclostrobin απ φπνπ πξνέθπςαλ δχν ηχπνη επαηζζεζίαο. Ζ αλζεθηηθφηεηα ηνπ B. cinerea ζηα κπθεηνθηφλα ηεο νκάδαο ησλ ζηξνκπηινπξηλψλ απνδφζεθε πξφζθαηα ζηε κεηαιιαγή G143A, ελψ ζε δηάθνξεο απνκνλψζεηο ηνπ παζνγφλνπ αληρλεχζεθε έλα επηπιένλ εζφλην ζην θσδηθφλην 143 ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b. Γηα ηελ αλίρλεπζε ηεο παξνπζίαο ηνπ QoI-επαίζζεηνπ (G143) ή ηνπ QoI-αλζεθηηθνχ (A143) αιιεινκφξθνπ αλαπηχρζεθε κηα πνιιαπιή TaqMan PCR ελψ γηα ηελ αλίρλεπζε ηεο παξνπζίαο ηνπ επηπιένλ εζνλίνπ κεηαμχ ησλ θσδηθνλίσλ 143 θαη 144 ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b (Bcbi 143/144 intron) αλαπηχρζεθε κηα δεχηεξε TaqMan PCR. Απφ ηα απνηειέζκαηα πξνέθπςε φηη απνκνλψζεηο κε θαηλνηππηθή αλζεθηηθφηεηα ζηηο ζηξνκπηινπξίλεο έθεξαλ ηε G143A κεηαιιαγή. Δπίζεο, ην επηπιένλ εζφλην αληρλεχζεθε κφλν ζε απνκνλψζεηο πνπ δελ έθεξαλ ηελ G143A κεηαιιαγή. Με βάζε ηα απνηειέζκαηα, θαίλεηαη φηη ε δηαδεδνκέλε παξνπζίαο ηνπ επηπιένλ εζνλίνπ ζηνπο πιεζπζκνχο ηνπ κχθεηα ελδερνκέλσο ζρεηίδεηαη κε ηελ θαζπζηέξεζε εκθάληζεο αλζεθηηθφηεηαο ζηηο ζηξνκπηινπξίλεο ζε θαιιηέξγεηεο πνπ δέρνληαη απμεκέλν αξηζκφ εθαξκνγψλ φπσο είλαη γηα παξάδεηγκα ε ζεξκνθεπηαθή θαιιηέξγεηα ηνκάηαο. III

6 Abstract The current study was conducted aimed primary at investigating the presence and frequency distribution of the transposable elements Boty and Flipper in populations of the necrotroph plant pathogen Botrytis cinerea in Greece. In total, 299 isolates were collected during 2008 and 2009 from grapes, strawberries, tomatoes, cucumbers, kiwifruit and apple fruit. The presence of the two transposable elements was determined by PCR detection. Results showed that, in all of the sampled hosts, the 4 possible different genotypes, isolates of transposa type carrying both transposable elements, Boty type isolates, Flipper-type isolates and vacuma type isolates carrying neither transposable element, occurred in sympatry. Marked differences in genotype frequencies among populations were observed. In tomatoes, cucumbers, grapes and strawberries transposa isolates carrying both elements were predominant in the populations, while in kiwifruit and apple fruit populations the vacuma isolates were prevailing. Furthermore, a PCR-RFLP approach on a 1171 bp fragment of Bc-hch gene was used to divide B. cinerea population into two groups: Group I and Group II. The results showed that all isolates were Group II and none of them were Group I. In an attempt to explain the observed predominance of vacuma isolates in kiwi and apple fruit populations, mycelial growth rate of a set of vacuma isolates was compared to the mycelial growth rate of a set of transposa isolates at 3 different temperatures (0, 10 and 20 o C). In addition, the same set of vacuma and transposa isolates were used to compare the virulence of isolates on wound-inoculated kiwifruits incubated at 2 different temperatures (0 and 20 o C), in terms of disease incidence and disease severity. The results showed that vacuma and transposa isolates had similar mycelial growth rates both at the limiting temperatures of 0 and 10 0 C, and at the optimum temperature of 20 o C. On the other hand, the results of the virulence test showed that there was a significant difference in disease severity on kiwifruit between transposa and vacuma isolates when incubated at 0 o C. Furthermore, fungicide resistance frequencies in the sampled population were determined. Measurements of the fungicide sensitivity profile of the isolates, using a single discriminatory concentration, revealed the widespread existence of resistance to benzimidazole, dicarboximide and anilinopyrimdine fungicides. Also, QoI-resistant phenotypes existed only within the population collected from strawberry fruit. None of the isolates was resistant either to phenylpyrroles or hydroxyanilides. Interestingly, resistance frequencies were significantly higher in the transposa subpopulation compared to the vacuma subpopulation in all the sampled hosts. Resistance of Botrytis cinerea to the quinone outside inhibiting (QoI) fungicides has been recently attributed to the G143A mutation, while in several pathogen isolates an intron has been detected at the 143 codon of the cytochrome b (cytb) gene. Measurements of EC 50 values to pyraclostrobin, in the strawberry population, showed a bimodal sensitivity distribution. A real-time TaqMan PCR assay was developed and applied to the detection of the G143A mutation and the presence of the cytb intron. Results showed that isolates which were phenotypically resistant to pyraclostrobin possessed the G143A mutation. IV

7 Moreover, differences were observed among the sampled populations originating from different hosts in the genotypic structure of cytb. Individuals carrying the intron were present at high incidence in apple fruit and greenhouse grown tomato and cucumber populations, whereas in strawberry population the intron frequency was lower. The intron presence was only identified in isolates that did not carry the G143A mutation, while none of the isolates carrying the mutation possessed the intron. The results of the study suggest that a high risk for selection of QoI highly-resistant strains exists in crops extensively treated with QoIs. However, the widespread presence of fungal strains carrying the cytb intron may explain the delay in the appearance of QoIs-resistance in crops heavily treated with QoIs such as greenhouse grown tomatoes. V

8 Πίλαθαο Πεξηερνκέλσλ Δπραξηζηίεο. Ι Πεξίιεςε (Διιεληθή) ΙΙ Πεξίιεςε (Αγγιηθή).. ΙV 1. Δηζαγσγή Παζνγόλν Αίηην - Δύξνο Ξεληζηώλ πκπηώκαηα Βηνινγία Δπηδεκηνινγία Καηαπνιέκεζε Γελεηηθή δνκή πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea από δηάθνξνπο μεληζηέο ζηελ Διιάδα Δηζαγσγή Πεγέο γελεηηθήο παξαιιαθηηθόηεηαο ηνπ κύθεηα Botrytis cinerea Μεηαζεηά ηνηρεία (Transposable Elements) Οκάδεο (Groups) θνπόο Δξγαζίαο Τιηθά θαη κέζνδνη πιινγή απνκνλώζεσλ Απνκόλσζε DNA Αλίρλεπζε ησλ κεηαζεηώλ ζηνηρείσλ Boty θαη Flipper Μνξηαθόο Γηαρσξηζκόο νκάδσλ Ι θαη ΙΙ απνκνλώζεσλ ηνπ κύθεηα Botrytis cinerea Δπίδξαζε ζεξκνθξαζίαο ζην ξπζκό κπθειηαθήο αλάπηπμεο transposa θαη vacuma απνκνλώζεσλ ηνπ B. cinerea Παζνγόλνο δύλακε transposa θαη vacuma απνκνλώζεσλ ηνπ B. cinerea ζε αθηηλίδηα Αλάιπζε δεδνκέλσλ Απνηειέζκαηα πρλόηεηα κεηαζεηώλ ζηνηρείσλ Μνξηαθόο δηαρσξηζκόο νκάδσλ Ι θαη ΙΙ απνκνλώζεσλ ηνπ κύθεηα Botrytis cinerea Δπίδξαζε ζεξκνθξαζίαο ζην ξπζκό κπθειηαθήο αλάπηπμεο transposa θαη vacuma απνκνλώζεσλ ηνπ B. cinerea

9 Παζνγόλνο δύλακε transposa θαη vacuma απνκνλώζεσλ ηνπ B. cinerea ζε αθηηλίδηα πδήηεζε Αλζεθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα B. cinerea ζε κπθεηνθηόλα κε έκθαζε ζηνπο παξεκπνδηζηέο ηνπ ζπκπιόθνπ ΙΙΙ ηεο αλαπλνήο Δηζαγσγή Υεκηθή θαηαπνιέκεζε ηνπ Β. cinerea Μπθεηνθηόλα κε βνηξπδηνθηόλν δξάζε Ιζηνξηθό αλζεθηηθόηεηαο Παξεκπνδηζηέο ηνπ ζπκπιόθνπ III ηεο αλαπλνήο (QoI s) Υεκηθή δνκή-θάζκα δξάζεο Μεραληζκόο δξάζεο Μεραληζκνί αλζεθηηθόηεηαο Γνκή θπηνρξώκαηνο b ζηνλ B.cinerea θνπόο εξγαζίαο Τιηθά θαη κέζνδνη Απνκνλώζεηο παζνγόλνπ Μπθεηνθηόλα Πξνζδηνξηζκόο ζπρλόηεηαο αλζεθηηθόηεηαο Μέηξεζε επαηζζεζίαο ζην pyraclostrobin Απνκόλσζε DNA Αλάπηπμε δνθηκήο αιπζηδσηήο αληίδξαζεο ηεο πνιπκεξάζεο πξαγκαηηθνύ ρξόλνπ (Real-time TaqMan-PCR) γηα ηελ αλίρλεπζε ηεο G143A κεηαιιαγήο ζην γνλίδην ηνπ θπηνρξώκαηνο b Αλάπηπμε δνθηκήο αιπζηδσηήο αληίδξαζεο ηεο πνιπκεξάζεο πξαγκαηηθνύ ρξόλνπ (Real-time TaqMan-PCR) γηα ηελ αλίρλεπζε ηνπ εζνλίνπ Bcbi 143/ Πξνζδηνξηζκόο λνπθιενηηδηθήο αιιεινπρίαο ηνπ γνληδίνπ θπηνρξώκαηνο b Αλάιπζε δεδνκέλσλ Απνηειέζκαηα πρλόηεηα αλζεθηηθόηεηαο ζηα κπθεηνθηόλα Δπαηζζεζία ζην pyraclostrobin Μνξηαθή αλίρλεπζε ηεο G143A κεηαιιαγήο θαη ηνπ εζνλίνπ Bcbi 143/ Πξνζδηνξηζκόο λνπθιενηηδηθήο αιιεινπρίαο ηνπ γνληδίνπ θπηνρξώκαηνο b

10 3.4. πδήηεζε Βηβιηνγξαθία Δπξεηήξην εηθόλσλ.. 84 Δπξεηήξην πηλάθσλ. 86 Πίλαθαο ζπληνκνγξαθηώλ

11 ΣΡΙΜΕΛΗ ΕΠΙΣΡΟΠΗ Δπηβιέπσλ: Γ. ΚΑΡΑΟΓΛΑΝΗΓΖ Λέθηνξαο ΑΠΘ Μέιε: Ν. ΚΑΣΖ Καζεγεηήο ΑΠΘ Α. ΛΑΓΟΠΟΓΖ Δπ. Καζεγήηξηα ΑΠΘ 4

12 1. Δηζαγσγή 1.1. Παζνγόλν Αίηην - Δύξνο Ξεληζηώλ - πκπηώκαηα Ο κχθεηαο Botrytis cinerea είλαη έλα θπηνπαζνγφλν πνπ ηαμηλνκηθά αλήθεη ζηελ νηθνγέλεηα Sclerotiniaceae ηεο θιάζεο Leotiomycetes ηνπ θχινπ Ascomycota. Oη αλαθνξέο ζε ζήςεηο ξαγψλ ζε ζηαθχιηα, εμ αηηίαο πξνζβνιψλ ηνπ κχθεηα, θαίλεηαη φηη είλαη ηφζν παιηέο φζν ε θαιιηέξγεηα ηεο ακπέινπ (Rosslenbroich and Stuebler, 2000). Ο Botrytis αλαγλσξίζηεθε σο γέλνο απφ ην Micheli ην 1729 ελψ ε ζχλδεζή ηνπ κε ηελ ηέιεηα κνξθή Botryotinia έγηλε ην 1866 απφ ηνλ de Bary. ηε θχζε ζπλήζσο απαληάηαη ε αηειήο κνξθή ηνπ κχθεηα ελψ ζε ζπάληεο πεξηπηψζεηο αλαθέξεηαη θαη ε ηέιεηα-εγγελήο κνξθή Botryotinia fuckeliana. Ζ ζπζρέηηζε ηνπ παζνγφλνπ κε εμεηδηθεπκέλεο ηάμεηο μεληζηψλ ηνπ Βφξεηνπ Ζκηζθαηξίνπ, δείρλεη φηη ην γέλνο Botrytis πξνέξρεηαη απφ απηέο ηηο πεξηνρέο θαη πηζαλφλ κεηαθέξζεθε κέζσ αλζξψπηλσλ δξαζηεξηνηήησλ πξνο πεξηνρέο ηνπ Νφηηνπ Ζκηζθαηξίνπ (Beever and Weeds, 2004). ε αληίζεζε κε ηα άιια είδε ηνπ γέλνπο Botrytis, o B. cinerea παξνπζηάδεη έλα πνιχ κεγάιν εχξνο μεληζηψλ θαη παγθφζκηα δηάδνζε ζε φιεο ηηο θιηκαηηθέο πεξηνρέο ηνπ πιαλήηε. Δίδε ηνπ γέλνπο Botrytis παξνπζηάδνληαη νπνπδήπνηε αλαπηχζζνληαη νη μεληζηέο ηνπο, απφ ηξνπηθέο θαη ππνηξνπηθέο πεξηνρέο κέρξη πνιηθέο (Elad et al., 2004). Δίλαη ηδηαίηεξα ελεξγφ παζνγφλν ζε ελδηάκεζεο ζεξκνθξαζίεο, παξ φια απηά, ε ηθαλφηεηα ηνπ κχθεηα λα είλαη ελεξγφο ζε ζεξκνθξαζίεο ηφζν ρακειέο φζν νη 0 C (Brooks and Cooley, 1917) ηνλ θαζηζηά έλα ζεκαληηθφ παζνγφλν απνζεθεπκέλσλ πξντφλησλ. Σν εχξνο μεληζηψλ ηνπ B. cinerea πεξηιακβάλεη 235 είδε ηα νπνία αλήθνπλ ζε δηάθνξεο νηθνγέλεηεο (Jarvis, 1977). O B. cinerea, φπσο θαη άιια είδε ηνπ ίδηνπ γέλνπο, απνηειεί ζεκαληηθφ παζνγφλν ζπνξείσλ, θαιισπηζηηθψλ, ιαραλνθνκηθψλ θαη βηνκεραληθψλ θπηψλ θαζψο θαη θαξπψλ νπνξσθφξσλ δέλδξσλ θαηά ηε θάζε ηεο απνζήθεπζεο-ζπληήξεζεο θαη κεηαθνξάο ηνπο (Elad et al., 2004). Οη πξνζβνιέο εθδειψλνληαη θαηεμνρήλ ζηα ππέξγεηα φξγαλα ησλ θπηψλ φπσο θχιια, άλζε, νθζαικνχο, ζηειέρε θαη θαξπνχο κε ηε κνξθή ζήςεο (Δηθφλεο 1-4). Πέξαλ απηψλ, πξνζβνιέο ηνπ κχθεηα έρνπλ αλαθεξζεί θαη ζε βνιβνχο, ζπφξνπο θαζψο θαη ζε άιια είδε πνιιαπιαζηαζηηθνχ πιηθνχ φπνπ επίζεο πξνθαιεί ζεκαληηθέο απψιεηεο (Elad et al., 2004). ηε δηεζλή βηβιηνγξαθία ν κχθεηαο B. cinerea αλαθέξεηαη σο ην παζνγφλν αίηην πνπ πξνθαιεί ηελ ιεγφκελε «ηεθξά ζήςε» (gray mould) ζηνπο μεληζηέο ηνπ. Γηα παξάδεηγκα, ζην ακπέιη ν κχθεηαο πξνθαιεί κηα απφ ηηο ζνβαξφηεξεο αζζέλεηεο ησλ ελαέξησλ νξγάλσλ, ηε ζήςε ησλ βφηξεσλ (Δηθφλα 5). Σέηνηεο ζήςεηο κπνξεί λα κεηψζνπλ δξαζηηθά ηελ παξαγσγή θαηά ηε ζπγθνκηδή θαζψο θαη ηελ πνηφηεηα ηνπ θξαζηνχ, ηδηαίηεξα ηνπ θφθθηλνπ (Bulit and Dubos, 1988). Παξ φια απηά, φηαλ κεηά ηελ πξνζβνιή επηθξαηήζνπλ ζπλζήθεο μεξαζίαο, κε δηαδηθαζίεο κεξηθήο αθπδάησζεο, ηα ζηαθχιηα γίλνληαη ελ κέξεη ιηαζηά. Ζ ζπγθεθξηκέλε κνξθή πξνβνιήο είλαη γλσζηή σο «επγελήο ζήςε» (noble rot). Σέηνηα ζηαθχιηα φηαλ 5

13 ζπγθνκίδνληαη ζε νξηζκέλν ζηάδην θαηά ηε δηάξθεηα ηεο πξνζβνιήο κπνξνχλ λα δψζνπλ αμηφινγα γιπθά θξαζηά (Vaczy et al., 2010). Δηθόλεο 1-4. Αλάπηπμε πξνζβνιήο ηεθξάο ζήςεο ζε θχιια ηνκάηαο (1), ζε αλζνθφξν νθζαικφ ηξηαληαθπιιηάο (2), ζε βιαζηφ ηνκάηαο (3) θαη ζε θαξπνχο θξάνπιαο (4) Ο ίδηνο ν κχθεηαο επηθέξεη ζεκαληηθέο απψιεηεο ζηα αθηηλίδηα, θαζψο πξνθαιεί κεηαζπιιεθηηθέο ζήςεηο ζηνπο θαξπνχο (Δηθφλα 6). ηε Νέα Εειαλδία θαη ηελ Καιηθφξληα ελψ αξρηθά ε θαιιηέξγεηα αθηηληδίνπ ζεσξείην σο ειεχζεξε αζζελεηψλ, ηα ηειεπηαία 25 ρξφληα ην παζνγφλν έρεη γίλεη έλα ζνβαξφ πξφβιεκα (Michailides and Elmer, 2000). Σν κεγαιχηεξν πνζνζηφ πξνζβνιψλ απφ ην κχθεηα ζηνπο θαξπνχο ηνπ αθηηληδίνπ πξνθαιείηαη απφ ιαλζάλνπζεο κνιχλζεηο ησλ νπνίσλ ηα ζπκπηψκαηα γίλνληαη νξαηά κεηά απφ 3 κε 4 εβδνκάδεο ζπληήξεζεο ζηνπο 0 C. Οη πξνζβεβιεκέλνη θαξπνί εκθαλίδνπλ ζήςε, ελψ ε επηδεξκίδα ηνπο απνθηά έληνλα ζθνχξν ρξψκα. Δπηπιένλ, ζηνπο πξνζβεβιεκέλνπο θαξπνχο παξαηεξείηαη αλάπηπμε γθξηδφιεπθνπ κπθειίνπ, θνληδηνθφξσλ κε θνλίδηα θαη ζθιεξσηίσλ (Michailides and Elmer, 2000). Πέξαλ ησλ άκεζσλ απσιεηψλ ζηελ παξαγσγή, ε αλάπηπμε ηεο 6

14 αζζέλεηαο θαηά ηε ζπληήξεζε ησλ θαξπψλ νδεγεί θαη ζε έκκεζεο απψιεηεο θαζψο νη πξνζβεβιεκέλνη θαξπνί παξάγνπλ απμεκέλεο πνζφηεηεο αηζπιελίνπ εληφο ησλ ζαιάκσλ ζπληήξεζεο, κε απνηέιεζκα ηελ επηηάρπλζε ηεο σξίκαλζεο ησλ πγηψλ θαξπψλ (Baraldi et al., 2002). Δηθόλεο 5 6. Πξνζβνιή απφ ην κχθεηα Botrytis cinerea ζε ψξηκα ζηαθχιηα (5) θαη ζε απνζεθεπκέλνπο θαξπνχο αθηηληδίνπ (6) Ζ ηεθξά ζήςε απνηειεί κηα απφ ηηο ζεκαληηθφηεξεο αζζέλεηεο θαη ζε ιαραλνθνκηθέο θαιιηέξγεηεο. ηε ηνκάηα, ζε κε ζεξκαηλφκελα ζεξκνθήπηα, πξνζβάιιεη άλζε, θαξπνχο, θχιια θαη ζηειέρε κε ηε κνξθή ζήςεο (Δηθφλα 7) (Elad and Yunis, 1993), ελψ ζε ζεξκαηλφκελα ζεξκνθήπηα νη πξνζβνιέο ηνπ Botrytis πεξηνξίδνληαη ζηα ζηειέρε (Elad et al., 1995). Αληίζηνηρε είλαη ε ζπκπησκαηνινγία ηεο αζζέλεηαο θαη ζηηο ππφινηπεο θαιιηέξγεηεο ιαραληθψλ ζεξκνθεπίνπ. Δλψ ζε ζεξκαηλφκελα ζεξκνθήπηα νη κνιχλζεηο πεξηνξίδνληαη ζε γεξαζκέλα θχιια θαη πιεγσκέλνπο ηζηνχο ζε κε ζεξκαηλφκελα ζεξκνθήπηα κε θαιιηέξγεηεο γηα παξάδεηγκα αγγνπξηψλ θαη πηπεξηάο παξαηεξνχληαη ζήςεηο θαξπψλ (Δηθφλα 8) (Yunis et al. 1994; Elad and Shtienderg, 1995). Ζ ηεθξά ζήςε απνηειεί κηα εμαηξεηηθά ζεκαληηθή αζζέλεηα θαη γηα ηελ θαιιηέξγεηα ηεο θξάνπιαο ζηελ νπνία θπξίσο πξνθαιεί πξνζπιιεθηηθέο ή κεηαζπιιεθηηθέο ζήςεηο θαξπψλ (Δηθφλα 9) (Boff et al., 2001). ηα δξεπηά άλζε φπσο γηα παξάδεηγκα ηα ηξηαληάθπιια θαη ε δέξκπεξα, ε αζζέλεηα είλαη επίζεο πνιχ θαηαζηξεπηηθή. ηα ζεξκαηλφκελα ζεξκνθήπηα νη πξνζβνιέο αλζέσλ θαηά ηελ πεξίνδν ηεο παξαγσγήο ζπαλίδνπλ. Παξ φια απηά, θνλίδηα πνπ ππάξρνπλ ζηα θπηά θαη ιαλζάλνπζεο κνιχλζεηο πξνθαινχλ νξαηά ζπκπηψκαηα κεηαζπιιεθηηθά θαηά ηελ απνζήθεπζε ζε ςπγεία (Dik and Wubben, 2004). 7

15 Δηθόλεο 7 8. ήςε ζε θαξπνχο ηνκάηαο (7) θαη πηπεξηάο (8) θαηφπηλ πξνζβνιήο απφ ηνλ κχθεηα Botrytis cinerea. Πέξαλ ησλ πξνζβνιψλ θαη ηε κείσζε ηεο παξαγσγήο πνπ πξνθαιεί ζε νπσξνθφξα, ιαραληθά θαη θαιισπηζηηθά θπηά, ν B. cinerea επζχλεηαη θαη γηα ζεκαληηθέο πξνζβνιέο θαη απψιεηεο ζηα ςπραλζή. ηα ξεβίζηα πξνθαιεί ζήςε ζε θχιια, ζηειέρε θαη ινβνχο ηα νπνία θαιχπηνληαη κε ηελ ηεθξή επάλζεζε ηνπ παζνγφλνπ (Δηθφλα 10), (Haware, 1998). Ο ίδηνο κχθεηαο επζχλεηαη θαη γηα ηε ηήμε ζπνξνθχησλ θαθήο (Morrall et al., 1994) θαη ξεβηζηνχ (Burgess et al., 1997) κεηά απφ ζπνξνκεηάδνζε. ε ηέηνηεο θαιιηέξγεηεο ηα ζπκπηψκαηα εκθαλίδνληαη δηάζπαξηα ζηνλ αγξφ θαη ππφ επλντθέο ζπλζήθεο εμαπιψλνληαη ξαγδαία. Αξθεηά είδε ηνπ γέλνπο Botrytis κεηαμχ ησλ νπνίσλ θαη ν B. cinerea πξνζβάιινπλ θαη θπηά ηεο Οηθνγέλεηαο ησλ Λεηξησδψλ. Γηα παξάδεηγκα ζηα θξεκκχδηα ν Botrytis επζχλεηαη γηα ηελ θαζηαλή θειίδσζε ησλ εμσηεξηθψλ ρηηψλσλ ηνπ βνιβνχ (Clark and Lorbeer 1973). Δηθόλεο Δκθάληζε κεηαζπιιεθηηθήο ζήςεο ζε θαξπνχο θξάνπιαο (9) θαη πξνζπιιεθηηθήο ζήςεο ζε ινβφ κπηδειηνχ (10) θαηφπηλ πξνζβνιήο απφ ην κχθεηα Botrytis cinerea. 8

16 1.2. Βηνινγία O B. cinerea είλαη έλα λεθξνηξνθηθφ θπηνπαζνγφλν ην νπνίν κεηά ηελ πξνζβνιή θαη ην ζάλαην ησλ ηζηψλ ηνπ μεληζηή, κπνξεί λα αλαπηπρζεί θαη λα ζπνξνπνηήζεη ζαλ ζαπξφθπην ζηνπο λεθξνχο ηζηνχο ή λα ζρεκαηίζεη κπθειηαθέο θαηαζθεπέο καθξνρξφληαο επηβίσζεο. Μεηαμχ απηψλ πεξηιακβάλνληαη κπθειηαθέο πθέο, κίθξν- θαη κάθξν- θνλίδηα, ριακπδνζπφξηα, ζθιεξψηηα, απνζήθηα θαη αζθνζπφξηα (Jarvis, 1980b). Απηέο νη δνκέο επηβίσζεο είλαη δπλαηφλ λα ζρεκαηίδνληαη ζε δσληαλά θπηά ή ζε ππνιείκκαηα θπηηθψλ ηζηψλ πνπ βξίζθνληαη ζην έδαθνο θαη απνηεινχλ πεγή κνιχζκαηνο. Πξαθηηθά, θάζε ηκήκα ηνπ ζαιινχ ηνπ κχθεηα κπνξεί λα ιεηηνπξγήζεη σο κηα δνκή επηβίσζεο (Holz et al., 2004). Όια ηα είδε Botrytis, αλάινγα κε ην ζηέιερνο θαη ηηο ζπλζήθεο αλάπηπμεο, ζρεκαηίδνπλ ζθιεξψηηα ηα νπνία κπνξεί λα δηαθέξνπλ ζε κέγεζνο θαη ζρήκα. Σα ζθιεξψηηα ζεσξνχληαη γεληθά νη πην ζεκαληηθέο κπθειηαθέο θαηαζθεπέο πνπ εκπιέθνληαη ζηελ επηβίσζε ηνπ κχθεηα. Μπνξνχλ λα επηβηψζνπλ ππφ δπζκελείο πεξηβαιινληηθέο ζπλζήθεο θαη ζηε ζπλέρεηα λα βιαζηήζνπλ πξνο κπθήιην, πξνο θνληδηνθφξνπο κε θνλίδηα ή θάησ απφ θαηάιιειεο ζπλζήθεο θαη γνληκνπνίεζε, πξνο απνζήθηα (Δηθφλα 11), (Beever and Weeds, 2004; Coley-Smith, 1980). Δηθόλα 11. Βιάζηεζε ζθιεξσηίσλ ηνπ Botrytis cinerea πξνο απνζήθηα (Σέιεηα κνξθή Botryotinia fuckeliana) Μηα άιιε θαηαζθεπή επηβίσζεο ηνπ B. cinerea είλαη ηα ριακπδνζπφξηα. Σα ριακπδνζπφξηα ζρεκαηίδνληαη θαηά θαλφλα ζε γεξαζκέλεο θαιιηέξγεηεο ηνπ κχθεηα θαζψο θαη ζε θαιιηέξγεηεο πνπ επηκνιχλζεθαλ κε άιινπο νξγαληζκνχο. Αλάινγα κε ηηο ζπλζήθεο πεξηβάιινληνο θαη ζξέςεο νη δνκέο απηέο βιαζηάλνπλ δίλνληαο πθή δηάηξεζεο, κηθξνθνλίδηα ή καθξνθνλίδηα (Holz et al., 2004). Σα ριακπδνζπφξηα κπνξνχλ επνκέλσο λα ιεηηνπξγήζνπλ σο δνκέο βξαρππξφζεζκεο επηβίσζεο νη νπνίεο 9

17 ίζσο βνεζνχλ ην κχθεηα λα μεπεξάζεη ζχληνκεο κε επλντθέο πεξηφδνπο αλάπηπμεο (Holz et al., 2004). ε αληίζεζε κε ηα ζθιεξψηηα θαη ηα ριακπδνζπφξηα, ηα θνλίδηα ηνπ B. cinerea ζεσξνχληαη γεληθά σο βξαρχβηεο δνκέο πνιιαπιαζηαζκνχ ζηνλ αγξφ (Δηθφλεο 12-13). Ζ επηβίσζή ηνπο θαζνξίδεηαη ζε κεγάιν βαζκφ απφ ηε ζεξκνθξαζία, ηε δηαζεζηκφηεηα πγξαζίαο, ηε κηθξνβηαθή δξαζηεξηφηεηα θαη ηελ έθζεζε ζην ειηαθφ θσο (Holz et al., 2004). Ο ζεκαληηθφηεξνο φκσο πεξηβαιινληηθφο παξάγνληαο πνπ επεξεάδεη ηε ζλεζηκφηεηα ησλ θνληδίσλ, θαίλεηαη λα είλαη ε ππεξηψδεο (UV) αθηηλνβνιία ηνπ ειηαθνχ θσηφο. Πέξαλ ησλ καθξνθνληδίσλ, ζην B. cinerea παξαηεξείηαη θαη παξαγσγή κηθξνθνληδίσλ ηα νπνία πξνζδίδνπλ κηα ελαιιαθηηθή κνξθή πνιιαπιαζηαζκνχ ηνπ παζνγφλνπ φηαλ απηφ βξεζεί λα αλαπηχζζεηαη ζε δπζκελείο ζπλζήθεο. Γεληθά ηα ζπλαληάκε ζε γεξαζκέλεο θαιιηέξγεηεο ηνπ κχθεηα ή ζε επηκνιπζκέλεο κε άιινπο νξγαληζκνχο (Jarvis, 1980a). Δηθόλεο Κνληδηνθφξνη κε θνλίδηα ηνπ Botrytis cinerea φπσο θαίλνληαη απφ κηθξνζθφπην (12) θαη ειεθηξνληθφ κηθξνζθφπην (13) Ο κχθεηαο B. cinerea είλαη γλσζηφ φηη παξνπζηάδεη έληνλε παξαιιαθηηθφηεηα ζε ζσκαηηθφ, κεηαβνιηθφ αιιά θαη γελεηηθφ επίπεδν (Munoz et al., 2002). Απφγνλνη πξνεξρφκελνη απφ αγελή αλαπαξαγσγή αηνκηθψλ θαιιηεξγεηψλ ηνπ B. cinerea είλαη κεξηθέο θνξέο θαηλνηππηθά δηαθνξεηηθνί (Lorenz, 1983). Απηή ε παξαιιαθηηθφηεηα ηνπ κχθεηα ζπρλά απνδίδεηαη ζηελ πνιπθπηηαξηθή θαη εηεξνθαξπσηηθή θχζε ησλ πθψλ ή ησλ θνληδίσλ ηνπ θαη ζηελ αλεππινεηδή θαηάζηαζε ησλ ππξήλσλ ηνπ (Buttner et al., 1994). Παξ φια απηά, ε εγγελήο αλαπαξαγσγή ηνπ κχθεηα θαίλεηαη φηη δελ παίδεη ζεκαληηθφ ξφιν ζηελ παξαιιαθηηθφηεηα ηνπ B. cinerea ιφγσ ηνπ φηη απηή πνιχ ζπάληα απαληά ζηνλ αγξφ (Faretra et al., 1988b). Όπσο έρεη απνδεηρζεί ν B. fuckeliana είλαη έλα είδνο βαζηθά εηεξνζαιέο κε δχν αιιειφκνξθα γνλίδηα (ΜΑΣ 1-1 θαη ΜΑΣ 1-2) λα ειέγρνπλ ηνλ ηχπν ζχδεπμεο. Ωζηφζν, κεξηθά ζηειέρε είλαη εηεξνθαξπσηηθά σο πξνο ηνλ ηχπν ζχδεπμεο πεξηέρνληαο θαη ηα δχν αιιειφκνξθα γνλίδηα κε απνηέιεζκα λα είλαη απηνγφληκα (δεπηεξνγελψο νκφζαιια) (Faretra and Pollastro, 1993). Δπηβεβαίσζε ηεο ζπνπδαηφηεηαο ηεο εηεξνθαξχσζεο ζηα ζηειέρε ηνπ κχθεηα έξρεηαη απφ κειέηεο ηνπ γνληδίνπ πνπ ειέγρεη ηνλ ηχπν ζχδεπμεο. Οη Faretra et al. (1988a) δηαπίζησζαλ φηη κνλνθνληδηαθέο απνκνλψζεηο απφ νκφζαιιεο απνκνλψζεηο 10

18 αγξνχ είηε παξέκελαλ νκφζαιιεο (δειαδή ήηαλ πηζαλψο εηεξνθάξπα ΜΑΣ 1-1 θαη ΜΑΣ 1-2) ή ζπκπεξηθέξνληαλ σο εηεξφζαιιεο (ήηαλ δειαδή πηζαλψο είηε ΜΑΣ 1-1 ή ΜΑΣ 1-2 νκνθάξπα). Δπίζεο κεξηθέο απνδείμεηο ηεο χπαξμεο θαη ηεο ζεκαζίαο ηεο εηεξνθαξχσζεο πξνθχπηνπλ απφ κειέηεο αλζεθηηθφηεηαο ζε κπθεηνθηφλα. Βξέζεθε φηη κεξηθέο απνκνλψζεηο ηνπ παζνγφλνπ δελ κεηαθέξνπλ πάληα ηελ αλζεθηηθφηεηά ηνπο ζηνπο εγγελείο απνγφλνπο ηνπο ή ε αλζεθηηθφηεηα ράλεηαη απφ κεξηθνχο αγελείο απνγφλνπο. Απηφ δείρλεη φηη νη κεηξηθέο απνκνλψζεηο ήηαλ εηεξνθάξπα κεηαμχ αλζεθηηθψλ θαη επαίζζεησλ λνπθιενηχπσλ (Faretra and Pollastro, 1993, Pollastro et al., 1996). Όπσο πξναλαθέξζεθε ε γελεηηθή παξαιιαθηηθφηεηα ησλ πιεζπζκψλ ηνπ B. cinerea είλαη ηδηαίηεξα πςειή θαη νη πιεζπζκνί κνηάδνπλ ζπρλά κε έλα κείγκα δηαθνξεηηθψλ θπιψλ ρσξίο θακία ζπζρέηηζε κεηαμχ θαηαγσγήο θαη ηδηνηήησλ ησλ θπιψλ (Alfonso et al., 2000). Ζ χπαξμε νκάδσλ βιαζηηθήο ζπκβαηφηεηαο παξέρεη ηε δπλαηφηεηα ππνθαηεγνξηνπνίεζεο (subdividing/sub-structuring) ησλ θπιψλ ηνπ κχθεηα. Φπιέο νη νπνίεο θέξνπλ παλνκνηφηππα αιιειφκνξθα ζε φινπο ηνπο γνληδηαθνχο ηχπνπο είλαη ηθαλέο λα ζρεκαηίζνπλ βηψζηκα εηεξνθάξπα κεηαμχ ηνπο, ραξαθηεξίδνληαη σο βιαζηηθά ζπκβαηέο θαη είλαη κέιε ηεο ίδηαο νκάδαο βιαζηηθήο ζπκβαηφηεηαο (Vegetative Compatibility Group) (Leslie, 1993). Μέιε ηεο ίδηαο νκάδαο βιαζηηθήο ζπκβαηφηεηαο κπνξνχλ λα πθίζηαληαη ζπγρψλεπζε κε δπλαηφηεηα κεηαθνξάο ππξεληθψλ θαη θπηνπιαζκηθψλ ζηνηρείσλ (Korolev et al., 2008). Παξ φια απηά, ε βιαζηηθή αζπκβαηφηεηα ζηνπο πιεζπζκνχο ηνπ B. fuckeliana κπνξεί λα δξα απνηξεπηηθά ζην ζρεκαηηζκφ εηεξνθαξχσλ φπσο έρεη πξνηαζεί θαη γηα άιινπο αζθνκχθεηεο (Delcan and Melgarejo, 2002). Δπίζεο εμσρξσκνζσκηθά ζηνηρεία πηζαλφλ λα εκπιέθνληαη ζηελ παξαιιαθηηθφηεηα θαη εμέιημε ηνπ παζνγφλνπ. Οη κχθεηεο γεληθά θαη ν B. cinerea εηδηθφηεξα, δηαζέηνπλ κηα πνηθηιία εμσρξσκνζσκηθψλ γελεηηθψλ ζηνηρείσλ ζπκπεξηιακβαλφκελσλ ησλ κηηνρνλδξίσλ, ηψλ, πιαζκηδίσλ θαη κεηαζεηψλ ζηνηρείσλ (Rosewich and Kister, 2000). Πέξαλ ησλ κηηνρνλδξίσλ, ηα ππφινηπα ζηνηρεία γεληθά ζεσξνχληαη πεξηηηά γηα ην θχηηαξν θαη ζπκπεξηθέξνληαη σο «εγσηζηηθά γελεηηθά ζηνηρεία». Κάπνηα απφ απηά ηα ζηνηρεία έρνπλ ηε δπλαηφηεηα λα ελζσκαηψλνληαη ζηα ρξσκνζψκαηα θαη ίζσο δηαδξακαηίδνπλ έλα ζεκαληηθφ καθξνπξφζεζκν ξφιν ζηελ εμέιημε ηνπ παζνγφλνπ. (Kidwell and Lisch, 2001) Δπηδεκηνινγία Σν κφιπζκα ηνπ B. cinerea ζεσξείηαη γεληθά φηη ππάξρεη ζπλερψο ζην πεξηβάιινλ ηνπ αγξνχ θαη φηη ε παξαγσγή, απειεπζέξσζε θαη δηαζπνξά ηνπ είλαη κηα ζπλερήο δηαδηθαζία (Jarvis, 1980b). Ο κχθεηαο B. cinerea κπνξεί λα δηαρεηκάζεη σο κπθήιην ζε λεθξφ ή δσληαλφ θπηηθφ πιηθφ ή σο ζθιεξψηηα ζε θπηηθά ππνιείκκαηα ζηελ επηθάλεηα ηνπ εδάθνπο ή ζακκέλα ζην έδαθνο (Strømeng et al. 2009). Απφ απηέο ηηο κνξθέο δηαρείκαζεο ζα πξνθχςνπλ αξγά ην ρεηκψλα θαη λσξίο 11

19 ηελ άλνημε θνληδηνθφξνη κε θνλίδηα ηα νπνία ζα απνηειέζνπλ ην αξρηθφ κφιπζκα ζηνλ αγξφ. Οη Strømeng et al. (2009) ζε πξφζθαηε εξγαζία ηνπο απέδεημαλ φηη ζηε Ννξβεγία ηα ππνιείκκαηα ησλ θπηψλ θξάνπιαο είλαη ε πην ζεκαληηθή πεγή θνληδίσλ ηελ άλνημε θαη έηζη, ηα κέηξα ειέγρνπ ηεο αζζέλεηαο πξέπεη λα ζηνρεχνπλ ζε απηά ηα πιηθά. ε ακπειψλεο ηεο Καιηθφξληαο ε παξαγσγή θνληδίσλ αξρίδεη απφ ζθιεξψηηα θαη κπθήιην ηα νπνία δηαηεξνχληαη ζε βφηξεηο πνπ παξέκεηλαλ ζηηο θιεκαηίδεο θαζψο θαη ζε κίζρνπο θχιισλ θαη ειάζκαηα πνπ βξίζθνληαη ζην έδαθνο ηνπ ακπειψλα (Elmer and Michailides, 2004). Παξφκνηεο πεγέο κνιχζκαηνο εληνπίδνληαη θαη ζε νπσξψλεο αθηηληδίσλ φπνπ παξαηεξείηαη άθζνλε ζπνξνπνίεζε ζε γεξαζκέλα θχιια δηδαλίσλ, ζε λεθξά θχιια θαη ππνιείκκαηα θαξπψλ ζην έδαθνο θαη ζπαληφηεξα ζε ππνιείκκαηα αλζηθψλ ηζηψλ αξζεληθψλ δέλδξσλ (Δηθφλα 14) (Michailides and Elmer, 2000). Πέξαλ ησλ θπηηθψλ ππνιεηκκάησλ, πεγή κνιχζκαηνο δχλαηαη λα απνηειέζνπλ θαη κνιπζκέλνη ζπφξνη ζε νξηζκέλεο θαιιηέξγεηεο. ε ζπφξνπο ξεβηζηνχ γηα παξάδεηγκα, ν B. cinerea βξέζεθε λα επηβηψλεη γηα ηνπιάρηζηνλ 5 ρξφληα (Grewal and Laha, 1983). Δηθόλα 14. Βηνινγηθφο θχθινο ηνπ κχθεηα Botrytis cinerea ζε θαιιηέξγεηα αθηηληδίνπ (Michailides and Elmer, 2000) Γηα λα επηηχρεη ην παζνγφλν κφιπλζε, πξέπεη λα κεηαθηλεζεί απφ ηελ αξρηθή πεγή ζε επαίζζεην πξνο κφιπλζε ηζηφ. Κάζε ηκήκα ηνπ ζαιινχ ηνπ κχθεηα (κπθήιην, θνλίδηα, ριακπδνζπφξηα, ζθιεξψηηα θαη αζθνζπφξηα) δχλαηαη λα ιεηηνπξγήζεη σο κνλάδα δηαζπνξάο θαη κφιπλζεο. Οη πξναλαθεξζείζεο κνιπζκαηηθέο κνλάδεο ηνπ παζνγφλνπ δηαζπείξνληαη κε ηνλ άλεκν, ηε βξνρή θαη ηα έληνκα. Ωζηφζν, ηα αεξνκεηαθεξφκελα θνλίδηα ζεσξνχληαη γεληθψο ε πην ζεκαληηθή κνιπζκαηηθή κνλάδα ηνπ B. cinerea. Πέξαλ φκσο ηνπ αλέκνπ θαη ε βξνρή έρεη 12

