Aναδίπλωση και επεξεργασία των πρωτεϊνών

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Aναδίπλωση και επεξεργασία των πρωτεϊνών"

Transcript

1 Aναδίπλωση και επεξεργασία των πρωτεϊνών

2 Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση Aλληλουχία αμινοξέων πολυπεπτιδικής αλυσίδας

3 Aναδίπλωση και επεξεργασία των πρωτεϊνών Σύνθεση πολυπεπτιδικής αλυσίδας Δεν σημαίνει οπωσδήποτε και παραγωγή λειτουργικής πρωτεΐνης Απαιτείται: συγκεκριμένη στερεοδιαμόρφωση ώστε τα πολυπεπτίδια να γίνουν λειτουργικά (αναδίπλωση) σχηματισμός συμπλόκου σε περίπτωση που το τελικό προϊόν αποτελείται από πολλά πολυπεπτίδια

4 Aναδίπλωση και επεξεργασία των πρωτεϊνών Η λειτουργία των πρωτεϊνών είναι συνάρτηση της διαμόρφωσής τους στο χώρο, της αναδίπλωσής τους, η οποία προκύπτει από... Activation Domains Η επιφάνεια μιας περιοχής του pkid AD του CREB Η επιφάνεια μιας περιοχής του KIX του CBP

5 Aναδίπλωση και επεξεργασία των πρωτεϊνών Πολλές πρωτεΐνες για να γίνουν ενεργές Πρέπει να υποστούν περαιτέρω τροποποιήσεις - αποκοπή τμήματός τους - ομοιοπολική πρόσδεση υδατανθράκων και λιπιδίων που παίζουν κρίσιμο ρόλο στη λειτουργία τους και στον σωστό εντοπισμό τους στο εσωτερικό του κυττάρου.

6 Aναδίπλωση και επεξεργασία των πρωτεϊνών Στο εσωτερικό των κυττάρων η ορθή αναδίπλωση των πρωτεϊνών χρειάζεται τη βοήθεια άλλων πρωτεϊνών. Μοριακοί συνοδοί (molecular chaperones) Λειτουργούν ως καταλύτες Διευκολύνουν την αναδίπλωση άλλων πρωτεϊνών τη συναρμολόγηση μακρομοριακών συμπλόκων

7 Aναδίπλωση και επεξεργασία των πρωτεϊνών Στο εσωτερικό των κυττάρων η ορθή αναδίπλωση των πρωτεϊνών χρειάζεται τη βοήθεια άλλων πρωτεϊνών. Μοριακοί συνοδοί (molecular chaperones) Λειτουργούν ως καταλύτες Διευκολύνουν την αναδίπλωση άλλων πρωτεϊνών τη συναρμολόγηση μακρομοριακών συμπλόκων

8 Aναδίπλωση και επεξεργασία των πρωτεϊνών Οι μοριακοί συνοδοί απλά υποβοηθούν μια αυθόρμητη διαδικασία. Όλη η πληροφορία για την ορθή αναδίπλωση μιας πολυπεπτιδικής αλυσίδας στο χώρο εμπεριέχεται στην αλληλουχία των αμινοξέων της. Προσδένονται είτε σε μη αναδιπλωμένες αλυσίδες είτε σε μερικά αναδιπλωμένες αλυσίδες οι οποίες αποτελούν ενδιάμεσα μιας πορείας που οδηγεί στην τελική αναδίπλωση (την ώριμη μορφή)

9 Aναδίπλωση και επεξεργασία των πρωτεϊνών Λανθασμένη αναδίπλωση Οι μη αναδιπλωμένες ή μερικά αναδιπλωμένες πολυπεπτιδικές αλυσίδες μέσα στο κύτταρο θα αναδιπλωνόταν λανθασμένα ή θα σχημάτιζαν αδιάλυτα συσσωματώματα

10 Aναδίπλωση και επεξεργασία των πρωτεϊνών Λανθασμένη αναδίπλωση Σοβαρές συνέπειες για το κύτταρο Νευροεκφυλιστικά νοσήματα (Alzheimer s, Parkinson) Π.χ. ινώδη αδιάλυτα συσσωματώματα (αμυλοειδή ινίδια) που συσσωρεύονται στον εξωκυττάριο χώρο ή στο εσωτερικό του κυττάρου

11 Μοριακοί συνοδοί ( molecular chaperones) Παράδειγμα 1: οι υπό σύνθεση πολυπεπτιδικές αλυσίδες οι οποίες είναι ακόμα συνδεδεμένες με το ριβόσωμα. Στην περίπτωση αυτή, οι μοριακοί συνοδοί αποτρέπουν τη λανθασμένη αναδίπλωση ή τον σχηματισμό αδιάλυτων συσσωματωμάτων του Ν-τελικού τμήματος της πολυπεπτιδικής αλυσίδας πριν ολοκληρωθεί η σύνθεσή της.

