PFGE. Method 61 strains of L. monocytogenes and 2 strains of presumptive L. monocytogenes

Μέγεθος: px

Εμφάνιση ξεκινά από τη σελίδα:

Download "PFGE. Method 61 strains of L. monocytogenes and 2 strains of presumptive L. monocytogenes"

Ζοροβάβελ Κοτζιάς
7 χρόνια πριν
Προβολές:

1 PFGE 21 PFGE (, ) :hly plca plcb prfa (PFGE) hly plcaplcb prfa 4, (PCR) 61 2,PulseNet 7 PFGE 61 hly + plca + plcb + prfa +,2 hly - plca + plcb - prfa - hly - plca - plcb - prfa - 7 PFGE 5 hly plca plcb prfa, 2,, 7 2 PFGE,, PFGE :, ; ; ;,, Virulence2Associated Genes and Molecular Sub2Typing of Listeria monocytogenes in Foods CHEN Wei2wei, HONGJin2chun, ZHANG Qiao2ji, YANG Yu2huan, MA Qun2fei ( Fujian Provincial Center for Disease Prevention and Control, Fujian Fuzhou , China) Abstract : Objective To understand the virulence2associated genes and the molecular sub2typing of the Listeria monocytogenes isolated from foods in Fujian Province. Method 61 strains of L. monocytogenes and 2 strains of presumptive L. monocytogenes isolated from raw meats were subjected to PCR assay for four virulence2associated genes, hly, plca, plcb and prfa. 7 of the 61 strains of L. monocytogenes were genotyped by PulseNet pulsed2field gel electrophoresis ( PFGE). Results The PCR assay revealed that the 61 strains of L. monocytogenes possessed all the four virulence2associated genes, hly, plca, plcb and plca the 2 strains of presumptive L. monocytogenes were hly -, plca +, plcb -, prfa - and hly -, plca -, plcb -, prfa - by PCR. PFGE divided 7 strains of L. monocytogenes into 5 different genotypes. Conclusion The 61 strains of L. monocytogenes possessed all the four virulence2associated genes, indicating their pothogenicity. The 2 strains of presumptive L. monocytogenes were confirmed as L. innocua by further study. The virulence genes2targeted PCR holds a good promise as a rapid and reliable method for further identification of L. monocytogenes. 2 pairs of the 7 strains of L. monocytogenes genotyped by PFGE have been identified having same pulsotype and have been found previously in chicken products from the same factory. Despite different in time and place, this finding indicates that the PFGE method can be used for further investigation of the source and route of transmission of L. monocytogenes in the frozen chicken produced by that factory. Key word : Listeria monocytogenes ; Virulence ; Genes ; Electrophoresis, Gel, Pulsed2Field ( Listeria monocytogenes, ),,,, 20 %30 % [1 ],1997 :(2002Y018) ; (2002) : 816 % [2 ] [3,4 ], % [5 ],, PCR PFGE

2 22 CHINESE JOURNAL OF FOOD HYGIENE PFGE ( CMCC 54004) ;PFGE 1 (5-3 ) Hly hly F GTTAATGAACCTACAAGHCC TTCC Hly R AACCGTTCTCCACCATTCCCA plca plca F AAGTTGAGTACGAAYTGCTCT ACTTTGTTG plca R AACACAAACGATGTCATTGTAC CAACAACTAG plcb plcb F GATAACCCGACAAATACTGA CGTAAATAC plcb R TCATCTGAGCAAAATCTTTT TGCTACCATGTC ( ) (bp) prfa PrfA F CCCAAGTAGCAGGACATGC PrfA R ATCACAAAGCTCACGAG DNA BHI,37 24 h,1 ml, min, min, PCR : DNA 1 l 5molΠL 2 l 2 mmolπl dntp 1 l 5 UΠ l Taq 014 l 25 mmolπl MgCl l 10 H , GBΠT Tap DNA ( ), dntp( Promega ), ( TakaRa ), Tris buffer 210 l 1014 l,20 l PCR 94, 10 min ; 94,1 min ; 20 s ( 1) ; 72,20 s ;30 ;72,8 min PCR PCR 2000 bp Marker, 5 l, 20 min,, baseedtaboric Acid ( BBI ), N2Lauroyl2 113 PFGE Sarcosine Sodium salt (Sarcosy1) (Sigma ), K( Merck ), Xba ( TakaRa ), AscI CSB (A 410),400 l 115 ml eppendorf,37 (NEB ), SeaKem Gold Agarose ( ) 5 min, 20 l K(20 mgπml), API Listeria ( ),(), ( ) PTC ( MJ ),5415D ( Eppendorf ),BIO - RAD300 CHEF Mapper XA ( ) ( ),PL5243 ( PALL ), (), Grant 112 PCR 400 l 1 % Seakem Gold : 1 % SDS, ml KΠCLB,54 2 h, 130 rπmin 15 ml TE Buffer 3, min, 10 ml TE, DNA 200 l H, min, H, 200 l ( hly plca H9812 Xba Asc plcb [6 ] prfa [7 ] 4,, 1 ),37 2 h ( s,18 h, ma) [13 ] PCR hly + plca + plcb + prfa + hly - hly - plca - plcb - prfa -,2 plca + plcb - prfa - 3 (CMCC 54004) PCR , API Listeria, 2,,