20 ζπζρεηηζηεί κε πςειέο ζπγθεληξψζεηο αεξνκεηαθεξφκελσλ θνληδίσλ θαζψο επεξεάδεη ηελ ειεπζέξσζή ηνπο. Φαίλεηαη φηη νη ζηαγφλεο βξνρήο ρηππψληαο ζηνπο πξνζβεβιεκέλνπο θπηηθνχο ηζηνχο απειεπζεξψλνπλ μεξά θνλίδηα ηα νπνία ζηε ζπλέρεηα κπνξνχλ λα κεηαθεξζνχλ κε ηα ζηαγνλίδηα (Jarvis, 1962). Δπίζεο, σο θνξείο ηνπ παζνγφλνπ αλαθέξνληαη θαη αξθεηά έληνκα ηα νπνία θπξίσο κε ηελ ηξνθηθή ηνπο δξαζηεξηφηεηα πξνζιακβάλνπλ θαη κεηαθέξνπλ ηκήκαηα ζαιινχ ηνπ κχθεηα. ε δηάθνξεο εξγαζίεο ππνζηεξίδεηαη φηη θνλίδηα ηνπ κχθεηα δχλαηαη λα παγηδεπηνχλ ζηελ επηδεξκίδα, ζσκαηηθέο ηξίρεο θαη αλάγιπθεο πεξηνρέο ηνπ ζψκαηνο δηαθφξσλ εληφκσλ πνπ ζρεηίδνληαη κε μεληζηέο ηνπ B. cinerea. Σέηνηα έληνκα είλαη ε Δπδεκίδα ηεο ακπέινπ, Lobesia botrana (Fermand and Le Menn, 1989), ν ζξίπαο Thrips obscuratus (Schmidt et al., 2007) θαη ε κχγα ηεο Μεζνγείνπ, Ceratitis capitata (Engelbrecht, 2002). Δηδηθφηεξα, ε κχγα ηεο Μεζνγείνπ θαίλεηαη λα έρεη ηελ ηάζε λα ηξέθεηαη ζε ιησκέλνπο ηζηνχο θαξπψλ κε απνηθίεο ηνπ B. cinerea, θάηη πνπ θάλεη ην έληνκν έλα ηδαληθφ θνξέα ηνπ παζνγφλνπ (Holz et al., 2004). Δπίζεο, νη Louis et al. (1996), απέδεημαλ φηη θνλίδηα ηνπ κχθεηα πνπ πξνζιακβάλνληαη απφ ηε Drosophila melanogaster βιαζηάλνπλ ζην πξφζζην έληεξν ηνπ εληφκνπ θαη αλαπηχζζνληαη ζε κπθήιην. Σν ηειεπηαίν δηαθνξνπνηείηαη ζε κηθξνζθιεξψηηα ηα νπνία κεηαθέξνληαη απφ ην έληνκν θαζ φιε ηε δηάξθεηα ηεο δσήο ηνπ. Ληγφηεξν ζεκαληηθή αιιά φρη ακειεηέα είλαη θαη ε ζπλεηζθνξά άιισλ ηκεκάησλ ηνπ ζαιινχ ηνπ κχθεηα ζηε δηαζπνξά ηνπ φπσο είλαη γηα παξάδεηγκα ηα αζθνζπφξηα, ηα ριακπδνζπφξηα αιιά θαη ηκήκαηα πξνζβεβιεκέλσλ θπηηθψλ ηζηψλ. Σέηνηνη ηζηνί εθηφο απφ κνλάδεο δηαζπνξάο ηνπ παζνγφλνπ κπνξεί λα απνηειέζνπλ θαη ζέζεηο γηα παξαγσγή επηπιένλ γελεψλ θνληδίσλ (Holz et al., 2004). Τςειή ζρεηηθή πγξαζία, ειεχζεξε πγξαζία ζηηο θπηηθέο επηθάλεηεο θαη ελδηάκεζεο ζεξκνθξαζίεο ζεσξνχληαη νη πην ζεκαληηθνί πεξηβαιινληηθνί παξάγνληεο γηα ηελ έλαξμε ηεο πξνζβνιήο απφ ην κχθεηα (O Neill et al., 1997). Πξάγκαηη, ν ξφινο ηεο κεκβξάλεο λεξνχ ζηε βιάζηεζε θαη κφιπλζε έρεη απφ θαηξφ αλαγλσξηζζεί. Ωζηφζν, είλαη ελδηαθέξνλ φηη ην παζνγφλν έρεη αλαπηχμεη ηελ ηθαλφηεηα λα κνιχλεη θπηά αθφκε θαη απνπζία κεκβξάλεο λεξνχ (Elad, 2004). Ο B. cinerea ζπλήζσο δηαπεξλά ηνπο ηζηνχο ηνπ μεληζηή ηνπ είηε κέζσ πιεγήο ή κέζσ θπζηθψλ αλνηγκάησλ. Όκσο, ν κχθεηαο έρεη ηε δπλαηφηεηα λα δηαπεξλά άκεζα ηελ επηδεξκίδα ησλ θπηψλ κέζσ ελδπκηθήο δηάζπαζεο (Cotoras and Silva, 2005) θαζψο παξάγεη ρηηηλάζεο, πεθηηλνιπηηθά έλδπκα φπσο ε κέζπιν-εζηεξάζε ηεο πεθηίλεο θαη ε πεθηηλνιηάζε, θαη έλαλ αξηζκφ δηάθνξσλ πνιπγαιαθηνπξνλαζψλ, πξσηεαζψλ θαη ιαθαζψλ (Cotoras and Silva, 2005). Γεληθά, νπνηνζδήπνηε παξάγνληαο (βηνηηθφο ή αβηνηηθφο) ν νπνίνο κπνξεί λα πξνθαιέζεη πιεγέο ή εμαζζέλεζε ζε θπηηθνχο ηζηνχο δηεπθνιχλεη ηελ πξνζβνιή απφ ην κχθεηα. ηελ θαιιηέξγεηα ηνκάηαο ζεξκνθεπίνπ νη πιεγέο θιαδέκαηνο γηα απνκάθξπλζε θχιισλ θαη καζραιηαίσλ νθζαικψλ επζχλνληαη γηα ηηο πξνζβνιέο ησλ ζηειερψλ (Δηθφλα 15) (Decognet et al., 2009). Έλα θαηλφκελν πνπ ζρεηίδεηαη κε ηηο πξνζβνιέο ηνπ Botrytis, είλαη ε ηθαλφηεηα ηνπ παζνγφλνπ λα παξακέλεη αλελεξγφ (ζε ιαλζάλνπζα θαηάζηαζε) εληφο ησλ ηζηψλ ηνπ μεληζηή γηα δηάθνξα ρξνληθά δηαζηήκαηα θαηά ηε δηάξθεηα ηεο θαιιηεξγεηηθήο πεξηφδνπ κέρξη θαη ηε ζπγθνκηδή ησλ θαξπψλ, πξνθαιψληαο ηηο ιεγφκελεο ιαλζάλνπζεο κνιχλζεηο (Elad, 2004). ηα 13

21 αθηηλίδηα, κειέηεο κνιπζκαηηθφηεηαο απέδεημαλ ηε ζπζρέηηζε κεηαμχ απνηθηζκνχ γεξαζκέλσλ αλζηθψλ ηζηψλ ηελ άλνημε θαη ηεο εκθάληζεο κεηαζπιιεθηηθήο ζήςεο ηνπ θαξπνχ ζηελ πεξηνρή ηνπ πνδίζθνπ (stem-end rot) (Δηθφλα 16) (Beever et al,. 1984). Καηά ηε δηάξθεηα ηεο αλζνθνξίαο ησλ αθηηληδίσλ, ηα πέηαια θαη νη αλζήξεο κνιχλνληαη θαη πηζηεχεηαη φηη απηνί νη ηζηνί παξέρνπλ ην κφιπζκα γηα ηηο κνιχλζεηο ησλ ζεπάισλ θαη ηεο αλζνδφρεο. Σα ζέπαια παξακέλνπλ εππαζή θαζ φιε ηε βιαζηηθή πεξίνδν κέρξη ηελ ζπγθνκηδή ησλ θαξπψλ. Οη κνιχλζεηο ησλ ζέπαισλ θαη ηεο αλζνδφρεο παξακέλνπλ ζε ιαλζάλνπζα κνξθή εθφζνλ δελ ππάξρνπλ νξαηά ζπκπηψκαηα (Michailides and Elmer, 2000). Δπηπιένλ, πιεγέο ζηελ επηθάλεηα ησλ θαξπψλ αθηηληδίνπ πνπ πξνθιήζεθαλ απφ θαθέο πξαθηηθέο ρεηξηζκνχ θαηά ηε ζπγθνκηδή, κπνξνχλ λα απνηειέζνπλ ζεκεία εηζφδνπ γηα ην παζνγφλν ην νπνίν ζα πξνθαιέζεη ζηελ ζπλέρεηα ηηο πιεπξηθέο ζήςεηο ( side rot ). Όκσο, απηφο ν ηχπνο πξνζβνιήο ησλ αθηηληδίσλ είλαη κηθξήο ζεκαζίαο (Michailides and Elmer, 2000). Δηθόλεο Έλαξμε πξνζβνιήο ηνπ κχθεηα Botrytis cinerea ζε θπηφ ηνκάηαο απφ πιεγή ζε πιεπξηθφ βιαζηφ (15) θαη πξφθιεζε κεηαζπιιεθηηθήο ζήςεο ζε θαξπφ αθηηληδίνπ ζηελ πεξηνρή ηνπ πνδίζθνπ (stem-end rot) (16). ηα ζηαθχιηα νη αξρηθέο κνιχλζεηο πξαγκαηνπνηνχληαη θαηά ηελ άλζεζε κέζσ απνηθηζκνχ ησλ άθζνλσλ λεθξψλ αλζηθψλ ππνιεηκκάησλ (Δηθφλα 17) (Martinez et al., 2005). Πέξαλ απηήο ηεο νδνχ, κνιχλζεηο θαξπψλ πξαγκαηνπνηνχληαη θαη κέζσ ηνπ πνδίζθνπ ησλ ξαγψλ. Μειέηεο έδεημαλ φηη ην κεγαιχηεξν πνζνζηφ ησλ κεηαζπιιεθηηθψλ πξνζβνιψλ ζηα ζηαθχιηα πξνεξρφηαλ απφ κνιχλζεηο ησλ βφηξεσλ θαηά ηελ έλαξμε ηεο άλζεζεο θαη θαηά ηελ πιήξε άλζεζε (Michailides et al., 2000). 14

22 Δηθόλα 17. Ο βηνινγηθφο θχθινο ηνπ κχθεηα Botrytis cinerea ζην ακπέιη (Elmer and Michailides, 2007) 1.4. Καηαπνιέκεζε Ο ρεκηθφο έιεγρνο παξακέλεη κέρξη θαη ζήκεξα ν θπξηφηεξνο ηξφπνο αληηκεηψπηζεο θαη κείσζεο ηεο ζπρλφηεηαο εκθάληζεο ηνπ B. cinerea. Οη πην θνηλέο επεκβάζεηο πεξηιακβάλνπλ ςεθαζκφ ησλ ελαέξησλ ηκεκάησλ ησλ θπηψλ κε κπθεηνθηφλα. Δπεκβάζεηο κε κπθεηνθηφλα γίλνληαη επίζεο ζε ζπφξνπο θαη βνιβνχο θαζψο θαη ζε ζπγθνκηζκέλνπο θαξπνχο πνπ πξννξίδνληαη γηα καθξνρξφληα ζπληήξεζε. Ο αξηζκφο ησλ επεκβάζεσλ θαηά ηε δηάξθεηα κηαο θαιιηεξγεηηθήο πεξηφδνπ θπκαίλεηαη απφ κηα κε δχν κέρξη πέξαλ ησλ είθνζη (Leroux, 2004). Παξ φια απηά ηα ηειεπηαία ρξφληα ππάξρνπλ θάπνηνη πεξηνξηζκνί ζην ρεκηθφ έιεγρν ηνπ κχθεηα ιφγσ αλάπηπμεο αλζεθηηθφηεηαο ζε αξθεηά βνηξπδηνθηφλα θαη ιφγσ ηεο αξλεηηθήο αληίιεςεο ηνπ θνηλνχ πνπ ζρεηίδεηαη κε ηελ αζθάιεηα ησλ βηνθηφλσλ. Γηεμνδηθφηεξε αλαθνξά ζηε ρεκηθή θαηαπνιέκεζε ηεο αζζέλεηαο θαη ζηνπο πεξηνξηζκνχο πνπ απηή ππφθεηηαη ζα γίλεη ζην αληίζηνηρν εηζαγσγηθφ θεθάιαην 3.1. Πέξαλ ηεο ρεκηθήο θαηαπνιέκεζεο, ζεκαληηθή ζπλεηζθνξά ζην πεξηνξηζκφ ηεο αζζέλεηαο έρνπλ ηα θαιιηεξγεηηθά κέηξα θαη ηα κέηξα πγηεηλήο ηα νπνία επεξεάδνπλ άκεζα ή έκκεζα ηνπο παξάγνληεο πξνδηάζεζεο ησλ ηζηψλ ηνπ μεληζηή ζε πξνζβνιέο ηνπ παζνγφλνπ (Δηθφλα 18-19). Γηα παξάδεηγκα ε πεξίζζηα ή ε έιιεηςε θάπνησλ ζξεπηηθψλ ζηνηρείσλ (π.ρ. άδσην θαη αζβέζηην) επεξεάδεη έκκεζα ηελ εππάζεηα ησλ 15

23 ηζηψλ ηνπ μεληζηή ζην κχθεηα (Elmer and Michailides, 2004). Δπίζεο, ηα κνξθνινγηθά, αλαηνκηθά θαη ρεκηθά ραξαθηεξηζηηθά ππνθεηκέλνπ θαη πνηθηιίαο ζην ακπέιη, ζεσξνχληαη απφ ηνπο ζεκαληηθφηεξνπο παξάγνληεο πνπ επεξεάδνπλ ηελ εθδήισζε επηδεκηψλ ηνπ B. cinerea (Mlikota Gabler et al., 2003; Ferreira and Marais,1987). ην ακπέιη, ε ππθλφηεηα ηεο θφκεο ησλ πξέκλσλ έρεη ζρεηηζηεί κε απμεκέλεο πξνζβνιέο απφ ην κχθεηα (Steel, 2001), ελψ ζηα αθηηλίδηα κε ην πνζνζηφ κεηαζπιιεθηηθήο ζήςεο θαηά ηε ζπληήξεζε ζε ςπθηηθνχο ζαιάκνπο (Michailides and Elmer, 2000). Ωο εθ ηνχηνπ, θαιιηεξγεηηθέο ηερληθέο φπσο θιάδεκα θαη αθαίξεζε θχιισλ ζηε δψλε θνληά ζηνπο θαξπνχο, απμάλνπλ ηνλ αεξηζκφ θαη ην θσηηζκφ ηεο θφκεο ησλ θπηψλ απνηξέπνληαο ηελ αλάπηπμε επλντθψλ ζπλζεθψλ γηα ην B. cinerea. Μηα απφ ηηο ελαιιαθηηθέο κεζφδνπο γηα έιεγρν ηνπ Botrytis πνπ εθαξκφδεηαη ζηηο θαιιηέξγεηεο ζεξκνθεπίσλ είλαη ε πξφιεςε ζρεκαηηζκνχ πγξαζίαο ζηα θπηά κε ζέξκαλζε θαη αεξηζκφ (Morgan, 1984). ηε Ννξβεγία, ηα θπηηθά ππνιείκκαηα θξάνπιαο ζεσξνχληαη σο ε ζεκαληηθφηεξε πεγή θνληδίσλ ηνπ B. cinerea ηελ άλνημε ζηε θαιιηέξγεηα θαη έηζη, ηα κέηξα γηα ηελ αληηκεηψπηζε ηνπ κχθεηα πξέπεη λα ζηνρεχνπλ ζηε κείσζή ηνπο. ε απηή ηε πεξίπησζε ε απνκάθξπλζε ηνλ ππνιεηκκάησλ κείσζε ηελ εθδήισζε ηεο αζζέλεηαο ηελ επφκελε ρξνληά (Strømeng et al. 2009). Δηθόλεο Καιιηέξγεηα ηνκάηαο κε ειιηπή θαιιηεξγεηηθά κέηξα θαη κέηξα πγηεηλήο (18) θαη πξφηππε ζεξκνθεπηαθή θαιιηέξγεηα ηνκάηαο κε ζπζηήκαηα ςχμεο, ζέξκαλζεο θαη αλαθχθισζεο ηνπ αέξα θαη εμαεξηζκνχ γηα ξχζκηζε ηεο ζεξκνθξαζίαο θαη πγξαζίαο ηνπ ζεξκνθεπίνπ (19) Δπίζεο, ελαιιαθηηθέο ζηξαηεγηθέο ειέγρνπ ηεο αζζέλεηαο, φπσο είλαη ν βηνινγηθφο έιεγρνο, θαίλνληαη αξθεηά ππνζρφκελεο θαζψο έρνπλ ην πιενλέθηεκα ηηο θαιχηεξεο απνδνρήο απφ ην θνηλφ θαη ηεο κεησκέλεο πεξηβαιινληηθήο επηβάξπλζεο (Duncan, 1991). Ο βηνινγηθφο έιεγρνο πξνζθέξεη κηα ειθπζηηθή ελαιιαθηηθή ή ζπκπιεξσκαηηθή κέζνδν ηεο ζπκβαηηθήο γηα έιεγρν ησλ αζζελεηψλ θαζψο νη κηθξνβηαθνί παξάγνληεο βηνειέγρνπ ζεσξνχληαη ιηγφηεξν επηβιαβείο ζην πεξηβάιινλ θαη γεληθά ν ζχλζεηνο ηξφπνο δξάζεο ηνπο κεηψλεη ηνλ θίλδπλν αλάπηπμεο αλζεθηηθφηεηαο (Elad and Stewart, 2004). Γέλε κηθξννξγαληζκψλ πνπ έρνπλ δείμεη ηε κεγαιχηεξε ηθαλφηεηα βηνινγηθνχ ειέγρνπ ηεο αζζέλεηαο πνπ πξνθαιεί ν B. cinerea πεξηιακβάλνπλ ηνπο κχθεηεο Trichoderma, Gliocladium θαη Ulocladium, ηα 16

24 βαθηήξηα Bacillus θαη Pseudomonas θαη ηηο δχκεο Pichia θαη Candida. Δκπνξηθή επηηπρία έρεη επηηεπρζεί ζην ζεξκνθήπην θαη ζε κεηαζπιιεθηηθά πεξηβάιινληα φπνπ νη ζηαζεξέο πεξηβαιινληηθέο ζπλζήθεο επηηξέπνπλ κεγαιχηεξν έιεγρν θαηά ηελ εθαξκνγή ηνπ βηνινγηθνχ παξάγνληα θαη έθθξαζε ηεο βηνινγηθήο ηνπ δξάζεο. Ωζηφζν, έρεη γίλεη ζεκαληηθή πξφνδνο θαη ζηελ επίηεπμε πην ζηαζεξνχ βηνινγηθνχ ειέγρνπ θάησ απφ ζπλζήθεο αγξνχ (Elad and Stewart, 2004). Δηθόλα 20. Βηνινγηθφο έιεγρνο ηνπ Botrytis cinerea ζε θπηά βεγφληαο. Απφ δεμηά πξνο αξηζηεξά: θπηά πνπ δελ δέρζεθαλ θακία επέκβαζε (Un), θπηά πνπ δέρζεθαλ επέκβαζε κε CaCl 2 (CaCl 2 ), κε chlorothalonil (Fung), θαη θπηά πνπ δέρζεθαλ επέκβαζε κε ην παξάγνληα βηνειέγρνπ Trichoderma hamatum T

25 2. Γελεηηθή δνκή πιεζπζκώλ ηνπ κύθεηα Botrytis cinerea από δηάθνξνπο μεληζηέο ζηελ Διιάδα 2.1. Δηζαγσγή Πεγέο γελεηηθήο παξαιιαθηηθόηεηαο ηνπ κύθεηα Botrytis cinerea Μέρξη θαη ηα ηέιε ηνπ 20 νπ αηψλα ήηαλ γεληθά παξαδεθηφ φηη ν κχθεηαο B. cinerea δελ παξνπζίαδε εμεηδίθεπζε σο πξνο ηνπο μεληζηέο ηνπ, ιφγσ ηνπ γεγνλφηνο φηη ήηαλ δπλαηφλ λα απνκνλσζεί απφ δηάθνξα θπηά ζηε θχζε (Δηθφλεο 21-26), ελψ ε κφιπλζε κπνξνχζε λα αλαπαξαρζεί ζην εξγαζηήξην πάλσ ζε έλα επξχ θάζκα μεληζηψλ (Jarvis, 1980b). Οη αλαθνξέο ζε ζσκαηηθή, κεηαβνιηθή θαη γελεηηθή παξαιιαθηηθφηεηα ηνπ κχθεηα απνδίδνληαλ ζηελ εηεξνθαξχσζε θαη αλεππινεηδία (Munoz et al., 2002). Δπίζεο, ήηαλ παξαδεθηφ φηη ε εγγελήο αλαπαξαγσγή δελ επεξέαδε, ζε κεγάιν βαζκφ, ηελ παξαιιαθηηθφηεηα ηνπ παζνγφλνπ εμαηηίαο ηνπ γεγνλφηνο φηη ε εγγελήο θάζε ζπάληα παξαηεξείηαη ζηε θχζε (Jarvis, 1980b). Δηθόλεο Αλάπηπμε πξνζβνιήο ηνπ κχθεηα Botrytis cinerea ζε δηάθνξνπο μεληζηέο [ζηαθχιη (21), θαξπφ ηνκάηαο (22), κήιν (23), ζηάρπ ζηηαξηνχ (24), ινβφ κπηδειηνχ (25) θαη βνιβφ θξεκκπδηνχ (26)] Παξ φια απηά, λεφηεξεο κειέηεο γελεηηθήο ησλ πιεζπζκψλ ηνπ κχθεηα απεθάιπςαλ φηη ν B. cinerea πηζαλψο απνηειείηαη απφ έλα ζχκπιεγκα ζπλππαξρφλησλ εηδψλ, κε πεξηνξηζκέλε ξνή γνληδίσλ κεηαμχ δηαθνξεηηθψλ 18

26 απφθξπθσλ γελεηηθψλ νκάδσλ (Fournier and Giraud, 2008). Οη Giraud et al. (1999) θαη νη Muñoz et al. (2002) απέδεημαλ φηη ππάξρνπλ ζεκαληηθέο γελεηηθέο δηαθνξέο κεηαμχ απνκνλψζεσλ ηνπ κχθεηα πνπ πξνέξρνληαλ απφ δηάθνξα θπηά-μεληζηέο ζηε Γαιιία θαη Υηιή, αληίζηνηρα. Οη Ma θαη Michailides (2005a), κειεηψληαο απνκνλψζεηο ηνπ κχθεηα απφ ηελ Καιηθφξληα, κε ηε ρξήζε κηθξνδνξπθφξσλ, απέδεημαλ ηελ χπαξμε ζεκαληηθψλ γελεηηθψλ δηαθνξψλ εληφο ηνπ πιεζπζκνχ ηνπ B. cinerea πνπ πξνέξρνληαλ απφ θάζε μεληζηή θαη φρη κεηαμχ ησλ δηάθνξσλ μεληζηψλ ηνπ. Σέηνηα ςειά επίπεδα γελεηηθήο παξαιιαθηηθφηεηαο ζηνπο πιεζπζκνχο ηνπ B. cinerea κπνξεί λα πξνθχςνπλ θπξίσο απφ: (i) ηελ εηεξνθαξχσζε θαη ηελ αλεππινεηδία, νη νπνίεο είλαη επξέσο απνδεθηέο σο ζεκαληηθέο πεγέο παξαιιαθηηθφηεηαο ηνπ κχθεηα (Buttner et al., 1994; Van Der Vlugt-Bergmans et al., 1993), (ii) ηελ εγγελή αλαπαξαγσγή, ε νπνία έρεη αλαθεξζεί ζε πιεζπζκνχο ηνπ κχθεηα ζηε Γαιιία (Giraud et al., 1999), ζηελ Ηζπαλία (Vallejo et al., 2002), ζηελ Ηηαιία (Baraldi et al., 2002) θαη ζηελ Οπγγαξία (Varzy et al., 2008), (iii) ηελ παξνπζία θαη δξαζηεξηφηεηα κεηαζεηψλ ζηνηρείσλ θαη εμσρξσκνζσκηθψλ γελεηηθψλ ζηνηρείσλ φπσο είλαη ε παξνπζία ηνζσκαηίσλ (κπθεηνηψλ) θαη κηηνρνλδξίσλ (Beever and Weeds, 2004) θαη (iv) ηηο απζφξκεηεο κεηαιιάμεηο (Ma and Michailidis, 2005b) Μεηαζεηά ηνηρεία (Transposable Elements) Σα κεηαζεηά ζηνηρεία (transposable elements, TE s) είλαη αιιεινπρίεο DNA, νη νπνίεο κπνξνχλ λα θηλεζνχλ ζε δηάθνξεο ζέζεηο εληφο ηνπ γνληδηψκαηνο ελφο θπηηάξνπ κε κηα δηαδηθαζία πνπ θαιείηαη κεηάζεζε (transposition). Σα TE s βξίζθνληαη ζε πξνθαξπσηηθνχο θαη επθαξπσηηθνχο νξγαληζκνχο, ηφζν ζε θπηά φζν θαη ζε δψα (Daboussi, 1997). Αξρηθά, αλαθαιχθζεθαλ ζην θαιακπφθη ηε δεθαεηία ηνπ 1940 απφ ηελ Barbara McClintock (McClintock, 1950). Ζ πξψηε αλαθνξά χπαξμεο TE s ζε γνληδίσκα κχθεηα έγηλε απφ ηνλ Boeke ην 1989 ζηε δχκε Saccharomyces cerevisiae θαη απφ ηνλ Oliver ην 1992 ζε κπθειηαθνχο κχθεηεο (Boeke, 1989; Oliver, 1992 ). Τπάξρεη κηα πνηθηιία θηλεηψλ γελεηηθψλ ζηνηρείσλ ε νπνία ρσξίδεηαη ζε δχν βαζηθέο θιάζεηο (Κιάζε Η θαη Κιάζε ΗΗ) κε βάζε ην κεραληζκφ κεηάζεζεο πνπ ρξεζηκνπνηείηαη (Favaro et al., 2005). ηελ θιάζε I ηα TE s ή ξεηξνκεηαζέηεο (retrotransposons) κε κηα δηαδηθαζία «αληηγξαθήο θαη επηθφιιεζεο» (copy and paste), αληηγξάθνπλ ηνλ εαπηφ ηνπο αξρηθά κεηαγξαθφκελα ζε RNA, ζηε ζπλέρεηα κε αληίζηξνθε κεηαγξαθή μαλά ζε DNA θαη ηέινο εηζέξρνληαη ζε άιιε ζέζε ηνπ γνληδηψκαηνο. ηελ θιάζε II ηα TE s ή DNA κεηαζέηεο (DNA transposons) θηλνχληαη απφ κηα ζέζε ζε άιιε εληφο ηνπ γνληδηψκαηνο κε κηα δηαδηθαζία «θνπήο θαη επηθφιιεζεο» (cut and paste) ρξεζηκνπνηψληαο ην έλδπκν ηξαλζπνδάζε (transposase) (Δηθφλα 27). Αληίζηνηρα ηα TE s ηεο θιάζεο I ρξεζηκνπνηνχλ ην έλδπκν ηεο αληίζηξνθεο κεηαγξαθάζεο (reverse transcriptase) θαηά ηελ αληίζηξνθε κεηαγξαθή απφ RNA ζε DNA (Madigan and Martinko, 2006). 19

27 Δηθόλα 27. Γηαδηθαζία κεηάζεζεο DNA γελεηηθψλ ζηνηρείσλ ηεο θιάζεο II. ην Α θαίλεηαη ε αξρηθή ζέζε ηνπ DNA-κεηαζέηε (transposon) ζην γνληδίσκα, ζην Β ην έλδπκν ηξαλζπνδάζε θαηαιχεη ηε δηαδηθαζία «θνπήο θαη επηθφιιεζεο» ηνπ DNA-κεηαζέηε θαη ζην Γ θαίλεηαη ε λέα ζέζε ηνπ DNA-κεηαζέηε ζην γνληδίσκα Οη θπξηφηεξεο κεηαβνιέο νη νπνίεο πξνθχπηνπλ απφ ηελ παξνπζία ηέηνησλ ζηνηρείσλ ζην γνληδίσκα ησλ νξγαληζκψλ είλαη: (i) αιιαγέο ζηελ έθθξαζε γνληδίσλ ιφγσ παξεκπφδηζεο ηεο κεηαγξαθήο θάπνηνπ γνληδίνπ ή κεηαβνιήο ηνπ κνηίβνπ κεηαγξαθήο, (ii) αιιαγέο ζηελ λνπθιενηηδηθή αιιεινπρία γνληδίσλ θαη (iii) ρξσκνζσκηθέο αλαθαηαηάμεηο (Favaro et al., 2005). Απηέο νη αιιαγέο αλαθέξνληαη σο γελεηηθά νπδέηεξεο, παξ φια απηά κπνξνχλ επίζεο λα νδεγήζνπλ ζε γελεηηθνχο ζπλδπαζκνχο ζεκαληηθνχο γηα ηελ πξνζαξκνγή ζε έλα ζπλερψο κεηαβαιιφκελν πεξηβάιινλ. Λίγα είλαη γλσζηά ζρεηηθά κε ην κεραληζκφ ν νπνίνο ειέγρεη ηε δξαζηεξηφηεηα ησλ TE s ζηνπο κχθεηεο, σζηφζν λεφηεξεο κειέηεο δείρλνπλ φηη απηά κπνξεί λα ελεξγνπνηεζνχλ ζε ζπλζήθεο θαηαπφλεζεο θαη λα ζηγεζνχλ κε επηγελεηηθέο δηαδηθαζίεο (Favaro et al., 2005). Πξψηνη νη Diolez et al. (1995) κειεηψληαο ηελ γελεηηθή παξαιιαθηηθφηεηα ηνπ B. cinerea απέδεημαλ ηελ χπαξμε ελφο κεηαζεηνχ ζηνηρείνπ ηεο θιάζεο I (retrotransposons), ηνπ Boty, ζην γνληδίσκα νξηζκέλσλ απνκνλψζεσλ. Γχν ρξφληα αξγφηεξα νη Giraud et al. (1997) δηαπίζησζαλ ηελ χπαξμε θαη δεχηεξνπ κεηαζεηνχ ζηνηρείνπ ηεο θιάζεο II (DNA transposons), ηνπ Flipper, ζην γνληδίσκα απνκνλψζεσλ ηνπ κχθεηα. ηελ ίδηα εξγαζία νη Giraud et al. πξνηείλνπλ ην δηαρσξηζκφ ησλ απνκνλψζεσλ ηνπ B. cinerea ζε δχν νκάδεο κε βάζε ηελ παξνπζία ε 20

28 απνπζία ησλ δχν κεηαζεηψλ ζηνηρείσλ ζην γνληδίσκα ηνπο: B. cinerea var transposa (απνκνλψζεηο θαη κε ηα δχν κεηαζεηά ζηνηρεία) θαη B. cinerea var vacuma (απνκνλψζεηο ρσξίο κεηαζεηά ζηνηρεία). Παξ φιν πνπ έρεη απνδεηρζεί ε γεσγξαθηθή ζπλχπαξμε θαη ησλ δχν ηχπσλ ηνπ B. cinerea (transposa και vacuma) ζε δηάθνξνπο μεληζηέο (Giraud et al., 1999; Muñoz et al., 2002; Ma and Michailides, 2005a; Fournier and Giraud, 2008; Tanovic et al., 2009), ε παξαιιαθηηθφηεηα πνπ πξνθχπηεη κεηαμχ transposa θαη vacuma ηχπσλ, εληζρχεη ηελ άπνςε φηη ν πιεζπζκφο ηνπ Botrytis απνηειείηαη απφ έλα ζχκπιεγκα εηδψλ. Οη Giraud et al. (1997) απέδεημαλ φηη ππάξρεη ζεκαληηθή γελεηηθή δηαθνξνπνίεζε κεηαμχ transposa θαη vacuma θαη πξνηείλνπλ φηη νη δχν νκάδεο είλαη πξάγκαηη γελεηηθά απνκνλσκέλεο. Δπίζεο παξφκνηεο κειέηεο έδεημαλ φηη νη ζπρλφηεηεο εκθάληζεο ησλ κεηαζεηψλ ζηνηρείσλ Boty θαη Flipper δηαθέξνπλ ζεκαληηθά ζηνπο δηάθνξνπο μεληζηέο (Muñoz et al., 2002; Giraud et al., 1999) εληζρχνληαο ηελ άπνςε φηη νη transposa θαη vacuma ηχπνη έρνπλ δηαθνξεηηθή ηθαλφηεηα πξνζβνιήο δηαθνξεηηθψλ μεληζηψλ. Μειέηεο γελεηηθήο παξαιιαθηηθφηεηαο ηνπ B. cinerea ππνζηεξίδνπλ φηη ζηειέρε ηα νπνία θέξνπλ ηα κεηαζεηά ζηνηρεία απαληψληαη ζπρλφηεξα θαη είλαη πην νκνηνγελή ζε ζρέζε κε ζηειέρε ηα νπνία δελ θέξνπλ κεηαζεηά ζηνηρεία ζην γνληδίσκά ηνπο (Giraud et al., 1997, 1999; Muñoz et al., 2002). Δπηπιένλ, νη Giraud et al. (1997, 1999) θαη Martinez et al. (2005), ζε κειέηεο πνπ έθαλαλ ζε πιεζπζκνχο ηνπ κχθεηα πνπ πξνέξρνληαλ απφ ην ακπέιη, δηαπίζησζαλ φηη ππάξρεη κηα ρξνληθή δηαδνρή ησλ δχν ηχπσλ ηνπ κχθεηα θαηά ηε δηάξθεηα ηεο θαιιηεξγεηηθήο πεξηφδνπ. Σα vacuma ζηειέρε απνκνλψλνληαη θπξίσο απφ αζπκπησκαηηθνχο ηζηνχο θαη παξνπζηάδνληαη ζε ςειφηεξεο ζπρλφηεηεο ηελ άλνημε θαηά ηε δηάξθεηα ηεο άλζεζεο, νη νπνίεο κεηψλνληαη ζηαδηαθά κέρξη ηελ ζπγθνκηδή. Σν γεγνλφο απηφ απνδφζεθε ζηελ ηθαλφηεηα ησλ vacuma ζηειερψλ λα αλαπηχζζνληαη θπξίσο ζαπξνθπηηθά ζε ζρέζε κε ηα transposa πνπ αλαπηχζζνληαη πεξηζζφηεξν σο παξάζηηα (Giraud et al., 1997, 1999; Martinez et al., 2003, 2005). Πέξαλ ηεο γελνηππηθήο παξαιιαθηηθφηεηαο, ηα vacuma θαη transposa ζηειέρε ηνπ κχθεηα θαίλεηαη λα παξνπζηάδνπλ θαη θαηλνηππηθή παξαιιαθηηθφηεηα. Πην ζπγθεθξηκέλα, απφ κειέηεο κνξθνινγηθψλ δηαθνξψλ ζηα ζπφξηα ηνπ κχθεηα πξνέθπςε ζεκαληηθή δηαθνξνπνίεζε ζην κήθνο θαη εκβαδφλ κεηαμχ ζπνξίσλ transposa θαη vacuma ζηειερψλ κε ηα ηειεπηαία λα θαίλεηαη φηη παξάγνπλ κεγαιχηεξα καθξνθνλίδηα ζε ζρέζε κε ηα πξψηα (Giraud et al., 1997). Πεηξάκαηα κέηξεζεο ηεο επαηζζεζίαο vacuma θαη transposa ζηειερψλ ζε βνηξπδηνθηφλα απέδεημαλ ηελ χπαξμε δηαθνξνπνηήζεσλ θαη ζην επίπεδν αλζεθηηθφηεηαο ζε κπθεηνθηφλα. Πην ζπγθεθξηκέλα, δηαπηζηψζεθε φηη ηα transposa ζηειέρε παξνπζίαζαλ πςειφηεξα επίπεδα αλζεθηηθφηεηαο ζε δξαζηηθέο νπζίεο φπσο ην carbendazim, diethofencarb θαη vinclozolin θαη ζπρλφηεξε εκθάληζε πνιιαπιήο αλζεθηηθφηεηαο ζπγθξηλφκελα κε vacuma ζηειέρε (Martinez et al., 2005; Giraud et al., 1999, 1997). Αληηζέησο, ζηειέρε vacuma παξνπζίαζαλ αλζεθηηθφηεηα ζην fenhexamid πξηλ αθφκε απηφ ιάβεη έγθξηζε θπθινθνξίαο θαη εθηεζνχλ ζε απηφ νη πιεζπζκνί ηνπ κχθεηα (Giraud et al., 1999). 21

29 Οκάδεο (Groups) Οη Fournier et al. (2003), κειεηψληαο ην πνιπκνξθηζκφ ηνπ γνληδηαθνχ ηφπνπ Bc-hch 117, ν νπνίνο ειέγρεη ηε βιαζηηθή ζπκβαηφηεηα κεηαμχ απνκνλψζεσλ ηνπ κχθεηα, κε ηε κέζνδν PCR-RFLP, πξφηεηλαλ κία λέα νκαδνπνίεζε ηνπ πιεζπζκνχ ηνπ Botrytis. χκθσλα κε απηή, δηαθξίλνληαη δχν νκάδεο ζηνλ πιεζπζκφ ηνπ B. cinerea νη νπνίεο αληηζηνηρνχλ ζε δχν ηχπνπο αιιειφκνξθσλ ζην γνληδηαθφ ηφπν Bchch: α) ε νκάδα I γηα ζηειέρε ηα νπνία θέξνπλ ην αιιειφκνξθν Bc-hch 1 θαη β) ε νκάδα II γηα ζηειέρε ηα νπνία θέξνπλ ην αιιειφκνξθν Bc-hch 2. Οη δχν νκάδεο δηέθεξαλ επίζεο σο πξνο ηελ επαηζζεζία ηνπο ζην κπθεηνθηφλν fenhexamid, θαζψο νη απνκνλψζεηο ηεο νκάδαο I (Bc-hch 1) ήηαλ αλζεθηηθέο ζην fenhexamid ελψ ηεο νκάδαο II (Bc-hch 2) επαίζζεηεο. Σέινο, ζηελ ίδηα εξγαζία θαηαηάζζνληαο ηα vacuma θαη transposa ζηειέρε ζηηο νκάδεο I θαη II δηαπηζηψζεθε φηη νη απνκνλψζεηο ηεο νκάδαο I ήηαλ φιεο vacuma ελψ ηεο νκάδαο II ήηαλ είηε vacuma ή transposa. Ο δηαρσξηζκφο απηφο ήηαλ ζχκθσλνο θαη κε πξνεγνχκελε αλαθνξά ησλ Fournier et al. (2002), νη νπνίνη, κε βάζε ην λνπθιενηηδηθφ πνιπκνξθηζκφ ζε ηέζζεξηο ππξεληθνχο ηφπνπο, δηαρψξηζαλ ηα vacuma ζηειέρε ζε δχν ππννκάδεο: ζην B. pseudo-cinerea ν νπνίνο αληηζηνηρεί ζηελ νκάδα Η θαη ζην B. cinerea sensu stricto, ν νπνίνο αληηζηνηρεί ζηελ νκάδα ΗI. ε εξγαζίεο πνπ αθνινχζεζαλ, νη Fournier et al. (2005) ζπκπέξαλαλ φηη νη πιεζπζκνί ηνπ B. cinerea δελ είλαη κηα παλκεημία εηδψλ θαη φηη ην θπξηφηεξν θξάγκα ζηε ξνή γνληδίσλ βξίζθεηαη κεηαμχ ησλ νκάδσλ I θαη II. Πέξαλ απηνχ, ε χπαξμε ελφο θξαγκνχ κεηαμχ ησλ νκάδσλ I θαη II ππνζηεξίδεηαη πεξεηαίξσ θαη απφ δηάθνξεο βηνινγηθέο δηαθνξνπνηήζεηο. Απφ παξαηεξήζεηο αγελψλ θαξπνθνξηψλ ηνπ κχθεηα δηαπηζηψζεθε φηη νη vacuma απνκνλψζεηο ηεο νκάδαο I παξάγνπλ κεγαιχηεξα θνλίδηα θαη καθξχηεξνπο θνληδηνθφξνπο απφ vacuma θαη transposa απνκνλψζεηο ηεο νκάδαο II (Fournier et al., 2005). Δπηπιένλ, νη δχν νκάδεο, παξνπζηάδνπλ δηαθνξεηηθά γελεηηθά ραξαθηεξηζηηθά. Ζ γελεηηθή παξαιιαθηηθφηεηα ήηαλ ρακειφηεξε εληφο ηεο νκάδαο I, φπσο απνθάιπςαλ κειέηεο πνιπκνξθηζκνχ ηνπ DNA θαζψο θαη δνθηκέο βιαζηηθήο ζπκβαηφηεηαο ( Fournier et al., 2003, 2005). Πέξαλ ηνπ γεγνλφηνο φηη νη δχν νκάδεο είλαη βιαζηηθά αζχκβαηεο κεηαμχ ηνπο, θαίλεηαη φηη ε νκάδα I ζρεκαηίδεη κφλν κία νκάδα βιαζηηθήο ζπκβαηφηεηαο ζε αληίζεζε κε ηελ νκάδα II, ε νπνία πηζαλφλ πεξηιακβάλεη πεξηζζφηεξεο απφ κία (Fournier et al., 2003, 2005). Με βάζε ηα παξαπάλσ επξήκαηα ζηνηρεηνζεηήζεθε ε άπνςε ζχκθσλα κε ηελ νπνία νη νκάδεο I θαη II (B. pseudo-cinerea και B. cinerea stricto-sensu) απνηεινχλ δχν δηαθνξεηηθά θπινγελεηηθά είδε (Fournier et al., 2002, 2003, 2005; Albertini et al., 2002). Γηαθνξνπνηήζεηο κεηαμχ ησλ 2 νκάδσλ θαίλεηαη λα ππάξρνπλ θαη ζε φηη αθνξά ηε ρξνληθή αιιεινπρία εκθάληζήο ηνπο. ηειέρε ηεο νκάδαο I απνκνλψλνληαη θπξίσο θαηά ηελ έλαξμε ηεο βιαζηηθήο πεξηφδνπ αιιά φρη θαηά ηελ ζπγθνκηδή ή θαηά ηε δηάξθεηα ηνπ ρεηκψλα. ε φηη αθνξά ηα ζηειέρε ηεο νκάδαο II θαίλεηαη φηη θαζνξηζηηθφ ξφιν παίδνπλ ην θαηλνινγηθφ ζηάδην ηνπ μεληζηή θαζψο θαη ην φξγαλν ηνπ μεληζηή απφ ην νπνίν γίλεηαη ε απνκφλσζε. Έηζη, ηα vacuma ζηειέρε ηεο νκάδαο 22