12 Μοριακοί συνοδοί ( molecular chaperones) Παράδειγμα 1: οι υπό σύνθεση πολυπεπτιδικές αλυσίδες οι οποίες είναι ακόμα συνδεδεμένες με το ριβόσωμα. Στην περίπτωση αυτή, οι μοριακοί συνοδοί αποτρέπουν τη λανθασμένη αναδίπλωση ή τον σχηματισμό αδιάλυτων συσσωματωμάτων του Ν-τελικού τμήματος της πολυπεπτιδικής αλυσίδας πριν ολοκληρωθεί η σύνθεσή της.

13 Μοριακοί συνοδοί ( molecular chaperones) Παράδειγμα 1: οι υπό σύνθεση πολυπεπτιδικές αλυσίδες οι οποίες είναι ακόμα συνδεδεμένες με το ριβόσωμα. Οι πρωτεΐνες αναδιπλώνονται σε επικράτειες ( aa) και πρέπει να παρεμποδιστεί η ανώμαλη αναδίπλωση των νεοσυντιθέμενων πολυπεπτιδίων (ή η μετατροπή τους σε αδιάλυτα συσσωματώματα με άλλες πρωτεΐνες) μέχρι να ολοκληρωθεί η σύνθεση της κάθε επικράτειας => η σωστή αναδίπλωση στο χώρο.

14 Μοριακοί συνοδοί ( molecular chaperones) Παράδειγμα 2: τα μη αναδιπλωμένα πολυπεπτίδια κατά τη διάρκεια της μεταφοράς τους στα κυτταρικά οργανίδια Ένα μερικώς αναδιπλωμένο πολυπεπτίδιο μεταφέρεται από το κυτταρόπλασμα στο μιτοχόνδριο. Α. Μοριακοί συνοδοί του κυτταροπλάσματος το σταθεροποιούν στη μη αναδιπλωμένη μορφή του. Β. Άλλοι μοριακοί συνοδοί στο εσωτερικό του μιτοχονδρίου διευκολύνουν τη διαδικασία της μεταφοράς και υποβοηθούν την επακόλουθη αναδίπλωση της πολυπεπτιδικής αλυσίδας στο εσωτερικό του μιτοχονδρίου.

15 Μοριακοί συνοδοί ( molecular chaperones) Παράδειγμα 3: η συναρμολόγηση πρωτεϊνών που αποτελούνται από πολλά πολυπεπτίδια ή η συναρμολόγηση μεγαλομοριακών συμπλόκων Trends in Biochemical Sciences, Volume 35, Issue 9, 2010, Προοδευτική συναρμολόγηση των νουκλεοσωμάτων από μοριακούς συνοδούς ιστονών (histone chaperones).

16 Μοριακοί συνοδοί ( molecular chaperones) Πολλά από αυτά τα μόρια ταυτοποιήθηκαν αρχικά ως πρωτεΐνες οι οποίες συντίθενται όταν τα κύτταρα εκτίθενται σε υψηλές θερμοκρασίες, και για το λόγο αυτό ονομάστηκαν Heat Shock Proteins (θερμο-επαγώμενες πρωτεΐνες) HSPs. Οι HSPs σταθεροποιούσαν άλλες πρωτεΐνες και διευκόλυναν την επαναδίπλωσή τους μετά τη μερική αποδιάταξη που πάθαιναν ως αποτέλεσμα της έκθεσής τους σε υψηλές θερμοκρασίες. Τόσο στα προκαρυωτικά όσο και στα ευκαρυωτικά κύτταρα διακρίνουμε δύο βασικές οικογένειες, την Hsp70 και την chaperonin.

17 Μοριακοί συνοδοί ( molecular chaperones) Τέτοιες πρωτεΐνες συναντώνται στο κυτταρόπλασμα και σε διάφορα οργανίδια, όπως το ER, τα μιτοχόνδρια και οι χλωροπολάστες. Τα μέλη της οικογένειας hsp70 είναι εκείνα που σταθεροποιούν τις νεοσυντιθέμενες πολυπεπτιδικές αλυσίδες κατά τη διάρκεια της μετάφρασης ή της μεταφοράς στα οργανίδια.

18 Μοριακοί συνοδοί ( molecular chaperones) Τέτοιες πρωτεΐνες συναντώνται στο κυτταρόπλασμα και σε διάφορα οργανίδια, όπως το ER, τα μιτοχόνδρια και οι χλωροπολάστες. Προσδένονται σε ένα μικρό τμήμα, μήκους ~7 aa των μη αναδιπλωμένων πολυπεπτιδίων και τα διατηρούν σε μη αναδιπλωμένη μορφή, εμποδίζοντας τον σχηματισμό συσσωματωμάτων.