3 PFGE 23 M:DL2000 marker,1 3 5 : ( hly plca plcb), : ( hly plca plcb) 1 (CMCC 54004) F32 hly plca plcb PCR M:DL2000 Marker,1 : (54004),2 :,38 2 hly PCR M:DL2000 marker,1 :, 2 : (54004),38 5 prfa PCR PFGE, 5 ( 6), 2, 2 4,,,3 5, 2 7 () M:DL2000 Marker,1 : (54004),2 :,38 3 plca PCR 6 7 PFGE (M H9812) M:DL2000 Marker,1 : (54004),2 :,38 4 plcb PCR,30 API Listeria DIM, 7510,30 DIM API Listeria ,500,,, %, ,,

4 24 CHINESE JOURNAL OF FOOD HYGIENE (Listeriolysin O,LLO) ( Phospholipases) ( Internalins) (ActA) (PrfA) P60 (iap) LLO, hly 1944, Harvey, [8 ],LLO, LLO, LLO,,, LLO LLO,, C :PI - PLC PC - PLCplcA (phosphatidylinositol) C( PI - PLC) plcb C( PC - PLC) PI - PLC,,PC - PLC PC - PLC,,,, prfa PrfA,, prfa [712 ], 61 hly plca plcb prfa, 2 hly plcb prfa,1 plca,,,,,, SN ,, 2,,,, API Listeria, PFGE,,,, O157 H7, O 157 PulseNet [13 ] PFGE, 7 5,, , PFGE [1 ],. [J ].,1999,5 (3) :9. [2 ],,,. [J ].,2000,21 (3) : 236. [3 ],. 2 [J ] ,21 (1) :75. [4 ],,,. 3 [J ] ,8 (12) :2038. [5 ],,, [J ]. 2005,17 (2) :112. [6 ] DMITRIY VOLOKHOV. Identification of Listeria Species by Microarray2Based Assay[J ]. Journal of Clinical Microbiology,2002,40 (12) : [7 ] KARVEN J, COORAY, TAKEAKI NISHIBORI, et al. Detection of multiple virulence associated genes of Listeria monocytogenes by PCR in artificially contaminated milk samples[j ]. Applied and environmental microbiology,1994,8 : [8 ] AMY L, DECATUR, DANIEL A, et al. A PEST2Like Sequence in listeriolysin O essential for Listeria monocytogenes pathogenicity [J ]. Science, 2000,290 :

5 PFGE 25 PFGE (, ) :PFGE, 6, DNA,Xba DNA,Bio2rad CHEP MAPPER PFGE,Quantity One TM ( ) PFGE Quantity One TM, :;,,;,; Study on fingerprint of Six strains of Salmonella Using PFGE WANG Ying, GU Qi2fang, LIU Cheng, ZHOU Pei2jun, ZHANG Mei2ying (Shanghai Municipal Center for Disease Prevention and Control, Shanghai , china) Abstract : Objective To draw the fingerprint of Salmonella of different serotypes by PFGE, for researching their source. Method Six different serotypes of Salmonella were made into plugs first. Then pure DNA was obtained with proteinase K and cut DNA using restriction enzyme Xba. Fingerprint was produced using Chef Mapper (Bio2Rad). Finally, the source of these strains were analyzed using the software2quantity One TM. and percentage. Results The source of all strains were expressed in similarity coefficient Conclusion PFGE is a very useful method to analyze the source of bacteria causing foodborne diseases. Key word : Salmonella ; Electrophoresis, Gel, Pulsed2Field ; Genes, Homeobox ; Bacteriological Techniques,, [1 ],, 6 PFGE O 1,4,5 : H i,2 (A) O 8 : H e,h ;5 (B) [9 ] RUDNICKA W. The host reponse to Listeria monocytogenes mutants defensive in genes encoding phospholipasesc (plca,plcb) and actin assembly(act) [J ]. Microbiol, Immunol,1997 :41 (11) : [10 ] ZENEWICZ L A, SKINNER J A, GOLDFINE H, et al. Listeria monocytogenes virulence proteins induce surface expression of Fas ligand on T lymphocytes[j ]. Mol Microbiol,2004,51(5) : [11 ] JAVIER A,CARRERO,BORIS C,et al. Listeriolysin O from Listeria monocytogenes is a lymphocyte apoptogenic molecule[j ]. The Journal O 1,9 :H g,m (C) O 7 : H k,5 ( E) O 1,4 :H f,g,s (F) O 10 :H l,v;6 (H) ( ),CSB ( EDTA,Tris - HCL) CLB ( EDTA,Tris - HCL, ) Sigma, TE Buffer (10 ml 1 mol Tris - HCl ph 716, 2 ml 015 mol EDTA ph ml) (Sigma ),K( ), of immunology,2004,172 : [12 ] SHAYNOOR D, PASCALE C. Listeriolysin O : a genuine cytolysin optimized for an intracellular parasite[j ]. The Journal of Cell Biology, 2002,156 (6) : [13 ] PULSENET USA CDC. Section 5. 3 Standardized protocol for molecular subtyping of Listeria monocytogenes by pulsed2field gel electropthoresis(pfge) [ Z] [ : ] :R15 ;Q ;R :A : (2007) :

Σχετικά έγγραφα

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S

( HN2y Co14 Co8 Co36 Sx (2) 56 (2) ) 16S 16S23S rrna 197 16S23S rrna (, 100050) : 16S23S rrna,, 2, 16S23S rrna,3 3 (ATCC10248 NCPPB 947 NCPPB3580) 1 B. phenazinium (LMG2247) 8 ( HN2y Co14 Co8 Co36 Sx8801 90-3 56 (2) 56 (2) ) 16S 23S rrna,( GenBank)