30 II επηθξαηνχλ ζηα γεξαζκέλα αλζηθά ππνιείκκαηα ελψ ηα transposa ζηειέρε απφ ηελ έλαξμε ηεο σξίκαλζεο θαη κεηά (Martinez et al., 2005; Fournier et al., 2005). Πέξαλ ηεο δηαθνξεηηθήο ρξνληθήο θαηαλνκήο, νη δχν νκάδεο ππνζηεξίδεηαη φηη δηαθέξνπλ θαη ζην εχξνο μεληζηψλ κε ηελ νκάδα II λα έρεη κεγαιχηεξν εχξνο απ φηη ε νκάδα I. Δπίζεο παξαηεξήζεθε φηη νη δχν νκάδεο ζπλήζσο δελ παξνπζηάδνληαη ζηνλ ίδην μεληζηή θαη πξνηάζεθε φηη ηα δχν απφθξπθα είδε ίζσο δελ είλαη πξνζαξκνζκέλα ζηνπο ίδηνπο μεληζηέο θαη ίζσο δελ έρνπλ ηηο ίδηεο βηνινγηθέο ηθαλφηεηεο κε ηηο transposa απνκνλψζεηο ηηο νκάδαο ΗΗ λα είλαη νη πην παζνγφλεο ζην ακπέιη (Fournier et al., 2005). Ωζηφζν, πην πξφζθαηεο κειέηεο ππνζηεξίδνπλ φηη ην θαιιηεξγεηηθφ ζχζηεκα, ν μεληζηήο θαη ε γεσγξαθηθή απνκφλσζε παίδνπλ ζεκαληηθφ ξφιν ζηε δηακφξθσζε ηεο γελεηηθήο δνκήο ηνπ πιεζπζκνχ ηνπ B. cinerea (Karchani-Balma et al., 2008; Fournier and Giraud, 2008; Choquer et al., 2007). Γηα παξάδεηγκα δηαπηζηψζεθε φηη ην θαιιηεξγεηηθφ ζχζηεκα επεξεάδεη πεξηζζφηεξν ηε γελεηηθή δνκή ησλ πιεζπζκψλ ηνπ κχθεηα πνπ πξνέξρνληαλ απφ θξάνπια ζε ζχγθξηζε κε ηε γεσγξαθηθή απφζηαζε (Karchani-Balma et al., 2008). ηελ ίδηα εξγαζία δηαπηζηψζεθε φηη ν μεληζηήο είλαη κηα ζεκαληηθή παξάκεηξνο πνπ νδεγεί ηε δηαθνξνπνίεζε ηνπ πιεζπζκνχ ηνπ B. cinerea ζηελ νκάδα II. Ζ δηαπίζησζε απηή θαίλεηαη λα ζπκθσλεί κε απηή ησλ Fournier θαη Giraud (2008) νη νπνίνη επίζεο ππνζηεξίδνπλ φηη ε ε γεσγξαθηθή απνκφλσζε δελ δηαθνξνπνηεί ζεκαληηθά ην πιεζπζκφ ηνπ B. cinerea ζηελ νκάδα II. Αληηζέησο, ην θπηφ μεληζηήο πεξηνξίδεη ζεκαληηθά ηε ξνή γνληδίσλ εληφο ηεο νκάδαο II θνπόο Δξγαζίαο Κχξην ζηφρν ηεο παξνχζαο εξγαζίαο απνηέιεζε ε κειέηε ηεο γελεηηθήο δνκήο ηνπ πιεζπζκνχ ηνπ κχθεηα B. cinerea ζηνπο ζεκαληηθφηεξνπο μεληζηέο ηνπ παζνγφλνπ ζηελ Διιάδα (ζηαθχιη, θξάνπια, θνινθπλζνεηδή, ηνκάηα, αθηηλίδηα θαη κήια). Αξρηθά, έγηλε αλίρλεπζε ησλ δχν κεηαζεηψλ ζηνηρείσλ Boty θαη Flipper θαη πξνζδηνξίζζεθε ε ζπρλφηεηα θαη ε θαηαλνκή ηνπο ζηνπο πιεζπζκνχο ηνπ κχθεηα πνπ πξνέξρνληαλ απφ θάζε μεληζηή. Αθνινχζσο, έγηλε κνξηαθφο δηαρσξηζκφο ησλ απνκνλψζεσλ ζηηο νκάδεο I θαη II. Δπίζεο, κειεηήζεθε ε επίδξαζε ηεο ζεξκνθξαζίαο ζηε κπθειηαθή αλάπηπμε ησλ δχν ηχπσλ ηνπ κχθεηα (vacuma θαη transposa). Δπηπιένλ, κειεηήζεθε ε παζνγφλνο δχλακε vacuma θαη transposa ηχπσλ ηνπ B. cinerea ζε αθηηλίδηα ζε δχν δηαθνξεηηθέο ζεξκνθξαζίεο επψαζεο πνπ αληηζηνηρνχλ ζε ζεξκνθξαζία δηαηήξεζεο ζην ξάθη (20 C) θαη ζεξκνθξαζία ζπληήξεζεο (0 C). 23

31 2.2. Τιηθά θαη κέζνδνη πιινγή απνκνλώζεσλ Οη απνκνλψζεηο ηνπ B. cinerea ζπιιέγρζεθαλ απφ πξνζβεβιεκέλνπο θαξπνχο θξάνπιαο, ζηαθπιηνχ, κήισλ, αθηηληδίσλ, ηνκάηαο θαη θνινθπλζνεηδψλ. Ζ ζπιινγή ησλ απνκνλψζεσλ πξαγκαηνπνηήζεθε ηηο ρξνληέο 2005, 2008 θαη 2009 απφ δηάθνξεο πεξηνρέο ηηο Διιάδαο (Πίλαθαο 1). ηηο θαιιηέξγεηεο θξάνπιαο, ζηαθπιηνχ, ηνκάηαο θαη θνινθπλζνεηδψλ ε δεηγκαηνιεςία πξαγκαηνπνηήζεθε ζην ηέινο ηεο πεξηφδνπ ζπγθνκηδήο φηαλ νη επεκβάζεηο κε κπθεηνθηφλα είραλ νινθιεξσζεί. Αληίζεηα, ηα δείγκαηα απφ κήια θαη αθηηλίδηα πάξζεθαλ απφ πξνζβεβιεκέλνπο θαξπνχο πνπ βξίζθνληαλ ζην ςπγείν θαηά ηε δηάξθεηα ηεο ζπληήξεζεο. Σα δείγκαηα κεηαθέξζεθαλ ζην εξγαζηήξην κέζα ζε θαζαξή πιαζηηθή ζαθνχια ην θάζε έλα μερσξηζηά, γηα απνηξνπή επηκφιπλζεο, θαη επσάζζεθαλ ζε απνζηεηξσκέλν πγξφ ζάιακν ζε ζεξκνθξαζία δσκαηίνπ γηα παξαγσγή θνληδίσλ. Μεηά ηε ζπνξνπνίεζε, απφ θάζε δείγκα κεηαθέξζεθε έλα θνκκάηη πξνζβεβιεκέλνπ ηζηνχ ζε 100 ml απνζηαγκέλνπ θαη απνζηεηξσκέλνπ λεξνχ θαη αλαθηλήζεθε ειαθξά γηα απειεπζέξσζε ησλ θνληδίσλ. Απφ ην ελαηψξεκα θνληδίσλ κε δηαδνρηθέο αξαηψζεηο απνθηήζεθαλ κνλφζπνξεο απνκνλψζεηο. Οη απνκνλψζεηο πξαγκαηνπνηήζεθαλ ζε ππφζηξσκα PDA (Potato Dextrose Agar), (Oxoid, Basingstoke, U.K.), ζην νπνίν είραλ πξνζηεζεί 0,5 ml l -1 γαιαθηηθφ νμχ 1Ν γηα θαηαζηνιή αλάπηπμεο βαθηεξηαθψλ επηκνιχλζεσλ. Απφ θάζε θαξπφ πάξζεθε κφλν κηα απνκφλσζε θαη ζπλνιηθά δεκηνπξγήζεθε έλα δείγκα πιπηεζκνχ ηνπ B. cinerea 299 απνκνλψζεσλ. Οη κνλφζπνξεο απνκνλψζεηο δηαηεξήζεθαλ ζε ππφζηξσκα PDA ζηνπο 4 o C κέρξη λα ρξεζηκνπνηεζνχλ. Πίλαθαο 1. Ξεληζηέο θαη πξνέιεπζε ησλ απνκνλψζεσλ ηνπ Botrytis ρξεζηκνπνηήζεθαλ ζηε κειέηε cinerea πνπ Ξεληζηήο Πεξηνρή ζπιινγήο Έηνο Αξηζκόο απνκνλώζεσλ Φξάνπια Πηεξία Φξάνπια Πηεξία ηαθχιη Κφξηλζνο ηαθχιη Καβάια Μήιν Ζκαζία Αθηηλίδην Ζκαζία Αθηηλίδην Πηεξία Σνκάηα Θεζζαινλίθε Σνκάηα Κξήηε Αγγνχξη Θεζζαινλίθε Κνινθχζη Κξήηε χλνιν

32 Απνκόλσζε DNA Γηα ηελ εθρχιηζε ηνπ DNA φιεο νη απνκνλψζεηο αλαπηχρηεθαλ ζε πγξφ ζξεπηηθφ ππφζηξσκα (Potato Dextrose Broth, Sigma-Aldrich, St. Louis, MO) γηα δχν κε ηξεηο κέξεο ζηνπο 22 o C. ηε ζπλέρεηα, ην κπθήιην ζπιιέρζεθε κε θηιηξάξηζκα ζε δηεζεηηθφ ραξηί θαη αθνχ ζηέγλσζε ηνπνζεηήζεθε ζε ζσιήλα eppendorf 1,5 ml. ην πψκα θάζε ζσιήλα δεκηνπξγήζεθε κηα κηθξή νπή κε ηε βνήζεηα απνζηεηξσκέλεο βειφλαο θαη αθνινχζσο νη ζσιήλεο κε ην κπθήιην ηνπνζεηήζεθαλ γηα ιπνθηινπνίεζε. Με ηελ νινθιήξσζε ηεο ιπνθηινπνίεζεο ην μεξφ κπθήιην αιέζζεθε κε ηε βνήζεηα απνζηεηξσκέλσλ κηθξν-γνπδηψλ (micropestles, Eppendorf International, Wesseling, Germany) θαη ε ζθφλε απνζεθεχηεθε ζηνπο -20 o C κέρξη λα ρξεζηκνπνηεζεί. Σν DNA εθρπιίζηεθε κε ηε ρξήζε ηνπ Qia Puregene Core Kit A (QIAGEN GmbH, Hilden, Germany) ζχκθσλα κε ην πξσηφθνιιν ηνπ Πίλαθα 2. Ζ ζπγθέληξσζε ηνπ εμαγφκελνπ DNA κεηξήζεθε κε ηε ρξήζε θαζκαηνθσηφκεηξνπ UV (Gene Quant2, Pharmacia Biotech, Cambridge, UK). Πίλαθαο 2. Πξσηφθνιιν απνκφλσζεο DNA απφ ην κπθήιην ηνπ κχθεηα Botrytis cinerea 1. Πξνζζήθε mg ιπνθηινπνηεκέλνπ κπθειίνπ ζε απνζηεηξσκέλα eppendorf ηνπ 1,5 ml 2. Πξνζζήθε 600 κl δηαιχκαηνο ιχζεσο ησλ θπηηάξσλ θαη 3 κl πξσηετλάζεο Κ. Καιή αλάδεπζε ζε αλαδεπηήξα vortex. 3. Δπψαζε ζηνπο 55 o C γηα κηα ψξα κε ήπηα αλαθίλεζε θάζε 10 ιεπηά. 4. Πξνζζήθε 3 κl δηαιχκαηνο RNάζεο A. Ήπηα αλαθίλεζε θαη επψαζε ζηνπο 37 o C γηα 15 ιεπηά. 5. Πξνζζήθε 200 κl δηαιχκαηνο θαζίδεζεο ησλ πξσηετλψλ θαη γξήγνξε αλάδεπζε γηα 20 ζε αλαδεπηήξα vortex. 6. Δπψαζε ζηνπο 0 o C γηα ιεπηά. 7. Φπγνθέληξεζε ζηα g γηα 3 ιεπηά. 8. Μεηαθνξά ηνπ ππεξθεηκέλνπ ζε απνζηεηξσκέλα eppendorf ησλ 1,5 ml ζηα νπνία πξνζηέζεθε απφ πξνεγνπκέλσο 600 κl ηζνπξνπαλφιε. Ήπηα αλαθίλεζε γηα 1 2 ιεπηά. 9. Φπγνθέληξεζε ζηα g γηα 1 ιεπηφ. Πξνζεθηηθή απνκάθξπλζε θαη απφξξηςε ηνπ ππεξθεηκέλνπ. 10. Πξνζζήθε 600 κl αηζαλφιεο 70% θαη ήπηα αλάδεπζε. 11. Φπγνθέληξεζε ζηα g γηα 1 ιεπηφ. Πξνζερηηθή απνκάθξπλζε θαη απφξξηςε ηνπ ππεξθεηκέλνπ. 12. ηέγλσκα ηεο πειέηαο κε θπζηθή εμάηκηζε. 13. Πξνζζήθε 100 κl DNA hydration solution θαη ήπηα αλάδεπζε. 14. Δπψαζε γηα 1 ψξα ζηνπ 65 o C θαη ζηε ζπλέρεηα γηα έλα βξάδπ ζε ζεξκνθξαζία δσκαηίνπ. 15. Γηαηήξεζε ζηνπο -20 o C κέρξη ηε ρξήζε. 25

33 Αλίρλεπζε ησλ κεηαζεηώλ ζηνηρείσλ Boty θαη Flipper Γηα ηελ αλίρλεπζε ηεο παξνπζίαο θαη ησλ δχν ή ηνπ ελφο κεηαζεηνχ ζηνηρείνπ (Boty θαη/ή Flipper) εθαξκφζηεθαλ δχν PCR δνθηκέο θαη ρξεζηκνπνηήζεθαλ ηα δεχγε εθθηλεηψλ F300 (5 -GCACAAAACCTACAGAAGA-3 ) θαη F1550 (5 -ATTC GTTTCTTGGACTGTA-3 ) (Levis et all., 1997) θαη ν BotyF4 (5 -CAGCTGCAGT ATACTGGGGGA-3 ) κε ηνλ BotyR4 (5 -GGTGCTCAAAGTGTTACGGGA G-3 ) (Ma and Michailides, 2005a). Σν δεχγνο εθθηλεηψλ F300 θαη F1550 ρξεζηκνπνηήζεθε γηα ηελ αλίρλεπζε ηνπ Flipper κεηαζεηνχ ζηνηρείνπ θαζψο εληζρχεη έλα ηκήκα γνληδίνπ 1250-bp ην νπνίν αληηζηνηρεί ζε απηφ ην ζηνηρείν. Αληίζηνηρα, ην δεχγνο εθθηλεηψλ BotyF4 θαη BotyR4 ρξεζηκνπνηήζεθε γηα ηελ αλίρλεπζε ηνπ Boty κεηαζεηνχ ζηνηρείνπ θαζψο εληζρχεη έλα ηκήκα γνληδίνπ 510-bp ην νπνίν αληηζηνηρεί ζε απηφ ην ζηνηρείν. Γηα ηελ αλίρλεπζε ηνπ Flipper ζηνηρείνπ ε αληίδξαζε PCR βειηηζηνπνηήζεθε ζε έλα ηειηθφ φγθν 25 κl πνπ πεξηείρε 2 κl εθρχιηζκα DNA ηνπ κχθεηα, 0.3 κμ απφ ην θάζε εθθηλεηή, 0.3 κμ dntps, 2 mm MgCl 2, 1X Platinum buffer θαη 1 U Platinum Taq DNA πνιπκεξάζε. Ζ PCR αλαπηχρζεθε ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 10 ιεπηά αθνινπζνχκελε απφ 40 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 40, ii) πβξηδνπνίεζε εθθηλεηψλ ζηνπο 55 o C γηα 40, iii) επηκήθπλζε ζηνπο 72 o C γηα 1,5 ιεπηά θαη ηεξκαηηζκφο κε κηα ηειηθή επψαζε ζηνπο 72 o C γηα 10 ιεπηά. Αληίζηνηρα γηα ηελ αλίρλεπζε ηνπ Boty ζηνηρείνπ ε αληίδξαζε PCR βειηηζηνπνηήζεθε ζε έλα ηειηθφ φγθν 25 κl πνπ πεξηείρε 1 κl εθρχιηζκα DNA ηνπ κχθεηα, 0.2 κμ απφ ην θάζε εθθηλεηή, 0.2 κμ dntps, 2 mm MgCl 2, 1X Platinum buffer θαη 0,5 U Platinum Taq DNA πνιπκεξάζε. Ζ PCR αλαπηχρζεθε ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 10 ιεπηά αθνινπζνχκελε απφ 40 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 30, ii) πβξηδνπνίεζε εθθηλεηψλ ζηνπο 68 o C γηα 30, iii) επηκήθπλζε ζηνπο 72 o C γηα 30 θαη ηεξκαηηζκφο κε κηα ηειηθή επψαζε ζηνπο 72 o C γηα 10 ιεπηά. Καη νη δχν αληηδξάζεηο αλαπηχρζεθαλ ζε έλα ζεξκνθπθινπνηεηή PTC 200 (MJ Research,Waltham, MA, USA). Σα πξντφληα ελίζρπζεο ηεο PCR δηαρσξίζηεθαλ κε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο 1,5% ζε Tris-acetate (TAE) buffer, ρξσκαηίζηεθαλ κε βξσκηνχρν αηζίδην θαη θσηνγξαθήζεθαλ θάησ απφ UV αθηηλνβνιία (Δηθφλα 29) Μνξηαθόο Γηαρσξηζκόο νκάδσλ Ι θαη ΙΙ απνκνλώζεσλ ηνπ κύθεηα Botrytis cinerea Γηα ην κνξηαθφ δηαρσξηζκφ ησλ νκάδσλ Η θαη ΗΗ ζηηο vacuma απνκνλψζεηο ηνπ κχθεηα, ρξεζηκνπνηήζεθε ην δεχγνο εθθηλεηψλ 262 (5 -AAGCCCTTCGAGTCT TGGA-3 ) θαη 520L (5 -ACGGATTCCGAACTAAGTAA-3 ) (Fournier et al., 2003). Οη εθθηλεηέο απηνί εληζρχνπλ έλα ηκήκα 1171 bp κεηαμχ ησλ ζέζεσλ 701 θαη

34 ηνπ γνληδίνπ Bc-hch. Ζ αληίδξαζε PCR πξαγκαηνπνηήζεθε ζε έλα ηειηθφ φγθν 50 κl πνπ πεξηείρε πνπ πεξηείρε 5 κl εθρχιηζκα DNA ηνπ κχθεηα, 5 κl ξπζκηζηηθφ δηάιπκα αληίδξαζεο, 4 κl MgCl 2, 2.5 κl απφ ην θάζε εθθηλεηή θαη 0.2 κl EUROCENTEC Taq πνιπκεξάζε, φπσο πεξηγξάθεηαη απφ ηνπο Fournier et al. (2003). Ζ PCR αλαπηχρζεθε ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 10 ιεπηά αθνινπζνχκελε απφ 30 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 30, ii) πβξηδνπνίεζε εθθηλεηψλ ζηνπο 55 o C γηα 1,5 ιεπηά θαη iii) επηκήθπλζε ζηνπο 72 o C γηα 1 ιεπηφ θαη ηεξκαηηζκφο κε κηα ηειηθή επψαζε ζηνπο 72 o C γηα 10 ιεπηά. Ζ αληίδξαζε PCR αλαπηχρζεθε ζε έλα ζεξκνθπθινπνηεηή PTC 200 (MJ Research,Waltham, MA, USA). Με ηελ νινθιήξσζε ηεο δνθηκήο PCR ηα πξντφληα ελίζρπζεο δηαρσξίζηεθαλ κε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο (Δηθφλα 31Α). ηε ζπλέρεηα, ε πέςε ησλ πξντφλησλ ηεο PCR πξαγκαηνπνηήζεθε ζε έλα ηειηθφ φγθν ησλ 20 κl ν νπνίνο πεξηείρε 5 κl πξντφλ PCR, 2 κl ξπζκηζηηθφ δηάιπκα αληίδξαζεο θαη 1 U έλδπκν πέςεο HhaI (GIBCO). Ζ πέςε πξαγκαηνπνηήζεθε ζηνπο 37 o C γηα 1,5 ψξα. Σέινο, ηα πξντφληα πέςεο δηαρσξίζηεθαλ κε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο (Δηθφλα 31Β). Ωο ζεηηθνί κάξηπξεο γηα ηελ νκάδα Η ρξεζηκνπνηήζεθαλ 2 ζηειέρε ηνπ κχθεηα ηα νπνία καο δφζεθαλ απφ ηνλ Καζ. M. Hahn, (Technical University of Kaiserslautern, Faculty of Biology, Department of Plant Pathology, Germany) Δπίδξαζε ζεξκνθξαζίαο ζην ξπζκό κπθειηαθήο αλάπηπμεο transposa θαη vacuma απνκνλώζεσλ ηνπ Botrytis cinerea Γηα ηνλ έιεγρν ηεο επίδξαζεο ηεο ζεξκνθξαζίαο ζην ξπζκφ ηεο κπθειηαθήο αλάπηπμεο ησλ δχν ηχπσλ ηνπ κχθεηα (vacuma θαη transposa), κειεηήζεθε ε αλάπηπμή ηνπο ζε δηάθνξεο ζεξκνθξαζίεο. πγθεθξηκέλα, επηιέρζεθαλ ηπραία απφ φιν ην δείγκα 14 απνκνλψζεηο transposa ηχπνπ (έθεξαλ θαη ηα δχν κεηαζεηά ζηνηρεία Boty θαη Flipper) θαη 15 απνκνλψζεηο vacuma ηχπνπ (απνπζία ησλ κεηαζεηψλ ζηνηρείσλ Boty θαη Flipper) θαη κεηξήζεθε ε κπθειηαθή ηνπο αλάπηπμε ζε ππφζηξσκα PDA ζε ηξεηο δηαθνξεηηθέο ζεξκνθξαζίεο, 0, 10 θαη 20 C. Γηα ην ζθνπφ απηφ, κπθειηαθά εκβφιηα (δηακέηξνπ 5 mm) κεηαθέξζεθαλ απφ θαιιηέξγεηεο ειηθίαο ηξηψλ εκεξψλ ζην θέληξν ηξπβιίσλ petri 9 cm ηα νπνία πεξηείραλ PDA σο ππφζηξσκα αλάπηπμεο. Γηα θάζε κηα απνκφλσζε εηνηκάζζεθαλ 3 επαλαιεπηηθά ηξπβιία. Οη θαιιηέξγεηεο ηνπνζεηήζεθαλ ζε ζαιάκνπο επψαζεο, κε ηηο ππφ κειέηε ζεξκνθξαζίεο, ζην ζθνηάδη. Γηα ηελ αμηνιφγεζε ηεο αλάπηπμεο ηνπ κπθειίνπ, κεηξήζεθαλ νη θάζεηνη δηάκεηξνη ηεο θάζε απνηθίαο ζην θάησ κέξνο ηνπ ηξπβιίνπ ζε 24σξα δηαζηήκαηα γηα ηηο απνκνλψζεηο πνπ επσάδνληαλ ζηνπο 10 θαη 20 C θαη 48σξα δηαζηήκαηα γηα ηηο απνκνλψζεηο πνπ επσάδνληαλ ζηνπο 0 C. Απφ θάζε κέηξεζε αθαηξέζεθε ε δηάκεηξνο ηνπ κπθειηαθνχ εκβνιίνπ (5 mm) θαη γηα θάζε απνκφλσζε ππνινγίζηεθε ν εκεξήζηνο ξπζκφο αλάπηπμεο ζηελ θάζε ζεξκνθξαζία. Σν πείξακα επαλαιήθζεθε δχν θνξέο. 27

35 Παζνγόλνο δύλακε transposa θαη vacuma απνκνλώζεσλ ηνπ Botrytis cinerea ζε αθηηλίδηα Γηα ηνλ έιεγρν ηεο παζνγφλνπ δχλακεο απνκνλψζεσλ ηνπ B. cinerea ζε αθηηλίδηα ρξεζηκνπνηήζεθαλ 20 ηπραία επηιεγκέλεο απνκνλψζεηο ηνπ κχθεηα, 10 ηχπνπ transposa θαη 10 ηχπνπ vacuma. Οη θαξπνί (πνηθηιία Hayward) ζπγθνκίζηεθαλ απφ εκπνξηθφ νπσξψλα ζηελ πεξηνρή ηεο Βέξνηαο, φηαλ έθηαζαλ ζην ζηάδην ηεο θπζηνινγηθήο σξίκαλζεο (ζπλεθηηθφηεηα ζάξθαο 60,5 ± 2,3 Ν θαη πεξηεθηηθφηεηα δηαιπηψλ ζηεξεψλ 7.9 ± 0.1%). Οη θαξπνί επηιέρζεθαλ κε βάζε ηελ νκνηνκνξθία ζρήκαηνο θαη κεγέζνπο (θαξπνί ρσξίο ειαηηψκαηα θαη κε κέζν βάξνο 95 ± 5 g). Μεηά ηε κεηαθνξά ηνπο ζην Δξγαζηήξην νη θαξπνί απνιπκάλζεθαλ κε βχζηζε ζε δηάιπκα ππφ-ρισξηψδνπο λαηξίνπ 5 % (v/v) γηα 1 ιεπηφ (Δηθφλα 28Α). Μεηά ηελ απνκάθξπλζή ηνπο απφ ην δηάιπκα απνιχκαλζεο μεπιχζεθαλ ηξεηο θνξέο ζε απνζηαγκέλν θαη απνζηεηξσκέλν λεξφ θαη ζηε ζπλέρεηα ηνπνζεηήζεθαλ γηα ζηέγλσκα ζε απνζηεηξσκέλεο πεηζέηεο. Αθνινχζσο, κεηά ην ζηέγλσκα νη θαξπνί κνιχλζεθαλ ηερλεηά κε 100 κl ελαηψξεκα θνληδίσλ (2 x 10 5 ζπφξηα ml -1 ). Σν κφιπζκα εηνηκάζηεθε κε παξαιαβή θνληδίσλ απφ απνηθίεο ειηθίαο δέθα εκεξψλ, αλεπηπγκέλεο ζε PDA, πξνζζέηνληαο 10 ml απνζηαγκέλνπ λεξνχ ζε θάζε ηξπβιίν petri. Σν ελαηψξεκα ζπνξίσλ ξπζκίζηεθε ζε κηα ζπγθέληξσζε ησλ 2 x 10 5 ml -1 κε ηε ρξήζε ελφο αηκνθπηηαξφκεηξνπ (model Thoma, Brand, Germany). Οη ηερλεηέο κνιχλζεηο ησλ θαξπψλ έγηλαλ κέζσ πιεγήο ε νπνία πξνθιήζεθε κε απνκάθξπλζε ηνπ κίζρνπ ηνπ θαξπνχ κε απνζηεηξσκέλν λπζηέξη (Δηθφλα 28Β). Μνιχλζεθαλ 10 θαξπνί / απνκφλσζε θαη ηνπνζεηήζεθαλ ζε πιαζηηθά θνπηηά (23 x 31 x 10 cm [πιάηνο x κήθνο x χςνο)] ζηα νπνία πξνζηέζεθαλ 20 ml απνζηεηξσκέλνπ λεξνχ θαη θαιχθζεθαλ γηα δηαηήξεζε ηεο ζρεηηθήο πγξαζίαο ζε πςειά επίπεδα (Δηθφλα 28Γ θαη Γ). Καξπνί πνπ ρξεζηκνπνηεζήθαλ σο κάξηπξεο κνιχλζεθαλ κε απνζηεηξσκέλν-απνζηαγκέλν λεξφ. Αθνινχζσο νη θαξπνί επσάζζεθαλ ζηηο δχν ζεξκνθξαζίεο (0 C θαη 20 C). Οη θαξπνί πνπ ηνπνζεηήζεθαλ ζηνπο 20 C επσάζηεθαλ γηα 13 κέξεο ελψ νη θαξπνί πνπ ηνπνζεηήζεθαλ ζηνπο 0 C επσάζηεθαλ γηα 60 κέξεο. ην ηέινο ηεο πεξηφδνπ επψαζεο θαηαγξάθεθε ν αξηζκφο ησλ θαξπψλ κε ηα ζπκπηψκαηα ηεο αζζέλεηαο θαη ππνινγίζηεθε ε ζπρλφηεηα ηεο αζζέλεηαο (πνζνζηφ κνιπζκέλσλ θαξπψλ, %) (Δηθφλα 28Δ). ηε ζπλέρεηα, εθηηκήζεθε ε έληαζε ηεο πξνζβνιήο ζηνπο κνιπζκέλνπο θαξπνχο κεηξψληαο ην βάζνο ζήςεο (mm) (Δηθφλα 28Σ). Σν πείξακα επαλαιήθζεθε δχν θνξέο Αλάιπζε δεδνκέλσλ Γηα ηε ζχγθξηζε ηεο ζπρλφηεηαο θαηαλνκήο ηνπ ηχπνπ ησλ απνκνλψζεσλ ζε θάζε μεληζηή ρξεζηκνπνηήζεθε ε δνθηκή χ 2. Σα δεδνκέλα ησλ κεηξήζεσλ ηνπ ξπζκνχ κπθειηαθήο αλάπηπμεο θαη ησλ πεηξακάησλ κνιπζκαηηθφηεηαο ππνβιήζεθαλ ζε αλάιπζε παξαιιαθηηθφηεηαο (ANOVA). Οη κέζεο ηηκέο ησλ ξπζκψλ κπθειηαθήο αλάπηπμεο θάζε απνκφλσζεο εληφο ησλ γελνηππηθψλ νκάδσλ ζπγθξίζεθαλ κε ην ηεζη 28

36 πξνζηαηεπφκελεο ειάρηζηεο ζεκαληηθήο δηαθνξάο Fisher`s ελψ νη κέζνη φξνη κεηαμχ ησλ γελνηππηθψλ νκάδσλ ζπγθξίζεθαλ κε ην pairwise Student`s t-ηεζη. Γηα ηελ αλάιπζε δεδνκέλσλ ζηα πεηξάκαηα κνιπζκαηηθφηεηαο νη απνκνλψζεηο νκαδνπνηήζεθαλ ζχκθσλα κε ηνλ γελφηππφ ηνπο θαη νη κέζεο ηηκέο ηεο θάζε νκάδαο ζπγθξίζεθαλ κε ην ηεζη Tukey-Kramer HSD. ηελ νκάδα vacuma ζπκπεξηιήθζεθαλ φιεο νη απνκνλψζεηο πνπ δελ έθεξαλ θαλέλα απφ ηα δχν κεηαζεηά ζηνηρεία ελψ ζηελ νκάδα transposa ζπκπεξηιήθζεθαλ φιεο νη απνκνλψζεηο πνπ έθεξαλ θαη ηα δχν ή ηνπιάρηζηνλ έλα απφ ηα δχν κεηαζεηά ζηνηρεία. Όια ηα ηεζη ζηαηηζηηθήο αλάιπζεο ππνζηεξίδνληαλ απφ ην SPSS (έθδνζε 11.0). Δηθόλα 28. ρεκαηηθή απεηθφληζε ηεο δηαδηθαζίαο ηερλεηήο κφιπλζεο θαη κέηξεζεο ηεο παζνγφλνπ δχλακεο απνκνλψζεσλ ηνπ Botrytis cinerea ζε θαξπνχο αθηηληδηάο: (Α) απνιχκαλζε θαξπψλ ζε δηάιπκα ππφ-ρισξηψδνπο λαηξίνπ 5%, (Β) αθαίξεζε πνδίζθνπ, (Γ) ηερλεηή κφιπλζε θαξπψλ κε αηψξεκα ζπνξίσλ ηνπ κχθεηα, (Γ) επψαζε θαξπψλ ζηηο ππφ κειέηε ζεξκνθξαζίεο, (Δ) θαηαγξαθή εκθάληζεο ζπκπησκάησλ θαη πξνζδηνξηζκφο πνζνζηνχ κνιπζκέλσλ θαξπψλ θαη (Σ) πξνζδηνξηζκφο έληαζεο ηεο αζζέλεηαο κεηξψληαο ην βάζνο ζήςεο Απνηειέζκαηα πρλόηεηα κεηαζεηώλ ζηνηρείσλ Ζ αλίρλεπζε ησλ δχν κεηαζεηψλ ζηνηρείσλ, κε βάζε ηελ δνθηκή PCR πνπ ρξεζηκνπνηήζεθε, έδεημε φηη, ζε φινπο ηνπο μεληζηέο ηνπ δείγκαηνο, αλεμαξηήησο πξνειεχζεσο, αληρλεχζεθαλ θαη νη ηέζζεξηο πηζαλνί ηχπνη: i) Transposa ηχπνο, ζηνλ νπνίν αληρλεχζεθαλ θαη ηα δχν κεηαζεηά ζηνηρεία, ii) Boty ηχπνο, ζηνλ νπνίν αληρλεχζεθε κφλν ην Boty ζηνηρείν, iii) Flipper ηχπνο, ζηνλ νπνίν αληρλεχζεθε κφλν ην Flipper ζηνηρείν θαη iv) Vacuma ηχπνο, ζηνλ νπνίν δελ αληρλεχζεθε θαλέλα απφ ηα δχν κεηαζεηά ζηνηρεία, (Δηθφλα 29). Παξφια απηά, ππήξραλ δηαθνξέο ζηε ζπρλφηεηα 29

37 Συχνότητα % απηψλ ησλ ηχπσλ εληφο ησλ πιεζπζκψλ ηνπ κχθεηα απφ ηνλ θάζε μεληζηή (Δηθφλα 30). ηε θξάνπια, ηνκάηα, θνινθπλζνεηδή θαη ζηαθχιη θπξηαξρνχζε ν transposa γελφηππνο ζε ζπρλφηεηεο πνπ θπκαίλνληαλ απφ 61 % ζην πιεζπζκφ ηεο θξάνπιαο κέρξη 77 %, ζην πιεζπζκφ απφ ηνκάηα. ε αληίζεζε, απνκνλψζεηο πνπ έθεξαλ θαη ηα δχν κεηαζεηά ζηνηρεία αληρλεχνληαλ ζε ρακειή ζπρλφηεηα ζηνπο πιεζπζκνχο ηνπ κχθεηα απφ αθηηλίδηα θαη κήια (17 θαη 10 %, αληίζηνηρα). Απνκνλψζεηο ηχπνπ vacuma αληρλεχηεθαλ ζε ζπρλφηεηεο πνπ θπκαίλνληαλ απφ 12 κέρξη 22 % ζηνπο πιεζπζκνχο ηνπ κχθεηα απφ θξάνπια, ηνκάηα, θνινθπλζνεηδή θαη ζηαθχιη ελψ αληίζεηα ν ίδηνο ηχπνο επηθξαηνχζε ζηνπο πιεζπζκνχο ηνπ κχθεηα απφ αθηηλίδηα θαη κήια κε ζπρλφηεηεο 46 θαη 55 %, αληίζηνηρα. Απνκνλψζεηο πνπ έθεξαλ κφλν έλα απφ ηα δχν κεηαζεηά ζηνηρεία (Boty ή Flipper ηχπνο) αληρλεχηεθαλ ζε φινπο ηνπο μεληζηέο ηνπ δείγκαηνο ζε ρακειφηεξεο ζπρλφηεηεο. πγθεθξηκέλα ν Boty γελφηππνο θπκάλζεθε ζε ζπρλφηεηεο απφ 2 κέρξη 13 % ελψ ν Flipper απφ 7 κέρξη 30 %. Δηθόλα 29. Γηαρσξηζκφο πξντφλησλ ελίζρπζεο ηεο PCR κε ειεθηξνθφξεζε ζε πεθηή αγαξφδεο γηα αλίρλεπζε ησλ κεηαζεηψλ ζηνηρείσλ boty θαη flipper 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% Boty type Flypper type Transposa type Vacuma type Ξενιστής Δηθόλα 30. πρλφηεηα θαηαλνκήο ησλ ηχπσλ Botrytis cinerea ζηνπο πιεζπζκνχο ηνπ κχθεηα απφ δηάθνξνπο μεληζηέο ζηελ Διιάδα. 30

38 Ζ χ 2 αλάιπζε ησλ ζπρλνηήησλ ησλ ηεζζάξσλ γελνηχπσλ ηνπ κχθεηα ζηνπο μεληζηέο ηνπ δείγκαηνο έδεημε φηη ν πιεζπζκφο ηνπ ζηαθπιηνχ έρεη παξφκνηα θαηαλνκή (P > 0,05) κε απηφλ ηεο ηνκάηαο, ησλ θνινθπλζνεηδψλ θαη ηεο θξάνπιαο αιιά δηέθεξε ζεκαληηθά απφ απηφ ηνπ αθηηληδίνπ θαη κήινπ (P > 0,05). Δπίζεο, ν πιεζπζκφο απφ ηνκάηα έδεημε παξφκνηα θαηαλνκή (P > 0,05) κε απηφλ απφ θνινθπλζνεηδή θαη θξάνπια αιιά δηέθεξε (P < 0,05) απφ απηφ ηνπ αθηηληδίνπ θαη κήινπ. Δπηπιένλ, ε θαηαλνκή απφ πιεζπζκνχο θνινθπλζνεηδψλ θαη θξάνπιαο δηέθεξε (P < 0,05) απφ απηή ηνπ αθηηληδίνπ θαη κήινπ ελψ δελ ππήξμε δηαθνξά (P > 0,05) ζηε ζπρλφηεηα ησλ ηχπσλ κεηαμχ ησλ πιεζπζκψλ ηνπ αθηηληδίνπ θαη κήινπ (Πίλαθαο 3). Πίλαθαο 3. χγθξηζε ηεο ζπρλφηεηαο θαηαλνκήο ηνπ ηχπνπ ησλ κεηαζεηψλ ζηνηρείσλ, κε βάζε ηε χ 2 αλάιπζε, ζε πιεζπζκνχο ηνπ Botrytis cinerea απφ δηάθνξνπο μεληζηέο ηνπ ζηελ Διιάδα. Ξεληζηήο ηνκάηα θνινθπλ. θξάνπια αθηηλίδην κήιν ηηκή χ 2 P ηηκή χ 2 P ηηκή χ 2 P ηηκή χ 2 P ηηκή χ 2 ζηαθύιη * * ηνκάηα * * θνινθπλ * * θξάνπια * * αθηηλίδην *ηηκέο P κηθξφηεξεο απφ 0.05 δείρλνπλ ζηαηηζηηθά ζεκαληηθέο ηηκέο χ 2 P Μνξηαθόο Γηαρσξηζκόο νκάδσλ Ι θαη ΙΙ απνκνλώζεσλ ηνπ κύθεηα Botrytis cinerea Έρεη βξεζεί φηη, ζην B. cinerea ν γνληδηαθφο ηφπνο πνπ ειέγρεη ηε βιαζηηθή ζπκβαηφηεηα ηνπ κχθεηα (Bc-hch), αληηζηνηρεί απζηεξά κε ηνπο θαηλνηχπνπο αλζεθηηθφηεηαο ζην κπθεηνθηφλν fenhexamid. πλεπψο, ε ρξήζε ηνπ Bc-hch σο δείθηε πιεζπζκνχ απνθαιχπηεη κηα λέα θαηάηαμε ησλ θπζηθψλ πιεζπζκψλ ηνπ B. cinerea ζε δχν νκάδεο (Group Η θαη Group ΗΗ) (Fournier et al., 2003). Ζ νκάδα Η πεξηιακβάλεη κφλν vacuma ζηειέρε, ελψ ε νκάδα ΗΗ πεξηιακβάλεη φια ηα transposa ζηειέρε θαζψο θαη vacuma ζηειέρε. Ωο εθ ηνχηνπ, γηα λα ειέγμνπκε ηνλ πνιπκνξθηζκφ ηνπ γνληδίνπ απηνχ θαη ελ ηέιεη λα δηαρσξίζνπκε ηηο νκάδεο Η θαη ΗΗ ρξεζηκνπνηήζεθε ην δεχγνο εθθηλεηψλ 262 θαη 520L, ην νπνίν εληζρχεη έλα ηκήκα 1171 bp ηνπ γνληδίνπ Bc-hch (Δηθφλα 31Α), θαη ην έλδπκν πεξηνξηζκνχ HhaI (Fournier et al., 2003). χκθσλα κε ηνπο Fournier et al. (2003), ην έλδπκν HhaI αληρλεχεη δχν κνηίβα πεξηνξηζκνχ, απνθαιχπηνληαο δχν αιιειφκνξθνπο, ηνλ Bchch2 κε 5 HhaI ζέζεηο πεξηνξηζκνχ θαη ηνλ Bc-hch1 κε 4 HhaI ζέζεηο πεξηνξηζκνχ. πλεπψο, θαηά ην δηαρσξηζκφ ζε πεθηή αγαξφδεο πξνθχπηνπλ 6 δψλεο γηα ηνλ 31

39 αιιειφκνξθν Bc-hch2 (517, 287, 155, 119, 84 θαη 9 -bp) θαη 5 δψλεο γηα ηνλ αιιειφκνξθν Bc-hch1 (601, 287, 155, 119 θαη 9 -bp) (Δηθφλα 31Β). Δηθόλα 31. (A) Γηαρσξηζκφο πξντφλησλ ελίζρπζεο ηκήκαηνο ηνπ γνληδίνπ Bc-hch κε ην δεχγνο εθθηλεηψλ 262 θαη 520L (1171-bp) θαη (Β) πξνθίι πεξηνξηζκνχ κεηά απφ πέςε απηψλ ησλ πξντφλησλ κε ην έλδπκν HhaI ( 2 : αιιειφκνξθνο Bc-hch2 θαη 1 : αιιειφκνξθνο Bchch1). πλεπψο, ην ηκήκα 1171-bp ηνπ γνληδίνπ Bc-hch εληζρχζεθε θαη θαηφπηλ ππέζηε πέςε κε ην έλδπκν HhaI ζην ζχλνιν ησλ vacuma απνκνλψζεσλ πνπ πξνέθπςαλ θαηά ην πξνεγνχκελν ζηάδην ηεο κειέηεο. Σα απνηειέζκαηα έδεημαλ φηη φιεο νη vacuma απνκνλψζεηο έθεξαλ ηνλ Bc-hch2 αιιειφκνξθν θαη σο εθ ηνχηνπ ηαμηλνκήζεθαλ ζηελ νκάδα ΗΗ ηνπ B. cinerea (B. cinerea sensu stricto) Δπίδξαζε ζεξκνθξαζίαο ζην ξπζκό κπθειηαθήο αλάπηπμεο transposa θαη vacuma απνκνλώζεσλ ηνπ Botrytis cinerea Όπσο αλακελφηαλ ν ξπζκφο κπθειηαθήο αλάπηπμεο ησλ απνκνλψζεσλ πνπ κειεηήζεθαλ επεξεάζηεθε ζεκαληηθά απφ ηε ζεξκνθξαζία επψαζεο ησλ ζηειερψλ. Καη ζηνπο δχν ηχπνπο απνκνλψζεσλ ν πςειφηεξνο ξπζκφο αλάπηπμεο παξαηεξήζεθε ζηνπο 20 o C κε κέζν φξν 22,35 mm/εκέξα γηα ηηο transposa απνκνλψζεηο θαη 23,39 mm/κέξα γηα ηηο vacuma απνκνλψζεηο, ηηκέο νη νπνίεο δελ δηέθεξαλ ζεκαληηθά (P>0.05) (Πίλαθαο 4 θαη Δηθφλα 32). Οη απνκνλψζεηο ήηαλ ηθαλέο λα αλαπηπρζνχλ αθφκε θαη ζηνπο 0 o C, παξφιν πνπ ε ζεξκνθξαζία απηή, φπσο θαη ε ζεξκνθξαζία ησλ 10 o C, ήηαλ πεξηνξηζηηθέο γηα ηελ κπθειηαθή αλάπηπμε. Καη ζηηο δχν ζεξκνθξαζίεο ε κέζε κπθειηαθή αλάπηπμε ησλ transposa απνκνλψζεσλ δελ δηέθεξε ζεκαληηθά (P>0.05) απφ ηε κέζε κπθειηαθή αλάπηπμε ησλ vacuma απνκνλψζεσλ δίλνληαο αληίζηνηρα ηηκέο 14,43 mm/εκέξα θαη 14,90 mm/εκέξα ζηνπο 10 o C ελψ ζηνπο 0 o C ε κέζε κπθειηαθή αλάπηπμε είρε ηηκέο 2,82 mm/εκέξα θαη 3,08 mm/εκέξα αληίζηνηρα (Πίλαθαο 4 θαη Δηθφλα 32). 32