19 Μοριακοί συνοδοί ( molecular chaperones) Τα διαδοχικά βήματα της δράσης των μοριακών συνοδών Μοριακοί συνοδοί της οικογένειας Hsp70 προσδένονται στην υπό σύνθεση πολυπεπτιδική αλυσίδα και τη σταθεροποιούν κατά τη διάρκεια της μετάφρασης. Κατόπιν, το μη αναδιπλωμένο πολυπεπτίδιο μεταφέρεται σε μέλη της οικογένειας chaperonin που σχηματίζουν μια δομή, στο εσωτερικό της οποίας λαμβάνει χώρα η αναδίπλωση της πολυπεπτιδικής αλυσίδας (και παράλληλα παρεμποδίζεται η αλληλεπίδρασή τους με άλλα πολυπεπτίδια και ο σχηματισμός συσσωματωμάτων).

20 Μοριακοί συνοδοί ( molecular chaperones) Τα διαδοχικά βήματα της δράσης των μοριακών συνοδών Μοριακοί συνοδοί της οικογένειας Hsp70 προσδένονται στην υπό σύνθεση πολυπεπτιδική αλυσίδα και τη σταθεροποιούν κατά τη διάρκεια της μετάφρασης. Τόσο για την απελευθέρωση της μη αναδιπλωμένης πολυπεπτιδικής αλυσίδας από τα μέλη της οικογένειας της Hsp70 όσο και για την αναδίπλωσή της στο εσωτερικό των σαπερονινών απαιτείται η υδρόλυση ATP.

21 Μοριακοί συνοδοί ( molecular chaperones) Στα ευκαρυωτικά κύτταρα ένα εναλλακτικό μονοπάτι που ακολουθούν ορισμένες πρωτεΐνες περιλαμβάνει τη διαδοχική δράση μελών της Hsp70 και της Hsp90. Τα υποστρώματα της Hsp90 είναι πρωτεΐνες που συμμετέχουν στη σηματοδότηση, όπως οι υποδοχείς των στεροειδών ορμονών και μια σειρά πρωτεϊνικών κινασών.

22 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Εκτός των μοριακών συνοδών τα κύτταρα διαθέτουν και δύο επιπλέον τύπους ενζύμων που καταλύουν την αναδίπλωση πρωτεϊνών. Ισομεράση πρωτεϊνικών δισουλφιδικών δεσμών (PDI, Protein disulfide Isomerase) Ισομεράση της πεπτιδυλοπρολίνης (PPI, peptidyl prolyl isomerase)

23 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Εκτός των μοριακών συνοδών τα κύτταρα διαθέτουν και δύο επιπλέον τύπους ενζύμων που καταλύουν την αναδίπλωση πρωτεϊνών. Ισομεράση πρωτεϊνικών δισουλφιδικών δεσμών (PDI, Protein disulfide Isomerase) Ισομεράση της πεπτιδυλοπρολίνης (PPI, peptidyl prolyl isomerase)

24 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης πρωτεϊνικών δισουλφιδικών δεσμών Η ισομεράση PDI αλληλεπιδρά με το υπόστρωμά της μέσω δύο καταλοίπων κυστεΐνης του ενεργού της κέντρου και καταλύει τον σχηματισμό δισουλφιδικών δεσμών.

25 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Σχηματισμός δισουλφιδικών δεσμών μεταξύ καταλοίπων κυστείνης είναι πολύ σημαντικός για τη σταθεροποίηση της αναδιπλωμένης μορφής πολλών πρωτεϊνών

26 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης πρωτεϊνικών δισουλφιδικών δεσμών Τέτοιοι δεσμοί περιορίζονται στις εκκρινόμενες και ορισμένες μεμβρανικές πρωτεΐνες γιατί το κυτταρόπλασμα περιέχει αναγωγικούς παράγοντες που διατηρούν τα κατάλοιπα κυστεΐνης στην ανηγμένη (- SH) μορφή τους και κατά συνέπεια παρεμποδίζει τη διατήρηση S-S δεσμών.

27 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης πρωτεϊνικών δισουλφιδικών δεσμών Οι δισουλφιδικοί δεσμοί σχηματίζονται στο οξειδωτικό περιβάλλον του ER. Η PDI καταλύει την αναδίπλωση των πρωτεϊνών στο ER και υπάρχει σε πολύ μεγάλη αφθονία εκεί.

28 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Εκτός των μοριακών συνοδών τα κύτταρα διαθέτουν και δύο επιπλέον τύπους ενζύμων που καταλύουν την αναδίπλωση πρωτεϊνών. Ισομεράση πρωτεϊνικών δισουλφιδικών δεσμών (PDI, Protein disulfide Isomerase) Ισομεράση της πεπτιδυλοπρολίνης (PPI, peptidyl prolyl isomerase)

29 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης της πεπτιδυλοπρολίνης Μια ιδιαιτερότητα της προλίνης είναι ότι η ισορροπία μεταξύ της cis και trans διαμόρφωσης των πεπτιδικών δεσμών που προηγούνται των καταλοίπων Pro είναι ελαφρά μόνο μετατοπισμένη προς την trans μορφή, σε αντίθεση, με τους άλλους πεπτιδικούς δεσμούς οι οποίοι είναι σχεδόν πάντα στην trans μορφή.

30 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης της πεπτιδυλοπρολίνης Η ισομεράση PPI καταλύει τον ισομερισμό ανάμεσα στη cis και την trans διαμόρφωση των πεπτιδικών δεσμών που προηγούνται των καταλοίπων προλίνης.

31 Ένζυμα που καταλύουν την αναδίπλωση των πρωτεϊνών Η δράση της ισομεράσης της πεπτιδυλοπρολίνης Το ένζυμο αυτό συναντάται τόσο στα προκαρυωτικά όσο και στα ευκαρυωτικά κύτταρα και παίζει σημαντικό ρόλο στην αναδίπλωση ορισμένων σηματοδοτικών πρωτεϊνών.

32 Πρωτεόλυση Πρωτεόλυση (proteolysis) είναι η κοπή της πολυπεπτιδικής αλυσίδας, και αποτελεί σημαντικό βήμα στην πορεία ωρίμανσης πολλών πρωτεϊνών. Τέτοιες τροποποιήσεις του Ν-τελικού άκρου παίζουν σημαντικό ρόλο στη μεταφορά πρωτεϊνών μέσω μεμβρανών π.χ. όταν πρόκειται να εκκριθούν από το κύτταρο ή να μεταφερθούν σε κάποια οργανίδια (λυσοσώματα, μιτοχόνδρια). Μεταφέρονται στον τόπο προορισμού τους μέσω των Ν-τελικών αλληλουχιών που στη συνέχεια απομακρύνονται πρωτεολυτικά.

33 Πρωτεόλυση Μόλις οι SS προβάλλουν από το ριβόσωμα, εισέρχονται σε ειδικούς διαύλους της μεμβράνης που πρόκειται να διασχίσουν. Το υπόλοιπο πολυπεπτίδιο τις ακολουθεί ενώ ακόμη συντίθεται, και με τον τρόπο αυτό διασχίζει τη μεμβράνη. Ο ρόλος της αλληλουχίας σήματος στη μεταφορά πρωτεϊνών μέσω μεμβρανών Οι πρωτεΐνες που πρόκειται να μεταφερθούν μέσω της κυτταροπλασματικής μεμβράνης των βακτηρίων ή στο ER των ευκαρυωτικών κυττάρων στοχοποιούνται χάρη σε κατάλληλες Ν-τελικές, αλληλουχίες σήματος (signal sequences), οι οποίες αποτελούνται συνήθως από ~20 υδρόφοβα αμινοξέα.

34 Πρωτεόλυση Ο ρόλος της αλληλουχίας σήματος στη μεταφορά πρωτεϊνών μέσω μεμβρανών Η αλληλουχία σήματος, αφού διεκπεραιώσει τον ρόλο της, αποκόπτεται χάρη στη δράση της πεπτιδάσης σήματος (signal peptidase) ώστε να απελευθερωθεί η ώριμη πρωτεΐνη.

35 Πρωτεόλυση Ορισμένες φορές η πρωτεολυτική επεξεργασία που οδηγεί στην αποκοπή ενός τμήματος κάποιου προδρόμου πολυπεπτιδίου είναι απαραίτητη για το σχηματισμό ενεργών ενζύμων ή ορμονών. * Π.χ. η ινσουλίνη συντίθεται στη μορφή ενός μεγαλύτερου πολυπεπτιδίου και η ενεργή μορφή σχηματίζεται μετά από δύο πρωτεολυτικές τομές.

36 Πρωτεόλυση Η πρωτεολυτική επεξεργασία της ινσουλίνης Το μόριο της ώριμης ινσουλίνης αποτελείται από δύο πολυπεπτιδικές αλυσίδες (την Α και τη Β) οι οποίες συνδέονται με δισουλφιδικούς δεσμούς.

37 Πρωτεόλυση Η πρωτεολυτική επεξεργασία της ινσουλίνης Αρχικά, συντίθεται ένα πρόδρομο πολυπεπτίδιο, που ονομάζεται προπροϊνσουλίνη. Το πολυπεπτίδιο αυτό φέρει μια αμινοτελική αλληλουχία σήματος, η οποία αποκόπτεται κατά τη διάρκεια της μεταφοράς του στο ενδοπλασματικό δίκτυο.