40 Πίλαθαο 4. Ρπζκφο κπθειηαθήο αλάπηπμεο (mm/εκέξα) απνκνλψζεσλ ησλ δχν ηχπσλ Botrytis cinerea ζε ηξεηο δηαθνξεηηθέο ζεξκνθξαζίεο. * Απνκόλσζε Ξεληζηήο Σύπνο Θεξκνθξαζία o C ηνκάηα B & F θξάνπια B & F θξάνπια B & F ηνκάηα B & F ζηαθχιη B & F ζηαθχιη B & F αθηηλίδην B & F ηνκάηα B & F θνινθπλζνεηδή B & F θνινθπλζνεηδή B & F θνινθπλζνεηδή B & F αθηηλίδην B & F κήιν B & F κήιν B & F κέζνο φξνο 2.82 a* a* a* 20 θξάνπια V θξάνπια V ηνκάηα V ζηαθχιη V ζηαθχιη V αθηηλίδην V θνινθπλζνεηδή V θνινθπλζνεηδή V θνινθπλζνεηδή V αθηηλίδην V αθηηλίδην V αθηηλίδην V αθηηλίδην V κήιν V κήιν V κέζνο φξνο 3.08 a* a* a* Όκνηα γξάκκαηα ππνδεηθλχνπλ ζηαηηζηηθά κε ζεκαληηθέο δηαθνξέο ζχκθσλα κε ηελ αλάιπζε παξαιιαθηηθφηεηαο (ANOVA). 33

41 Ρπζκόο κπθειηαθήο αλάπηπμεο mm/εκέξα Transposa Vacuma a a 15 a a 10 5 a a 0 0 C 10 C 20 C Θεξκνθξαζία επώαζεο Δηθόλα 32. Ρπζκφο κπθειηαθήο αλάπηπμεο (mm/κέξα) transposa θαη vacuma απνκνλψζεσλ ζε ηξεηο δηαθνξεηηθέο ζεξκνθξαζίεο Παζνγόλνο δύλακε transposa θαη vacuma απνκνλώζεσλ ηνπ Botrytis cinerea ζε αθηηλίδηα Όιεο νη απνκνλψζεηο πνπ ρξεζηκνπνηήζεθαλ ζε απηή ηε δνθηκή ήηαλ παζνγφλεο ζην αθηηλίδην αλεμάξηεηα απφ ην μεληζηή πξνέιεπζή ηνπο. Παξφια απηά, παξαηεξήζεθε παξαιιαθηηθφηεηα κεηαμχ ησλ απνκνλψζεσλ ηφζν ζην πνζνζηφ ησλ θαξπψλ πνπ αλέπηπμαλ ζπκπηψκαηα ηεο αζζέλεηαο φζν θαη ζηελ έληαζε ηεο αζζέλεηαο ε νπνία εθθξάζηεθε ζε βάζνο ζήςεο ησλ θαξπψλ κε ζπκπηψκαηα. Σν πνζνζηφ κφιπλζεο ήηαλ πνιχ ρακειφηεξν φηαλ νη θαξπνί επσάζηεθαλ ζηνπο 0 o C ζε ζρέζε κε ην πνζνζηφ κφιπλζεο φηαλ νη θαξπνί επσάζηεθαλ ζηνπο 20 o C (Δηθφλα 33A). ηνπο 0 o C ην 45 % ησλ θαξπψλ πνπ κνιχλζεθαλ κε transposa απνκνλψζεηο παξνπζίαζαλ ζπκπηψκαηα ηεο αζζέλεηαο ελψ ην αληίζηνηρν πνζνζηφ ησλ θαξπψλ πνπ κνιχλζεθαλ κε vacuma απνκνλψζεηο ήηαλ 45,5 % (P>0.05). Παξνκνίσο, φηαλ νη θαξπνί κεηά ηε κφιπλζε επσάζηεθαλ ζηνπο 20 o C ηα πνζνζηά πξνζβνιήο απφ ηηο transposa θαη vacuma απνκνλψζεηο, κε ηηκέο 81,5 θαη 76 % αληίζηνηρα, δελ παξνπζίαζαλ ζηαηηζηηθά ζεκαληηθέο δηαθνξέο (P>0.05) (Δηθφλα 33A). Ωζηφζν, ε έληαζε πξνζβνιήο (βάζνο ζήςεο) ζε θαξπνχο πνπ κνιχλζεθαλ κε transposa απνκνλψζεηο θαη επσάζηεθαλ ζηνπο 0 o C ήηαλ ςειφηεξε (14 mm) θαη δηέθεξε ζεκαληηθά (P<0,05) απφ ηελ έληαζε πξνζβνιήο πνπ παξαηεξήζεθε ζηνπο θαξπνχο πνπ κνιχλζεθαλ κε vacuma απνκνλψζεηο (11mm). Αληίζεηα, φηαλ νη θαξπνί επσάζηεθαλ ζηνπο 20 o C ε έληαζε πξνζβνιήο πνπ πξνθάιεζαλ νη δχν ηχπνη απνκνλψζεσλ δε δηέθεξε ζεκαληηθά (P>0,05) (Δηθφλα 33Β). 34

42 Πνζνζηό πξνζβεβιεκέλσλ θαξπώλ (%) Έληαζε πξνζβνιήο (βάζνο ζήςεο, mm) A 100% 80% 60% 40% 20% 0% Transposa Vacuma a a a a 0 C 20 C Θερμοκρασία Β a b Transposa Vacuma a a 0 C 20 C Θερμοκρασία Δηθόλα 33. Παζνγφλνο δχλακε transposa θαη vacuma ηχπσλ ηνπ Botrytis cinerea ζε θαξπνχο αθηηληδίνπ πνπ επσάζηεθαλ ζηνπο 0 θαη 20 o C. Ζ παζνγφλνο δχλακε εθθξάζηεθε σο πνζνζηφ πξνζβεβιεκέλσλ θαξπψλ (Α) θαη έληαζε πξνζβνιήο (Β). Γηαθνξεηηθά γξάκκαηα ζηηο ζηήιεο ππνδεηθλχνπλ ζηαηηζηηθά ζεκαληηθέο δηαθνξέο ζχκθσλα κε ηε δνθηκή Tukey-Kramer HSD (P = 0,05) πδήηεζε Ο κνξηαθφο δηαρσξηζκφο ησλ απνκνλψζεσλ ηνπ κχθεηα ζηηο νκάδσλ Η θαη ΗΗ κε PCR-RFLP δνθηκέο, απνθάιπςε φηη θακία απφ ηηο απνκνλψζεηο ηνπ κχθεηα πνπ ρξεζηκνπνηήζεθαλ ζε απηή ηελ εξγαζία δελ αλήθε ζην ηχπν ηνπ Botrytis cinerea ηεο Οκάδαο Η. Ζ παξνπζία απνκνλψζεσλ ηεο Οκάδαο Η έρεη αλαθεξζεί ζε έλα ζεκαληηθφ αξηζκφ εξγαζηψλ ζε ρακειά επίπεδα ζπρλφηεηαο ηα νπνία θπκαίλνληαη απφ 2,5 κέρξη 15 % ηνπ πιεζπζκνχ (Ma and Michailides, 2005a; Matinez et al., 2005; Krethcmer and Hahn, 2008), ελψ απνκνλψζεηο απφ ζηαθχιη ζηελ Οπγγαξία (Váczy et al., 2008), απφ δηάθνξνπο μεληζηέο ζηε Σπλεζία (Karchani-Balma et al., 2008) θαη Απζηξαιία (Isenegger et al., 2008) απεθάιπςαλ ηελ απνπζία ζηειερψλ ηεο Οκάδαο Η. Ζ αλαθνξά ρακειψλ ζπρλνηήησλ ζηειερψλ ηεο Οκάδαο Η ζε πξνεγνχκελεο εξγαζίεο, καδί κε ηελ απνπζία ηέηνησλ ζηειερψλ απφ πιεζπζκνχο ηεο Διιάδαο, Οπγγαξία, Σπλεζίαο θαη Απζηξαιίαο, ππνδειψλεη φηη ηέηνηα ζηειέρε είλαη κηθξήο επηδεκηνινγηθήο ζεκαζίαο. Δπηπιένλ, ηα ζηειέρε ηεο Οκάδαο Η είλαη ίζσο θαη κηθξήο βηνινγηθήο ζεκαζίαο δεδνκέλνπ φηη ζε κηα πξφζθαηε κειέηε, ρξεζηκνπνηψληαο πνιιαπιέο γελεηηθέο γελεαινγίεο, απνδείρζεθε ε απνπζία γελεηηθήο αληαιιαγήο κεηαμχ ζηειερψλ ηεο Οκάδαο Η θαη ηεο Οκάδαο ΗΗ ππνζηεξίδνληαο φηη αλήθνπλ ζε δηαθξηηά θπινγελεηηθά είδε (Fournier et al., 2005). Ο πιεζπζκφο ηνπ παζνγφλνπ πνπ ρξεζηκνπνηήζεθε ζηε παξνχζα εξγαζία πξνεξρφηαλ απφ κνιπζκέλνπο θαξπνχο, ελψ είλαη γλσζηφ φηη ηα ζηειέρε ηεο Οκάδαο Η ζπλήζσο απνκνλψλνληαη απφ πξνζβεβιεκέλα θχιια θαη άλζε. πλεπψο, απηφ πνπ απνκέλεη είλαη λα εξεπλεζεί εάλ ε παξαηεξνχκελε απνπζία απνκνλψζεσλ ηεο Οκάδαο Η νθείιεηαη ζηε ζηξαηεγηθή δεηγκαηνιεςίαο ή ζε κηα πξαγκαηηθή απνπζία ηέηνησλ ζηειερψλ ζηελ Διιάδα. 35

43 ηελ εξγαζία απηή, παξφιν πνπ νη απνκνλψζεηο απφ ηνκάηα, θνινθπλζνεηδή θαη θξάνπια ζπιιέρζεθαλ απφ ζεξκνθεπηαθέο θαιιηέξγεηεο ελψ νη απνκνλψζεηο ακπειηνχ απφ ππαίζξηα θαιιηέξγεηα, ελ ηνχηνηο νη πιεζπζκνί ηνπ παζνγφλνπ παξνπζίαζαλ φκνηα ζχλζεζε σο πξνο ηε ζπρλφηεηα παξνπζίαο ησλ δηαθφξσλ ζπλδπαζκψλ κεηαζεηψλ ζηνηρείσλ. Μηα ηέηνηα νκνηφηεηα κπνξεί λα απνδνζεί ζε κηα ζπλερή ξνή γνληδίσλ απφ ηα ζεξκνθήπηα πξνο ππαίζξηεο θαιιηέξγεηεο θαη αληίζηξνθα φπσο έρεη πξνηαζεί ζε πξνεγνχκελεο εξγαζίεο (Alfonso et al., 2000; Decognet et al., 2009). Παξά ην γεγνλφο φηη ηα ζεξκνθήπηα ίζσο δξνπλ σο θξαγκφο, νδεγψληαο ζε γελεηηθή απνκφλσζε αλ ε είζνδνο εμσηεξηθνχ κνιχζκαηνο είλαη πεξηνξηζκέλε (Karchani-Balma et al., 2008), απηφ είλαη θάηη πνπ απέρεη πνιχ απφ ηηο γεσξγηθέο πξαθηηθέο πνπ εθαξκφδνληαη ζηελ Διιάδα νη νπνίεο πεξηιακβάλνπλ: i) ελαιιαγή ζνιαλσδψλ, φπσο γηα παξάδεηγκα ηνκάηα, κειηηδάλα θαη πηπεξηά κε θνινθπλζνεηδή, φπσο γηα παξάδεηγκα αγγνχξη θαη θνινθπζάθη, ii) άλνηγκα νξνθήο θαη πιατλψλ παξαζχξσλ ζεξκνθεπίνπ θαηά ηε δηάξθεηα ησλ ζεξκψλ σξψλ ηεο εκέξαο γηα αεξηζκφ θαη iii) απνκάθξπλζε θαη εγθαηάιεηςε πξνζβεβιεκέλσλ θπηψλ ή ηκεκάησλ ηνπο ζηηο άθξεο ησλ ρσξαθηψλ ή ησλ ζεξκνθεπίσλ. Σέηνηνη παξάγνληεο, παξάιιεια κε ηελ απνπζία κηαο απζηεξήο εμεηδίθεπζεο παζνγφλνπ-μεληζηή, ίζσο εμεγνχλ ηελ παξαηεξνχκελε νκνηφηεηα ζηνπο ηχπνπο ηνπ παζνγφλνπ ζε απηέο ηηο θαιιηέξγεηεο. Ωζηφζν, απαηηείηαη πεξεηαίξσ έξεπλα γηα λα μεθαζαξίζεη ε παξνπζία ή απνπζία πξαγκαηηθψλ γελεηηθψλ νκνηνηήησλ κεηαμχ πιεζπζκψλ πνπ παξνπζηάδνπλ φκνηα ζχλζεζε σο πξνο ηε ζπρλφηεηα παξνπζίαο ησλ δηαθφξσλ ζπλδπαζκψλ κεηαζεηψλ ζηνηρείσλ. Έλα απφ ηα ζεκαληηθφηεξα επξήκαηα απηήο ηεο εξγαζίαο είλαη φηη νη vacuma απνκνλψζεηο επηθξαηνχζαλ ζηνπο πιεζπζκνχο ηνπ παζνγφλνπ απφ αθηηλίδην θαη κήιν ελψ φπσο αλακελφηαλ νη transposa απνκνλψζεηο επηθξαηνχζαλ ζηνπο ππφινηπνπο μεληζηέο. Δίλαη ηεθκεξησκέλν φηη νη vacuma απνκνλψζεηο εκθαλίδνπλ επνρηθή δηαθχκαλζε φπσο γηα παξάδεηγκα ζην ζηαθχιη φπνπ επηθξαηνχλ λσξίο ηελ θαιιηεξγεηηθή πεξίνδν ελψ κεηψλνληαη ζε ζπρλφηεηα κεηά ηελ έλαξμε ηεο σξίκαλζεο (Giraud et al., 1997; Giraud et al., 1999; Martinez et al., 2005). Δπηθξάηεζε vacuma ζηειερψλ ζε πιεζπζκφ ηνπ κχθεηα θαηά ην ηέινο ηεο βιαζηηθήο πεξηφδνπ έρεη αλαθεξζεί κφλν ζηελ κπηδειηά (Giraud et al., 1999). Οη παξαηεξνχκελεο δηαθνξέο ζηε ζπρλφηεηα θαηαλνκήο ησλ ηχπσλ B. cinerea κεηαμχ αθηηληδίνπ θαη άιισλ μεληζηψλ φπσο ζηαθχιη ή ηνκάηα έρεη επίζεο αλαθεξζεί ζε πιεζπζκνχο ηνπ παζνγφλνπ απφ ηε Υηιή (Munoz et al., 2002). Δπηπιένλ, απξφζκελα πςειή ήηαλ θαη ε ζπρλφηεηα απνκνλψζεσλ πνπ έθεξαλ κφλν ην Flipper ζηνηρείν ζηνπο πιεζπζκνχο απφ αθηηλίδην θαη κήιν. ε δηάθνξεο πξνεγνχκελεο αλαθνξέο, ηέηνηεο απνκνλψζεηο είηε απνπζίαδαλ πιήξσο (Kretchmer and Hahn et al., 2008; Ma and Micailides, 2005a; Munoz et al., 2002) ή βξίζθνληαλ ζε πνιχ ρακειέο ζπρλφηεηεο (Albertini et al., 2002). Αλίρλεπζε απνκνλψζεσλ ηνπ B. cinerea πνπ έθεξαλ κφλν ην flipper ζηνηρείν ζε ςειέο ζπρλφηεηεο έρεη αλαθεξζεί κφλν ζε απνκνλψζεηο απφ θξάνπια θαη ζηαθχιη (Milisevic et al., 2006; Váczy et al., 2008). Σν αλ απηέο νη Flipper απνκνλψζεηο πξνέξρνληαη απφ δηαζηαχξσζε κεηαμχ vacuma θαη transposa απνκνλψζεσλ ή ζπληζηνχλ έλα δηαθξηηφ ηχπν B. cinerea απαηηεί πεξαηηέξσ δηεξεχλεζε. 36

44 Ζ αλίρλεπζε πνιχ πςειφηεξεο ζπρλφηεηαο vacuma απνκνλψζεσλ ζηνπο πιεζπζκνχο απφ αθηηλίδην θαη κήιν δεκηνχξγεζε εξσηεκαηηθά ζρεηηθά κε ηελ εμήγεζε ηνπ θαηλνκέλνπ. Βαζηδφκελνη ζην γεγνλφο φηη νη πιεζπζκνί θαη απφ κήιν θαη απφ αθηηλίδην είραλ ζπιιερζεί απφ ζάπηνπο θαξπνχο ζπληεξεκέλνπο ζηα ςπγεία ησλ ζπζθεπαζηεξίσλ, ππνζέζακε φηη νη vacuma απνκνλψζεηο κπνξνχζαλ είηε λα αλαπηπρζνχλ γξεγνξφηεξα απφ ηηο transposa ζηε ζεξκνθξαζία ζπληήξεζεο ησλ 0 o C ή φηη νη vacuma απνκνλψζεηο ήηαλ πην κνιπζκαηηθέο ζε μεληζηέο φπσο ην αθηηλίδην ή ην κήιν ζηε ζεξκνθξαζία ζπληήξεζεο. Γηα λα ειέγμνπκε απηή ηελ ππφζεζε δηελεξγήζακε δχν επηπξφζζεηεο ζεηξέο πεηξακάησλ ζπγθξίλνληαο ην ξπζκφ κπθειηαθήο αλάπηπμεο θαη ηελ παζνγφλν δχλακε ζην αθηηλίδην ελφο αξηζκνχ ηπραία επηιεγκέλσλ transposa θαη vacuma απνκνλψζεσλ θάησ απφ δηάθνξεο ζεξκνθξαζίεο. Ζ ζχγθξηζε ησλ ξπζκψλ κπθειηαθήο αλάπηπμεο ζηηο ηξεηο δηαθνξεηηθέο ζεξκνθξαζίεο έδεημε φηη ε ζεξκνθξαζία επεξεάδεη θαηά ηνλ ίδην ηξφπν ηφζν ηηο transposa φζν θαη ηηο vacuma απνκνλψζεηο ρσξίο λα ππάξρνπλ ζηαηηζηηθά ζεκαληηθέο δηαθνξέο κεηαμχ ησλ δχν ηχπσλ ζηελ θάζε ζεξκνθξαζία. Καη γηα ηνπο δχν ηχπνπο ν ςειφηεξνο ξπζκφο αλάπηπμεο παξαηεξήζεθε ζηε ζεξκνθξαζία ησλ 20 o C ελψ ν ρακειφηεξνο ζηνπο 0 o C. Ζ απνπζία δηαθνξψλ ζηνπο ξπζκνχο κπθειηαθήο αλάπηπμεο πξσηίζησο ζηε ζεξκνθξαζία ησλ 0 o C, είλαη ηδηαίηεξεο ζεκαζίαο θαζψο ε ζεξκνθξαζία απηή αληηζηνηρεί ζηε ζεξκνθξαζία ζπληήξεζεο ησλ αθηηληδίσλ θαη κήισλ. Γεδνκέλεο ηεο απνπζίαο νπνηαζδήπνηε δηαθνξάο ζην ξπζκφ κπθειηαθήο αλάπηπμεο κεηαμχ vacuma θαη transposa απνκνλψζεσλ κπνξεί λα εμαρζεί ην ζπκπέξαζκα φηη ν ξπζκφο αλάπηπμεο ζηνπο 0 o C δελ κπνξεί λα εμεγήζεη ηελ επηθξαηνχζα εκθάληζε vacuma απνκνλψζεσλ εληφο ηνπ πιεζπζκνχ πνπ ζπιιέρζεθε απφ θαξπνχο δηαηεξεκέλνπο ζην ςπγείν φπσο είλαη ηα αθηηλίδηα. Δπηπξφζζεηα, ηα απνηειέζκαηα απφ ηηο δνθηκέο ειέγρνπ ηεο παζνγφλνπ δχλακεο έδεημαλ φηη ην πνζνζηφ πξνζβνιήο πνπ πξνθάιεζαλ νη transposa θαη vacuma απνκνλψζεηο ζε θαξπνχο αθηηληδίσλ κεηά απφ ηερλεηή κφιπλζε κέζσ πιεγήο ήηαλ φκνηα θάησ θαη απφ ηηο δχν ζεξκνθξαζίεο επψαζεο πνπ ειέγρζεθαλ. Ωο εθ ηνχηνπ, ν ηξφπνο κφιπλζεο ησλ θαξπψλ πνπ επηιέρζεθε δελ θαηάθεξε λα δηαρσξίζεη ηνπο δχν δηαθξηηνχο ηχπνπο ηνπ κχθεηα σο πξνο ηελ παζνγφλν δχλακή ηνπο ζηνπο θαξπνχο ηεο αθηηληδηάο. Παξφια απηά, ζα πξέπεη λα ιεθζεί ππφςε ην γεγνλφο φηη ν B. cinerea κπνξεί λα ζπκπεξηθεξζεί θαη σο έλα παζνγφλν ιαλζαλνπζψλ κνιχλζεσλ. Μπνξεί λα εηζέιζεη ζηνπο ηζηνχο ησλ θαξπψλ κεηά απφ απνηθηζκφ γεξαζκέλσλ αλζηθψλ νξγάλσλ θαη λα παξακέλεη ιαλζάλσλ εληφο ησλ ηζηψλ κέρξη ηελ σξίκαλζε ησλ θαξπψλ, ζπλήζσο θαηά ηε δηάξθεηα ηεο ζπληήξεζεο. Απηφο ν ηξφπνο κφιπλζεο θαξπψλ αληηπξνζσπεχεη έλαλ απφ ηνπο 3 πηζαλνχο ηξφπνπο (Michailides and Elmer, 2000). Ο δεχηεξνο ηξφπνο κφιπλζεο είλαη δηακέζνπ πιεγψλ νη νπνίεο δεκηνπξγήζεθαλ θαηά ηε ζπγθνκηδή (Sharrock and Hallet, 1991). Απηφο ν ηξφπνο κφιπλζεο αληηζηνηρεί ζηνλ ηξφπν κφιπλζεο ησλ αθηηληδίσλ πνπ ρξεζηκνπνηήζεθε ζε απηή ηελ εξγαζία. Ο ηξίηνο ηξφπνο απνηειεί ηε δηαζπνξά ηνπ κνιχζκαηνο απφ θαξπφ ζε θαξπφ κε ηελ επαθή θάηη πνπ ζεσξείηαη κηθξήο επηδεκηνινγηθήο ζεκαζίαο. Πξνεγνχκελε εξγαζία έρεη δείμεη φηη νη vacuma απνκνλψζεηο ραξαθηεξίδνληαη απφ πςειφηεξε ζαπξνθπηηθή ηθαλφηεηα ζε ζρέζε κε ηηο transposa απνκνλψζεηο (Martinez et al., 2005). Απηή ε πςειή ζαπξνθπηηθή 37

45 ηθαλφηεηα ίζσο νδεγήζεη ζε ιαλζάλνπζεο κνιχλζεηο θαηά ηελ έλαξμε ηεο θαιιηεξγεηηθήο πεξηφδνπ θαηά θχξην ιφγν απφ vacuma απνκνλψζεηο, ελψ κνιχλζεηο κέζσ πιεγψλ ζηε πεξηνρή ηνπ πνδίζθνπ ησλ αθηηληδίσλ θαηά ηε ζπγθνκηδή, ίζσο πξνθαινχληαη εμίζνπ θαη απφ transposa θαη απφ vacuma απνκνλψζεηο. πλεπψο, ε πςειή ζπρλφηεηα ησλ vacuma απνκνλψζεσλ ε νπνία παξαηεξήζεθε ζε θαξπνχο ζπληεξεκέλνπο ζε ςπγεία κπνξεί λα εμεγεζεί κέζσ ηεο ππφζεζεο φηη απηέο πξνέξρνληαη απφ ιαλζάλνπζεο κνιχλζεηο νη νπνίεο επζχλνληαη γηα έλα κεγάιν κέξνο ηνπ ζπλνιηθνχ αξηζκνχ κνιπζκέλσλ θαξπψλ. πλνςίδνληαο, ηα απνηειέζκαηα απηήο ηεο εξγαζίαο είλαη ζχκθσλα κε πξνεγνχκελεο εξγαζίεο νη νπνίεο έρνπλ δείμεη φηη ην είδνο ηνπ μεληζηή κπνξεί λα επηδξά ζεκαληηθά ζηε γελεηηθή δνκή ηνπ παζνγφλνπ, παξά ηελ απνπζία απφιπηεο εμεηδίθεπζεο θαηά μεληζηή (Fournier and Giraud, 2008). Ζ γλψζε ηεο γελεηηθήο δνκήο ηνπ πιεζπζκνχ ζηνλ πξνζβεβιεκέλν μεληζηή είλαη βαζηθή γηα ηελ αλάπηπμε κηαο νξζνινγηθήο ζηξαηεγηθήο ειέγρνπ ηνπ παζνγφλνπ. Γηα ην ιφγν απηφ, ηα λέα εξγαιεία κνξηαθήο γελεηηθήο ζηνρεχνπλ πξνο κηα βαζχηεξε θαηαλφεζε ηεο γελεηηθήο δνκήο απηνχ ηνπ ζεκαληηθνχ παζνγφλνπ. 38

46 3. Αλζεθηηθόηεηα πιεζπζκώλ ηνπ κύθεηα B. cinerea ζε κπθεηνθηόλα κε έκθαζε ζηνπο παξεκπνδηζηέο ηνπ ζπκπιόθνπ ΙΙΙ ηεο αλαπλνήο 3.1. Δηζαγσγή Υεκηθή θαηαπνιέκεζε ηνπ Β. cinerea Μπθεηνθηόλα κε βνηξπδηνθηόλν δξάζε Ο ρεκηθφο έιεγρνο παξακέλεη κέρξη θαη ζήκεξα ν θπξηφηεξνο ηξφπνο γηα ηελ αληηκεηψπηζε ηεο ηεθξάο ζήςεο ζηηο πεξηζζφηεξεο θαιιηέξγεηεο. Ζ πην θνηλή επέκβαζε πεξηιακβάλεη ςεθαζκνχο ησλ ελαέξησλ ηκεκάησλ ησλ θπηψλ κε κπθεηνθηφλα. Οη εθαξκνδφκελεο δφζεηο πνηθίινπλ απφ g/ha (π.ρ. maneb, thiram, dichlofluanid) κέρξη g/ha (π.ρ. carbendazim, fludioxonil, pyrimethanil). Ο αξηζκφο ησλ επεκβάζεσλ θαηά ηε δηάξθεηα κηαο θαιιηεξγεηηθήο πεξηφδνπ θπκαίλεηαη απφ κηα κε δχν, κέρξη πέξαλ ησλ είθνζη. Μεηαρεηξίζεηο ζπφξσλ θαη βνιβψλ θαζψο θαη εθαξκνγέο κπθεηνθηφλσλ κεηαζπιιεθηηθά, επίζεο ρξεζηκνπνηνχληαη (Leroux, 2004). Δίλαη δηαζέζηκεο δηάθνξεο νκάδεο ζπλζεηηθψλ βνηξπδηνθηφλσλ νη νπνίεο κπνξνχλ λα ηαμηλνκεζνχλ αλάινγα κε ην βηνρεκηθφ ηξφπν δξάζεο ηνπο ζε πέληε θαηεγνξίεο: 1) κπθεηνθηφλα πνπ παξεκβαίλνπλ ζηε κίησζε θαη θπηηαξνδηαίξεζε, 2) ελψζεηο πνπ επεξεάδνπλ ηελ σζκσξχζκηζε, 3) κπθεηνθηφλα αλαζηνιήο ηεο βηνζχλζεζεο ακηλνμέσλ (κεζεηνλίλεο), 4) κπθεηνθηφλα αλαζηνιήο ηεο βηνζχλζεζεο ζηεξνιψλ θαη 5) κπθεηνθηφλα πνπ παξεκβαίλνπλ ζηελ αιπζίδα ηεο αλαπλνήο. Σε δεθαεηία ηνπ 1960 αλαπηχρζεθαλ ηα πξψηα δηαζπζηεκαηηθά κπθεηνθηφλα φπσο είλαη ηα βελδηκηδαδνιηθά (benomyl, thiabendazole, carbendazim) (Δηθφλα 34) θαη νη εζηέξεο ηνπ ζεηνθαληθνχ νμένο (thiophonate-methyl). Σα κπθεηνθηφλα απηά είλαη επξέσο θάζκαηνο πξνζηαηεπηηθά θαη ζεξαπεπηηθά κπθεηνθηφλα θαη εκθαλίδνπλ εμαηξεηηθή βνηξπδηνθηφλν δξάζε (Leroux, 2004). ηελ νκάδα απηή αλήθεη θαη ην θαξβακηδηθφ κπθεηνθηφλν diethofencarb (Δηθφλα 34) ην νπνίν επίζεο ρξεζηκνπνηείηαη θαηά ηνπ B. cinerea. Σα βελδηκηδαδνιηθά φπσο θαη ηα ππφινηπα κέιε ηεο νκάδαο απηήο ζεσξνχληαη αλαζηνιείο ηεο κίησζεο θαζψο παξεκβαίλνπλ ζηνλ πνιπκεξηζκφ ηεο ηνπκπνπιίλεο αλαζηέιινληαο ηε ζπλδεζκνινγία ησλ κηθξνζσιελίζθσλ πξνζδελφκελα ζηε β-ηνπκπνπιίλε (β-tubulin) (Davidse and Flach, 1978). πλεπψο εκπνδίδνπλ ην ζρεκαηηζκφ ιεηηνπξγηθήο ππξεληθήο αηξάθηνπ. Μηα άιιε θαηεγνξία κπθεηνθηφλσλ πνπ ρξεζηκνπνηήζεθαλ ή θαη ρξεζηκνπνηνχληαη θαηά ηνπ B. cinerea πεξηιακβάλεη κπθεηνθηφλα πνπ επεξεάδνπλ ηελ σζκσξχζκηζε. Σα δηθαξβνμακίδηα (chlozolinate, iprodione, procymidone, vinclozolin), ηα θαηλπινππξξφιηα (fludioxonil θαη fenpiclonil) (Δηθφλα 34) θαη νη 39

47 αξσκαηηθνί πδξνγνλάλζξαθεο (dicloran, quintozene θιπ) είλαη νκάδεο κπθεηνθηφλσλ ηεο θαηεγνξίαο απηήο (Leroux, 2004). Σα δηθαξβνμακίδηα αληηθαηέζηεζαλ ηα βελδηκηδαδνιηθά ζηα ηέιε ηεο δεθαεηίαο ηνπ 1970 θαη έρνπλ ρξεζηκνπνηεζεί γηα ηελ αληηκεηψπηζε ηεο αζζέλεηαο γηα πεξηζζφηεξν απφ δχν δεθαεηίεο (Sun et al., 2010). Σα θαηλπινππξξφιηα είλαη ζπλζεηηθά αλάινγα ηνπ αληηβηνηηθνχ pyrrolnitrin θαη ρξεζηκνπνηνχληαη ζαλ κπθεηνθηφλα θπιιψκαηνο θαηά ηνπ Botrytis θαη άιισλ ζπγγεληθψλ εηδψλ κπθήησλ. Δίλαη κε δηαζπζηεκαηηθά κπθεηνθηφλα ηα νπνία δηαηίζεληαη ζην εκπφξην θαη σο κίγκαηα κε ην cyprodinil (Rosslenbroich and Stuebler, 2000). Σέινο, απφ ηα αξσκαηηθά κπθεηνθηφλα, ηα νπνία αληηπξνζσπεχνπλ κηα παιηά εηεξνγελή νκάδα, ην πην απνηειεζκαηηθφ θαηά ηνπ B. cinerea είλαη ην δηαζπζηεκαηηθφ dicloran ην νπνίν θπθινθφξεζε ζην εκπφξην ην Ο αθξηβήο κεραληζκφο δξάζεο ησλ κπθεηνθηφλσλ απηήο νκάδαο δελ έρεη πιήξσο δηεπθξηληζηεί παξφιν πνπ νη νπζίεο απηέο ρξεζηκνπνηνχληαη εδψ θαη ρξφληα. Τπνζηεξίδεηαη φηη νη νπζίεο απηέο παξεκβαίλνπλ ζην κνλνπάηη κεηαθνξάο ζεκάησλ σζκσξχζκηζεο ην νπνίν απνηειείηαη απφ ηε θηλάζε ηεο ηζηηδίλεο (histidine kinase) θαη ηηο δηαδνρηθέο θηλάζεο MAP (MAP kinase cascades) δηεγείξνληαο κηα κε θπζηνινγηθή ζπζζψξεπζε γιπθεξφιεο (Yamaguchi and Fujimura, 2005; Pillonel and Meyer, 1997). Καη ηα ηξία κέιε ηεο θαηεγνξίαο απηήο (δηθαξβνμακηδηθά, θαηλπινππξξφιηα θαη αξσκαηηθά κπθεηνθηφλα) αλαζηέιινπλ ηφζν ηε βιάζηεζε ησλ θνληδίσλ ηνπ κχθεηα φζν θαη ηε κπθειηαθή αλάπηπμε. Δηθόλα 34. Υεκηθέο δνκέο κπθεηνθηφλσλ ηεο νκάδαο ησλ βελδηκηδαδνιηθψλ (benomyl, carbendazim), ησλ θαξβακηδηθψλ (diethofencarb), ησλ δηθαξβνμηκηδίσλ (iprodione), ησλ θαηλπθνππξξνιίσλ (fludioxonil) θαη ησλ αληιηλνππξηκηδηλψλ (cyprodinil) Μηα ζρεηηθά λέα νκάδα κπθεηνθηφλσλ ηα νπνία εηζήρζεζαλ ζε δηάθνξεο επξσπατθέο ρψξεο ζηα κέζα ηεο δεθαεηίαο ηνπ 1990 είλαη νη αληιηλνππξηκηδίλεο. Οη νκάδα ησλ αληιηλνππξηκηδηλψλ αληηπξνζσπεχεηαη απφ ηξεηο δξαζηηθέο νπζίεο, ην 40

48 cyprodinil (Δηθφλα 34), ην mepanipyrim θαη ην pyrimethanil. Σα κπθεηνθηφλα ηεο νκάδαο απηήο ειέγρνπλ ηθαλνπνηεηηθά ην B. cinerea θαη είλαη απνηειεζκαηηθά θαηά πιεζπζκψλ ηνπ κχθεηα αλζεθηηθψλ ζηα βελδηκηδαδνιηθά θαη δηθαξβνμηκηδηθά κπθεηνθηφλα (Leroux et al., 1999). Οη αληιηλνππξηκηδίλεο ζεσξνχληαη αλαζηνιείο ηεο βηνζχλζεζεο δηαθφξσλ ακηλνμέσλ θαη ηδηαίηεξα ηεο κεζεηνλίλεο. Δπίζεο, νη αληιηλνππξηκηδίλεο αλαζηέιινπλ ηελ έθθξηζε εμσθπηηαξηθψλ πξσηετλψλ, ζπκπεξηιακβαλνκέλσλ πδξνιπηηθψλ ελδχκσλ πνπ ζρεηίδνληαη κε ηε παζνγέλεζε κπθήησλ (Heye et al., 1994; Milling and Richardson, 1995). Οη νπζίεο απηέο είλαη δηαζπζηεκαηηθά κπθεηνθηφλα κε θαηεμνρήλ πξνζηαηεπηηθή θαη κεξηθψο ζεξαπεπηηθή δξάζε (Rosslenbroich and Stuebler, 2000). Όια ηα κπθεηνθηφλα ηεο νκάδαο έρνπλ ηνλ ίδην ηξφπν δξάζεο θαη ζπλεπψο παξαηεξείηαη δηαζηαπξσηή αλζεθηηθφηεηα κεηαμχ ησλ κπθεηνθηφλσλ ηεο νκάδαο (Hilber and Schüepp, 1996 a,b). Ζ επφκελε νκάδα κπθεηνθηφλσλ-βνηξπδηνθηφλσλ πεξηιακβάλεη ηνπο αλαζηνιείο ηεο βηνζχλζεζεο ησλ ζηεξνιψλ (SBIs, Sterol Biosynthesis Inhibitors). ηελ θαηεγνξία απηή αλήθνπλ νη αλαζηνιείο ηεο απνκεζπιίσζεο ηνπ άλζξαθα 14 ηεο ιαλνζηεξφιεο ή DMIs θαη ε λεφηεξε νκάδα ησλ πδξνμπαληιηδίσλ πνπ παξεκβαίλνπλ ζηελ απνκεζπιίσζε ηνπ ηέηαξηνπ άλζξαθα (C-4 demethylation) ζην κνλνπάηη βηνζχλζεζεο ηεο εξγνζηεξφιεο αλαζηέιινληαο ηε δξάζε ηεο 3-θεηνξεδνπθηάζεο (Debieu et al., 2001; Leroux, 2004). Ζ νκάδα ησλ πδξνμπαληιηδίσλ αληηπξνζσπεχεηαη απφ ην κπθεηνθηφλν fenhexamid (Δηθφλα 35) ην νπνίν παξνπζηάδεη πξνζηαηεπηηθή δξάζε θαηά ηνπ B. cinerea θαη άιισλ ζπγγεληθψλ εηδψλ κπθήησλ. Ωζηφζν, παξά ην γεγνλφο φηη ην fenhexamid ήηαλ έλα λέν κπθεηνθηφλν, ελ ηνχηνηο ζηειέρε αλζεθηηθά ζε απηφ ην ππνζρφκελν βνηξπδηνθηφλν ήηαλ εχθνια αληρλεχζηκα ζηνπο πιεζπζκνχο ηνπ κχθεηα πξηλ αθφκα εηζαρζεί ζηε γεσξγηθή πξάμε (Leroux, 2004). Σα κπθεηνθηφλα ηεο νκάδαο ησλ SBIs δελ παξεκπνδίδνπλ ηε βιάζηεζε ησλ θνληδίσλ αιιά ζε ρακειέο ζπγθεληξψζεηο αλαζηέιινπλ ηελ επηκήθπλζε ησλ βιαζηηθψλ ζσιήλσλ θαη ηελ κπθειηαθή αλάπηπμε (Leroux et al., 1999). ηελ ηειεπηαία νκάδα κπθεηνθηφλσλ κε βνηξπδηνθηφλν δξάζε πεξηιακβάλνληαη δξαζηηθέο νπζίεο νη νπνίεο έρνπλ ζηφρν ηελ αιπζίδα ηεο αλαπλνήο. Σα κπθεηνθηφλα απηά δηαηαξάζζνπλ ηνλ εθνδηαζκφ ελέξγεηαο ηνπ B. cinerea δηαθφπηνληαο ηελ ζχλζεζε ΑΣΡ. Σέηνηεο ελψζεηο είλαη ηζρπξνί αλαζηνιείο ηεο βιάζηεζεο θνληδίσλ. ηελ νκάδα απηή αλήθνπλ: α) πνιπζεζηθά κπθεηνθηφλα, β) παξεκπνδηζηέο ηεο νμεηδσηηθήο θνζθνξπιίσζεο θαη γ) αλαζηνιείο ηνπ ζπκπιφθνπ II θαη III ηεο αλαπλεπζηηθήο αιπζίδαο ησλ κηηνρνλδξίσλ. Απφ ηελ θαηεγνξία ησλ πνιπζεζηθψλ βνηξπδηνθηφλσλ ρξεζηκνπνηήζεθαλ γηα αξθεηά ρξφληα ηα δηζεηνθαξβακηδηθά (thiram, mancozeb θαη maneb) (Δηθφλα 35), ηα θζαιηκίδηα θαη ηα αξπινζνπιθακίδηα (captan, folpet, dichlofluanid θαη tolylfluanid) (Δηθφλα 35) θαη ην chlorathalonil (Leroux, 2004). Όια ηα κέιε ηεο θαηεγνξίαο ησλ πνιπζεζηθψλ κπθεηνθηφλσλ παξνπζηάδνπλ πξνζηαηεπηηθή δξάζε θαη ρξεηάδνληαη ζπρλέο εθαξκνγέο ζε ςειέο δφζεηο (κεηαμχ 1000 θαη 2000 gr δξαζηηθήο νπζίαο αλά εθηάξην) (Leroux, 2004). Ο νπζηαζηηθφο θίλδπλνο γηα αλάπηπμε αλζεθηηθφηεηαο ζε 41

49 ηέηνηα κπθεηνθηφλα ζεσξείηαη ρακειφο, σζηφζν, ππάξρνπλ δηάθνξεο αλαθνξέο γηα απνηπρία ειέγρνπ ηνπ κχθεηα. Σν fluazinam είλαη κηα αξπιακηλνππξηδίλε, έλαο απφ ηνπο ηζρπξφηεξνπο γλσζηνχο παξεκπνδηζηέο ηεο ζχλζεζεο ηνπ ΑΣΡ. Σν fluazinam έρεη ρξεζηκνπνηεζεί θαηά ηνπ B. cinerea αξρηθά ζηελ Ηαπσλία απφ ην 1990 θαη απφ ηα ηέιε ηεο δεθαεηίαο ηνπ 1990 θαη ζηελ Δπξψπε. Οη παξεκπνδηζηέο ηνπ ζπκπιφθνπ ΗΗ ηεο αλαπλνήο, γλσζηνί αιιηψο θαη σο αλαζηνιείο ηεο αθπδξνγνλάζεο ηνπ ειεθηξηθνχ νμένο (succinate dehydrogenase inhibitors, SDHIs) είλαη κηα παιηά νκάδα κπθεηνθηφλσλ πνπ πεξηιακβάλεη ζηηο ηάμεηο ηεο δξαζηηθέο νπζίεο δηαθφξσλ ρεκηθψλ δνκψλ φπσο ηα θαξβνμακίδηα θαη ζπγγεληθά αληιίδηα. Σα κπθεηνθηφλα απηά εηζήρζεζαλ ζηε γεσξγηθή πξάμε ζηα ηέιε ηεο δεθαεηίαο ηνπ 1960 σο δηαθπιιηθά θαη επελδπηηθά ζπφξσλ ιφγσ ηεο δηαζπζηεκαηηθήο ηνπο δξάζεο θπξίσο έλαληη βαζηδηνκπθήησλ (Leroux, 2004). Όκσο, ηα ηειεπηαία ρξφληα ην εξεπλεηηθφ ελδηαθέξνλ επηθεληξψλεηαη ζε απηή ηελ νκάδα κπθεηνθηφλσλ θαη έηζη εηζήρζεζαλ πξφζθαηα λέεο δξαζηηθέο νπζίεο ζηε γεσξγηθή πξάμε ή πξφθεηηαη ζχληνκα λα ιάβνπλ έγθξηζε θπθινθνξίαο. ηε λεφηεξε γεληά ησλ αληιηδίσλ εκπίπηεη ην κπθεηνθηφλν boscalid (Δηθφλα 35) ην νπνίν παξνπζηάδεη έλα πνιχ επξχ θάζκα δξάζεο πέξαλ ηνπ B. cinerea. Ζ πξσηεΐλε ζηφρνο ηνπ boscalid φπσο θαη ησλ ππνινίπσλ κπθεηνθηφλσλ απηήο ηεο νκάδαο είλαη ε αθπδξνγνλάζε ηνπ ειεθηξηθνχ νμένο (ζαμηληθή αθπδξνγνλάζε), ε νπνία απνηειείηαη απφ ηέζζεξηο ππνκνλάδεο (SdhA, SdhB, SdhC θαη SdhD) θαη ζπκκεηέρεη ζε δχν ζεκαληηθέο θπηηαξηθέο δηαδηθαζίεο, ζην θχθιν ηνπ ηξηθαξβνμπιηθνχ νμένο θαη ζηελ αιπζίδα κεηαθνξάο ειεθηξνλίσλ (αλαπλεπζηηθή αιπζίδα) ζηα κηηνρφλδξηα. Με ηνλ ηξφπν απηφ νη SDHIs εκπνδίδνπλ ηε κεηαθνξά ειεθηξνλίσλ απφ ην ειεθηξηθφ νμχ ζηελ νπκπηθηλφλε (Stammler et al., 2007; Leroux, 2004). Δηθόλα 35. Υεκηθέο δνκέο κπθεηνθηφλσλ ηεο νκάδαο ησλ πδξνμπαληιηδίσλ (fenhexamid), ησλ δηζεηνθαξβακηδηθψλ (mancozeb), ησλ αξπινζνπιθακηδίσλ (captan) θαη ησλ αληιηδίσλ (boscalid) 42

50 Ιζηνξηθό αλζεθηηθόηεηαο Πξηλ απφ ην 1970, ζρεδφλ φια ηα κπθεηνθηφλα πνπ ρξεζηκνπνηνχληαλ γηα ηνλ έιεγρν ησλ θπηνπαζνγφλσλ ήηαλ πνιπζεζηθνί αλαζηνιείο κε πξνζηαηεπηηθή δξάζε. Παξά ηελ επξεία ηνπο ρξήζε, ε αλάπηπμε αλζεθηηθφηεηαο ζε απηέο ηηο νπζίεο ήηαλ έλα ζπάλην θαηλφκελν. Ωζηφζν, κεηά ηελ εηζαγσγή ησλ κπθεηνθηφλσλ εμεηδηθεπκέλνπ ηξφπνπ δξάζεο ζηα ηέιε ηεο δεθαεηίαο ηνπ 1960, ε αλζεθηηθφηεηα ησλ θπηνπαζνγφλσλ κπθήησλ ζηα κπθεηνθηφλα έρεη γίλεη έλα ζνβαξφ πξφβιεκα ζηε θπηνπξνζηαζία (Brent, 1995). Ζ αλζεθηηθφηεηα ζηα κπθεηνθηφλα είλαη κηα ζηαζεξή, θιεξνλνκήζηκε πξνζαξκνγή ελφο κχθεηα ζε έλα κπθεηνθηφλν κε απνηέιεζκα ηε κεησκέλε επαηζζεζία ηνπ κχθεηα ζε απηφ (Ma and Michailides, 2005b). Έρνπλ πξνζδηνξηζηεί δηάθνξνη κεραληζκνί αλζεθηηθφηεηαο, σζηφζν, αιιαγέο ζηε πξσηεΐλε-ζηφρν, ε νπνία παξακέλεη ιεηηνπξγηθή αιιά είλαη ιηγφηεξν επαίζζεηε ζηα κπθεηνθηφλα, είλαη ν πην θνηλφο κεραληζκφο αλζεθηηθφηεηαο ζηνπο θπηνπαζνγφλνπο κχθεηεο. Αιιαγέο ηνπ ζεκείνπ-ζηφρνπ πξνθχπηνπλ απφ ζεκεηαθέο κεηαιιάμεηο ζην αληίζηνηρν γνλίδην. Ωζηφζν, θαη άιινη κεραληζκνί έρνπλ αλαθεξζεί, ζε ρακειφηεξεο ζπρλφηεηεο, θαη αθνξνχλ: i) ππεξέθθξαζε ηνπ ζηφρνπ, ii) ελεξγνπνίεζε ελφο ελαιιαθηηθνχ κνλνπαηηνχ αληηθαζηζηψληαο ην θχξην κνλνπάηη, iii) ηαρχηεξε απνηνμίλσζε ηνπ κπθεηνθηφλνπ ή ρακειφηεξα επίπεδα πξν-κπθεηνθηφλνπ ελεξγνπνίεζεο θαη iv) κείσζε ηεο εηζξνήο κπθεηνθηφλνπ ή αχμεζε ηεο εθξνήο ηνπ κε απνηέιεζκα ηε ρακειφηεξε ζπγθέληξσζε ηνπ εληφο ηνπ θπηηάξνπ (Brent and Hollomon, 2007; Leroux et al., 2010). Αλζεθηηθά ζηειέρε ηππηθά ππάξρνπλ ζηε θχζε ζε πνιχ ρακειέο ζπρλφηεηεο. Γεδνκέλνπ φηη έλα κπθεηνθηφλν κπνξεί λα ειέγμεη απνηειεζκαηηθά ηα επαίζζεηα ζηειέρε, ηα αλζεθηηθά ζηειέρε επηθξαηνχλ ζηνπο πιεζπζκνχο ηνπ παζνγφλνπ ππφ ηε πίεζε επηινγήο πνπ δεκηνπξγεί ε επαλαιακβαλφκελε ρξήζε ελφο κπθεηνθηφλνπ. Σν απνηέιεζκα ηεο επηινγήο αλζεθηηθψλ ζηειερψλ κπνξεί λα είλαη ν πεξηνξηζκφο ή θαη ε πιήξεο απψιεηα ηεο απνηειεζκαηηθφηεηαο ηνπ κπθεηνθηφλνπ (Ma and Michailides, 2005b). Δίλαη επξέσο γλσζηφ φηη ν κχθεηαο B. cinerea αληηπξνζσπεχεη έλα θιαζζηθφ παζνγφλν πςεινχ θηλδχλνπ φζνλ αθνξά ηελ αλάπηπμε αλζεθηηθφηεηαο ζηα κπθεηνθηφλα εμαηηίαο ηεο πςειήο γελεηηθήο παξαιιαθηηθφηεηάο ηνπ, ηεο άθζνλεο ζπνξνπνίεζεο, ηνπ ζχληνκνπ βηνινγηθνχ ηνπ θχθινπ θαη ηνπ κεγάινπ εχξνπο μεληζηψλ ηνπ (Myresiotis et al., 2008). Ωο εθ ηνχηνπ, ε αλάπηπμε αλζεθηηθψλ ζηειερψλ ηνπ παζνγφλνπ ζηα ρξεζηκνπνηνχκελα βνηξπδηνθηφλα ήηαλ αλακελφκελε. Ακέζσο κεηά ηελ εηζαγσγή ησλ βελδηκηδαδνιηθψλ κπθεηνθηφλσλ ζηε γεσξγηθή πξάμε θαηαγξάθεθαλ θαη νη πξψηεο αλαθνξέο αλζεθηηθφηεηαο εμαηηίαο κεηαιιάμεσλ ζην γνλίδην ηεο β-ππνκνλάδαο ηεο ηνπκπνπιίλεο (Faretra and Pollastro, 1991). ηηο πεξηζζφηεξεο πεξηπηψζεηο, ε αλάπηπμε αλζεθηηθφηεηαο ζηα βελδηκηδαδνιηθά κπθεηνθηφλα νθείιεηαη ζε κεηαιιάμεηο ακηλνμέσλ ζηηο ζέζεηο 198 θαη 200 ηνπ γνληδίνπ ηεο β-ηνπκπνπιίλεο (Yarden and Katan, 1993). Ωζηφζν, ηα πεξηζζφηεξα ζηειέρε ηνπ B. cinerea ηα νπνία ήηαλ αλζεθηηθά ζηα βελδηκηδαδνιηθά κπθεηνθηφλα, ζηειέρε κε ηελ E198A κεηαιιαγή, ήηαλ ηαπηνρξφλσο πνιχ επαίζζεηα ζην diethofencarb θαη αληηζηξφθσο (Banno et al., 2008; Leroux et al., 1999). Ζ 43

51 δηαπίζησζε ηνπ θαηλνκέλνπ ηεο αξλεηηθήο δηαζηαπξσηήο αλζεθηηθφηεηαο νδήγεζε ζηελ εηζαγσγή ελφο κίγκαηνο carbendazim θαη diethofencarb ζηα ηέιε ηεο δεθαεηίαο ηνπ χληνκα φκσο, κεηά ηελ εηζαγσγή ηνπ κίγκαηνο, ζηειέρε ηνπ B. cinerea κε ηελ F200Y ή ηελ E198K κεηάιιαμε ηα νπνία εκθαλίδνπλ δηπιή αλζεθηηθφηεηα ζε βελδηκηδαδνιηθά κπθεηνθηφλα θαη ην diethofencarb επηιέρζεθαλ ζηνπο πιεζπζκνχο ηνπ παζνγφλνπ (Yarden and Katan, 1993; Leroux et al.,2002). Σα κπθεηνθηφλα πνπ επεξεάδνπλ ηελ σζκσξχζκηζε (δηθαξβνμακηδηθά, θαηλπινππξξφιηα θαη αξσκαηηθά κπθεηνθηφλα) ζπληζηνχλ κηα ρεκηθά εηεξνγελή νκάδα. Απηφ φκσο, δελ εκπφδηζε ηελ αλάπηπμε δηαζηαπξσηήο αλζεθηηθφηεηαο κεηαμχ ησλ νπζηψλ απηψλ. Έιεγρνη πιεζπζκψλ ηνπ B. cinerea απφ δηάθνξεο θαιιηέξγεηεο έδεημαλ ηελ παξνπζία ζηειερψλ κέηξηα αλζεθηηθψλ ζηα δηθαξβνμακηδηθά κπθεηνθηφλα κε δηαζηαπξσηή αλζεθηηθφηεηα ζηνπο αξσκαηηθνχο πδξνγνλάλζξαθεο αιιά φρη κε ηα θαηλπινππξξφιηα (Leroux, 2004). ε θάπνηα ζηειέρε αγξνχ ε αλζεθηηθφηεηα πεξηνξίδεηαη ζηα δηθαξβνμακηδηθά (Leroux et al., 1999) ή σηα θαηλπινππξξφιηα (Vignutelli et al., 2002). πγθεθξηκέλα γηα ηα δηθαξβνμακηδηθά, αλάινγα κε ηηο κεηαιιάμεηο ζην γνλίδην BcOS1 ηεο θηλάζεο ηεο ηζηηδίλεο, ε αλζεθηηθφηεηα δηαρσξίδεηαη ζε ηξεηο ηχπνπο (Banno et al., 2008). Όζνλ αθνξά ηελ αλζεθηηθφηεηα ηνπ B. cinerea ζηηο αληιηλνππξηκηδίλεο απηή έρεη αλαθεξζεί ζε πνιιέο θαιιηέξγεηεο ζε δηάθνξεο ρψξεο (Latorre et al., 2002; Moyano et al., 2004; Myresiotis et al., 2007; Kretchmer and Hahn, 2008). Έρνπλ πξνζδηνξηζηεί δηάθνξνη θαηλφηππνη αλζεθηηθφηεηαο ζηηο αληιηλνππξηκηδίλεο κε επίπεδα αλζεθηηθφηεηαο πνπ θπκαίλνληαη απφ ρακειά σο πνιχ ςειά (Leroux et al., 1999; Myresiotis et al., 2007). Γηα παξάδεηγκα, νη Leroux et al. (1999, 2002), πξνζδηφξηζαλ ζε γαιιηθνχο πιεζπζκνχο ηνπ κχθεηα ηξεηο θαηλνηχπνπο αλζεθηηθφηεηαο ζηηο αληιηλνππξηκηδίλεο (Ani R1, Ani R2 θαη Ani R3). Δπηπξφζζεηα, νη Bardas et al. (2008), απέδεημαλ φηη ε αλζεθηηθφηεηα ζηηο αληιηλνπηξηκηδίλεο είλαη ζηαζεξή θαη φηη ε αλάπηπμε αλζεθηηθφηεηαο ζηα κπθεηνθηφλα απηήο ηεο νκάδαο δελ επεξεάδεη ηελ πξνζαξκνζηηθφηεηα ησλ αλζεθηηθψλ απνκνλψζεσλ. Σα κπθεηνθηφλα πνπ αλήθνπλ ζηελ νκάδα ησλ αλαζηνιέσλ βηνζχλζεζεο ζηεξνιψλ (SBIs, Sterol Biosynthesis Inhibitors) παξνπζηάδνπλ απνηειεζκαηηθή δξάζε ζηελ αλαζηνιή ηεο κπθειηαθήο αλάπηπμεο ηνπ B. cinerea. Ωζηφζν, ππήξμαλ αλαθνξέο φηη θάπνηα κπθεηνθηφλα απηήο ηεο νκάδαο έρνπλ εμαηξεηηθή δξάζε in vitro θαηά ηνπ B. cinerea αιιά πεξηνξηζκέλε απνηειεζκαηηθφηεηα ζην ρσξάθη (Stehmann and Waard, 1996; Elad, 1992). Οη Stehmann and Waard (1996) αλαθέξνπλ φηη απηφ θπξίσο πξνθαιείηαη απφ i) ηηο ζρεηηθά ρακειέο ζπγθεληξψζεηο εθαξκνγήο ζην ρσξάθη πνπ ζπζηήλνληαη γηα ηα DMIs θαη ii) ηελ πςειή γελεηηθή παξαιιαθηηθφηεηα ζηελ επαηζζεζία ησλ πιεζπζκψλ ηνπ B. cinerea ζηνπο DMIs. Παξφια απηά, ε εθαξκνγή πςειφηεξσλ δφζεσλ, νη νπνίεο ζα επέηξεπαλ θαιχηεξν έιεγρν ηεο ηεθξάο ζήςεο, δελ ελδείθλπληαη ιφγσ θπηνηνμηθφηεηαο. Απηφ ην πξφβιεκα κπνξεί λα μεπεξαζηεί κε ηε ρξήζε κηγκάησλ κε πνιπζεζηθά κπθεηνθηφλα (Stehmann, 1995). Σν πην απνηειεζκαηηθφ κπθεηνθηφλν ηεο νκάδαο ησλ αλαζηνιέσλ βηνζχλζεζεο ζηεξνιψλ (SBIs) θαηά ηνπ B. cinerea είλαη ην πδξνμπαληιίδην fenhexamid. Ωζηφζν, πξηλ αθφκε ε δξαζηηθή νπζία ρξεζηκνπνηεζεί ζε εκπνξηθφ 44

52 επίπεδν, ζηειέρε αλζεθηηθά ζην κπθεηνθηφλν ήηαλ εχθνια αληρλεχζηκα ζηνπο πιεζπζκνχο αγξνχ ηνπ B. cinerea (Leroux, 2004). Οη Giraud et al. (1999), δηαπίζησζαλ φηη ε αλζεθηηθφηεηα ζην fenhexamid παξαηεξνχληαλ κφλν ζε vacuma ζηειέρε θαη απηφ ην απέδσζαλ ζε απμεκέλε απνηνμίλσζε ηνπ κπθεηνθηφλνπ. Δπίζεο, νη Fournier et al. (2003) κειεηψληαο ην γνληδηαθφ ηφπν Bc-hch ζε αλζεθηηθνχο θαη επαίζζεηνπο ζην fenhexamid θαηλφηππνπο ηνπ B. cinerea επηβεβαίσζαλ ηε ζπζρέηηζε ηεο αλζεθηηθφηεηαο ζηε δξαζηηθή απηή κε ηα vacuma ζηειέρε θαη δηαρψξηζαλ ην πιεζπζκφ ηνπ παζνγφλνπ ζε δχν νκάδεο. ηελ Οκάδα Η θαηαηάρζεθαλ ηα ζηειέρε κε ηνλ Bc-hch1 αιιειφκνξθν θαη ζηελ Οκάδα ΗΗ ηα ζηειέρε κε ηνλ Bc-hch2 αιιειφκνξθν. Παξάιιεια, ν δηαρσξηζκφο αλζεθηηθψλ θαη επαίζζεησλ ζηειερψλ ζην fenhexamid ηαπηίζηεθε κε ην δηαρσξηζκφ ζηηο δχν νκάδεο. Ζ Οκάδα Η αληηζηνηρνχζε ζε vacuma ζηειέρε αλζεθηηθά ζην fenhexamid ελψ ε Οκάδα ΗΗ αληηζηνηρνχζε ζε vacuma θαη transposa ζηειέρε επαίζζεηα ζην fenhexamid. Απηφ αξρηθά νδήγεζε ζηελ ππνςία φηη ε αλζεθηηθφηεηα ηνπ B. cinerea ζην κπθεηνθηφλν ζρεηίδεηαη κε ην Bc-hch γνλίδην θάηη πνπ απνξξίθζεθε απφ ηνπ ίδηνπο. Οη Fournier et all. (2003) ζεψξεζαλ φηη νη δχν νκάδεο είλαη αξθεηά απνκνλσκέλεο θαη έρνπλ ελζσκαηψζεη δηάθνξα ηδηαίηεξα αιιειφκνξθα, ζπκπεξηιακβαλνκέλσλ ησλ Bc-hch αιιεινκφξθσλ θαζψο θαη αιιεινκφξθσλ πνπ ζρεηίδνληαη κε ηελ αλζεθηηθφηεηα ζην fenhexamid. Σειηθά φκσο, φπσο απνθαιχπηνπλ νη Fillinger et al. (2008), ε αλζεθηηθφηεηα ζην fenhexamid ζρεηίδεηαη κε κεηαιιάμεηο ζηε ζέζε 412 ηνπ γνληδίνπ ηεο 3-θεηνξεδνπθηάζεο (erg27). Ο νπζηαζηηθφο θίλδπλνο γηα αλάπηπμε αλζεθηηθφηεηαο ζηα πνιπζεζηθά κπθεηνθηφλα, παξφιν πνπ απηά ρξεζηκνπνηνχληαη εδψ θαη ρξφληα ζηα πξνγξάκκαηα αληηκεηψπηζεο ηνπ B. cinerea, ζεσξείηαη ρακειφο. Έρεη αλαθεξζεί αλζεθηηθφηεηα ηνπ κχθεηα ζε N-trihalomethylthio παξάγσγα θαη ζην chlorothalonil ζε δηάθνξεο επξσπατθέο ρψξεο. Δπηπιένλ, έρεη δηαπηζησζεί δηαζηαπξσηή αλζεθηηθφηεηα ζε δηάθνξα δηζεηνθαξβακηδηθά κεηαμχ αλζεθηηθψλ ζην captan απνκνλψζεσλ (Leroux et al., 2004). Δπίζεο, νη Bardas et al. (2010) ππνζηεξίδνπλ φηη ε εληαηηθή ρξήζε ηνπ boscalid ζε νπσξψλεο αθηηληδίνπ νδήγεζε ζε επηινγή αλζεθηηθψλ απνκνλψζεσλ, ίζσο εμαηηίαο ζεκεηαθψλ κεηαιιάμεσλ ζην ελδπκηθφ ζχκπινθν ηεο αθπδξνγνλάζεο ηνπ ειεθηξηθνχ νμένο (Βεινχθαο, αδεκνζίεπηα δεδνκέλα) Παξεκπνδηζηέο ηνπ ζπκπιόθνπ III ηεο αλαπλνήο (QoI s) Υεκηθή δνκή-θάζκα δξάζεο Οη ζηξνκπηινπξίλεο ή QoI s (Quinone outside Inhibitors) φπσο ζπλήζσο αλαθέξνληαη ζηε δηεζλή βηβιηνγξαθία, απνηεινχλ κηα ζεκαληηθή νκάδα κπθεηνθηφλσλ κε έλα λέν ηξφπν δξάζεο. Ζ αλαθάιπςε απηήο ηεο νκάδαο κπθεηνθηφλσλ πξνέθπςε απφ ηε κειέηε κηαο νκάδαο θπζηθψλ β-κεζφμπ αθξπιηθψλ ελψζεσλ (β-methoxyacrylates), νη απινχζηεξεο απφ ηηο νπνίεο είλαη ε 45

53 ζηξνκπηινπξίλε Α, ε oudemansin A θαη ε myxothiazol A (Δηθφλα 36) (Bartlett et al., 2002). Οη θπζηθέο απηέο νπζίεο, νη νπνίεο απνκνλψζεθαλ απφ βαζηδηνκχθεηεο, ζπκπεξηιακβαλνκέλνπ θαη ηνπ Strobilurus tenacellus (Δηθφλα 37) (Vincelli, 2002), παξά ηελ πςειή δξαζηηθφηεηά ηνπο in vitro έλαληη πνιιψλ θπηνπαζνγφλσλ κπθήησλ θξίζεθαλ αθαηάιιειεο γηα γεσξγηθή ρξήζε ιφγσ ηεο θσηνρεκηθήο ηνπο αζηάζεηαο θαη πηεηηθφηεηαο (Bartlett et al., 2002). Ζ γλψζε φκσο ηεο δνκήο θαη ησλ ηδηνηήησλ ηνπο ήηαλ ην εθαιηήξην γηα ηελ έλαξμε εξεπλεηηθψλ πξνγξακκάησλ. Σν 1992, 15 ρξφληα κεηά ηελ αλαθάιπςε ησλ ζηξνκπηινπξηλψλ απφ Γεξκαλνχο εξεπλεηέο, νη εηαηξείεο αγξνρεκηθψλ ICI θαη BASF αλήγγεηιαλ ηελ αλάπηπμε ησλ πξψησλ ζηξνκπηινπξηλψλ, ηνπ azoxystrobin θαη kresoxim-methyl (Δηθφλα 36), αληίζηνηρα. Απηά ηα πξντφληα θπθινθφξεζαλ ζην εκπφξην γηα πξψηε θνξά ην 1996, γηα ηνλ έιεγρν αζζελεηψλ ζηα ζηηεξά (Bartlett et al., 2002). ήκεξα ζηε δηεζλή αγνξά θπθινθνξνχλ 13 δηαθνξεηηθέο ελψζεηο πνπ αλήθνπλ ζηελ νκάδα ησλ ζηξνκπηινπξηλψλ (Fernandez-Ortuno et al., 2008a). Δηθόλα 36. Υεκηθέο δνκέο θπζηθψλ ελψζεσλ ηεο νκάδαο ησλ β-κεζφμπ αθξπιηθψλ (ζηξνκπηινπξίλε Α, oudemansin A θαη myxothiazol A) θαη ρεκηθέο δνκέο ησλ πξψησλ ζπλζεηηθψλ κπθεηνθηφλσλ ηεο νκάδαο ησλ ζηξνκπηινπξηλψλ (azoxystrobin θαη kresoximmethyl) Οη ζηξνκπηινπξίλεο, σο νκάδα κπθεηνθηφλσλ, δίλνπλ πςειά επίπεδα απνηειεζκαηηθφηεηαο ζε έλα επξχ θάζκα κπθεηνινγηθψλ αζζελεηψλ ζε δηάθνξεο θαιιηέξγεηεο φπσο ζηηεξά, βηνκεραληθά θπηά, νπνξσθφξα, ιαραληθά, ριννηάπεηεο θαη θαιισπηζηηθά (Vincelli, 2002). Γηα παξάδεηγκα, ην azoxystrobin είλαη έλα επξέσο θάζκαηνο κπθεηνθηφλν κε δξάζε θαηά ησλ ηεζζάξσλ θπξηφηεξσλ νκάδσλ θπηνπαζνγφλσλ, κπθήησλ θαη σνκπθήησλ (Αζθνκχθεηεο, Βαζηδηνκχθεηεο, Γεπηεξνκχθεηεο θαη Ωνκχθεηεο) (Clough and Godfrey, 1996). Παξφκνην εχξνο δξάζεο έρεη θαη ην pyraclostrobin ην νπνίν εθαξκφδεηαη ζε έλα κεγάιν εχξνο θαιιηεξγεηψλ. Παξφια απηά, δελ πξνζθέξνπλ φιεο νη ζηξνκπηινπξίλεο πςειά 46

54 επίπεδα ειέγρνπ θαη ζηηο ηέζζεξηο θιάζεηο θπηνπαζνγφλσλ κπθήησλ. Γηα παξάδεηγκα, ην kresoxim-methyl θαη ην trifloxystrobin παξνπζηάδνπλ κέηξηα δξάζε θαηά ησλ Ωνκπθήησλ, φπσο γηα παξάδεηγκα ηνπ Plasmopara viticola, παζνγφλνπ αηηίνπ ηνπ πεξνλνζπφξνπ ηεο ακπέινπ, ελψ ζε αζζέλεηεο πνπ πξνθαινχληαη απφ Βαζηδηνκχθεηεο, φπσο γηα παξάδεηγκα ζηηο ζθσξηάζεηο ησλ ζηηεξψλ, παξνπζηάδνπλ πςειά επίπεδα απνηειεζκαηηθφηεηαο. Δπίζεο, ζηξνκπηινπξίλεο φπσο ην metominostrobin θαη ην picoxystrobin έρνπλ αλαπηπρζεί γηα ρξήζε απνθιεηζηηθή ζην ξχδη θαη ζηα ζηηεξά, αληίζηνηρα (Bartlett et al., 2002). Δηθόλα 37. Καξπνθνξία ηνπ Βαζηδηνκχθεηα Strobilurus tenacellus απφ ηνλ νπνίν απνκνλψζεθαλ νη β-κεζφμπ αθξπιηθέο ελψζεηο ζηξνκπηινπξίλε Α, oudemansin A θαη myxothiazol A Μεραληζκόο δξάζεο Σν θπηφρξσκα b είλαη κηα κεκβξαληθή πξσηεΐλε ε νπνία ζρεκαηίδεη ηνλ ππξήλα ηνπ ελδπκηθνχ ζπκπιέγκαηνο ησλ θπηνρξσκάησλ bc (ζχκπινθν III) (Δηθφλα 38), ηεο αιπζίδαο κεηαθνξάο ειεθηξνλίσλ ε νπνία βξίζθεηαη ζηελ εζσηεξηθή κεκβξάλε ησλ κηηνρνλδξίσλ (Brandt and Trumpower, 1994; Sauter et al., 1995). Ζ πξσηετληθή ππνκνλάδα ηνπ ζπκπιφθνπ III, θπηφρξσκα b, θσδηθνπνηείηαη απφ ην γνλίδην ηνπ θπηνρξψκαηνο b (cytb) ην νπνίν βξίζθεηαη ζην κηηνρνλδξηαθφ γνληδίσκα (Grasso et al., 2006b). Σα κπθεηνθηφλα ηεο νκάδαο ησλ ζηξνκπηινπξηλψλ, φπσο πξναλαθέξζεθε, έρνπλ ηελ ηδηαηηεξφηεηα ελφο λένπ ηξφπνπ δξάζεο. Οη νπζίεο απηέο δεζκεχνληαη ζηε ζέζε Q 0 (ζέζε πξνο ηελ εμσηεξηθή πιεπξά ηεο εζσηεξηθήο κεκβξάλεο ησλ κηηνρνλδξίσλ φπνπ ε νπκπηθηλφιε νμεηδψλεηαη πξνο νπκπηθηλφλε) ηνπ θπηνρξψκαηνο b, εκπνδίδνληαο ηε κεηαθνξά ειεθηξνλίσλ κεηαμχ θπηνρξψκαηνο b θαη θπηνρξψκαηνο c 1 (Δηθφλα 38). Απηφ έρεη σο απνηέιεζκα ηε παξεκπφδηζε ηεο κηηνρνλδξηαθήο αλαπλνήο θαη ηεο παξαγσγήο ηξηθνζθσξηθήο αδελνζίλεο (ATP) κε ζπλέπεηα ηελ δηαηαξαρή ηνπ ελεξγεηαθνχ θχθινπ ηνπ κχθεηα (Bartlett et al., 2002). Ζ κηηνρνλδξηαθή αλαπλνή παξέρεη ηελ απαξαίηεηε ελέξγεηα γηα ηελ βιάζηεζε ησλ 47

55 ζπνξίσλ θαη ζπλεπψο, αξρηθά επεξεάδεηαη ε βιάζηεζε θαη άιιεο δηαδηθαζίεο κε ελεξγεηαθέο απαηηήζεηο (Lesemann et al., 2006). Δηθόλα 38. ρεκαηηθή απεηθφληζε ηεο δνκήο ηνπ θπηνρξψκαηνο b. ηελ εηθφλα, κεηαμχ άιισλ, θαίλεηαη ε ζέζε Qo θαη ε ξνή ειεθηξνλίσλ απφ ηελ νπκπηθηλφιε (QH 2 ) πξνο ην θπηφρξσκα c (Cyt c) κέζσ ηνπ θπηνρξψκαηνο b Μεραληζκνί αλζεθηηθόηεηαο Σν θπηφρξσκα b πνπ απνηειεί ηελ πξσηεΐλε ζηφρν ησλ QoI s, θσδηθνπνηείηαη απφ ην κηηνρνλδξηαθφ DNA (mt DNA), ην νπνίν ζεσξείηαη φηη κεηαιιάζζεηαη ζε πςειφηεξεο ζπρλφηεηεο απ φηη ην γελσκηθφ DNA (Nakazawa and Asami, 1995). Σν mt DNA παξνπζηάδεη ξπζκνχο κεηάιιαμεο πεξίπνπ 10% πεξηζζφηεξν απ φηη ην γελσκηθφ DNA. Απηφ πηζηεχεηαη φηη νθείιεηαη ζηελ παξαγσγή πςειφηεξσλ ζπγθεληξψζεσλ ελδηάκεζσλ ξηδψλ νμπγφλνπ (reactive oxygen intermediates, ROI s), ηελ απνπζία ηζηνλψλ απφ ηα κηηνρφλδξηα θαη ηελ έιιεηςε νξηζκέλσλ κνλνπαηηψλ επηδηφξζσζεο ηα νπνία ιεηηνπξγνχλ ζηνπο ππξήλεο θαη κεηψλνπλ ηνπο ξπζκνχο κεηάιιαμεο (Taylor et al., 2002; Avila-Adame and Koller, 2003). Δπίζεο, ν ξπζκφο κεηάιιαμεο ζηα κηηνρφλδξηα είλαη πςειφηεξνο ζε θπηνπαζνγφλνπο κχθεηεο νη νπνίνη έρνπλ αεξνκεηαθεξφκελα θνλίδηα θαη ζπλεπψο εθηίζεληαη πεξηζζφηεξν ζηελ ππεξηψδε αθηηλνβνιία (Lesemann et al., 2006). Σα κπθεηνθηφλα ηεο νκάδαο ησλ ζηξνκπηινπξηλψλ είλαη παξεκπνδηζηέο εμεηδηθεπκέλνπ ζεκείνπ (site-specific inhibitors). πλεπψο απηά ηα κπθεηνθηφλα ζεσξείηαη φηη είλαη πςεινχ θηλδχλνπ γηα ηελ αλάπηπμε αλζεθηηθφηεηαο ζε πιεζπζκνχο παζνγφλσλ φηαλ ρξεζηκνπνηνχληαη ζηελ πξάμε (Russell, 1999). Παξνπζία ησλ ζηξνκπηινπξηλψλ, νη ξπζκνί κεηάιιαμεο ηνπ ζεκείνπ ζηφρνπ ησλ ζηξνκπηινπξηλψλ ζηα κηηνρφλδξηα απμάλνληαη εμεηδηθεπκέλα, εμ αηηίαο ησλ απμεκέλσλ ζπγθεληξψζεσλ ελδηάκεζσλ ξηδψλ νμπγφλνπ (ROI) πνπ παξάγνληαη σο ζπλέπεηα ηεο αλαζηνιήο ηεο ξνήο ειεθηξνλίσλ. Ωο εθ ηνχηνπ θάπνηνο ζα κπνξνχζε 48

56 λα ζεσξήζεη φηη νη απμεκέλνη ξπζκνί κεηάιιαμεο ζην γνλίδην ηνπ θπηνρξψκαηνο b ζα κπνξνχζαλ λα απνηεινχλ έλα παξάδεηγκα πξνζαξκνζκέλεο κεηάιιαμεο (Lesemann et al., 2006; Ishii et al., 2009). Σν 1998, δχν κφιηο ρξφληα κεηά ηελ εηζαγσγή ησλ πξψησλ ζηξνκπηινπξηλψλ ζηε γεσξγηθή πξάμε έγηλε ε πξψηε αλαθνξά αλζεθηηθφηεηαο ζε κπθεηνθηφλα ηεο νκάδαο ζην κχθεηα Erysiphe graminis f.sp. tritici ζηε Γεξκαλία (Bartlett et al., 2002). Μέρξη ζήκεξα έρεη αλαθεξζεί αλζεθηηθφηεηα ζηηο ζηξνκπηινπξίλεο ζε 46 θπηνπαζνγφλα (FRAC, 2010) (Πίλαθαο 5). ηα πεξηζζφηεξα παζνγφλα φπνπ έρεη αλαθεξζεί αλάπηπμε αλζεθηηθφηεηαο ζηηο ζηξνκπηινπξίλεο, ν θπξηφηεξνο κεραληζκφο αληνρήο απνδφζεθε ζε κηα κεηάιιαμε ζην γνλίδην ηνπ θπηνρξψκαηνο b, πξνθαιψληαο ηελ αληηθαηάζηαζε ηεο γιπθίλεο κε αιαλίλε ζην θσδηθψλην 143 (G143A κεηαιιαγή). Απηή ε κεηάιιαμε ηνπ ζεκείνπ-ζηφρνπ ησλ ζηξνκπηινπξηλψλ έρεη πξνζδηνξηζηεί ζε αλζεθηηθέο απνκνλψζεηο ζεκαληηθψλ θπηνπαζνγφλσλ φπσο: Blumeria graminis, Alternaria alternata, Mycosphaerella fijiensis, Plasmopara viticola, Venturia inaequalis, Botrytis cinerea θιπ. (Sierotzki et al., 2000; Gisi et al., 2002; Steinfeld et al., 2002; Jiang et al., 2009). Πίλαθαο 5. Καηάινγνο θπηνπαζνγφλσλ κπθήησλ ζηνπο νπνίνπο έρεη αλαθεξζεί αλάπηπμε αλζεθηηθφηεηαο ζηνπο Q o αλαζηνιείο (FRAC, 2010) Παζνγόλν Κνηλή νλνκαζία Καιιηέξγεηα Αλαθνξέο Altenaria alternata Κειίδσζε απφ Αιηεξλάξηα θπζηίθη Ma et al. 2003; Avenot & Michallides 2007 Altenaria alternata Altenaria alternata Alternaria arborescens Alternaria mali Κειίδσζε απφ Αιηεξλάξηα Καζηαλή θειίδσζε Κειίδσζε απφ Αιηεξλάξηα Κειίδσζε απφ Αιηεξλάξηα κήιν Ishii 2008 πνξηνθάιη Mondal et al θπζηίθη Ma et al κήιν Lu et al Alternaria solani Κειίδσζε θχιισλ παηάηα Pasche et al. 2002, 2004, Pasche et al Pasche & Gudmestad 2008 Alternaria tenuissima Κειίδσζε απφ Αιηεξλάξηα θπζηίθη Ma et al Ascochyta rabiei Αζθνρχησζε ξεβίζη Wise at al Blumeria graminis, (Erysiphe graminis) Ωίδην ζηηάξη Heaney et al Sierotzki et al. 2000a 49

57 Botrytis cinerea Σεθξά ζήςε θξάνπια, πνξηνθάιη Markoglou et al FRAC 2007 Ishii 2008 Colletotrichum graminicola Colletotrichum gloeosporioides Αλζξάθσζε γθαδφλ Avila-Adame et al Αλζξάθσζε θξάνπια Ishii 2008 Corynespora cassiicola Κειίδσζε θχιισλ αγγνχξη Ishii 2004 Didymella bryoniae Μαχξε ζήςε ή Κνκκίσζε ηνπ ζηειέρνπο θνινθπλζνεηδή Olaya & Holm 2001 Langston 2002 Stevenson et al Didymella rabiei Αζθνρχησζε ξεβίζη Gossen & Anderson 2004 Erysiphe graminis tritici Ωίδην ζηηάξη Heaney et al Sierotzki et al. 2000a Erysiphe graminis hordei Erysiphe necator: see also Uncinula necator Ωίδην θξηζάξη Heaney et al Ωίδην ακπέιη Wilcox et al Fusicladium carpophilum Κειίδσζε θχιισλ ακπγδαιηά Foerster et al Glomerella cingulata (Colletotrichum gloeosporioides) Αλζξάθσζε θξάνπια Ishii 2004 Magnaporthe oryzae Ππξηθνπιάξηα ξχδη Ma & Uddin 2009 Mycosphaerella fijiensis Μαχξε θειίδσζε κπαλάλα Heaney et al Sierotzki et al. 2000b Chin et al Mycosphaerella graminicola See also Septoria tritici επηνξίσζε ζηηάξη Armand et al Clark 2005 Fraaije et al Gisi et al Mycovellosiella nattrassii ήςε θχιισλ κειηηδάλα Yano & Kawada 2003 Ishii

58 Microdochium nivale Microdochium majus Microdochium spp. ήςε ζηειέρνπο/ θεθαιήο ήςε ζηειέρνπο/ θεθαιήο ζηηάξη Walker et al ζηηεξά FRAC 2008 Pseudoperonospora cubensis Πεξνλφζπνξνο αγγνχξη Heaney et al Plasmopara viticola Πεξνλφζπνξνο ακπέιη Podosphaera fusca Ωίδην αγγνχξη Podosphaera xanthii Ωίδην θνινθπλζνεηδή Heaney et al Gullino et al Sierotzki et al Ishii et al Fernandez-Ortuno et al Fernandez-Ortuno et al McGrath & Shinshkoff 2003a,b Pseudoperonospora cubensis Πεξνλφζπνξνο αγγνχξη Heaney et al Ishii et al Pyrenophora teres Δικηλζνζπνξίαζε θξηζάξη FRAC Semar et al Pyrenophora triticirepentis Δικηλζνζπνξίαζε ζηηάξη Reimann & Deising 2005 FRAC Pyricularia grisea Ππξηθνπιαξίσζε ξχδη Vincelli & Dixon 2002 Kim et al Pythium aphanidermatum Σήμε γξαζίδη Gisi et al Olaya et al Ramularia collicygni Rhynchosporium secalis Saccharomyces cerevisiae Septoria tritici (Mycosphaerella graminicola) Ρακνπιάξηα θξηζάξη FRAC 2006 Ρπγρνζπνξίσζε θξηζάξη FRAC 2008 Di Rago et al επηνξίσζε ζηηάξη Fraaije & Lucas

59 Sphaerotheca aphanis var aphanis Ωίδην θξάνπια Ishii 2008 Sphaerotheca fuligenea Ωίδην αγγνχξη Heaney et al Ishii et al Stemphyllium vesicarium Καζηαλή θειίδσζε αριάδη FRAC 2006 Stemphyllium vesicarium Uncinula necator (Erysiphe necator) Ηψδεο θειίδσζε ζπαξάγγη FRAC 2006 Ωίδην ακπέιη Wilcox et al Ustilago maydis Άλζξαθαο θαιακπφθη Ziogas et al Venturia inaequalis Φνπδηθιάδην κήιν Zheng et al Farber et al Steinfeld et al Dux et al ε θάπνηα είδε παζνγφλσλ, φπσο Pyricularia grisea, Pythium aphanidermatum, Pyrenophora teres, Pyrenophora tritici-repentis θιπ κηα δεχηεξε κεηάιιαμε ζην θσδηθψλην 129 ζπζρεηίζζεθε κε αλζεθηηθφηεηα ζηηο ζηξνκπηινπξίλεο. ηα παζνγφλα απηά ε θαηλπιαλαλίλε ζην θσδηθψλην 129 ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b αληηθαζίζηαηαη απφ ιεπθίλε (F129L κεηαιιαγή) (Gisi et al., 2002; Kim et al., 2003; Sierotzki et al., 2007). Δπηπξφζζεηα, κηα ηξίηε κεηαιιαγή απφ γιπθίλε ζε αξγηλίλε ζην θσδηθψλην 137 (G137R κεηαιιαγή) ζηνλ Pyrenophora tritici-repentis πξνζδίδεη αλζεθηηθφηεηα ζηηο ζηξνκπηινπξίλεο (Sierotzki et al., 2007). Παξ φια απηά, νη κεηαιιαγέο F129L θαη G137R γεληθά πξνζδίδνπλ ρακειφηεξα επίπεδα αλζεθηηθφηεηαο ζε ζχγθξηζε κε ηε G143A κεηαιιαγή (Gisi et al., 2002; Kim et al., 2003; Sierotzki et al., 2007). Πέξαλ ησλ κεραληζκψλ αλζεθηηθφηεηαο ζηνπο νπνίνπο εκπιέθνληαη ζεκεηαθέο κεηαιιάμεηο νη νπνίεο νδεγνχλ ζηελ αλάπηπμε QoI αλζεθηηθψλ πιεζπζκψλ παζνγφλσλ απνδεηθλχεηαη φηη ππάξρνπλ θαη άιινη κεραληζκνί πνπ ζρεηίδνληαη κε ην θαηλφκελν ηεο αλζεθηηθφηεηαο ζε κπθεηνθηφλα ηεο νκάδαο. Οη Ishii et al. (2001), κειεηψληαο ηελ χπαξμε αλζεθηηθφηεηαο ζην σίδην ηεο αγγνπξηάο (Podosphaera fusca) δηαπίζησζαλ φηη ππήξραλ θαηλνηππηθά αλζεθηηθέο απνκνλψζεηο πνπ δελ έθεξαλ θακία ζεκεηαθή κεηάιιαμε ζην cytb γνλίδην, πξνηείλνληαο ηελ χπαξμε θάπνηνπ άιινπ κεραληζκνχ. Παξνκνίσο, νη Fernandez-Ortuno et al. (2008b) αλαθέξνπλ φηη νη ππεχζπλνη κεραληζκνί γηα ηελ αλζεθηηθφηεηα ζε QoIs ζην σίδην ηεο αγγνπξηάο δελ ζρεηίδνληαλ κε ηππηθέο κεηαιιάμεηο ζην γνλίδην ηνπ θπηνρξψκαηνο b. ε πξφζθαηε εξγαζία, νη Amiri et al. (2010), κειεηψληαο ην γνλίδην ηνπ θπηνρξψκαηνο b απνκνλψζεσλ ηεο Monilinia fructicola κε κεησκέλε επαηζζεζία ζην azoxystrobin, δελ δηαπίζησζαλ νπνηαδήπνηε γλσζηή ζεκεηαθή 52