38 Πρωτεόλυση Η πρωτεολυτική επεξεργασία της ινσουλίνης Μετά την αποκοπή σχηματίζεται ένα δεύτερο πρόδρομο μόριο, που ονομάζεται προϊνσουλίνη. Η προϊνσουλίνη μετατρέπεται σε ινσουλίνη με περαιτέρω πρωτεόλυση, η οποία οδηγεί στην απομάκρυνση ενός εσωτερικού τμήματός της.

39 Πρωτεόλυση Και άλλες πρωτεΐνες, όπως πεπτικά ένζυμα, παράγοντες που συμμετέχουν στην πήξη του αίματος πρωτεάσες που συμμετέχουν στον προγραμματισμένο κυτταρικό θάνατο ενεργοποιούνται μετά από διαδικασίες πρωτεόλυσης. Οι πρωτεΐνες πολλών ιών σχηματίζονται από την πρωτεολυτική κοπή μεγαλύτερων πρόδρομων μορίων.

40 Πρωτεόλυση Κατά την αντιγραφή του HIV μια πρωτεάση που κωδικοποιείται από τον ιό κόβει ορισμένα πρόδρομα ιικά πολυπεπτίδια προκειμένου να σχηματιστούν οι δομικές πρωτείνες του HIV. H πρωτεάση αυτή αποτελεί (μαζί με τη μεταγραφάση) στόχο για την ανάπτυξη φαρμάκων (καταστολείς πρωτεασών). Ρόλος πρωτεόλυσης στον πολλαπλασιασμό των ιών

41 Γλυκοζυλίωση (glucosylation) Πολλές ευκαρυωτικές πρωτεΐνες, κυρίως εκκρινόμενες, αλλά και της κυτταροπλασματικής μεμβράνης, του πυρήνα και του κυτταροπλάσματος, τροποποιούνται στο ER και τη συσκευή Golgi μέσω της προσθήκης υδατανθράκων (...γλυκοπρωτείνες). Οι υδατάνθρακες των γλυκοπρωτεϊνών παίζουν σημαντικό ρόλο στην αναδίπλωση τους στο ER, καθώς και στη στοχοποίησή τους για μεταφορά στο κατάλληλο κυτταρικό διαμέρισμα στις γλυκοπρωτεΐνες της κυτταρικής επιφάνειας οι υδατάνθρακες λειτουργούν ως θέσης αλληλεπίδρασης μεταξύ γειτονικών κυττάρων

42 Γλυκοζυλίωση (glucosylation) Η γλυκοζυλίωση μπορει να είναι - Ν-συνδεόμενη (N-linked) οι υδατανθρακικές αλυσίδες συνδέονται σε κατάλοιπα ασπαραγίνης είτε - Ο-συνδεόμενη (O-linked) οι υδατανθρακικές αλυσίδες συνδέονται είτε σε κατάλοιπα σερίνης είτε σε κατάλοιπα θρεονίνης.

43 Γλυκοζυλίωση (glucosylation) Η πρόσδεση υδατανθρακικών αλυσίδων σε γλυκοπρωτεΐνες Στην περίπτωση των Ν-συνδεδεμένων (N-linked) γλυκοπρωτεϊνών, οι υδατανθρακικές αλυσίδες συνδέονται σε κατάλοιπα ασπαραγίνης. Στην περίπτωση των Ο-συνδεδεμένων(O-linked)* γλυκοπρωτεϊνών, οι υδατανθρακικές αλυσίδες συνδέονται είτε σε κατάλοιπα σερίνης είτε σε κατάλοιπα θρεονίνης.

44 Γλυκοζυλίωση (glucosylation) Σημασία της γλυκοζυλίωσης των πρωτεϊνών 1. Είναι σημαντική για τη δομή και λειτουργία κάποιων πρωτεϊνών 2. Προστατεύει άλλες από πρόωρη αποδόμηση 3. Σε ορισμένες πρωτεΐνες η φύση της υδατανθρακικής τροποποίησης επηρεάζει τη στοχοποίησή τους για μεταφορά στο κατάλληλο κυτταρικό διαμέρισμα

45 Γλυκοζυλίωση (glucosylation) Σακχαρώδης διαβήτης (Diabetes mellitus) Στην υπεργλυκαιμία γίνεται μη-ειδική γλυκοζυλίωση των κυτταροπλασματικων πρωτεϊνών. Στον σακχαρώδη διαβήτη είναι ενδεικτική των δευτερογενών μικροαγγειακών επιπλοκών.