60 κεηάιιαμε. Δπίζεο νη Luo et al. (2010), απνθιείνληαο ηελ χπαξμε ηεο G143A κεηαιιαγήο ζηνλ κχθεηα Monilinia fructicola ππνζηεξίδνπλ κεηαμχ άιισλ ηελ πηζαλή χπαξμε ελφο κεραληζκνχ πνπ δελ ζρεηίδεηαη κε ην γνλίδην ηνπ θπηνρξψκαηνο b. ε λεφηεξεο σζηφζν εξγαζίεο, γίλεηαη αλαθνξά γηα ηελ ηαπηνπνίεζε ηεο G143A κεηαιιαγήο ζε θαηλνηππηθά επαίζζεηεο απνκνλψζεηο δηάθνξσλ παζνγφλσλ φπσο γηα παξάδεηγκα ζε Venturia inaequalis, Podosphaera leucotricha θαη B. cinerea (Zheng et al., 2000; Lesemann et al., 2006; Ishii et al., 2009). ηηο πεξηπηψζεηο απηέο γίλεηαη ιφγνο γηα ηελ χπαξμε εηεξνπιαζκίαο φπνπ ε ζπρλφηεηα χπαξμεο κηηνρνλδξίσλ κε ηελ G143A κεηαιιαγή θαζνξίδεη ηε θαηλνηππηθή ζπκπεξηθνξά ηεο απνκφλσζεο. Οη Ishii et al (2007) πξνηείλνπλ φηη i) απνπζία ηνπ κπθεηνθηφλνπ-παξάγνληα επηινγήο, ε νκνπιαζκία κεηαιιαγκέλσλ αιιεινπρηψλ ζην γνλίδην ηνπ θπηνρξψκαηνο b αλζεθηηθψλ ζηειερψλ ίζσο ζηαδηαθά επηζηξέθεη ζε εηεξνπιαζκηθή θαηάζηαζε ζπκπεξηιακβάλνληαο άγξηνπ ηχπνπ αιιεινπρίεο θαη ii) ην πνζνζηφ κεηαιιαγκέλσλ αιιεινπρηψλ ζην γνλίδην ηνπ θπηνρξψκαηνο b απμάλεηαη γξήγνξα ζε κεγάιν αξηζκφ κε ηελ παξνπζία ηζρπξήο πίεζεο επηινγήο απφ QoI κπθεηνθηφλα Γνκή θπηνρξώκαηνο b ζηνλ Botrytis cinerea Πξφζθαηεο εξγαζίεο απέδεημαλ φηη ε δνκή ηνπ θπηνρξψκαηνο b (cytb), ην νπνίν απνηειεί θαη ηελ πξσηεΐλε ζηφρν ησλ QoIs, δηαδξακαηίδεη θπξίαξρν ξφιν ζηελ εκθάληζε αλζεθηηθφηεηαο ζηα κπθεηνθηφλα ηεο νκάδαο ησλ QoIs απφ ην κχθεηα Botrytis cinerea. ε επίπεδν λνπθιενηηδίσλ, κηα ζεκεηαθή κεηάιιαμε ηεο γνπαλίλεο (G) ζε θηηνζίλε (C) ζηε ζέζε 143 έρεη ραξαθηεξηζηεί σο ππεχζπλε γηα ηελ απψιεηα επαηζζεζίαο απνκνλψζεσλ ηνπ παζνγφλνπ ζηα κπθεηνθηφλα ηεο νκάδαο (Δηθφλα 39) (Banno et al., 2009; Ishii et al., 2009; Jiang et al., 2009; Leroux et al., 2010; Bardas et al., 2010). Ζ κεηάιιαμε απηή, ε νπνία είλαη θαη ε κφλε απφ ηηο κέρξη ζήκεξα αλαθνξέο ε νπνία ζρεηίδεηαη άκεζα κε ηελ αλζεθηηθφηεηα ηνπ B. cinerea ζηνπο QoIs, νδεγεί ζε επίπεδν ακηλνμέσλ, ζηελ αληηθαηάζηαζε ηεο γιπθίλεο (Glycine) απφ ηελ αιαλίλε (Alanine) ζην θσδηθψλην 143 (G143A κεηαιιαγή). Δπίζεο, έρεη βξεζεί φηη νη απνκνλψζεηο ηνπ B. cinerea δηαθνξνπνηνχληαη ζε δχν νκάδεο κε βάζε ηελ παξνπζία ή απνπζία απφ ην γνλίδην ηνπ cytb ελφο επηπξφζζεηνπ εζνλίνπ (intron) κεηαμχ ησλ θσδηθσλίσλ 143 θαη 144 (Bcbi 143/144 intron) (Δηθφλα 40) (Banno et al., 2009). Οη Banno et al., (2009), κειεηψληαο ηε δνκή ηνπ γνληδίνπ ηνπ cytb ζην B. cinerea, δηαπίζησζαλ κηα δηαθνξνπνίεζε κεηαμχ επαίζζεησλ ζηηο ζηξνκπηινπξίλεο απνκνλψζεσλ ηνπ κχθεηα. πγθεθξηκέλα, ηα πξντφληα ηεο PCR πνπ πξνθχπηνπλ απφ ελίζρπζε πεξηνρήο ηνπ γνληδίνπ ηνπ cytb QoI επαίζζεησλ απνκνλψζεσλ ηνπ παζνγφλνπ, θαη νη νπνίεο πεξηέρνπλ ην θσδηθψλην 143, δηαρσξίδνληαη ζε δχν νκάδεο θαηά ηελ αλάιπζε ηήμεο (melting analysis). Ζ κηα νκάδα απνκνλψζεσλ ηνπ κχθεηα έθεξε ηξία εζφληα ζην γνλίδην ηνπ cytb ελψ ε δεχηεξε έθεξε έλα επηπξφζζεην εζφλην κεγέζνπο 1205-bp κεηαμχ ησλ 53

61 θνδηθσλίσλ 143 θαη 144 (Δηθφλα 40). Απηή ε εζνληθή αιιεινπρία ζεσξείηαη φηη αλήθεη ζηελ νηθνγέλεηα εζνλίσλ ηεο νκάδαο I (Cech, 1988). Δηθόλα 39. Αιιεινπρία ηκήκαηνο ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b (cytb), (Α) QoI αλζεθηηθψλ θαη (Β) QoI επαίζζεησλ αιιεινκφξθσλ, εθαηέξσζελ ηνπ ζεκείνπ κεηάιιαμεο (θσδηθψλην 143). Ζ ζεκεηαθή κεηάιιαμε ηεο γνπαλίλεο (G) ζε θηηνζίλε (C) ζηε ζέζε 143, νδεγεί ζε επίπεδν ακηλνμέσλ, ζηελ αληηθαηάζηαζε ηεο γιπθίλεο (Gly) απφ ηελ αιαλίλε (Ala) ζην θσδηθψλην 143 (G143A κεηαιιαγή). Δηθόλα 40. Αιιεινπρία ηκήκαηνο ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b (cytb) ζηελ νπνία θαίλεηαη ε παξνπζία ηνπ επηπιέoλ εζνλίνπ κεηαμχ ησλ θσδηθσλίσλ 143 θαη 144. Σα εζφληα ηεο νκάδαο I είλαη θνηλά ζηα κηηνρνλδξηαθά γνλίδηα κπθήησλ πνπ θσδηθνπνηνχλ ζπζηαηηθά ηνπ ζπζηήκαηνο κεηαθνξάο ειεθηξνλίσλ θαη ζηα γνλίδηα ηνπ ξηβνζσκηθνχ RNA (Foury et al., 1998). Αλαθέξεηαη φηη ην DNA ησλ εζνλίσλ απηήο ηεο νκάδαο πεξηέρεη έλα αλνηθηφ πιαίζην αλάγλσζεο (ORF) ην νπνίν θσδηθνπνηεί κηα mrna maturase, ε νπνία εκπιέθεηαη ζηε δηαδηθαζία αλαδίπισζεο ηεο εζνληθήο αιιεινπρίαο θαηά ην ζηάδην σξίκαλζεο ηνπ mrna. Σν ζεκείν έλσζεο ζηεξίδεηαη ζηελ αλαγλψξηζε κηαο εζσηεξηθήο αιιεινπρίαο νδεγφ ηνπ εζνλίνπ, ε νπνία δεπγαξψλεη κε ηελ εμoληθή αιιεινπρία πνπ βξίζθεηαη ζην 5 άθξν ηνπ ζεκείνπ ζχλδεζεο. πλεπψο, ε εμoληθή αιιεινπρία ζην ζεκείν ζχλδεζεο δηαδξακαηίδεη έλαλ νπζηψδε ξφιν θαηά ηελ σξίκαλζε ηνπ mrna θαη ηε κεηέπεηηα κεηαγξαθή ηνπ γνληδίνπ (Grasso et al., 2006b). χκθσλα κε ηνπο ίδηνπο εξεπλεηέο, ην θσδηθψλην GGT ζηε ζέζε 143 είλαη ηνπνζεηεκέλν αθξηβψο ζην εμoληθφ/εζνληθφ ζχλνξν θαη πηζαλψο είλαη ηκήκα ηεο αιιεινπρίαο ζήκαηνο ε νπνία είλαη απαξαίηεηε γηα ηελ αλαγλψξηζε ηνπ εζνληθνχ RNA πνπ πξέπεη λα αθαηξεζεί. Δπίζεο, νη Grasso et al. (2006b), πξνβιέπνπλ φηη κηα λνπθιενηηδηθή αληηθαηάζηαζε ζην θσδηθψλην 143 (απφ GGT ζε GCT) κπνξεί λα επεξεάζεη ζεκαληηθά ηε δηαδηθαζία σξίκαλζεο, 54

62 νδεγψληαο ζε έλα ειαηησκαηηθφ θπηφρξσκα b. Ζ αληηθαηάζηαζε ηεο γνπαλίλεο απφ ηε θπηνζίλε πξνθαλψο δελ επηηξέπεη ην νξζφ δεπγάξσκα ησλ εμoληθψλ λνπθιενηηδίσλ κε ηελ εζσηεξηθή αιιεινπρία νδεγφ ηνπ εζνλίνπ ζην αλψξηκν κφξην mrna. πλεπψο, κηα ηέηνηα αληηθαηάζηαζε ζα είλαη ζαλαηεθφξνο. Μηα ζεηξά εξγαζηψλ κε ζέκα ηελ αλζεθηηθφηεηα ηνπ B. cinerea ζηηο ζηξνκπηινπξίλεο εληζρχνπλ ηελ ζεσξία ησλ Grasso et al. (2006b) θαζψο αληρλεχνπλ ηελ G143A κεηαιιαγή ζην γνλίδην cytb κφλν ζε ζηειέρε ηα νπνία δελ θέξνπλ ην εζφλην Bcbi 143/144 (Banno et al., 2009; Jiang et al., 2009; Leroux et al., 2010). χκθσλα κε ηηο εξγαζίεο απηέο, αλαγλσξίδεηαη ε χπαξμε δχν κηηνρνλδξηαθψλ ηχπσλ ζην κχθεηα κε βάζε ηελ χπαξμε ή φρη ελφο επηπξφζζεηνπ εζνλίνπ κεηαμχ ησλ θσδηθσλίσλ 143 θαη 144 ζην γνλίδην ηνπ cytb. Δπίζεο, νη Leroux et al., (2010) ζπγθξίλνληαο ηε ζπρλφηεηα αλίρλεπζεο ηνπ Bcbi 143/144 εζνλίνπ ζηηο δχν νκάδεο απνκνλψζεσλ ηνπ κχθεηα ζπκπέξαλαλ φηη νη πιεζπζκνί ηεο νκάδαο I (B. psendocinerea) έθεξαλ ην επηπιένλ εζφλην ζε πςειφηεξε ζπρλφηεηα ζε ζρέζε κε ηνπο πιεζπζκνχο ηεο νκάδαο II (B. cinerea sensu stricto). χκθσλα κε ηελ ίδηα εξγαζία, θακηά απνκφλσζε ηεο νκάδαο I δελ έθεξε ηε κεηαιιαγή G143A. Με βάζε απηά ηα ζηνηρεία νη Leroux et al. (2010) πξνηείλνπλ φηη ην είδνο B. cinerea sensu stricto ίζσο πξνέξρεηαη απφ ην είδνο B. pseudocinerea. Μεηά ηελ απφθιηζε ησλ δχν εηδψλ, ίζσο πξνέθπςαλ επαλαιακβαλφκελεο αλεμάξηεηεο απψιεηεο ηνπ Bcbi εζνλίνπ απφ ηνπο πιεζπζκνχο ηνπ B. cinerea sensu stricto πξάγκα πνπ δηεπθφιπλε ηελ κεηαγελέζηεξε απφθηεζε ηεο G143A κεηαιιαγήο ζε απηέο ηηο γελεαινγίεο ζε αληαπφθξηζε ζηελ πίεζε επηινγήο πνπ αζθείηαη απφ ηα κπθεηνθηφλα ηεο νκάδαο ησλ QoIs θνπόο εξγαζίαο Κχξην ζηφρν ηεο παξνχζαο εξγαζίαο απνηέιεζε ν πξνζδηνξηζκφο ηεο ζπρλφηεηαο αλζεθηηθφηεηαο ζε βνηξπδηνθηφλα ζε πιεζπζκνχο ηνπ παζνγφλνπ πνπ απνκνλψζεθαλ απφ θαξπνχο θξάνπιαο, ηνκάηαο, θνινθπλζνεηδψλ, ζηαθπιηψλ, αθηηληδίσλ θαη κήισλ απφ δηάθνξεο πεξηνρέο ηεο Διιάδαο θαζψο θαη ν πξνζδηνξηζκφο ησλ αθξηβψλ επηπέδσλ επαηζζεζίαο ζην pyraclostrobin ζε απνκνλψζεηο ηνπ κχθεηα πνπ πξνέξρνληαη απφ ηε θξάνπια. Δπίζεο, αλαπηχρζεθε κηα πςειήο επαηζζεζίαο αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο πξαγκαηηθνχ ρξφλνπ (Real Time - PCR) γηα ηνλ έιεγρν ηεο παξνπζίαο ηεο G143A κεηαιιαγήο θαη ηνπ Bcbi 143/144 εζνλίνπ ζην γνλίδην ηνπ cytb θαη πξνζδηνξίζηεθε ε ζπρλφηεηά ηνπο ζηνπο πιεζπζκνχο ηνπ παζνγφλνπ πνπ κειεηήζεθαλ. Σέινο, γηα ηελ επηβεβαίσζε ησλ κνξηαθψλ απνηειεζκάησλ αιιεινπρήζεθε ηκήκα ηνπ γνληδίνπ ηνπ cytb αληηπξνζσπεπηηθψλ απνκνλψζεσλ πνπ έθεξαλ ή φρη ηελ G143A θαη ην Bcbi 143/144 εζφλην. 55

63 3.2. Τιηθά θαη κέζνδνη Απνκνλώζεηο παζνγόλνπ Οη απνκνλψζεηο ηνπ παζνγφλνπ πνπ ζπιιέρζεθαλ γηα ηηο αλάγθεο ηηο ελφηεηαο 2 ρξεζηκνπνηήζεθαλ θαη γηα ηελ πξαγκαηνπνίεζε ησλ πεηξακαηηθψλ δνθηκψλ απηνχ ηνπ θεθαιαίνπ. Πιεξνθνξίεο ζρεηηθά κε ηηο απνκνλψζεηο πνπ ρξεζηκνπνηήζεθαλ ζηε παξνχζα εξγαζία δίλνληαη ζην Πίλαθα 6. Οη απνκνλψζεηο δηαηεξήζεθαλ ζε ππφζηξσκα PDA ζηνπο 4 o C κέρξη λα ρξεζηκνπνηεζνχλ Μπθεηνθηόλα Σα κπθεηνθηφλα πνπ ρξεζηκνπνηήζεθαλ ζηε παξνχζα εξγαζία ήηαλ εκπνξηθά ζθεπάζκαηα ησλ cyprodinil (Chorus 50WG, Syngenta Hellas, Athens, Greece), fludioxonil (Medallion 50WP, Syngenta Hellas, Athens, Greece), iprodione (Rovral 50 WP, BASF Hellas, Athens, Greece), fenhexamid (Teldor 50WG, BayerCropScience, Athens, Greece), carbendazim (Pacarzim 50WP, Papaoikonomou Agrochemicals S.A., Thessaloniki, Greece) θαη ηερληθψο θαζαξφ πξντφλ pyraclostrobin ην νπνίν παξαρσξήζεθε απφ ηελ BASF. Πίλαθαο 6. Ξεληζηέο θαη πξνέιεπζε ησλ απνκνλψζεσλ ηνπ κχθεηα Botrytis cinerea πνπ ρξεζηκνπνηήζεθαλ Ξεληζηήο Πεξηνρή ζπιινγήο Έηνο Ιζηνξηθό ρξήζεο QoIs* Αξηζκόο απνκνλώζεσλ Φξάνπια Πηεξία 2008 εληαηηθή 42 Φξάνπια Πηεξία 2009 εληαηηθή 40 ηαθύιη Κφξηλζνο 2008 κέηξηα 15 ηαθύιη Καβάια 2008 κέηξηα 30 Μήιν Ζκαζία 2008 εληαηηθή 29 Αθηηλίδην Ζκαζία 2008 ρακειή 27 Αθηηλίδην Πηεξία 2008 ρακειή 27 Σνκάηα Θεζζαινλίθε 2008 εληαηηθή 21 Σνκάηα Κξήηε 2005 ρακειή 34 Αγγνύξη Θεζζαινλίθε 2008 εληαηηθή 27 Κνινθύζη Κξήηε 2005 ρακειή 7 ύλνιν 299 * ρακειή ρξήζε: 0-1 εθαξκνγέο Q o Is /έηνο, κέηξηα ρξήζε: 1-2 εθαξκνγέο Q o Is /έηνο, εληαηηθή ρξήζε: >2 εθαξκνγέο Q o Is /έηνο. 56

64 Πξνζδηνξηζκόο ζπρλόηεηαο αλζεθηηθόηεηαο Ο πξνζδηνξηζκφο ηεο ζπρλφηεηαο αλζεθηηθφηεηαο ζηα κπθεηνθηφλα έγηλε κε ηε ρξήζε κηαο δηαθξηηηθήο δφζεο γηα θάζε κπθεηνθηφλν. Γηα ηα κπθεηνθηφλα cyprodinil, fludioxonil, iprodione, carbendazim θαη fenhexamid πξνζδηνξίζηεθε ε ζπρλφηεηα αλζεθηηθφηεηαο ζε φιεο ηηο απνκνλψζεηο ηνπ κχθεηα εθηφο απηψλ πνπ ζπιιέρζεθαλ απφ θξάνπια θαηά ην 2009, ελψ γηα ην pyraclostrobin ε ζπρλφηεηα αλζεθηηθφηεηαο πξνζδηνξίζηεθε ζην ζχλνιν ησλ απνκνλψζεσλ. Γηα ηε δεκηνπξγία ησλ αξρηθψλ δηαιπκάησλ ησλ κπθεηνθηφλσλ ηα εκπνξηθά ζθεπάζκαηα δηαιχζεθαλ ζε απνζηεηξσκέλν-απνζηαγκέλν λεξφ ελψ ην pyraclostrobin δηαιχζεθε ζε δηκέζπινζνπιθνμείδην. Οη απνκνλψζεηο ραξαθηεξίζηεθαλ σο αλζεθηηθέο ή επαίζζεηεο ζην θάζε κπθεηνθηφλν ρξεζηκνπνηψληαο ηηο δηαθξηηηθέο ζπγθεληξψζεηο ησλ 0.05 κg ml -1 γηα ην cyprodinil, 0.1 κg ml -1 γηα ην fludioxonil, 5 κg ml -1 γηα ην iprodione, 1 κg ml -1 γηα ην carbendazim, 0.4 κg ml -1 γηα ην fenhexamid θαη 0.3 κg ml -1 γηα ην pyraclostrobin, φπσο απηέο θαζνξίζηεθαλ ζε πξνεγνχκελεο εξγαζίεο (Giraud et al., 1999; Baroffio et al., 2003; Myresiotis et al., 2007, 2008). Ζ δνθηκή πξαγκαηνπνηήζεθε ζε ηξπβιία κε ην ππφζηξσκα αλάπηπμεο ζην νπνίν είρε πξνζηεζεί ε αληίζηνηρε ζπγθέληξσζε κπθεηνθηφλνπ. Γηα ηα κπθεηνθηφλα fludioxonil, iprodione, carbendazim θαη fenhexamid ην ππφζηξσκα αλάπηπμεο ήηαλ PDA, γηα ην cyprodinil ήηαλ ην L-asparagine-based άγαξ (ASP-agar) θαη γηα ην pyraclostrobin ήηαλ 2 % άγαξ λεξνχ ζην νπνίν είραλ πξνζηεζεί 100 κg ml -1 ζαιηθππδξνμακηθφ νμχ (salihydroxamic acid, SHAM) γηα αλαζηνιή ηεο ελαιιαθηηθήο αλαπλνήο. Οη κάξηπξεο αλαπηχρζεθαλ ζηα αληίζηνηρα ππνζηξψκαηα φπσο αλαθέξνληαη πην πάλσ ρσξίο ην κπθεηνθηφλν. Γηα ηνλ έιεγρν αλζεθηηθφηεηαο ζηα κπθεηνθηφλα cyprodinil, fludioxonil, iprodione, carbendazim θαη fenhexamid, κπθειηαθά εκβφιηα (δηακέηξνπ 5 mm) κεηαθέξζεθαλ απφ θαιιηέξγεηεο ηξηψλ εκεξψλ ζην θέληξν ηξπβιίσλ κε ην ππφζηξσκα αλάπηπμεο θαη ην αληίζηνηρν κπθεηνθηφλν ελψ γηα ηνλ έιεγρν αλζεθηηθφηεηαο ζην pyraclostrobin απιψζεθε ελαηψξεκα θνληδίσλ (1 Υ 10 5 θνλίδηα ml -1 ) ζηα ηξπβιία κε ην ππφζηξσκα αλάπηπμεο θαη ην pyraclostrobin. Σέινο, νη θαιιηέξγεηεο κε ηα κπθεηνθηφλα cyprodinil, fludioxonil, iprodione, carbendazim θαη fenhexamid επσάζηεθαλ ζηνπο 20 ν C ζην ζθνηάδη γηα ηξεηο κέξεο, ελψ νη θαιιηέξγεηεο κε ην pyraclostrobin ζηνπο 20 ν C ζην ζθνηάδη γηα 18 ψξεο. Γηα ηνλ έιεγρν ηεο αλζεθηηθφηεηαο ζηα κπθεηνθηφλα iprodione, carbendazim θαη fenhexamid σο αλζεθηηθέο ζεσξήζεθαλ νη απνκνλψζεηο πνπ επέδεημαλ κπθειηαθή αλάπηπμε ζηα ππνζηξψκαηα κε κπθεηνθηφλν, ελψ σο επαίζζεηεο ζεσξήζεθαλ απνκνλψζεηο ησλ νπνίσλ ε κπθειηαθή ηνπο αλάπηπμε παξεκπνδίζηεθε πιήξσο. Γηα ηα κπθεηνθηφλα cyprodinil θαη fludioxonil, κεηξήζεθε ε δηάκεηξνο ηεο απνηθίαο θαη ζπγθξίζεθε κε απηή ηνπ κάξηπξα. Απνκνλψζεηο κε ζρεηηθή αλάπηπμε ζην ππφζηξσκα κε cyprodinil ή fludioxonil κεγαιχηεξε ηνπ 50 % ηνπ κάξηπξα ζεσξήζεθαλ σο αλζεθηηθέο, ελψ απνκνλψζεηο κε ζρεηηθή αλάπηπμε κηθξφηεξε ηνπ 50 % ηνπ κάξηπξα ζεσξήζεθαλ σο επαίζζεηεο (Baroffio et al., 2003). Σέινο, γηα ηνλ πξνζδηνξηζκφ ηεο αλζεθηηθφηεηαο ζην pyraclostrobin, ειέγρζεθε ε βιάζηεζε ησλ θνληδίσλ. Έλα θνλίδην γηα λα ζεσξεζεί σο βιαζηεκέλν έπξεπε λα έρεη κήθνο 57

65 βιαζηηθνχ ζσιήλα ηνπιάρηζην ίζν κε ην κηζφ ηνπ κήθνπο ηνπ θνληδίνπ. ε θάζε ηξπβιίν κεηξήζεθε ε βιαζηηθφηεηα 100 θνληδίσλ. Ζ δνθηκή πξαγκαηνπνηήζεθε δχν θνξέο θαη ζε θάζε δνθηκή γηα θάζε ζπλδπαζκφ απνκφλσζεο - κπθεηνθηφλνπ ππήξραλ ηξεηο επαλαιήςεηο Μέηξεζε επαηζζεζίαο ζην pyraclostrobin Γηα ηελ αθξηβή κέηξεζε ηεο επαηζζεζίαο ζην pyraclostrobin πξνζδηνξίζηεθαλ νη ηηκέο EC 50 ζηηο 82 απνκνλψζεηο ηνπ κχθεηα απφ θξάνπια. Γηα ηελ δεκηνπξγία ηνπ αξρηθνχ δηαιχκαηνο pyraclostrobin, απηφ δηαιχζεθε ζε δηκέζπιν-ζνπιθνμείδην. Ζ δνθηκή πξαγκαηνπνηήζεθε ζε ηξπβιία Petri 6 cm κε 2 % άγαξ-λεξνχ ζηα νπνία είραλ πξνζηεζεί 100 κg ml -1 ζαιηθπ-πδξνμακηθφ νμχ (salihydroxamic acid, SHAM) γηα αλαζηνιή ηεο ελαιιαθηηθήο αλαπλνήο θαη ε αλάινγε πνζφηεηα απφ ην αξρηθφ δηάιπκα ηνπ pyrasclostrobin. Οη ηειηθέο ζπγθεληξψζεηο pyraclostrobin ήηαλ 0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10 θαη 30 κg ml -1. Γηα θάζε απνκφλσζε εηνηκάζηεθε έλα ελαηψξεκα θνληδίσλ (1 Υ 10 5 θνλίδηα ml -1 ) απφ θαιιηέξγεηεο εκεξψλ θαη κηα πνζφηεηα 20 κl κεηαθέξζεθε ζηα ηξπβιία κε ην ππφζηξσκα αλάπηπμεο θαη ηελ αληίζηνηρε ζπγθέληξσζε pyraclostrobin. Οη θαιιηέξγεηεο επσάζηεθαλ ζηνπο 20 ν C ζην ζθνηάδη γηα 18 ψξεο θαη θαηφπηλ κεηξήζεθε ην πνζνζηφ ησλ θνληδίσλ πνπ βιάζηεζε. Ωο βιαζηεκέλα ζεσξήζεθαλ ηα θνλίδηα πνπ είραλ κήθνο βιαζηηθνχ ζσιήλα ηνπιάρηζηνλ ίζν κε ην κηζφ ηνπ κήθνπο ηνπ θνληδίνπ. ε θάζε ηξπβιίν κεηξήζεθε ε βιαζηηθφηεηα 100 θνληδίσλ. Ζ δνθηκή πξαγκαηνπνηήζεθε δχν θνξέο θαη ζε θάζε δνθηκή γηα θάζε ζπλδπαζκφ απνκφλσζεο ζπγθέληξσζεο pyraclostrobin έγηλαλ ηξεηο επαλαιήςεηο Απνκόλσζε DNA Γηα ηελ εθρχιηζε ηνπ DNA αθνινπζήζεθε ε δηαδηθαζία πνπ πεξηγξάθεηαη ζηε παξάγξαθν Αλάπηπμε δνθηκήο αιπζηδσηήο αληίδξαζεο ηεο πνιπκεξάζεο πξαγκαηηθνύ ρξόλνπ (Real-time TaqMan- PCR) γηα ηελ αλίρλεπζε ηεο G143A κεηαιιαγήο ζην γνλίδην ηνπ θπηνρξώκαηνο b Γηα ηελ αλίρλεπζε ησλ QoI αλζεθηηθψλ απνκνλψζεσλ ηνπ B. cinerea, πνπ θέξνπλ ηε G143A κεηαιιαγή, ζρεδηάζηεθαλ δχν εθθηλεηέο (BC-F θαη BC-R) θαη δχν κνξηαθνί αληρλεπηέο TaqMan (RESITAQ θαη SENSITAQ) (Πίλαθαο 7) θαη αλαπηχρζεθε κηα αιπζηδσηή αληίδξαζε ηεο πνιπκεξάζεο πξαγκαηηθνχ ρξφλνπ (TaqMan-PCR). Ζ αληίδξαζε ζρεδηάζηεθε έηζη ψζηε λα εληζρχεη έλα ηκήκα ηνπ 58

66 γνληδίνπ ηνπ θπηνρξψκαηνο b κεγέζνπο 82 δεπγψλ βάζεσλ (Πίλαθαο 7). Σν 5 άθξν ησλ δχν κνξηαθψλ αληρλεπηψλ, RESITAQ θαη SENSITAQ, ζεκάλζεθε κε ηηο ρξσζηηθέο αλαθνξάο 6-Carboxy fluorescein (FAM) θαη cyanine 5 (Cy5), ελψ ηα 3 άθξα κε ηηο ρξσζηηθέο απνξξφθεζεο Black Hole Quencher 1 (BHQ 1) θαη Black Berry Quencher (BBQ), αληίζηνηρα. Απηέο νη δχν δηαθνξεηηθέο θζνξίδνπζεο ρξσζηηθέο, επηηξέπνπλ ηε ηαπηφρξνλε δηαθνξνπνίεζε αλζεθηηθψλ θαη επαίζζεησλ αιιεινκφξθσλ κε κηα πνιιαπιή δνθηκή TaqMan -PCR (Δηθφλα 41). Πίλαθαο 7. Δθθηλεηέο θαη κνξηαθνί αληρλεπηέο πνπ ζρεδηάζηεθαλ γηα ηελ αλάπηπμε ησλ TaqMan-PCR δνθηκψλ πνπ ρξεζηκνπνηήζεθαλ Όλνκα Αιιεινπρία (5-3 ) α ΣΜ Θέζε BC-F TAAGTTTGTATTTTGTATG β BC-R ACAGCACTCATAAGATT β SENSI-TAQ {Cy5}-CAAATGTCACTGTGAGGT-{BBQ} β RESI-TAQ {FAM}-CAAATGTCACTGTGAGCT-{BHQ1} γ BCIN-F ACGGGCAAATGTCACTGTGA δ BCIN-R GAGAAGACGCACTTAATAAAACCATAATAA δ BCIN-TAQ {FAM}-AGCCTCATATGCGACTTTTA- TTCTCTTACTCAACATTATG-{BHQ1} δ Μέγεζνο πξντόληνο 82 bp 128 bp α Σα θιεηδσκέλα λνπθιετθά νμέα (Locked Nucleic Acids, LNAs) παξνπζηάδνληαη κε έληνλε θαη ππνγξακκηζκέλε γξακκαηνζεηξά β Genbank accession no. AB γ Genbank accession no. FJ δ Genbank accession no. AB Δηθόλα 41. ρεκαηηθή απεηθφληζε ηεο TaqMan -PCR δνθηκήο γηα αλίρλεπζε ησλ QoI αλζεθηηθψλ θαη QoI επαίζζεησλ αιιεινκφξθσλ. ηελ εηθφλα θαίλνληαη κέξνο ηεο γελεηηθήο δνκήο ηνπ cytb γνληδίνπ αλζεθηηθψλ θαη επαίζζεησλ απνκνλψζεσλ ηνπ Botrytis cinerea, νη αιιεινπρίεο ησλ εθθηλεηψλ (BC-F θαη BC-R) θαη κνξηαθψλ αληρλεπηψλ (RESITAQ θαη SENSITAQ) θαζψο θαη ηα ζεκεία δέζκεπζήο ηνπο φπσο ζρεδηάζηεθαλ γηα ηελ δηπιή αλίρλεπζε κε TaqMan -PCR δνθηκή. 59

67 Γηα αχμεζε ηεο εμεηδίθεπζεο ηεο δνθηκήο νχησο ψζηε λα ππάξρεη απνηειεζκαηηθή αλίρλεπζε ηεο ζεκεηαθήο λνπθιενηηδηθήο κεηάιιαμεο, ν θάζε κνξηαθφο αληρλεπηήο ζρεδηάζηεθε έηζη ψζηε λα πεξηέρεη έλα ηξνπνπνηεκέλν θιεηδσκέλν λνπθιετθφ νμχ (Locked Nucleic Acid, LNA) κε βάζε ην ζεκείν ηεο κεηάιιαμεο. Ο ξηβνζσκηθφο δαθηχιηνο ηνπ ηξνπνπνηεκέλνπ απηνχ λνπθιετθνχ νμένο είλαη θιεηδσκέλνο κε κηα γέθπξα κεζπιελίνπ ε νπνία ελψλεη ην δεχηεξν άηνκν νμπγφλνπ κε ην ηέηαξην άηνκν άλζξαθα (Δηθφλα 42). Απηή ε ηξνπνπνίεζε ζην λνπθιετθφ νμχ ηνπ κνξηαθνχ αληρλεπηή, πνπ αληηζηνηρεί ζην ζεκείν ηεο κεηάιιαμεο, απμάλεη ηε ζεξκηθή ηνπ ζηαζεξφηεηα θαη βειηηψλεη ηε δηαθξηηηθή ηνπ ηθαλφηεηα ζε ζρέζε κε ην λνπθιετθφ νμχ-ζηφρν. Απμάλεη δειαδή ηελ εμεηδηθεπκέλε πβξηδνπνίεζε ηνπ κνξηαθνχ αληρλεπηή κε ηελ αιιεινπρία ζηφρν. Καη νη δχν κνξηαθνί αληρλεπηέο ζρεδηάζηεθαλ λα έρνπλ ζεξκνθξαζίεο ηήμεσο (TM) ηνπιάρηζην 10 ν C ςειφηεξεο (62 ν C) απφ απηέο ησλ εθθηλεηψλ (50 ν C) θαη ε % πεξηεθηηθφηεηά ηνπο ζε GC ήηαλ κεγαιχηεξε απφ 40 %. Ζ πνιιαπιή TaqMan PCR βειηηζηνπνηήζεθε ζε έλα ηειηθφ φγθν 25 κl ν νπνίνο πεξηείρε 20 mm Tris-HCl, 0.3 κm dntp, 50 mm KCl, 5.5 mm MgCl 2, U Platinum Taq DNA πνιπκεξάζε (Invitrogen Life Technologies, Carlsbad, CA, USA), 300 nm απφ ην θάζε εθθηλεηή (BC-F θαη BC-R), 100 nm απφ ην θάζε κνξηαθφ αληρλεπηή (RESITAQ θαη SENSITAQ) θαη 1κl εθρχιηζκα DNA. Ζ PCR αλαπηχρζεθε ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 4 ιεπηά αθνινπζνχκελε απφ 35 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 10 θαη ii) πβξηδνπνίεζε θαη επηκήθπλζε ζηνπο 55 o C γηα 30. Οη εθθηλεηέο θαη νη TaqMan κνξηαθνί αληρλεπηέο πξνκεζεχηεθαλ απφ ηελ TIB MOLBIOL (Berlin, Germany) θαη νη αιιεινπρίεο ηνπο δίλνληαη ζην Πίλαθα 6. Ζ δνθηκή αλαπηχρζεθε, αμηνινγήζεθε θαη αλαιχζεθε ζην Biorad CFX96 Real Time PCR Detection System (Bio-Rad Laboratories, Inc, Hercules, CA.-). Δηθόλα 42. Σξνπνπνηεκέλν θιεηδσκέλν λνπθιετθφ νμχ (Locked Nucleic Acid, LNA) ηνπ νπνίνπ ν ξηβνζσκηθφο δαθηχιηνο είλαη θιεηδσκέλνο κε κηα γέθπξα κεζπιελίνπ ελψλνληαο ην δεχηεξν άηνκν νμπγφλνπ κε ην ηέηαξην άηνκν άλζξαθα 60

68 Αλάπηπμε δνθηκήο αιπζηδσηήο αληίδξαζεο ηεο πνιπκεξάζεο πξαγκαηηθνύ ρξόλνπ (Real-time TaqMan- PCR) γηα ηελ αλίρλεπζε ηνπ εζνλίνπ Bcbi 143/144 Γηα ηελ αλίρλεπζε ηνπ επηπξφζζεηνπ εζνλίνπ (intron) πνπ βξίζθεηαη κεηαμχ ησλ θσδηθνλίσλ 143 θαη 144 ηνπ γνληδίνπ ηνπ θπηνρξψκηνο b (Bcbi 143/144 intron) ζρεδηάζηεθε έλα επηπιένλ δεχγνο εθθηλεηψλ (BCIN-F θαη BCIN-R) θαη κνξηαθφο αληρλεπηήο (BCINTAQ) (Πίλαθαο 7) θαη αλαπηχρζεθε κηα δεχηεξε TaqMan PCR δνθηκή πξαγκαηηθνχ ρξφλνπ. Απηή ε δνθηκή ζρεδηάζηεθε νχησο ψζηε λα εληζρχεη έλα πξντφλ 128 δεπγψλ βάζεσλ ζην ζεκείν έλαξμεο ηνπ εζνλίνπ (Δηθφλα 43). Ζ δνθηκή βειηηζηνπνηήζεθε ζε έλα ηειηθφ φγθν 25 κl ν νπνίνο πεξηείρε 20 mm Tris- HCl, 0.3 κm dntp, 50 mm KCl, 5.5 mm MgCl 2, U Platinum Taq DNA πνιπκεξάζε (Invitrogen Life Technologies, Carlsbad, CA, USA), 300 nm απφ ην θάζε εθθηλεηή (BCIN-F θαη BCIN-R), 100 nm απφ ην κνξηαθφ αληρλεπηή (BCINTAQ) θαη 1κl εθρχιηζκα DNA. Ζ PCR αλαπηχρζεθε ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 4 ιεπηά αθνινπζνχκελε απφ 40 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 10 θαη ii) πβξηδνπνίεζε θαη επηκήθπλζε ζηνπο 60 o C γηα 30. Οη εθθηλεηέο θαη ν κνξηαθφο αληρλεπηήο TaqMan εμαζθαιίζηεθαλ απφ ηελ MWG-Biotech AG (Ebersberg, Germany) θαη νη αιιεινπρίεο ηνπο δίλνληαη ζην Πίλαθα 6. Ζ δνθηκή αλαπηχρζεθε, αμηνινγήζεθε θαη αλαιχζεθε ζην Biorad CFX96 Real Time PCR Detection System (Bio-Rad Laboratories, Inc, Hercules, CA.-). Δηθόλα 43. ρεκαηηθή απεηθφληζε ηεο TaqMan-PCR δνθηκήο γηα αλίρλεπζε ηνπ εζνλίνπ Bcbi 143/144. ηελ εηθφλα θαίλνληαη κέξνο ηεο δνκήο ηνπ cyt b γνληδίνπ απνκνλψζεσλ ηνπ Botrytis cinerea πνπ θέξνπλ ην επηπιένλ εζφλην, νη αιιεινπρίεο ησλ εθθηλεηψλ (BCIN-F θαη BCIN-R) θαη ηνπ κνξηαθνχ αληρλεπηή (BCINTAQ) θαζψο θαη ηα ζεκεία δέζκεπζήο ηνπο φπσο ζρεδηάζηεθαλ γηα ηελ αλίρλεπζε κε TaqMan-PCR δνθηκή Πξνζδηνξηζκόο λνπθιενηηδηαθήο αιιεινπρίαο ηνπ γνληδίνπ θπηνρξώκαηνο b Γηα ηελ ελίζρπζε θαη κειέηε ηεο αιιεινπρίαο ηκήκαηνο ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b, ζρεδηάζηεθε έλα δεχγνο εθθηλεηψλ, (F1 θαη R1) (Πίλαθαο 8), νη νπνίνη εληζρχνπλ έλα ηκήκα 400 δεπγψλ βάζεσλ πεξηιακβάλνληαο ην θσδηθφλην 143. Γηα ην ζθνπφ απηφ επηιέγεθαλ θαη κειεηήζεθαλ 7 ηπραίεο απνκνλψζεηο ηνπ B. cinerea ζηηο νπνίεο αληρλεχηεθε ην επαίζζεην αιιειφκνξθν (G143) θαη 5 ζηηο νπνίεο αληρλεχηεθε ην αλζεθηηθφ αιιειφκνξθν (Α143). Ζ αληίδξαζε PCR βειηηζηνπνηήζεθε ζε έλα ηειηθφ φγθν 25 κl πνπ πεξηείρε 2 κl εθρχιηζκα DNA ηνπ 61

69 κχθεηα, 0.5 κμ απφ ηνλ θάζε εθθηλεηή, 0.3 κμ dntps, 1.5 mm MgCl 2, 1X Platinum buffer θαη 1 U Platinum Taq DNA πνιπκεξάζε (Invitrogen Life Technologies, Carlsbad, CA, USA). Ζ PCR αλαπηχρζεθε ζε έλα ζεξκνθπθινπνηεηή PTC 200 (MJ Research, USA) ζχκθσλα κε ηηο αθφινπζεο ζπλζήθεο: κηα αξρηθή πξνζέξκαλζε ζηνπο 94 o C γηα 5 ιεπηά αθνινπζνχκελε απφ 35 θχθινπο i) απνδηάηαμε ζηνπο 94 o C γηα 30, ii) πβξηδνπνίεζε εθθηλεηψλ ζηνπο 52 o C γηα 45, iii) επηκήθπλζε ζηνπο 72 o C γηα 1 ιεπηφ θαη ηεξκαηηζκφο κε κηα ηειηθή επψαζε ζηνπο 72 o C γηα 10 ιεπηά. ηε ζπλέρεηα, ηα πξντφληα ελίζρπζεο ηεο PCR (400 bp) απφ ηηο 12 απνκνλψζεηο, θαζαξίζηεθαλ ρξεζηκνπνηψληαο ην PureLink TM kit (Invitrogen Corporation, CA) ζχκθσλα κε ην πξσηφθνιιν ηνπ παξαζθεπαζηή θαη ζηάιζεθαλ γηα αιιεινχρηζε. Πίλαθαο 8. Δθθηλεηέο νη νπνίνη ζρεδηάζηεθαλ γηα ελίζρπζε ηκήκαηνο ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b εθαηέξσζελ ηνπ θσδηθνλίνπ 143 Όλνκα Αιιεινπρία (5-3 ) ΣΜ Θέζε Μέγεζνο πξντόληνο F1 GTCGGCCATATAAAAGGTCG α 400 bp R1 TTGTCTGGTTTAAAAGTATTTTGCA α α Genbank accession no. AB Αλάιπζε δεδνκέλσλ Γηα ηελ ζχγθξηζε ηεο ζπρλφηεηαο χπαξμεο αλζεθηηθφηεηαο ζηα κπθεηνθηφλα απνκνλψζεσλ ηνπ B. cinerea κεηαμχ ησλ δχν ηνπ ηχπσλ, vacuma θαη transposa, ρξεζηκνπνηήζεθε ην Fisher Exact Test. ηελ νκάδα vacuma ζπκπεξηιήθζεθαλ φιεο νη απνκνλψζεηο πνπ δελ έθεξαλ θαλέλα απφ ηα δχν κεηαζεηά ζηνηρεία, ελψ ζηελ νκάδα transposa ζπκπεξηιήθζεθαλ φιεο νη απνκνλψζεηο πνπ έθεξαλ θαη ηα δχν ή ηνπιάρηζηνλ έλα απφ ηα δχν κεηαζεηά ζηνηρεία. Οη ηηκέο EC 50 ηεο θάζε απνκφλσζεο ζην pyraclostrobin ππνινγίζηεθαλ κε ζπζρέηηζε ηεο ζρεηηθήο αλαζηνιήο ηεο βιάζηεζεο ησλ ζπνξίσλ πξνο ην Log 10 ησλ ζπγθεληξψζεσλ ηνπ κπθεηνθηφλνπ ζε ηξεηο αλεμάξηεηεο κεηξήζεηο θαη νη κέζεο ηηκέο ππνινγίζηεθαλ ρξεζηκνπνηψληαο ην SAS (JMP, SAS Institute, Cary, NC). Όιεο νη ζηαηηζηηθέο αλαιχζεηο ππνζηεξίρζεθαλ απφ ην ζηαηηζηηθφ παθέην SPSS, έθδνζε Απνηειέζκαηα πρλόηεηα αλζεθηηθόηεηαο ζηα κπθεηνθηόλα cyprodinil, fludioxonil, iprodione, carbendazim, fenhexamid θαη pyraclostrobin Γηαπηζηψζεθε φηη ππήξραλ πςειέο ζπρλφηεηεο αλζεθηηθψλ ζηειερψλ ζηνπο πιεζπζκνχο πνπ κειεηήζεθαλ, κε εμαίξεζε ηνλ πιεζπζκφ πνπ πξνεξρφηαλ απφ ηα 62