46 Γλυκοζυλίωση (glucosylation) Σακχαρώδης διαβήτης (Diabetes mellitus) Mέτρηση των επιπέδων της μη γλυκοζυλιωμένης αιμοσφαιρίνης (HbA 1c ) * χρησιμοποιείται για να καθορίσει πως ήταν η μέση τιμή γλυκόζης στο αίμα μας, τους τελευταίους 3 μήνες περίπου Η γλυκοζυλιωμένη αιμοσφαιρίνη =χημική ένωση της αιμοσφαιρίνης με τη γλυκόζη, επηρεάζεται από τις τιμές σακχάρου όλου του 24ώρου των τελευταίων 120 ημερών. Η γλυκοζυλιωμένη αιμοσφαιρίνη είναι το ποσοστό της αιμοσφαιρίνης που έχει υποστεί γλυκοζυλίωση.

47 Γλυκοζυλίωση (glucosylation) Στη συνέχεια, μεταφέρεται ολόκληρος σε μια ασπαραγίνη-δέκτη του πολυπεπτιδίου. Η σύνθεση των N-συνδεδεμένων γλυκοπρωτεϊνών Το πρώτο βήμα της γλυκοζυλίωσης είναι η προσθήκη ενός ολιγοσακχαρίτη που αποτελείται από 14 σάκχαρα στην αυξανόμενη πολυπεπτιδική αλυσίδα, η οποία εισέρχεται στο ER. Ο ολιγοσακχαρίτης συντίθεται πάνω σε ένα λιπίδιο-φορέα (στη φωσφορική δολιχόλη) της μεμβράνης του ER.

48 Γλυκοζυλίωση (glucosylation) Η επεξεργασία των Ν-συνδεδεμένων ολιγοσακχαριτών. Μέσω της τροποπoίησης της αλυσίδας των 14 σακχάρων που αρχικά προστίθεται στο ενδοπλασματικό δίκτυο και είναι κοινή για όλους τους Ν-συνδεδεμένους ολιγοσακχαρίτες προκύπτουν διάφοροι εναλλακτικοί τύποι ολιγοσακχαριτών. Τα τρία ακραία κατάλοιπα γλυκόζης αφαιρούνται στο ER και κατόπιν η γλυκοπρωτεΐνη μεταφέρεται στη συσκευή Golgi. Σε αυτό το κυτταρικό διαμέρισμα είναι δυνατόν να αφαιρεθούν κατάλοιπα μαννόζης και να προστεθούν άλλα σάκχαρα.

49 Γλυκοζυλίωση (glucosylation) Παραδείγματα Ο-συνδεδεμένων ολιγοσακχαριτών. Οι Ο-συνδεδεμένοι ολιγοσακχαρίτες συνήθως αποτελούνται από λίγα μόνο σάκχαρα, τα οποία προστίθενται διαδοχικά το ένα μετά το άλλο.

50 Πρόσδεση λιπιδίων

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους ΚΕΦΑΛΑΙΟ 8 Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους Εισαγωγή Η πρωτεϊνοσύνθεση (μετάφραση) είναι το τελικό στάδιο της γονιδιακής έκφρασης. 1. Η μετάφραση του mrna είναι το πρώτο

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017)

Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Τα κύρια σημεία της σημερινής διάλεξης είναι τα παρακάτω: Aποκωδικοποίηση του

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ(

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 15. Κυτταρική ρύθμιση. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 15. Κυτταρική ρύθμιση. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 15 Κυτταρική ρύθμιση Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 15.1 Μηχανισμοί διακυτταρικής σηματοδότησης. Η διακυτταρική σηματοδότηση μπορεί να συμβαίνει είτε απευθείας

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Η κυτταρική μετατόπιση των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από μόνο ένα τύπο ριβοσώματος

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες

πρωτεΐνες πολυμερείς ουσίες δομούν λειτουργούν λευκώματα 1.Απλές πρωτεΐνες 2.Σύνθετες πρωτεΐνες πρωτεΐδια μη πρωτεϊνικό μεταλλοπρωτεΐνες ΠΡΩΤΕΙΝΕΣ Οι πρωτεΐνες είναι πολυμερείς ουσίες με κυρίαρχο και πρωταρχικό ρόλο στη ζωή. Πρωτεΐνες είναι οι ουσίες που κυρίως δομούν και λειτουργούν τους οργανισμούς. Λέγονται και λευκώματα λόγω του λευκού

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 9 ο ΣΤΡΑΤΗΓΙΚΕΣ ΚΑΤΑΛΥΣΗΣ

ΚΕΦΑΛΑΙΟ 9 ο ΣΤΡΑΤΗΓΙΚΕΣ ΚΑΤΑΛΥΣΗΣ ΚΕΦΑΛΑΙΟ 9 ο ΣΤΡΑΤΗΓΙΚΕΣ ΚΑΤΑΛΥΣΗΣ Είδαμε τους μηχανισμούς με τους οποίους καταλύονται οι χημικές/βιολογικές αντιδράσεις (θα επανέλθουμε αν έχουμε χρόνο) Θα εξετάσουμε δύο παραδείγματα ενζύμων και του