70 πρλόηεηα % κήια φπνπ κφλν κηα απνκφλσζε παξνπζίαδε αλζεθηηθφηεηα ζε έλα ηνπιάρηζηνλ κπθεηνθηφλν. Ζ αλζεθηηθφηεηα ζηα βελδηκηδαδνιηθά ή ζηα αληιηλνππξηκηδηληθά κπθεηνθηφλα ήηαλ ε πην θνηλή αλζεθηηθφηεηα πνπ παξαηεξήζεθε ζην ζχλνιν ηνπ πιεζπζκνχ πνπ ειέγρζεθε. Παξάιιεια, παξαηεξήζεθε ε χπαξμε ελφο ζεκαληηθνχ πνζνζηνχ απνκνλψζεσλ νη νπνίεο παξνπζίαδαλ αλζεθηηθφηεηα ζε δχν ή αθφκα θαη ζε ηξία κπθεηνθηφλα ηαπηφρξνλα ελψ θακία απφ ηηο απνκνλψζεηο πνπ ειέγρζεθαλ δελ ήηαλ αλζεθηηθή ζην fenhexamid ή fludioxonil. Οη ζπρλφηεηεο αλζεθηηθφηεηαο πνπ παξαηεξήζεθαλ ζηα δηάθνξα κπθεηνθηφλα θαηά μεληζηή παξνπζηάδνληαη ζην Πίλαθα 9. Μεηά απφ ζπζρεηηζκφ ησλ θαηλνηχπσλ αλζεθηηθφηεηαο κε ηνπο δχν ηχπνπο B. cinerea δηαπηζηψζεθε φηη νη transposa απνκνλψζεηο ήηαλ πην επηξξεπείο ζηελ αλάπηπμε αλζεθηηθφηεηαο. ε φινπο ηνπο μεληζηέο, ε ζπρλφηεηα θαηλνηχπσλ αλζεθηηθψλ ζηα κπθεηνθηφλα ήηαλ ζεκαληηθά πςειφηεξε εληφο ηνπ transposa ππνπιεζπζκνχ ζε ζχγθξηζε κε ηνλ vacuma (Δηθφλα 44). ε θακία απφ ηηο vacuma απνκνλψζεηο ηνπ πιεζπζκνχ ησλ θνινθπλζνεηδψλ δελ αληρλεχζεθε αλζεθηηθφηεηα ζηα κπθεηνθηφλα πνπ κειεηήζεθαλ. Αληίζηνηρα, ζην πιεζπζκφ απφ θξάνπια κφλν ην 10 % ησλ vacuma απνκνλψζεσλ ήηαλ αλζεθηηθέο ζε ηνπιάρηζην έλα κπθεηνθηφλν, ελψ ζηηο transposa απνκνλψζεηο ηνπ ίδηνπ μεληζηή ην αληίζηνηρν πνζνζηφ ήηαλ 69 %. Ζ ςειφηεξε ζπρλφηεηα αλζεθηηθφηεηαο ζηα κπθεηνθηφλα πνπ ειέγρζεθαλ εληφο ηνπ vacuma ππνπιεζπζκνχ παξαηεξήζεθε ζην ζηαθχιη. Παξφια απηά, ζε απηφλ ηνλ μεληζηή ην 89 % ησλ transposa απνκνλψζεσλ ήηαλ αλζεθηηθέο ζε ηνπιάρηζηνλ έλα κπθεηνθηφλν (Δηθφλα 44) Transposa Vacuma a b a a Δηθόλα 44. πρλφηεηα αλζεθηηθφηεηαο ζηα κπθεηνθηφλα απνκνλψζεσλ ηνπ Botrytis cinerea εληφο ηνπ transposa θαη vacuma ππνπιεζπζκνχ. Γηαθνξεηηθά γξάκκαηα ζηηο ζηήιεο ππνδεηθλχνπλ ζηαηηζηηθά ζεκαληηθέο δηαθνξέο ζχκθσλα κε ην Fisher's Exact Test (P = 0,05). Ο πξνζδηνξηζκφο ηεο ζπρλφηεηα αλζεθηηθφηεηαο ζην pyraclostrobin ρξεζηκνπνηψληαο ηε δηαθξηηηθή ζπγθέληξσζε ησλ 0.3 κg ml -1 έδεημε φηη αλζεθηηθνί θαηλφηππνη ζην pyraclostrobin ππήξραλ κφλν ζην πιεζπζκφ απφ θξάνπια. Ζ ζπρλφηεηα αλζεθηηθφηεηαο ζην pyraclostrobin απμήζεθε ζεκαληηθά απφ ην 2008 ζην 2009 απφ ην 43 ζην 52.5 %, αληίζηνηρα. ε θακία απνκφλσζε απφ ηνπο ππφινηπνπο μεληζηέο δελ παξαηεξήζεθε αλζεθηηθφο θαηλφηππνο ζην pyraclostrobin (Δηθφλα 45). a αθηηλίδηα ζηαθχιηα θνινθπλζνεηδή ηνκάηεο θξάνπιεο Ξεληζηήο b a b a b 63

71 Πίλαθαο 9. πρλφηεηεο θαηλνηχπσλ αλζεθηηθφηεηαο ζε δηάθνξα κπθεηνθηφλα απνκνλψζεσλ ηνπ κχθεηα Botrytis cinerea απφ δηάθνξνπο μεληζηέο, κε βάζε ηε κπθειηαθή αλάπηπμε ζε δηαθξηηηθέο δφζεηο ησλ κπθεηνθηφλσλ α. Έηνο Αξ. πρλόηεηα αλζεθηηθόηεηαο (%) β Ξεληζηήο απνκόλσζεο απνκ. Σνκάηα Βελδ Α Αληι Α Γηθαξ Α Βελδ Α Αληι Α Βελδ Α Γηθαξ Α Αληι Α Γηθαξ Α Βελδ Α Αληι Α Γηθαξ Α Δπαίζζεηεο Σνκάηα Κνινθπλζ Φξάνπια ηαθύιη Αθηηλίδην Μήιν α Οη δηαθξηηηθέο ζπγθεληξψζεηο κπθεηνθηφλσλ πνπ ρξεζηκνπνηήζεθαλ ήηαλ: 1 κg ml -1 carbendazim, 0.05 κg ml -1 cyprodinil, 5 κg ml -1 iprodione, 0.1 κg ml -1 fludioxonil θαη 0.4 κg ml -1 fenhexamid β Βελδ Α : αλζεθηηθφηεηα ζηα βελδηκηδαδνιηθά (carbendazim), Αληι Α : αλζεθηηθφηεηα ζηα αληιηλνππξηκηδηληθά (cyprodinil), Γηθαξ Α : αλζεθηηθφηεηα ζηα δηθαξβνμακηδηθά (iprodione), Δπαίζζεηεο: επαίζζεηεο απνκνλψζεηο ζε φια ηα κπθεηνθηφλα πνπ ειέγρζεθαλ (carbendazim, cyprodinil, iprodione, fludioxonil θαη fenhexamid) [64]

72 Αξηζκόο απνκνλώζεσλ πρλόηεηα % Δπίζεο, αληηζηνηρψληαο ηηο αλζεθηηθέο απνκνλψζεηο ζην pyraclostrobin ζηνπο δχν ππνπιεζπζκνχο ηνπ B. cinerea πξνέθπςε φηη ην 100 % ησλ απνκνλψζεσλ απηψλ ήηαλ ηχπνπ transposa. 60% 50% 40% 30% 20% 10% 0% QoI αλζεθηηθέο απνκνλψζεηο Ξεληζηήο Δηθόλα 45. πρλφηεηα αλζεθηηθψλ απνκνλψζεσλ ζην pyraclostrobin ζηνπο πιεζπζκνχο ηνπ Botrytis cinerea απφ δηάθνξνπο μεληζηέο Δπαηζζεζία ζην pyraclostrobin Ζ κέηξεζε επαηζζεζίαο ζην pyraclostrobin, πξνζδηνξίδνληαο ηηο ηηκέο EC 50, πξαγκαηνπνηήζεθε κφλν ζηνn πιεζπζκφ ηνπ κχθεηα απφ θξάνπια. Με βάζε ηα απνηειέζκαηα παξαηεξήζεθε αζπλερήο θαηαλνκή ηεο επαηζζεζίαο. Καηά ηε δηάξθεηα θαη ησλ δχν ρξφλσλ δεηγκαηνιεςίαο νη ηηκέο EC 50 θπκάλζεθαλ απφ κέρξη >30 κg ml -1. Δπηπιένλ, θαηά ην 2009 ππήξμε κηα μεθάζαξε ηάζε γηα κείσζε ηεο επαηζζεζίαο (Δηθφλα 46) < >10 EC50 (κg ml -1 ) pyraclostrobin Δηθόλα 46. Καηαλνκή ησλ ηηκψλ EC 50 ζην pyraclostrobin ζην πιεζπζκφ ηνπ Botrytis cinerea απφ θξάνπια θαηά ην 2008 θαη 2009 [65]

73 Μνξηαθή αλίρλεπζε ηεο G143A κεηαιιαγήο θαη ηνπ εζνλίνπ Bcbi 143/144 Όινη νη εθθηλεηέο θαη νη κνξηαθνί αληρλεπηέο TaqMan ππνβιήζεθαλ αξρηθά ζε βειηηζηνπνίεζε κε εθρχιηζκα DNA απφ δείγκαηα αλαθνξάο αλζεθηηθψλ θαη επαίζζεησλ απνκνλψζεσλ πνπ έθεξαλ ή φρη ην εζφλην Bcbi 143/144. Καη νη δχν δνθηκέο επηθπξψζεθαλ ρξεζηκνπνηψληαο δηάθνξεο ζεξκνθξαζίεο επηκήθπλζεο θαη ζεξκηθά πξνθίι. πγθεθξηκέλα, ε ζπγθέληξσζε ησλ εθθηλεηψλ θαη ησλ κνξηαθψλ αληρλεπηψλ πνπ έδηλε ηε κεγαιχηεξε αληαπφθξηζε θζνξηζκνχ ζηνπο ιηγφηεξνπο θχθινπο PCR (Δηθφλα 47) ήηαλ 300 nm γηα ηνπο εθθηλεηέο θαη 100 nm γηα ηνπο κνξηαθνχο αληρλεπηέο θαη γηα ηηο δχν δνθηκέο. Οη άξηζηεο ζεξκνθξαζίεο επηκήθπλζεο ήηαλ 55 o C γηα 30 θαη 60 o C γηα 30 γηα ηε πνιιαπιή δνθηκή αλίρλεπζεο ηεο κεηάιιαμεο θαη ηε δνθηκή αλίρλεπζεο ηνπ εζνλίνπ, αληίζηνηρα. Δηθόλα 47. Κακπχιεο ελίζρπζεο γηα ηελ αλίρλεπζε (Α) QoI επαίζζεησλ θαη QoI αλζεθηηθψλ αιιεινκφξθσλ ρξεζηκνπνηψληαο πνιιαπιή TaqMan -PCR θαη (Β) ηεο παξνπζίαο ηνπ εζνλίνπ Bcbi 143/144 ρξεζηκνπνηψληαο TaqMan -PCR [66]

74 Οη LNA κνξηαθνί αληρλεπηέο TaqMan θαη νη εμεηδηθεπκέλνη εθθηλεηέο επηθπξψζεθαλ κε ηελ αλάιπζε νιφθιεξνπ ηνπ δείγκαηνο ηνπ παζνγφλνπ. Απφ ηα απνηειέζκαηα πξνέθπςε φηη νη δχν κνξηαθνί αληρλεπηέο πνπ ρξεζηκνπνηήζεθαλ ζηε πνιιαπιή δνθηκή αληέδξαζαλ κφλν κε ηηο επαίζζεηεο ή αλζεθηηθέο απνκνλψζεηο ρσξίο λα αληηδξνχλ κεηαμχ ηνπο. Ο κνξηαθφο αληρλεπηήο RESITAQ παξνπζίαδε απμεκέλν θζνξηζκφ κφλν γηα απνκνλψζεηο πνπ έθεξαλ ηε G143A κεηαιιαγή, ελψ ν κνξηαθφο αληρλεπηήο SENSITAQ αληηδξνχζε κε απνκνλψζεηο πνπ δελ έθεξαλ ηε G143A κεηαιιαγή. Παξφκνηα, ν κνξηαθφο αληρλεπηήο TaqMan θαη νη δχν εθθηλεηέο πνπ ρξεζηκνπνηήζεθαλ γηα ηελ αλίρλεπζε ηεο παξνπζίαο ηνπ εζνλίνπ Bcbi 143/144 επίζεο επηθπξψζεθαλ κε ηελ αλάιπζε νιφθιεξνπ ηνπ δείγκαηνο ηνπ παζνγφλνπ. Σα απνηειέζκαηα έδεημαλ φηη ε δνθηκή ήηαλ εμεηδηθεπκέλε θαη έδηλε ζεηηθή αληίδξαζε κφλν κε απνκνλψζεηο πνπ έθεξαλ ην επηπιένλ εζφλην. Απφ ηα απνηειέζκαηα ηεο ελίζρπζεο πξνέθπςε φηη ε κεηαιιαγή G143A ππήξρε κφλν ζηνλ πιεζπζκφ ηνπ κχθεηα πνπ απνκνλψζεθε απφ θξάνπια θαηά ην 2008 θαη 2009 ζε ζπρλφηεηεο 43 θαη 52.5 %, αληίζηνηρα (Πίλαθαο 10). Παξάιιεια, ην εζφλην κεηαμχ ησλ θσδηθνλίσλ 143 θαη 144 ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b παξνπζηαδφηαλ ζηνπο πιεζπζκνχο απφ φινπο ηνπο μεληζηέο πνπ πάξζεθαλ δείγκαηα ζε ζπρλφηεηεο πνπ θπκαίλνληαλ απφ 20 κέρξη 100 % (Πίλαθαο 10). Ηδηαίηεξν ελδηαθέξνλ παξνπζηάδεη ην γεγνλφο φηη ην πςειφηεξν πνζνζηφ ησλ απνκνλψζεσλ πνπ έθεξαλ ην εζφλην παξαηεξήζεθε ζηνπο πιεζπζκνχο πνπ απνθηήζεθαλ απφ θαιιηέξγεηεο ιαραληθψλ ζεξκνθεπίνπ, ελψ ην ρακειφηεξν πνζνζηφ παξαηεξήζεθε ζηνλ πιεζπζκφ απφ θξάνπια. Κακηά απφ ηηο απνκνλψζεηο πνπ έθεξαλ ην εζφλην Bcbi 143/144 δελ έθεξε ηαπηφρξνλα ηε κεηαιιαγή G143A. Δπίζεο, αληρλεχζεθαλ ζηνπο πιεζπζκνχο απφ φινπο ηνπο μεληζηέο πνπ πάξζεθαλ δείγκαηα, απνκνλψζεηο πνπ δελ έθεξαλ νχηε ην εζφλην νχηε ηε κεηαιιαγή G143A ζε ζρεηηθψο ςειέο ζπρλφηεηεο πνπ θπκαίλνληαλ απφ 8.8 % ζην πιεζπζκφ πνπ απνκνλψζεθε απφ ηνκάηα ην 2005 κέρξη 71.1 % ζην πιεζπζκφ απφ ζηαθχιη (Πίλαθαο 10). Πίλαθαο 10. πρλφηεηα (%) αλίρλεπζεο ηεο κεηαιιαγήο G143A θαη ηνπ εζνλίνπ Bcbi 143/144 απνκνλψζεσλ ηνπ Botrytis cinerea ζπιιεγκέλσλ απφ δηάθνξνπο μεληζηέο ηνπ ζηελ Διιάδα κε βάζε ηε δνθηκή TaqMan real-time PCR πνπ αλαπηχρζεθε ζε απηή ηε κειέηε Ξεληζηήο Έηνο Αξηζκόο Γνκή ηνπ γνληδίνπ ηνπ θπηνρξώκαηνο b απνκνλώζεσλ G143A + G143A - G143A - Intron - (%) Intron + (%) Intron - (%) Σνκάηα Σνκάηα Κνινθ Κνινθ Φξάνπια Φξάνπια ηαθχιη Αθηηλίδην Μήιν [67]

75 Πξνζδηνξηζκόο λνπθιενηηδηαθήο αιιεινπρίαο ηνπ γνληδίνπ ηνπ θπηνρξώκαηνο b Γηα ηε κειέηε ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b, ηκήκα ηνπ γνληδίνπ εθαηέξσζελ ηνπ θσδηθνλίνπ 143, απφ 7 ηπραίεο απνκνλψζεηο ηνπ B. cinerea ζηηο νπνίεο αληρλεχηεθε ν επαίζζεηνο αιιειφκνξθνο (G143) θαη απφ 5 ζηηο νπνίεο αληρλεχηεθε ν αλζεθηηθφο αιιειφκνξθνο (Α143) κε βάζε ηελ Real-time TaqMan- PCR πνπ αλαπηχρζεθε, εληζρχζεθε θαη αιιεινπρήζεθε. Απφ ηε κειέηε ηεο αιιεινπρίαο ησλ απνκνλψζεσλ πξνέθπςε φηη: i) ζηηο απνκνλψζεηο πνπ αληρλεχηεθε ν επαίζζεηνο αιιειφκνξθνο (G143) θαη ραξαθηεξίζηεθαλ σο θαηλνηππηθά επαίζζεηεο ζην pyraclostrobin έθεξαλ ηελ αιιεινπρία λνπθιετθψλ νμέσλ GGT ζην θσδηθφλην 143 θαη ii) ζηηο απνκνλψζεηο πνπ αληρλεχηεθε ν αλζεθηηθφο αιιειφκνξθνο (Α143) θαη ραξαθηεξίζηεθαλ σο θαηλνηππηθά αλζεθηηθέο ζην pyraclostrobin έθεξαλ ηελ αιιεινπρία λνπθιετθψλ νμέσλ GCT ζην θσδηθφλην 143 (Δηθφλα 48). Δηθόλα 48. Αιιεινπρία ηκήκαηνο ηνπ γνληδίνπ ηνπ θπηνρξψκαηνο b εθαηέξσζελ ηνπ ζεκείνπ κεηάιιαμεο ζε QoI επαίζζεηεο (Β 20, 53, 118, 192, 15, 198 θαη 14 ) θαη QoI αλζεθηηθέο (Β 42, 43, 289, 41 θαη 290) απνκνλψζεηο ηνπ Botrytis cinerea. Οη ζθηαζκέλεο πεξηνρέο ππνδειψλνπλ ηα ζεκεία δέζκεπζεο ησλ εθθηλεηψλ θαη ησλ κνξηαθψλ αληρλεπηψλ ζηελ Real-time TaqMan -PCR δνθηκή πνπ αλαπηχρζεθε γηα ηελ αλίρλεπζε ηεο G143A κεηαιιαγήο πδήηεζε Σα απνηειέζκαηα ηεο κειέηεο έδεημαλ φηη ε ζπρλφηεηα αλζεθηηθφηεηαο ζηα κπθεηνθηφλα ήηαλ ςειφηεξε ζην transposa ππνπιεζπζκφ ζε ζχγθξηζε κε ην vacuma. Απηφ είλαη ζχκθσλν κε πξνεγνχκελεο αλαθνξέο ησλ Martinez et al. (2005) νη νπνίνη βξήθαλ φηη ηα transposa ζηειέρε απφ ζηαθχιη παξνπζίαζαλ ςειφηεξε ζπρλφηεηα αλζεθηηθφηεηαο ζην δηθαξβνμακηδηθφ κπθεηνθηφλν vincozoline ζε ζρέζε κε ηα vacuma ζηειέρε. Γηα λα εξκελεχζνπλ ηα επξήκαηά ηνπο πξφηεηλαλ φηη ηα transposa ζηειέρε ήηαλ πεξηζζφηεξν εθηεζεηκέλα ζε κεηαρεηξίζεηο δηθαξβνμακηδηθψλ απφ φηη ηα vacuma ζηειέρε ηα νπνία κπνξνχλ λα βξεζνχλ ζην ζηαθχιη θαηά ηελ έλαξμε ηεο θαιιηεξγεηηθήο πεξηφδνπ πξηλ ηελ έλαξμε ησλ [68]

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ

H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ H ΜΑΓΕΙΑ ΤΩΝ ΑΡΙΘΜΩΝ Φξεζηκόηεηα καζεκαηηθώλ Αξρή θαηακέηξεζεο Όζα έδσζαλ νη Έιιελεο... Τξίγσλνη αξηζκνί Τεηξάγσλνη αξηζκνί Δπηκήθεηο αξηζκνί Πξώηνη αξηζκνί Αξηζκνί κε μερσξηζηέο ηδηόηεηεο Γίδπκνη πξώηνη

Διαβάστε περισσότερα

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP

ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ΑΛΛΑΓΗ ΟΝΟΜΑΣΟ ΚΑΙ ΟΜΑΔΑ ΕΡΓΑΙΑ, ΚΟΙΝΟΥΡΗΣΟΙ ΦΑΚΕΛΟΙ ΚΑΙ ΕΚΣΤΠΩΣΕ ΣΑ WINDOWS XP ηότοι εργαζηηρίοσ ην πιαίζην ηνπ ζπγθεθξηκέλνπ εξγαζηεξίνπ ζα παξνπζηαζηνύλ βαζηθέο ιεηηνπξγίεο ησλ Windows XP πνπ ζρεηίδνληαη

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα.

Δξγαιεία Καηαζθεπέο 1 Σάμε Σ Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ. ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Φαθόο κε ζσιήλα. Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΧΝ ΠΡΧΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 11 ε : ΦΧ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Φαθόο κε ζσιήλα Γηαθξάγκαηα Δξγαιεία Καηαζθεπέο 2 Η θαηαζθεπή πεξηγξάθεηαη ζηελ αληίζηνηρε ελόηεηα

Διαβάστε περισσότερα

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ

Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική ΑΔ Άζκηζη ζτέζης κόζηοσς-τρόνοσ (Cost Time trade off) Καηαζκεσαζηική Δίζηε μησανικόρ διοίκηζηρ μεγάληρ καηαζκεςαζηικήρ εηαιπείαρ και καλείζηε να ςλοποιήζεηε ηο έπγο πος πεπιγπάθεηαι από ηον Πίνακα 1. Κωδ.

Διαβάστε περισσότερα

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016

Βάσεις Δεδομέμωμ. Εξγαζηήξην V. Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 Βάσεις Δεδομέμωμ Εξγαζηήξην V Τκήκα Πιεξνθνξηθήο ΑΠΘ 2015-2016 2 Σκοπός του 5 ου εργαστηρίου Σθνπόο απηνύ ηνπ εξγαζηεξίνπ είλαη: ε κειέηε ζύλζεησλ εξσηεκάησλ ζύλδεζεο ζε δύν ή πεξηζζόηεξεο ζρέζεηο ε κειέηε

Διαβάστε περισσότερα

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12

Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 2011-12 Απνηειέζκαηα Εξσηεκαηνινγίνπ 2o ηεηξάκελν 11-12 Project 6: Ταμίδη κε ηε Μεραλή ηνπ Φξόλνπ Υπεύζπλνη Καζεγεηέο: Ε. Μπηιαλάθε Φ. Αλησλάηνο Δρώηηζη 3: Πνηα από ηα παξαθάησ ΜΜΕ ηεξαξρείηε από πιεπξάο ζεκαζίαο;

Διαβάστε περισσότερα

Καηεσζσληήρηες οδεγίες καθροζθοπηθώλ έιεγτωλ γηα ηε δηαπίζηωζε ή κή ηωλ επηβιαβώλ οργαληζκώλ Scirrhia pini ( Mycosphaerella pini

Καηεσζσληήρηες οδεγίες καθροζθοπηθώλ έιεγτωλ γηα ηε δηαπίζηωζε ή κή ηωλ επηβιαβώλ οργαληζκώλ Scirrhia pini ( Mycosphaerella pini Καηεσζσληήρηες οδεγίες καθροζθοπηθώλ έιεγτωλ γηα ηε δηαπίζηωζε ή κή ηωλ επηβιαβώλ οργαληζκώλ Scirrhia pini (Mycosphaerella pini) θαη Scirrhia acicola (Mycosphaerella dearnessii) 1. Επηβιαβείς οργαληζκοί:

Διαβάστε περισσότερα

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis

Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training. Dipl.Biol.cand.med. Stylianos Kalaitzis Αζθήζεηο 5 νπ θεθαιαίνπ Crash course Step by step training Dipl.Biol.cand.med. Stylianos Kalaitzis Stylianos Kalaitzis Μνλνϋβξηδηζκνο 1 Γπν γνλείο, εηεξόδπγνη γηα ηνλ αιθηζκό θάλνπλ παηδηά. Πνία ε πηζαλόηεηα

Διαβάστε περισσότερα

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή

Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ. Καξθηά 3 θηιά πεξίπνπ κε κήθνο ηξηπιάζην από ην πάρνο ηνπ μύινπ θπξί κεγάιν θαη ππνκνλή Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΙΩΝ ΠΡΩΣΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ ΔΝΟΣΗΣΑ 10 ε : ΜΗΥΑΝΙΚΗ ΜΔΡΟ Β ΠΙΔΗ ΔΡΓΑΛΔΙΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Καξέθια θαθίξε Όξγαλα Τιηθά Κόληξα πιαθέ ζαιάζζεο κε δηαζηάζεηο 40Υ40 εθ.

Διαβάστε περισσότερα

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ

ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ. Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ ΥΟΛΗ ΓΔΩΣΔΥΝΙΚΩΝ ΔΠΙΣΗΜΩΝ ΚΑΙ ΓΙΑΥΔΙΡΙΗ ΠΔΡΙΒΑΛΟΝΣΟ Πτυχιακή διατριβή ΟΛΟΚΛΗΡΩΜΔΝΗ ΑΠΟΡΡΤΠΑΝΗ ΚΑΤΑΔΡΙΩΝ ΠΛΟΙΩΝ Αργσρώ Ιωάννοσ Λεμεσός 2012 ΣΔΥΝΟΛΟΓΙΚΟ ΠΑΝΔΠΙΣΗΜΙΟ ΚΤΠΡΟΤ

Διαβάστε περισσότερα

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger

Κεθάλαιο 1. Ενόηηηα 2 Πλάνο Μάρκεηινγκ. Εξγαιεία Μάξθεηηλγθ. Dr. Andrea Grimm Dr. Astin Malschinger Κεθάλαιο 1 Ενόηηηα 2 Πλάνο Μάρκεηινγκ Εξγαιεία Μάξθεηηλγθ Dr. Andrea Grimm Dr. Astin Malschinger ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ 2 ΠΛΑΝΟ ΜΑΡΚΕΤΙΝΓΚ Κεθάιαην 1: Εξγαιεία Μάξθεηηλγθ Σπγγξαθείο: Δξ. Andrea Grimm, Δξ.

Διαβάστε περισσότερα

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots)

Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) Σημεία Ασύπματηρ Ππόσβασηρ (Hot-Spots) 1.1 Σςνοπτική Πεπιγπαυή Hot Spots Σα ζεκεία αζύξκαηεο πξόζβαζεο πνπ επηιέρζεθαλ αλαθέξνληαη ζηνλ επόκελν πίλαθα θαη παξνπζηάδνληαη αλαιπηηθά ζηηο επόκελεο παξαγξάθνπο.

Διαβάστε περισσότερα

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ

ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ ΔΛΔΓΥΟ ΔΜΒΟΛΙΑΣΙΚΗ ΚΑΛΤΦΗ Δ ΠΑΙΓΙΑ ΠΡΟΥΟΛΙΚΗ ΚΑΙ ΥΟΛΙΚΗ ΗΛΙΚΙΑ ΣΟΤ ΝΟΜΟΤ ΚΔΡΚΤΡΑ 24 ο ΠΑΝΔΛΛΗΝΙΟ ΤΝΔΓΡΙΟ ΔΛΛΗΝΙΚΗ ΔΣΑΙΡΔΙΑ ΚΟΙΝΧΝΙΚΗ ΠΑΙΓΙΑΣΡΙΚΗ ΚΑΙ ΠΡΟΑΓΧΓΗ ΣΗ ΤΓΔΙΑ ΠΙΝΟΤΛΑ ΔΤΡΤΓΙΚΗ ΒΑΡΚΑΡΗ ΠΟΛΤΚΡΙΣΗ

Διαβάστε περισσότερα

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2

Α. Εηζαγσγή ηεο έλλνηαο ηεο ηξηγσλνκεηξηθήο εμίζσζεο κε αξρηθό παξάδεηγκα ηελ εκx = 2 ΣΡΙΓΩΝΟΜΔΣΡΙΚΔ EΞΙΩΔΙ Πνηα παξαδείγκαηα εμηζώζεσλ ή θαη πξνβιεκάησλ πηζηεύεηαη όηη είλαη θαηάιιεια γηα ηελ επίιπζε ηνπο θαηά ηελ δηάξθεηα ηεο δηδαθηηθήο δηαδηθαζίαο κέζα ζηελ ηάμε; 1 ε ΓΙΓΑΚΣΙΚΗ ΩΡΑ Α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 εως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ. Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα. Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ

ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ. Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα. Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ ΑΝΘΟ ΑΓΓΕΙΟΠΕΡΜΩΝ Μάξζα Λαδαξίδνπ Αζαλαζηάδνπ Καζεγήηξηα Εξγαζηήξην Μνξθνινγίαο θαη Φπζηνινγίαο Φπηώλ Σκήκα Δαζνπνλίαο ΔΦΠ, παξ/κα Δξάκαο, ΣΕΙ Καβάιαο, ΑΝΘΟ ΣΩΝ ΑΓΓΔΙΟΠΔΡΜΩΝ Η εγγελήο αλαπαξαγσγή ησλ αγγεηνζπέξκσλ

Διαβάστε περισσότερα

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ.

Μονοψϊνιο. Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Μονοψϊνιο Ολιγοψώνιο Αγνξά κε ιίγνπο αγνξαζηέο. Δύναμη μονοψωνίος Η ηθαλόηεηα πνπ έρεη ν αγνξαζηήο λα επεξεάζεη ηελ ηηκή ηνπ αγαζνύ. Οπιακή αξία Δπηπξόζζεηα νθέιε από ηελ ρξήζε/θαηαλάισζε κηαο επηπξόζζεηε

Διαβάστε περισσότερα

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά:

ΑΝΤΗΛΙΑΚΑ. Η Μηκή ζθέθηεθε έλαλ ηξόπν, γηα λα ζπγθξίλεη κεξηθά δηαθνξεηηθά αληειηαθά πξντόληα. Απηή θαη ν Νηίλνο ζπλέιεμαλ ηα αθόινπζα πιηθά: ΑΝΤΗΛΙΑΚΑ Η Μηκή θαη ν Νηίλνο αλαξσηήζεθαλ πνην αληειηαθό πξντόλ παξέρεη ηελ θαιύηεξε πξνζηαζία ζην δέξκα ηνπο. Τα αληειηαθά πξντόληα έρνπλ έλα δείθηε αληειηαθήο πξνζηαζίαο (SPF), ν νπνίνο δείρλεη πόζν

Διαβάστε περισσότερα

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ

ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ ΠΑΡΑΡΣΗΜΑ Δ. ΔΤΡΔΗ ΣΟΤ ΜΔΣΑΥΗΜΑΣΙΜΟΤ FOURIER ΓΙΑΦΟΡΩΝ ΗΜΑΣΩΝ Εδώ ζα ππνινγίζνπκε ην κεηαζρεκαηηζκό Fourier κεξηθώλ αθόκα ζεκάησλ, πξνζπαζώληαο λα μεθηλήζνπκε από ην κεηαζρεκαηηζκό Fourier γλσζηώλ ζεκάησλ

Διαβάστε περισσότερα

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ

ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΟΛΤΜΕΡΙΜΟ - ΠΕΣΡΟΥΗΜΙΚΑ ΠΑΡΑΔΕΙΓΜΑΣΑ Ο πολσμεριζμός Πολσμεριζμός είναι η τημική ανηίδραζη καηά ηην οποία πολλά μόρια ίδιων ή διαθορεηικών οργανικών ενώζεων, ποσ ονομάζονηαι μονομερή, ενώνονηαι και ζτημαηίζοσν

Διαβάστε περισσότερα

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15

Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Σπληήξεζε ηξνθίκσλ ρσξίο ρεκηθά πξόζζεηα PROJECT B ΛΥΚΕΙΟΥ 2 014-15 Εηζαγσγή Οη ηερληθέο ζπληήξεζεο ηξνθίκσλ έρνπλ ζθνπό : α) λα παξεκπνδίζνπλ αλεπηζύκεηεο κεηαβνιέο ζηα ραξαθηεξηζηηθά (γεύζε - ρξώκα -

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ ΜΑΘΗΜΑ : ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1382/153 1. Καη όηαλ έγηλε ε ππνρώξεζε αξγά ην απόγεπκα, επεηδή θνβήζεθαλ νη νιηγαξρηθνί κήπσο νη δεκνθξαηηθνί, αθνύ θάλνπλ επίζεζε, θαηαιάβνπλ

Διαβάστε περισσότερα

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη

iii. iv. γηα ηελ νπνία ηζρύνπλ: f (1) 2 θαη ΔΠΑΝΑΛΗΠΣΙΚΑ ΘΔΜΑΣΑ ΣΟ ΓΙΑΦΟΡΙΚΟ ΛΟΓΙΜΟ Μάρτιος 0 ΘΔΜΑ Να ππνινγίζεηε ηα όξηα: i ii lim 0 0 lim iii iv lim e 0 lim e 0 ΘΔΜΑ Γίλεηαη ε άξηηα ζπλάξηεζε '( ) ( ) γηα θάζε 0 * : R R γηα ηελ νπνία ηζρύνπλ:

Διαβάστε περισσότερα

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ

ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ ΤΑΞΙΝΟΜΗΣΗ ΤΩΝ ΤΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ ΚΑΤΑ ΤΑ ICDAS II ΚΡΙΤΗΡΙΑ ΜΔ ΒΑΣΗ ΤΗ ΚΛΙΝΙΚΗ ΔΞΔΤΑΣΗ Κιηληθή ηαμηλόκεζε ηνπ βαζκνύ ηεξεδνληθήο βιάβεο ηωλ νπώλ θαη ζρηζκώλ καζεηηθώλ επηθαλεηώλ θαηά ICDAS 1 νο Βαζκόο

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Α Γυμνασίου έλαξμεο 09.30 ιήμεο 09.45 Σην παξαθάησ ζρήκα θαίλεηαη ηκήκα ελόο πνιενδνκηθνύ ζρεδίνπ κηαο πόιεο. Οη ζθηαζκέλεο

Διαβάστε περισσότερα

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ

ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ ΙΣΤΟΡΙΑ ΤΟΥ ΑΡΧΑΙΟΥ ΚΟΣΜΟΥ Α ΛΤΚΕΙΟΤ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ Σχολικό έτος: 2011-2012 Καθηγήτριες: Κεφαλληνού Λουκία- Καλλία Αθηνά ΙΙ. ΟΙ ΑΧΑΙΟΙ ΕΛΛΗΝΕΣ ΑΠΟ ΣΟΤ ΠΡΟΙΣΟΡΙΚΟΤ ΥΡΟΝΟΤ ΕΩ ΚΑΙ ΣΟ Μ. ΑΛΕΞΑΝΔΡΟ 1. ΕΛΛΗΝΙΚΗ

Διαβάστε περισσότερα

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ )

Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Γηαηάμεηο Αλίρλεπζεο Γηαξξνώλ (λεξνύ θαπζίκωλ ρεκηθώλ ) Τν πξόβιεκα - Γηαξξνή λεξνύ Αθόκε θαη κηα κηθξή δηαξξνή λεξνύ κπνξεί λα πξνθαιέζεη θαηαζηξνθή αλ δελ αληρλεπζεί εγθαίξσο Δηαξξνή κπνξεί λα πξνέιζεη

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΤΙΚΗ ΣΚΥΤΑΛΟΓΡΟΜΙΑ 2015 ΓΙΑ ΤΟ ΓΥΜΝΑΣΙΟ Τεηάπηη 28 Ιανουαπίου 2015 ΛΔΥΚΩΣΙΑ Τάξη: Α Γυμναζίου ΠΡΟΒΛΗΜΑ Σε έλα ηνπξλνπά βόιετ δήισζαλ ζπκκεηνρή νκάδεο Γπκλαζίσλ ηεο Κύπξνπ.

Διαβάστε περισσότερα

Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι

Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι Ο ΔΡΟΜΟ ΠΡΟ ΣΟ «ΑΕΙΦΟΡΟ ΧΟΛΕΙΟ» ένα φωτογπαφικό ταξίδι ηα Δθπαηδεπηήξηα Πάλνπ ππνζηεξίδνπκε ηελ άπνςε όηη ην «αεηθόξν ζρνιείν» είλαη έλα όξακα εθηθηό. Η εθπαίδεπζε γηα ηελ αεηθνξία δελ είλαη κάζεκα, αιιά

Διαβάστε περισσότερα

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ

ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ ΘΔΚΑ ΡΖΠ ΑΛΑΓΛΩΟΗΠΖΠ 1.Απηόο πνπ ζα αλαγλσξηζηεί απνπζηάδεη γηα πνιύ θαηξό. 2.Δπηζηξέθεη κε πιαζηή ηαπηόηεηα ή κεηακνξθσκέλνο. 3.Απνκνλώλνληαη ηα δύν πξόζσπα 4.Άξζε κεηακόξθσζεο 5.Απνθάιπςε 6.Ακθηβνιίεο-απνδεηθηηθά

Διαβάστε περισσότερα

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH

ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KARNAUGH ΑΠΛΟΠΟΙΗΗ ΛΟΓΙΚΩΝ ΤΝΑΡΣΗΕΩΝ ΜΕ ΠΙΝΑΚΕ KRNUGH Γηα λα θάλνπκε απινπνίεζε κηαο ινγηθήο ζπλάξηεζεο κε πίλαθα (ή ράξηε) Karnaugh αθνινπζνύκε ηα παξαθάησ βήκαηα:. Η ινγηθή ζπλάξηεζε ζα πξέπεη λα είλαη ζε πιήξε

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 4 ΣΥΝΔΥΑΣΤΙΚΑ ΚΥΚΛΩΜΑΤΑ 1. ρεδίαζε πλδπαζηηθνύ Κπθιώκαηνο Έλα ζπλδπαζηηθό θύθισκα (Κ) έρεη ηξεηο εηζόδνπο A, B θαη C θαη κία έμνδν Y Y=A B+AC Να θαηαζθεπάζεηε ην ράξηε Karnaugh. B 0

Διαβάστε περισσότερα

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα!

Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Cpyright 2013 Λόγος & Επικοινωνία // All rights Reserved Παιχνίδι γλωζζικής καηανόηζης με ζχήμαηα! Αυηό ηο παιχνίδι έχει ζηόχους: 1. ηελ εθγύκλαζε ηεο αθνπζηηθήο κλήκεο ησλ παηδηώλ 2. ηελ εμάζθεζε ζηελ

Διαβάστε περισσότερα

Διατείριση Φσσικών Καταστρουών: ACTIVE LANDSLIDE INVENTORY MAPPING AND SUSCEPTIBILITY ZONING

Διατείριση Φσσικών Καταστρουών: ACTIVE LANDSLIDE INVENTORY MAPPING AND SUSCEPTIBILITY ZONING Διατείριση Φσσικών Καταστρουών: ACTIVE LANDSLIDE INVENTORY MAPPING AND SUSCEPTIBILITY ZONING Ναηαιία Σπαλνύ, spanou@igme.gr & natspanou@gmail.com Τερληθόο Γεσιόγνο (M.Sc.) Πεξηγξαθή Χάξηεο ρσξηθήο θαηαλνκήο

Διαβάστε περισσότερα

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ

ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ ΥΡΙΣΟΤΓΔΝΝΙΑΣΙΚΔ ΚΑΣΑΚΔΤΔ 1) Υξηζηνπγελληάηηθα ειαηάθηα θάξηα ή θαδξάθη θάξηα ή θαδξάθη Τιηθά πνπ ζα ρξεηαζηνύκε: Υαξηί θάλζνλ καύξν γηα ην θόλην, πξάζηλν γηα ηα ειαηάθηα, θόθθηλν γηα ηα αζηεξάθηα Απιό

Διαβάστε περισσότερα

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε.

Δπηιέγνληαο ην «Πξνεπηινγή» θάζε θνξά πνπ ζα ζπλδέεζηε ζηελ εθαξκνγή ζα βξίζθεζηε ζηε λέα ρξήζε. ΑΝΟΙΓΜΑ ΝΔΑ ΥΡΗΗ 1. Γεκηνπξγείηε ηε λέα ρξήζε από ηελ επηινγή «Παξάκεηξνη/Παξάκεηξνη Δηαηξίαο/Γηαρείξηζε Δηαηξηώλ». Πιεθηξνινγείηε ηνλ θσδηθό ηεο εηαηξίαο ζαο θαη παηάηε Enter. Σηελ έλδεημε «Υξήζεηο» παηάηε

Διαβάστε περισσότερα

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84

Διαηιμήζεις για Αιολικά Πάρκα. Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Κώδικες 28, 78 και 84 Διαηιμήζεις για Αιολικά Πάρκα Οη Διαηιμήζεις για Αιολικά Πάρκα εθαξκόδνληαη γηα ηελ απνξξνθνύκελε ελέξγεηα από Αηνιηθά Πάξθα πνπ είλαη ζπλδεδεκέλα ζην

Διαβάστε περισσότερα

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο:

Σύνθεζη ηαλανηώζεων. Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Σύνθεζη ηαλανηώζεων Α. Σύλζεζε δύν α.α.η ηεο ίδιας ζστνόηηηας Έζησ έλα ζώκα πνπ εθηειεί ηαπηόρξνλα δύν αξκνληθέο ηαιαληώζεηο ηεο ίδηαο ζπρλόηεηαο πνπ πεξηγξάθνληαη από ηηο παξαθάησ εμηζώζεηο: Η απνκάθξπλζε

Διαβάστε περισσότερα

ΙNCOFRUIT - (HELLAS).

ΙNCOFRUIT - (HELLAS). Πξνο ΟΛΑ ΤΑ ΜΔΛΗ Κε Σπλάδειθε Θέκα: Ιζπαλία & Γεξκαλία 5 ε ΔΒΓΟΜΑΓΑ 2011 (31 Ιαλ έσο 30 Φεβξ.2011) Παξαζέηνπκε θαησηέξσ: Αλαζθόπεζε ηεο 4 εο εβδνκάδνο 2011 κε ηηο ηηκέο ησλ εζπεξηδνεηδώλ πνπ δηακνξθώζεθαλ

Διαβάστε περισσότερα

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2

ΛΙΜΝΗ ΤΣΑΝΤ. Σρήκα 1. Σρήκα 2 ΛΙΜΝΗ ΤΣΑΝΤ Τν Σρήκα 1 δείρλεη ηελ αιιαγή ηεο ζηάζκεο ηεο Λίκλεο Τζαλη, ζηε Σαράξα ηεο Βόξεηαο Αθξηθήο. Η Λίκλε Τζαλη εμαθαλίζηεθε ηειείσο γύξσ ζην 20.000 π.χ., θαηά ηε δηάξθεηα ηεο ηειεπηαίαο επνρήο ησλ

Διαβάστε περισσότερα

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν

Δξγαιεία Καηαζθεπέο 1 Σάμε Δ Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ. ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ. Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Δξγαιεία Καηαζθεπέο 1 Δ.Κ.Φ.Δ. ΥΑΝΗΩΝ ΠΡΩΣΟΒΑΘΜΗΑ ΔΚΠΑΗΓΔΤΖ ΔΝΟΣΖΣΑ 2 ε : ΤΛΗΚΑ ΩΜΑΣΑ ΔΡΓΑΛΔΗΑ ΚΑΣΑΚΔΤΔ Καηαζθεπή 1: Ογθνκεηξηθό δνρείν Καηαζθεπάδνπκε έλα νγθνκεηξηθό δνρείν από πιαζηηθό κπνπθάιη λεξνύ

Διαβάστε περισσότερα

Ανάπτυξη Ελληνικής τεχνολογίας μηχανών ηλεκτροπαραγωγής ORC

Ανάπτυξη Ελληνικής τεχνολογίας μηχανών ηλεκτροπαραγωγής ORC Εθνικό Συνέδριο «Γεωθερμική Ηλεκτροπαραγωγή» Ξενοδοχείο Divani Caravel Αθήνα 20 Νοεμβρίου 2013 Ανάπτυξη Ελληνικής τεχνολογίας μηχανών ηλεκτροπαραγωγής ORC Α.Μπένου, Ι. Χωροπανίτης Τμήμα Γεωθερμικής Ενέργειας

Διαβάστε περισσότερα

γηα ηνλ Άξε Κσλζηαληηλίδε

γηα ηνλ Άξε Κσλζηαληηλίδε γηα ηνλ Άξε Κσλζηαληηλίδε γηα «ην θνηλό θαη ην θύξην» (Γ.νισκόο) γηα λα ρηίδω πάληα κε ηνλ ίδηνλε ηξόπν, κε ηηο ίδηεο θαηαζθεπαζηηθέο θαη πιαζηηθέο πξννπηηθέο, κε ηελ ίδηαλε πάληνηε πίζηε θαη αγάπε.. Α.Κ.