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ

ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΓΩΝΙΕΣ φ, ψ ΚΑΙ ΕΠΙΤΡΕΠΤΕΣ ΔΙΑΜΟΡΦΩΣΕΙΣ ΤΗΣ ΠΟΛΥΠΕΠΤΙΔΙΚΗΣ ΑΛΥΣΙΔΑΣ ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ φ φ Ccarbonyl n Ccarbonyl n N Cα n Ccarbonyl n-1 Cα n N φ Ccarbonyl n-1 ΜΕΤΡΗΣΗ ΤΗΣ ΓΩΝΙΑΣ ψ φ ψ Ccarbonyl n N (Ca

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου.

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου. ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου. I. Πώς ονομάζεται η κυτταρική δομή που απεικονίζεται στην εικόνα; Οι αριθμοί:

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i..

Τα χημικά στοιχεία που είναι επικρατέστερα στους οργανισμούς είναι: i.. ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ «XHMIKH ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ» ΕΙΣΑΓΩΓΗ ΚΑΙ Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Όταν αναφερόμαστε στον όρο «Χημική Σύσταση του Κυττάρου», τί νομίζετε ότι

Διαβάστε περισσότερα

Περιοχές της συσκευής Golgi

Περιοχές της συσκευής Golgi Η συσκευή Golgi Η συσκευή Golgi αποτελείται από μια στιβάδα πεπλατυσμένων δεξαμενών και τα κυστίδια που συνδέονται με αυτές. Πρωτεΐνες και λιπίδια από το ER εισέρχονται στη cis όψη της συσκευής Golgi και

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

οµή και λειτουργία των µεγάλων βιολογικών µορίων

οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων οµή και λειτουργία των µεγάλων βιολογικών µορίων κατηγορίες υδατάνθρακες πρωτεΐνες νουκλεϊνικά οξέα λιπίδια Οι πρωτεΐνες, υδατάνθρακες, νουκλεϊνικά οξέα

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ

BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ ΜΕΡΟΣ ΠΡΩΤΟ - ΠΕΡΙΓΡΑΜΜΑ 5.1 ΈΝΑ ΝΟΥΚΛΕΙΝΙΚΟ ΟΞΥ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΌ ΤΕΣΣΕΡΑ ΕΙΔΗ ΒΑΣΕΩΝ, ΠΟΥ ΠΡΟΣΔΕΝΟΝΤΑΙ ΣΕ ΈΝΑ ΚΟΡΜΟ ΣΑΚΧΑΡΩΝ ΦΩΣΦΟΡΙΚΩΝ 5.2 ΈΝΑ ΖΕΥΓΟΣ

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

Σύνθεση πρωτεϊνών και σημειακές μεταλλάξεις Γ. Παπανικολαόυ MD, PhD

Σύνθεση πρωτεϊνών και σημειακές μεταλλάξεις Γ. Παπανικολαόυ MD, PhD Σύνθεση πρωτεϊνών και σημειακές μεταλλάξεις Γ. Παπανικολαόυ MD, PhD Κεντρικό δόγμα DNA Μεταγραφή RNA Αντιγραφή Αντίστροφη μεταγραφάση Μετάφραση mrna Πρωτείνη RNA γονίδια trna rrna SnRNA microrna κα Ροή

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΤΑΦΟΡΑ ΜΕ ΚΥΣΤΙΔΙΑ, ΛΥΣΟΣΩΜΑΤΙΑ & ΑΥΤΟΦΑΓΙΑ ΔIAΛEΞΕΙΣ 6 & 7 (8 & 13/3/2017)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΤΑΦΟΡΑ ΜΕ ΚΥΣΤΙΔΙΑ, ΛΥΣΟΣΩΜΑΤΙΑ & ΑΥΤΟΦΑΓΙΑ ΔIAΛEΞΕΙΣ 6 & 7 (8 & 13/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 6 & 7 (8 & 13/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΤΑΦΟΡΑ ΜΕ ΚΥΣΤΙΔΙΑ, ΛΥΣΟΣΩΜΑΤΙΑ & ΑΥΤΟΦΑΓΙΑ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΔΡΑΣΗ ΠΡΩΤΕΙΝΩΝ

ΔΟΜΗ ΚΑΙ ΔΡΑΣΗ ΠΡΩΤΕΙΝΩΝ ΔΟΜΗ ΚΑΙ ΔΡΑΣΗ ΠΡΩΤΕΙΝΩΝ ΠPΩTEINEΣ Οι πρωτεΐνες παίζουν σημαντικό ρόλο σε όλες σχεδόν τις βιολογικές διεργασίες. H σημασία τους φαίνεται στις παρακάτω περιπτώσεις: 1. Κατάλυση (πχ. ένζυμα) 2. Μεταφορά