Διαβάστε περισσότερα

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger

Τάπηα με ππάζo, bacon και θέηα by Madame Ginger Τάπηα με ππάζo, bacon και θέηα by Madame Ginger 1 θύιιν ζθνιηάηαο 2 πξάζα 150 γξ. bacon 150 γξ. θέηα ΓΧΓΧΝΗ 100 γξ. γξαβηέξα ΓΧΓΧΝΗ 1 θ.ζ. ειαηόιαδν Κόβνπκε ηα πξάζα ζε ιεπηέο ξνδέιεο. Κόβνπκε ην bacon

Διαβάστε περισσότερα

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014

ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 ΠΑΡΔΜΒΑΔΙ ΔΤΑΙΘΗΣΟΠΟΙΗΗ ΚΑΙ ΠΡΟΛΗΨΗ ΓΙΑ ΣΟΝ HIV/AIDS ΣΗΝ ΑΚΣΟΓΡΑΜΜΗ ΣΩΝ ΠΔΡΙΦΔΡΔΙΑΚΩΝ ΔΝΟΣΗΣΩΝ ΣΗ ΚΔΝΣΡΙΚΗ ΜΑΚΔΓΟΝΙΑ ΑΤΓΟΤΣΟ 2014 Σν ΚΔ.ΔΛ.Π.ΝΟ., Γξαθείν Θεζζαινλίθεο θαη ε Γηεύζπλζε Γεκόζηαο Τγείαο ηεο

Διαβάστε περισσότερα

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ

ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ ΠΡΩΣΟΚΟΛΛΑ ΓΙΑΥΔΙΡΗΗ ΣΩΝ ΣΔΡΗΓΟΝΙΚΩΝ ΒΛΑΒΩΝ Δ ΔΝΗΛΙΚΔ Σν ζύγρξνλν πξόηππν αληηκεηώπηζεο ηεο ηεξεδόλαο ελειίθσλ δελ εζηηάδεηαη κόλν ζηελ απνθαηάζηαζε ησλ ηεξεδνληθώλ βιαβώλ πνπ έρνπλ εθδεισζεί, αιιά έρεη

Διαβάστε περισσότερα

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ

ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ 1 ΠΕΤΡΕΛΑΙΟ ΧΑΡΑΛΑΜΠΟΤ ΜΑΡΙΑ ΣΖΑΜΟΤΡΑΝΗ ΕΛΕΝΗ ΟΤΣΖΙΟΤ ΑΤΓΕΡΙΝΗ ΧΑΙΔΕΜΕΝΑΚΗ ΝΑΣΑΛΙΑ ΝΟΗΠΚΝΠ 2 Τν πεηξέιαην, πνπ κεξηθέο θνξέο ζηελ θαζεκεξηλή γιώζζα απνθαιείηαη θαη μαύπορ σπςσόρ ή τσάι τος Ρέξαρ, είλαη

Διαβάστε περισσότερα

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000.

ΔΕΟ 13. Ποσοτικές Μέθοδοι. θαη λα ππνινγίζεηε ην θόζηνο γηα 10000 παξαγόκελα πξντόληα. Να ζρεδηαζηεί γηα εύξνο πξντόλησλ έσο 30000. ΔΕΟ 13 Ποσοτικές Μέθοδοι Σσνάρηηζη Κόζηοσς C(), μέζο κόζηος C()/. Παράδειγμα 1 Μηα εηαηξεία δαπαλά γηα θάζε πξντόλ Α πνπ παξάγεη 0.0 λ.κ. Τα πάγηα έμνδα ηεο εηαηξείαο είλαη 800 λ.κ. Ζεηείηαη 1) Να πεξηγξάςεηε

Διαβάστε περισσότερα

IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ

IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ IV Ο ΕΛΛΗΝΙΜΟ ΣΗ ΔΤΗ,ΠΟΛΙΣΙΜΟΙ Δ.ΜΕΟΓΕΙΟΤ ΚΑΙ ΡΩΜΗ Να σαπακηηπίζεηε ηιρ πποηάζειρ, πος ακολοςθούν, υρ ππορ ηην οπθόηηηά ηοςρ, με ηην ένδειξη Σωστό ή Λάθος 1. ηελ αξραία Ρώκε νη πιεβείνη δελ είραλ αξρηθά

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_1379/50 1. Όηαλ ινηπόλ ήξζαλ [νη πξέζβεηο ζηελ Αζήλα], αθνύ ζπλέιαβαλ νη Αζελαίνη θαη ηνπο πξέζβεηο σο ππνθηλεηέο ζηάζεο θαη όζνπο έπεηζαλ [νη πξέζβεηο], ηνπο ζπγθέληξσζαλ γηα αζθάιεηα ζηελ Αίγηλα.

Διαβάστε περισσότερα

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43

ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 ΕΞΟΡΤΞΗ & ΚΑΣΑΚΕΤΕ ΣΗΝ ΕΤΡΩΠΗ ΜΑΘΗΜΑ 43 Κα ακαθένεηε 5 εονςπασθέξ πώνεξ θαη κα βνείηε ημ είδμξ ημο μνοθημύ ημοξ πιμύημο. Πμημη πανάγμκηεξ επηηνέπμοκ ηεκ θαηαζθεοή μεγάιςκ ηεπκηθώκ ένγςκ; Ε ελόνολε (ελαγςγή

Διαβάστε περισσότερα

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) =

ΔΦΑΡΜΟΜΔΝΑ ΜΑΘΗΜΑΣΙΚΑ ΣΗ ΧΗΜΔΙΑ Ι ΘΔΜΑΣΑ Α επηέκβξηνο 2009. 1. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(x,y) = ΘΔΜΑΣΑ Α επηέκβξηνο 9. Να ππνινγηζηνύλ νη κεξηθέο παξάγσγνη πξώηεο ηάμεο ηεο ζπλάξηεζεο f(,y) = y.. Να ππνινγηζηνύλ ηα νινθιεξώκαηα: a) ln b) a) 3cos b) e sin 4. Να ππνινγηζηεί ην νινθιήξσκα: S ( y) 3

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ

ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΑΠΑΝΤΗΣΔΙΣ ΓΙΚΤΥΑ ΥΠΟΛΟΓΙΣΤΩΝ II ΔΠΑΛ ΘΔΜΑ Α Α1. α. Σ β. Σ γ. Λ δ. Λ ε. Λ ζη. Σ Α2. Γ Α3. 1. γ 2. ε 3. δ 4. α Β1. ΘΔΜΑ Β Οη ηειηθνί ππνινγηζηέο παίξλνπλ απνθάζεηο δξνκνιόγεζεο κόλν γηα ηα δηθά ηνπο απηνδύλακα

Διαβάστε περισσότερα

3) Απνηειεζκαηηθή παξαθνινύζεζε (Monitoring) ησλ επηβιαβώλ νξγαληζκώλ.

3) Απνηειεζκαηηθή παξαθνινύζεζε (Monitoring) ησλ επηβιαβώλ νξγαληζκώλ. 1 Καηεπζπληήξηεο νδεγίεο γηα ηελ απνηειεζκαηηθή παξαθνινύζεζε (monitoring), ηελ πξόιεςε θαη ηελ νινθιεξσκέλε δηαρείξηζε ησλ επηβιαβώλ νξγαληζκώλ: Ceroplastes rusci, Hemiberlesia lataniae, Lobesia botrana

Διαβάστε περισσότερα

Χορήγηζη ΗΧΜΒ ζε ορθοπαιδικό τειροσργείο σπό περιοτική αναιζθηζία

Χορήγηζη ΗΧΜΒ ζε ορθοπαιδικό τειροσργείο σπό περιοτική αναιζθηζία Χορήγηζη ΗΧΜΒ ζε ορθοπαιδικό τειροσργείο σπό περιοτική αναιζθηζία Δρ Σηαμάηιος Α. Παπαδάκης Ορθοπαιδικός Χειροσργός Επιμεληηής Α - Ε.Σ.Υ. Δ Ορθοπαιδική Κλινική Γ.Ν.Α. KAT Αγαπεηέ Γηαηξέ.. Υειρόγραθο κείμενο

Διαβάστε περισσότερα

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ

Η/Υ A ΤΑΞΕΩΣ ΑΕ 2010-2011. Συστήματα Αρίθμησης. Υποπλοίαρχος Ν. Πετράκος ΠΝ Συστήματα Αρίθμησης Υποπλοίαρχος Ν. Πετράκος ΠΝ 1 Ειζαγωγή Τν bit είλαη ε πην βαζηθή κνλάδα κέηξεζεο. Είλαη κία θαηάζηαζε on ή off ζε έλα ςεθηαθό θύθισκα. Άιιεο θνξέο είλαη κία θαηάζηαζε high ή low voltage

Διαβάστε περισσότερα

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H )

Α Ο Κ Η Α Μ Α Ζ Η Η Ρ Η ( S E A R C H ) Ξ G O O G L E S C H O L A R Α Ο Ξ Ε Κ Ε Θ Λ Θ Α Λ Η Τ Α Μ Η Α Μ Α Ζ Η Η Ρ Η Ρ Οξαγκαηνπνηώληαο αλαδήηεζε ζην GoogleScholar (http://scholar.google.com/) ν ρξήζηεο κπνξεί λα εληνπίζεη πιηθό αθαδεκαϊθνύ θαη

Διαβάστε περισσότερα

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1

ΑΙΟΛΙΚΑ ΠΑΡΚΑ. Δρώτηση 1 ΑΙΟΛΙΚΑ ΠΑΡΚΑ Πνιινί άλζξσπνη πηζηεύνπλ όηη ν άλεκνο ζα έπξεπε λα αληηθαηαζηήζεη ην πεηξέιαην θαη ην θάξβνπλν σο πεγή ελέξγεηαο γηα ηελ παξαγσγή ειεθηξηζκνύ. Οη θαηαζθεπέο πνπ θαίλνληαη ζηελ εηθόλα είλαη

Διαβάστε περισσότερα

Α Ρ Η Σ Ο Σ Δ Λ Δ Η Ο Π Α Ν Δ Π Η Σ Ζ Μ Η Ο Θ Δ Α Λ Ο Ν Η Κ Ζ

Α Ρ Η Σ Ο Σ Δ Λ Δ Η Ο Π Α Ν Δ Π Η Σ Ζ Μ Η Ο Θ Δ Α Λ Ο Ν Η Κ Ζ Α Ρ Η Σ Ο Σ Δ Λ Δ Η Ο Π Α Ν Δ Π Η Σ Ζ Μ Η Ο Θ Δ Α Λ Ο Ν Η Κ Ζ ΣΜΖΜΑ ΓΔΩΛΟΓΗΑ ΔΡΓΑΣΖΡΗΟ ΣΔΥΝΗΚΖ ΓΔΩΛΟΓΗΑ ΜΑΘΖΜΑ: ΤΕΧΝΙΚΗ ΓΕΩΛΟΓΙΑ ΓΗΓΑΚΟΝΣΔ: Β. ΥΡΖΣΑΡΑ, Καθ. ΔΞΑΜΖΝΟ: 7 ο Β. ΜΑΡΗΝΟ, Δπ.Καθ. Φεβροσάριος

Διαβάστε περισσότερα

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ

ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ ΑΞΙΟΘΕΑΣΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ β. ΣΟ ΠΝΕΤΜΑΣΙΚΟ ΜΑ ΚΕΝΣΡΟ γ. Η ΠΑΝΟΡΑΜΙΚΗ ΘΕΗ ΣΟΤ ΥΩΡΙΟΤ ΜΑ α. Η ΕΚΚΛΗΙΑ ΣΟΤ ΥΩΡΙΟΤ ΜΑ. Η Εθθιεζία ηνπ ρσξηνύ καο, ε Αγία Άλλα, είλαη θηηζκέλε πξηλ πνιιά

Διαβάστε περισσότερα

ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ

ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ ΘΕΜΑ: ΚΟΠΖ ΠΗΣΑ ΠΑΔΠΠΔ - ΔΔΓΑ Μεγάιε επηηπρία ζεκείωζε ε θνηλή εθδήιωζε γηα ηελ θνπή πίηαο γηα ην 2009, ηνπ Παλειιήληνπ πλδέζκνπ Δπηρεηξήζεωλ Πξνζηαζίαο Πεξηβάιινληνο (ΠΑΔΠΠΔ) θαη ηεο Διιεληθήο Δηαηξίαο

Διαβάστε περισσότερα

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π

Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Τ ξ ε ύ ο ξ π ς ξ σ ξ ο ί ξ σ _ Ι ε ο α μ ε ι κ ό π Α ο υ ι ς ε κ ς ξ μ ι κ ή ρ ύ μ θ ε ρ η 6 Τ ξ μ έ α π ΘΘΘ, X ώ ο ξ π κ α ι Δ π ι κ ξ ι μ χ μ ί α Η έ μ α : Διδάρκξμςεπ: Τξ εύοξπ ςξσ ξοίξσ Ιεοαμεικόπ

Διαβάστε περισσότερα

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ

T A E K W O N D O. Δ. ΠπθαξΨο. ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ T A E K W O N D O Δ. ΠπθαξΨο ΔπΫθνπξνο ΘαζεγεηΪο ΑζιεηηθΪο ΦπζηθνζεξαπεΫαο ΡΔΦΑΑ - ΑΞΘ ΦΠΗΘΝΘΔΟΑΞΔΗΑ Ο Ρ Ι Μ Ο Φπζη(θ)νζεξαπεΫα εϋλαη ε επηζηϊκε, ε νπνϋα κόλν κε θπζηθψ κωζα θαη κεζόδνπο πξνζπαζεϋ λα ζεξαπεύζεη

Διαβάστε περισσότερα

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2

TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΠΡΟΑΡΜΟΓΗ: ΒΑΛΚΑΝΙΩΣΗ ΔΗΜ. ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 TOOLBOOK ΜΑΘΗΜΑ 2 TOOLBOOK (μάθημα 2) Δεκηνπξγία βηβιίνπ θαη ζειίδσλ ΕΚΠΑΙΔΕΤΣΙΚΟ ΠΕ19 1 Δημιουργία σελίδων και βιβλίων Έλα θαηλνύξην βηβιίν πεξηέρεη κία άδεηα ζειίδα κε έλα άδεην background. Δελ κπνξνύκε λα μερσξίζνπκε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ

ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ 1 ΘΔΜΑ Α ΒΙΟΛΟΓΙΑ ΓΔΝΙΚΗΣ ΠΑΙΓΔΙΑΣ Να γπάτεηε ζηο ηεηπάδιό ζαρ ηον απιθμό καθεμιάρ από ηιρ παπακάηυ ημιηελείρ πποηάζειρ Α1 υρ Α5 και δίπλα ηο γπάμμα πος ανηιζηοισεί ζηη λέξη ή ηη θπάζη, πος ζςμπληπώνει

Διαβάστε περισσότερα

Αληηκεηώπηζε ηνπ Metcalfa Pruinosa (Say) Ε. Ι. Ναβξνδίδεο

Αληηκεηώπηζε ηνπ Metcalfa Pruinosa (Say) Ε. Ι. Ναβξνδίδεο Αληηκεηώπηζε ηνπ Metcalfa Pruinosa (Say) Ε. Ι. Ναβξνδίδεο Αλεξάνδπειο Τεσνολογικό Εκπαιδεςηικό Ίδπςμα Θεζζαλονίκηρ, Τ.Θ. 141 Τ.Κ.574 00 Σίνδορ, Θεζζαλονίκη Αληηκεηώπηζε ηνπ Metcalfa Pruinosa (Say) Χημική

Διαβάστε περισσότερα

Καηεπζπληήξηεο νδεγίεο καθξνζθνπηθώλ έιεγρσλ γηα ηε δηαπίζησζε ή κή ηνπ επηβιαβνύο νξγαληζκνύ Cryphonectria parasitica (Murrill

Καηεπζπληήξηεο νδεγίεο καθξνζθνπηθώλ έιεγρσλ γηα ηε δηαπίζησζε ή κή ηνπ επηβιαβνύο νξγαληζκνύ Cryphonectria parasitica (Murrill Καηεπζπληήξηεο νδεγίεο καθξνζθνπηθώλ έιεγρσλ γηα ηε δηαπίζησζε ή κή ηνπ επηβιαβνύο νξγαληζκνύ Cryphonectria parasitica (Murrill 1. Ο επηβιαβήο νξγαληζκόο: Ο κύθεηαο Cryphonectria parasitica (Murrill) Barr

Διαβάστε περισσότερα

10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ

10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ 10). ΣΤΠΟΠΟΙΗΜΕΝΕ ΠΑΡΟΥΕ ΜΣ ΚΑΙ ΥΣ Σσποποιημένες παροτές ΥΣ Γηα ηελ ειεθηξνδόηεζε θάζε εζωηεξηθήο εγθαηάζηαζεο θαηαζθεπάδεηαη κία από ηηο «ηππνπνηεκέλεο» παξνρέο πνπ αλαθέξνληαη παξαθάηω. Γηα θάζε ηππνπνηεκέλε

Διαβάστε περισσότερα

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η

Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η Σ Δ Υ Ν Ι Κ Η Δ Κ Θ Δ Η Π Ρ Ο Μ Η Θ Δ Ι Α Ο Ι Κ Ο Γ Ο Μ Ι Κ Ω Ν Τ Λ Ι Κ Ω Ν Γ Η Μ Ο Τ Β Ο Λ Β Η ΠΔΡΙΔΥΟΜΔΝΑ 1. Τερληθή Έθζεζε 2. Δλδεηθηηθφο Πξνυπνινγηζκφο 3. Έληππν νηθνλνκηθήο πξνζθνξάο ΘΔΜΑ : Πξνκήζεηα

Διαβάστε περισσότερα

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ..

ΚΤΠΡΙΑΚΗ ΜΑΘΗΜΑΣΙΚΗ ΕΣΑΙΡΕΙΑ ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ΥΟΛΕΙΟ.. ΜΑΘΗΜΑΣΙΚΗ ΚΤΣΑΛΟΓΡΟΜΙΑ 2007 ΓΙΑ ΣΟ ΓΤΜΝΑΙΟ Παπασκευή 26 Ιανουαπίου 2007 Σάξη: Γ Γυμνασίου ιήμεο 11.00 Κάπνηνο άξρηζε λα δηαβάδεη έλα βηβιίν ηελ 1 ε Δεθεκβξίνπ. Κάζε κέξα δηάβαδε ηνλ ίδην αξηζκό ζειίδσλ

Διαβάστε περισσότερα

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ.

ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΛΘΤΑΗΚΘΔΗΡ Τ. ΑΓΩΜΘΡΘΙΞΘ ΤΩΠΞΘ ΡΘΡ ΛΘΙΠΕΡ ΗΚΘΙΘΕΡ ΟΑIΤΜΘΔΘ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ 11V11 ΗΚΘΙΘΑ 6-10 ΤΠΞΜΩΜ ΛΕΘΞΜΕΙΗΛΑΑ ΞΣ ΟΑΘΤΜΘΔΘΞΣ ΡΕ ΛΕΓΑΚΞ ΓΗΟΕΔΞ ΓΘΑ ΟΑΘΙΕΡ ΗΚΘΙΘΑΡ 6-10 ΕΩΜ Η ΔΘΑΔΠΞΛΗ ΑΟΞ Η ΛΘΑ ΕΡΘΑ ΡΗΜ ΑΚΚΗ ΕΘΜΑΘ ΛΕΓΑΚΗ

Διαβάστε περισσότερα

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες.

Η απνξξόθεζε ηνπ νξαηνύ θσηόο γίλεηαη κέζσ ρξσζηηθώλ νπζηώλ πνπ νλνκάδνληαη τλωροθύλλες. ΦΩΣΟΤΝΘΔΗ Δλαιιαθηηθή δηεξγαζία παξαγσγήο ελέξγεηαο Υξεζηκνπνηείηαη από ηνπο νλνκαδόκελνπο θσηνζπλζεηηθνύο νξγαληζκνύο Οπζηαζηηθά ε αληίζηξνθε δηεξγαζία ηεο αλαπλνήο πλίζηαηαη ζηελ δέζκεπζε ειηαθήο ελέξγεηαο

Διαβάστε περισσότερα

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c.

ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) v t. αθνύ ζύκθσλα κε ηα πεηξάκαηα Mickelson-Morley είλαη c =c. ΥΔΣΙΚΟΣΗΣΑ Μεηαζρεκαηηζκνί Γαιηιαίνπ. (Κιαζηθή ζεώξεζε) y y z z t t Σν νπνίν νδεγεί ζην όηη = - π.(άηνπν), αθνύ ζύκθσλα κε ηα πεηξάκαηα Mikelson-Morley είλαη =. Δπίζεο y = y, z = z, t = t Σν νπνίν ( t

Διαβάστε περισσότερα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα

Γιπθόδε + Ομπγόλν Δηνμείδην ηνπ άλζξαθα + Νεξό + Ελέξγεηα 4. ΑΝΑΠΝΟΗ Η δηάζπαζε ηεο γιπθόδεο γίλεηαη κέζα ζηα θύηηαξα, νλνκάδεηαη θπηηαξηθή αλαπλνή θαη εμαζθαιίδεη ηελ ελέξγεηα πνπ είλαη απαξαίηεηε ζην θύηηαξν. Η δηάζπαζε γίλεηαη κε ηελ παξνπζία νμπγόλνπ θαη

Διαβάστε περισσότερα

Η Αξιολόγηζη ηηρ Πεπίλητηρ Κειμένος Παιδαγυγικό Ινζηιηούηο

Η Αξιολόγηζη ηηρ Πεπίλητηρ Κειμένος Παιδαγυγικό Ινζηιηούηο Η Αξιολόγηζη ηηρ Πεπίλητηρ Κειμένος Παιδαγυγικό Ινζηιηούηο Οδηγίες για ηη διδαζκαλία ηων θιλολογικών μαθημάηων ζηο Ενιαίο Λύκειο (απόζπαζμα) Αθήνα 2001 ΠΔΡΙΔΥΟΜΔΝΑ Α. Τν πεξηερόκελν ηεο πεξίιεςεο (0-12

Διαβάστε περισσότερα

Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο

Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο Διάλεξη 2 Εηζαγωγή ζηελ Επεμεξγαζία Υγξώλ Απνβιήηωλ Σηάδηα Επεμεξγαζίαο Σηάδηα επεμεξγαζίαο πγξψλ απνβιήησλ Πξσηνβάζκηα ή Μεραληθή Δπεμεξγαζία Γεπηεξνβάζκηα ή Βηνινγηθή Δπεμεξγαζία Τξηηνβάζκηα ή Χεκηθή

Διαβάστε περισσότερα

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ

ΣΡΑΠΕΖΑ ΘΕΜΑΣΩΝ Α ΛΤΚΕΙΟΤ Α/Α : 0_3207/391 1. Τελ άιιε κέξα νη Τξηάθνληα, πνιύ ηαπεηλσκέλνη θαη ληώζνληαο εγθαηαιειεηκκέλνη, ζπγθεληξώζεθαλ ζην ρώξν ησλ ζπλεδξηάζεσλ παξάιιεια, νη «ηξεηο ρηιηάδεο», ζε όια ηα ζεκεία όπνπ είραλ ηνπνζεηεζεί,

Διαβάστε περισσότερα

Γραφεύα Επικοινωνύασ & Ενημϋρωςησ ϋρρεσ, Τψηλϊντου 4 3οσ Όροφοσ ΣΗΛ 2321023640 ΥΑΦ 2321051861

Γραφεύα Επικοινωνύασ & Ενημϋρωςησ ϋρρεσ, Τψηλϊντου 4 3οσ Όροφοσ ΣΗΛ 2321023640 ΥΑΦ 2321051861 Οπγάνωζη και διοίκηζη ηοςπιζηικών επισειπήζεων (ξενοδοσεία, ηοςπιζηικά γπαθεία ) Α) ΑΔΙ ΣΔΙ και Β) ΑΠΟΦΟΙΣΟΙ ΤΠΟΥΡΔΩΣΙΚΗ ΓΔΤΣΔΡΟΒΑΘΜΙΑ και ΜΔΣΑΓΔΤΣΔΡΟΒΑΘΜΙΑ ΔΚΠΑΙΓΔΤΗ Ρν πξόγξακκα απηό ζρεδηάζηεθε γηα

Διαβάστε περισσότερα

Poly-Feed. ςνιζηώμενερ Δοζολογίερ

Poly-Feed. ςνιζηώμενερ Δοζολογίερ Poly-Feed ςνιζηώμενερ Δοζολογίερ Πίνακαρ Πεπιεσομένων Σύποι Poly-Feed Poly-Feed GG... 3 Poly-Feed GG soilless....4 Poly-Feed Drip... 5 Poly-Feed Foliar... 6 ςνιζηώμενερ Δοζολογίερ για... Λαραληθά Κξεκκύδηα

Διαβάστε περισσότερα

Καρκίνος του μαστού: Παράγοντες Κινδύνου και Οικογενής Προδιάθεση

Καρκίνος του μαστού: Παράγοντες Κινδύνου και Οικογενής Προδιάθεση Καρκίνος του μαστού: Παράγοντες Κινδύνου και Οικογενής Προδιάθεση Ioanna Tzoulaki MSc PhD Lecturer in Epidemiology University of Ioannina School of Medicine & Imperial College School of Medicine Καρκίνος

Διαβάστε περισσότερα

ΠΑΡΑΓΧΓΗ ΒΑΙΛΙΚΟΤ ΠΟΛΣΟΤ ΥΧΡΙ ΑΦΑΙΡΔΗ Η ΠΔΡΙΟΡΙΜΟ ΣΗ ΒΑΙΛΙΑ

ΠΑΡΑΓΧΓΗ ΒΑΙΛΙΚΟΤ ΠΟΛΣΟΤ ΥΧΡΙ ΑΦΑΙΡΔΗ Η ΠΔΡΙΟΡΙΜΟ ΣΗ ΒΑΙΛΙΑ ΠΑΡΑΓΧΓΗ ΒΑΙΛΙΚΟΤ ΠΟΛΣΟΤ ΥΧΡΙ ΑΦΑΙΡΔΗ Η ΠΔΡΙΟΡΙΜΟ ΣΗ ΒΑΙΛΙΑ Γ. Γκόρας, Δ. Λαδαρίδοσ, Π. Φελεκίδοσ, Γ. Ιωάννοσ, Α. Θραζσβούλοσ Δξγαζηήξην Μειηζζνθνκίαο Σεξνηξνθίαο, Α.Π.Θ. e-mail: panthakk@hotmail.com ΠΔΡΙΛΗΦΗ

Διαβάστε περισσότερα

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ

Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com Ώρες διδασκαλίας: 16:00 19:15 μμ ΠΑΙΓΑΓΩΓΙΚΟ ΙΝΣΙΣΟΤΣΟ ΚΤΠΡΟΤ Πξόγξακκα Δπηκόξθσζεο Τπνςεθίσλ Καζεγεηώλ Σερλνινγίαο Γελάξεο 2011 ΗΛΔΚΣΡΟΝΙΚΑ Ι (Ύιε Γπκλαζίνπ) Διδάσκων: Σαββίδης Σάββας Τηλζφωνο: 99543321 Ε-mail: savvas_email@yahoo.com

Διαβάστε περισσότερα

Γενεηική Καρδιαγγειακών Παθήζεων

Γενεηική Καρδιαγγειακών Παθήζεων Γενεηική Καρδιαγγειακών Παθήζεων Νίκορ Ππωτονοτάπιορ, MD, FESC, Νάξορ Η γελεηηθή ησλ θαξδηαγγεηαθώλ παζήζεσλ έρεη εμειηρζεί νπζηαζηηθά θαηά ηα ηειεπηαία είθνζη ρξόληα. Σε απηό ην ρξνληθό δηάζηεκα εμειίρζεθε

Διαβάστε περισσότερα

ΑΛΔΞΑΝΓΡΔΗΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΣΔΥΝΟΛΟΓΗΑ ΓΔΧΠΟΝΗΑ ΣΜΖΜΑ ΦΤΣΗΚΖ ΠΑΡΑΓΧΓΖ ΣΟΜΔΑ ΟΠΧΡΟΚΖΠΔΤΣΗΚΧΝ-ΒΟΣΑΝΗΚΖ ΠΣΤΥΗΑΚΖ ΓΗΑΣΡΗΒΖ

ΑΛΔΞΑΝΓΡΔΗΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΣΔΥΝΟΛΟΓΗΑ ΓΔΧΠΟΝΗΑ ΣΜΖΜΑ ΦΤΣΗΚΖ ΠΑΡΑΓΧΓΖ ΣΟΜΔΑ ΟΠΧΡΟΚΖΠΔΤΣΗΚΧΝ-ΒΟΣΑΝΗΚΖ ΠΣΤΥΗΑΚΖ ΓΗΑΣΡΗΒΖ ΑΛΔΞΑΝΓΡΔΗΟ ΣΔΥΝΟΛΟΓΗΚΟ ΔΚΠΑΗΓΔΤΣΗΚΟ ΗΓΡΤΜΑ ΘΔΑΛΟΝΗΚΖ ΥΟΛΖ ΣΔΥΝΟΛΟΓΗΑ ΓΔΧΠΟΝΗΑ ΣΜΖΜΑ ΦΤΣΗΚΖ ΠΑΡΑΓΧΓΖ ΣΟΜΔΑ ΟΠΧΡΟΚΖΠΔΤΣΗΚΧΝ-ΒΟΣΑΝΗΚΖ ΠΣΤΥΗΑΚΖ ΓΗΑΣΡΗΒΖ «Η ΒΙΟΛΟΓΙΚΗ ΑΝΣΙΜΔΣΧΠΙΗ ΣΟΤ ΠΔΡΟΝΟΠΟΡΟΤ ΣΟΤ ΑΜΠΔΛΙΟΤ»

Διαβάστε περισσότερα

Πνηα λνκίδεηο όηη ζα είλαη ε ζπλνιηθή αληίζηαζε κηαο ζπλδεζκνινγίαο δύν αληηζηαηώλ ζπλδεδεκέλεο ζε ζεηξά; Γηαηί;...

Πνηα λνκίδεηο όηη ζα είλαη ε ζπλνιηθή αληίζηαζε κηαο ζπλδεζκνινγίαο δύν αληηζηαηώλ ζπλδεδεκέλεο ζε ζεηξά; Γηαηί;... ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ: Ιζοδύναμη ανηίζηαζη ζύνδεζηρ ανηιζηαηών Η δηδαζθαιία ηεο ηζνδύλακεο αληίζηαζεο γηα ζύλδεζε αληηζηαηώλ ζε ζεηξά θαη παξάιιεια ππάξρεη ζην Αλαιπηηθό Πξόγξακκα Σπνπδώλ ζηα καζήκαηα Φπζηθήο

Διαβάστε περισσότερα

Μέζνδνη ραξαθηεξηζκνύ πιηθώλ Δξγαζηεξηαθή άζθεζε 8: Μαγλεηηθέο Μεηξήζεηο Ηκεξνκελία δηεμαγσγήο: 26/5/2010

Μέζνδνη ραξαθηεξηζκνύ πιηθώλ Δξγαζηεξηαθή άζθεζε 8: Μαγλεηηθέο Μεηξήζεηο Ηκεξνκελία δηεμαγσγήο: 26/5/2010 Μέζνδνη ραξαθηεξηζκνύ πιηθώλ Δξγαζηεξηαθή άζθεζε 8: Μαγλεηηθέο Μεηξήζεηο Ηκεξνκελία δηεμαγσγήο: 26/5/2010 ΕΙΑΓΩΓΗ: Τα δηάθνξα πιηθά, αλάινγα κε ηε ζπκπεξηθνξά ηνπο εληόο καγλεηηθνύ πεδίνπ δηαθξίλνληαη

Διαβάστε περισσότερα

Οξγαλνινγία Κηλεηή θάζε αέξην (άδσην ή ήιην)

Οξγαλνινγία Κηλεηή θάζε αέξην (άδσην ή ήιην) ΑΕΡΙΑ ΧΡΩΜΑΤΟΓΡΑΦΙΑ Οξγαλνινγία Κηλεηή θάζε αέξην (άδσην ή ήιην) 150-200 ν C 400 o C Δθαξκνγέο Πην εθιεθηηθή κέζνδνο γηα αλίρλεπζε πξνζκίμεσλ θαηά ηελ παξαγσγή Πνζνηηθόο πξνζδηνξηζκόο νπζηώλ πνπ ζηεξνύληαη

Διαβάστε περισσότερα

ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη. Ανθρώπινου Δυναμικοφ. «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ»

ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη. Ανθρώπινου Δυναμικοφ. «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ» ACTA A.E. Αριςτο Σέλεια Πιςτοποίηςη Ανθρώπινου Δυναμικοφ «ΠΙΣΟΠΟΙΗΗ ΑΝΘΡΩΠΙΝΟΤ ΔΤΝΑΜΙΚΟΤ Εξελίξεισ - Προοπτικέσ» Εταιρεία Ένταςησ Γνώςησ Αριςτοτελείου Πανεπιςτημίου Θεςςαλονίκησ Δια Βίου Μάθηςη Νόκνο:

Διαβάστε περισσότερα

επαξθήο ζηαηηζηηθή ζπλάξηεζε, β) Έζησ η.δ. είλαη αλεμάξηεην ηνπ. Άξα πξόθεηηαη γηα 1 n

επαξθήο ζηαηηζηηθή ζπλάξηεζε, β) Έζησ η.δ. είλαη αλεμάξηεην ηνπ. Άξα πξόθεηηαη γηα 1 n . ΜΑΚΡΑ ΣΟΑ 7 & ΕΘΝ. ΑΝΣΙΣΑΕΩ (ΠΕΙΡΑΙΑ),. ΔΕΛΗΓΙΩΡΓΗ 06 Α (ΠΕΙΡΑΙΑ), 3. ΠΤΡΓΟ ΑΘΗΝΩΝ, ΑΜΠΕΛΟΚΗΠΟΙ (ΑΘΗΝΑ). ΣΗΛ 040970,,, www.vtal.gr Επιλεγμένες Ασκήσεις. α) Έζησ η.δ. Ep. Να δεηρζεί όηη ε T,..., ~, 0

Διαβάστε περισσότερα

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird

1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1. Οδηγίερ εγκαηάζηαζηρ και σπήζηρ έξςπνυν καπηών και τηθιακών πιζηοποιηηικών με σπήζη ηος λογιζμικού Μοzilla Thunderbird 1.1 Εγκαηάζηαζη ηυν οδηγών ηηρ έξςπνηρ κάπηαρ ζηο λογιζμικό Mozilla Thunderbird

Διαβάστε περισσότερα

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΗΜΙΟ ΑΘΗΝΩΝ ΣΜΗΜΑ ΕΠΙΣΗΜΗ ΥΤΣΙΚΗ ΠΑΡΑΓΩΓΗ ΕΡΓΑΣΗΡΙΟ ΔΕΝΔΡΟΚΟΜΙΑ

ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΗΜΙΟ ΑΘΗΝΩΝ ΣΜΗΜΑ ΕΠΙΣΗΜΗ ΥΤΣΙΚΗ ΠΑΡΑΓΩΓΗ ΕΡΓΑΣΗΡΙΟ ΔΕΝΔΡΟΚΟΜΙΑ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΗΜΙΟ ΑΘΗΝΩΝ ΣΜΗΜΑ ΕΠΙΣΗΜΗ ΥΤΣΙΚΗ ΠΑΡΑΓΩΓΗ ΕΡΓΑΣΗΡΙΟ ΔΕΝΔΡΟΚΟΜΙΑ Η επίδραςη του φορτίου ςτη φωτοςυνθετική δραςτηριότητα και ςτην ανάπτυξη των δένδρων ελιάσ ποικιλίασ Κορωνέΰκη Διπλωματική

Διαβάστε περισσότερα

ΚΔΝΑΚ θαη ιέβεηεο. Ζκεξίδα 20/11/2010. Σσηήξεο Καηζηκίραο Γξ. Μεραλνιόγνο Μεραληθόο. Γεληθόο Γξακκαηέαο β ΔΝ.Δ.ΔΠΙ.Θ.Δ. Αζήλα 20.11.

ΚΔΝΑΚ θαη ιέβεηεο. Ζκεξίδα 20/11/2010. Σσηήξεο Καηζηκίραο Γξ. Μεραλνιόγνο Μεραληθόο. Γεληθόο Γξακκαηέαο β ΔΝ.Δ.ΔΠΙ.Θ.Δ. Αζήλα 20.11. Ζκεξίδα 2/11/21 ΚΔΝΑΚ θαη ιέβεηεο Σσηήξεο Καηζηκίραο Γξ. Μεραλνιόγνο Μεραληθόο Γεληθόο Γξακκαηέαο β ΔΝ.Δ.ΔΠΙ.Θ.Δ. Αζήλα 2.11.21 Πεγέο ελέξγεηαο Σπλ. Πξσηνγελήο Δλέξγεηα = Σ Καηαλ. Δλέξγεηα θαπζίκνπ x Σπλη.

Διαβάστε περισσότερα

ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ

ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ ύζηεκα Ωξνκέηξεζεο Πξνζσπηθνύ (Έθδνζε 2) ΤΠΗΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΩΝ ΤΣΗΜΑΣΩΝ Πεξηερόκελα Σερληθά Υαξαθηεξηζηηθά Καηαγξαθή Ώξαο πγρξνληζκόο πζηήκαηνο Παξνπζίαζε πζηήκαηνο Πηζαλά ελάξηα Υξήζεο 2 Σερληθά Υαξαθηεξηζηηθά

Διαβάστε περισσότερα

ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ

ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ Α. Αεπόβια ικανόηηηα: ΑΣΚΗΣΔΙΣ ΦΥΣΙΚΗΣ ΚΑΤΑΣΤΑΣΗΣ ΣΤΟ ΓΗΠΔΓΟ 1. Φόλλοος ζηα δύο καλάθια: νη αζιεηέο είλαη απέλαληη από ηα ηακπιώ ζε δπν γξακκέο. Οη πξώηνη έρνπλ από κηα κπάια. Με ην ζύλζεκα θάλνπλ θόιιννπ

Διαβάστε περισσότερα

ΛΤΚΘΟ Ή GOJI ΣΟ ΦΤΣΟ ΣΗ ΜΑΚΡΟΖΩΘΑ

ΛΤΚΘΟ Ή GOJI ΣΟ ΦΤΣΟ ΣΗ ΜΑΚΡΟΖΩΘΑ ΛΤΚΘΟ Ή GOJI ΣΟ ΦΤΣΟ ΣΗ ΜΑΚΡΟΖΩΘΑ Η νλνκαζία ηνπ γέλνπο πξνέξρεηαη απφ ηε αξραία πεξηνρή ηεο Ννηηναλαηνιηθήο Λπθίαο. ηα Διιεληθά ιέγεηαη Λχθην,ζηα Αγγιηθά Wolfberry,ζηα Κηλέδηθα Goji θαη ζηα Ιαπσληθά Κuko.

Διαβάστε περισσότερα

Μεηαπηπρηαθή δηαηξηβή

Μεηαπηπρηαθή δηαηξηβή ΣΔΥΝΟΛΟΓΗΚΟ ΠΑΝΔΠΗΣΖΜΗΟ ΚΤΠΡΟΤ ΥΟΛΖ ΚΑΛΧΝ ΚΑΗ ΔΦΑΡΜΟΜΔΝΧΝ ΣΔΥΝΧΝ Μεηαπηπρηαθή δηαηξηβή ΣΑ TABLETS Χ ΔΚΠΑΗΓΔΤΣΗΚΟ ΔΡΓΑΛΔΗΟ ΣΟ ΝΖΠΗΑΓΧΓΔΗΟ ΓΗΑ ΣΖΝ ΔΝΗΥΤΖ ΤΝΔΡΓΑΣΗΚΧΝ ΓΡΑΣΖΡΗΟΣΖΣΧΝ ΜΑΘΖΜΑΣΗΚΧΝ Έιελα Κσλζηαληίλνπ

Διαβάστε περισσότερα

ΠΑΡΑΣΗΡΗΗ ΓΙΑ ΣΗ ΓΙΑΠΙΣΩΗ ΣΗ ΠΑΡΟΤΙΑ Η ΜΗ ΣΟΤ ΠΑΘΟΓΟΝΟΤ ΒΑΚΣΗΡΙΟΤ PSEUDOMONAS SYRINGAE PV. ΑCTINIDIAE

ΠΑΡΑΣΗΡΗΗ ΓΙΑ ΣΗ ΓΙΑΠΙΣΩΗ ΣΗ ΠΑΡΟΤΙΑ Η ΜΗ ΣΟΤ ΠΑΘΟΓΟΝΟΤ ΒΑΚΣΗΡΙΟΤ PSEUDOMONAS SYRINGAE PV. ΑCTINIDIAE ΔΛΛΗΝΙΚΗ ΓΗΜΟΚΡΑΣΙΑ ΠΔΡΙΦΔΡΔΙΑ ΗΠΔΙΡΟΤ ΠΔΡΙΦΔΡΔΙΑΚΗ ΔΝΟΣΗΣΑ ΑΡΣΑ Γ/ΝΗ ΑΓΡ. ΟΙΚΟΝΟΜΙΑ & ΚΣΗΝΙΑΣΡΙΚΗ ΣΜΗΜΑ:. ΠΟΙΟΣΙΚΟΤ & ΦΤΣΟΤΓΔΙΟΝΟΜΙΚΟΤ ΔΛΔΓΥΟΤ ΜΔΘΟΓΟΛΟΓΙΑ ΔΠΙΚΟΠΗΗ- ΠΑΡΑΣΗΡΗΗ ΓΙΑ ΣΗ ΓΙΑΠΙΣΩΗ ΣΗ ΠΑΡΟΤΙΑ

Διαβάστε περισσότερα

Οινθιεξωκέλεο ιύζεηο γηα ηελ γαιαθηνβηνκεραλία

Οινθιεξωκέλεο ιύζεηο γηα ηελ γαιαθηνβηνκεραλία ΧΗΜΙΚΑ ΠΡΟΪΟΝΤΑ Α.Ε Οινθιεξωκέλεο ιύζεηο γηα ηελ γαιαθηνβηνκεραλία Πνηνί είκαζηε Η ΜΙΝΔΡΑΛ ΥΗΜΙΚΑ ΠΡΟΪΟΝΣΑ Α.Δ. μεθίλεζε ηελ πνξεία ηεο ην 1976. Από ηελ αξρή ζπλεξγαζηήθακε κε πξωηνπόξνπο εηαηξείεο ζηνλ

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΗΜΙΟ ΜΑΚΕΔΟΝΙΑ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΣΜΗΜΑ ΕΦΑΡΜΟΜΕΝΗ ΠΛΗΡΟΦΟΡΙΚΗ ΣΕΥΝΗΣΗ ΝΟΗΜΟΤΝΗ

ΠΑΝΕΠΙΣΗΜΙΟ ΜΑΚΕΔΟΝΙΑ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΣΜΗΜΑ ΕΦΑΡΜΟΜΕΝΗ ΠΛΗΡΟΦΟΡΙΚΗ ΣΕΥΝΗΣΗ ΝΟΗΜΟΤΝΗ ΘΕΜ 1 ο (2.5 κνλάδεο) ΠΝΕΠΙΣΗΜΙΟ ΜΚΕΔΟΝΙ ΟΙΚΟΝΟΜΙΚΩΝ ΚΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΣΜΗΜ ΕΦΡΜΟΜΕΝΗ ΠΛΗΡΟΦΟΡΙΚΗ ΣΕΥΝΗΣΗ ΝΟΗΜΟΤΝΗ Σελικέρ εξετάσειρ Σετάπτη 21 Ιανοςαπίος 2009 13:00-16:00 Έζησ ν θόζκνο ηεο ειεθηξηθήο

Διαβάστε περισσότερα