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Τα ΥΠΕΡΟΞΕΙΔΙΟΣΩΜΑΤΑ Μέρος Ε ΤΑ ΒΑΣΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΤΩΝ ΥΠΕΡΟΞΕΙΔΙΟΣΩΜΑΤΩΝ - Περιέχουν ένζυµα για ποικίλες µεταβολικές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΔΟΜΕΣ ΠΡΩΤΕΪΝΩΝ. Fibrous - extended shape, insoluble (e.g. keratin, collagen, elastin) Globular

ΔΟΜΕΣ ΠΡΩΤΕΪΝΩΝ. Fibrous - extended shape, insoluble (e.g. keratin, collagen, elastin) Globular ΔΟΜΕΣ ΠΡΩΤΕΪΝΩΝ Fibrous - extended shape, insoluble (e.g. keratin, collagen, elastin) Globular - compact shape, water soluble (e.g. myoglobin, trypsin) Membranous - often multidomain one lipid soluble

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που

Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που Κατα το θερµικό Σοκ µαζί µε τις αλλαγές πού επισυµβαινουν στην µεταγραφή παρατηρείται και µια επιλεκτική µετάφραση των µηνυµάτων εκείνων που κωδικοποιούν για τις πρωτεϊνες που επάγονται από το θερµικό

Διαβάστε περισσότερα

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία, από τα οποία 27 μόνο είναι απαραίτητα για τη ζωή. ΠΟΣΟΣΤΟ ΣΤΟΙΧΕΙΑ 96% ο άνθρακας (C), το υδρογόνο (H), το οξυγόνο (O) και

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΔΙΔΑΣΚΑΛΙΑ ΘΕΩΡΗΤΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΦΥΣΙΟΛΟΓΙΑ Ι ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ

ΔΙΔΑΣΚΑΛΙΑ ΘΕΩΡΗΤΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΦΥΣΙΟΛΟΓΙΑ Ι ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ ΔΙΔΑΣΚΑΛΙΑ ΘΕΩΡΗΤΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΦΥΣΙΟΛΟΓΙΑ Ι ΦΥΣΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ Φωτεινή Μάλλη Καλή ακαδημαϊκή χρονιά!! Σύγγραμμα 3 Εξεταστέα ύλη Σύγγραμμα Παραδόσεις SOS???? 4 Εξετάσεις Τελικές γραπτές

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.2 Κύτταρο: η μονάδα της ζωής Ιστορικά 1665: Ο Ρ.Χουκ μιλά για κύτταρα. Σύγχρονη κυτταρική θεωρία: Το κύτταρο είναι η θεμελιώδης δομική και λειτουργική

Διαβάστε περισσότερα

αποτελούν το 96% κ.β Ποικιλία λειτουργιών

αποτελούν το 96% κ.β Ποικιλία λειτουργιών ΧΗΜΙΚΑ ΣΤΟΙΧΕΙΑ ΠΟΥ ΣΥΝΘΕΤΟΥΝ ΤΟΥΣ ΟΡΓΑΝΙΣΜΟΥΣ 92 στοιχεία στο φλοιό της Γης 27 απαραίτητα για τη ζωή H, Ο, Ν, C αποτελούν το 96% κ.β S, Ca, P, Cl, K, Na, Mg αποτελούν το 4% κ.β. Fe, I Ιχνοστοιχεία αποτελούν

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ»

«ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» «ΠΡΩΤΕΪΝΕΣ: ΧΗΜΙΚΗ ΔΟΜΗ ΚΑΙ ΒΙΟΛΟΓΙΚΟΣ ΡΟΛΟΣ» Τι είναι οι πρωτεΐνες; Από τι αποτελούνται; Ποιος είναι ο βιολογικός του ρόλος; Ας ρίξουμε μία ματιά σε όλα αυτά τα ερωτήματα που μας απασχολούν ΚΕΦΑΛΑΙΟ 1:

Διαβάστε περισσότερα

Ρόλος Υδατανθρακών. Μονοσακχαρίτες Ολιγοσακχαρίτες, Πολυσακχαρίτες

Ρόλος Υδατανθρακών. Μονοσακχαρίτες Ολιγοσακχαρίτες, Πολυσακχαρίτες Ρόλος Υδατανθρακών Καύσιµα, αποθήκες ενέργειας, µεταβολικά ενδιάµεσα Δοµικά στοιχεία RNA, DNA, κυτταρικού τοιχώµατος φυτών & βακτηρίων Μεσολαβητές κυτταρικών αλληλεπιδράσεων Μονοσακχαρίτες Ολιγοσακχαρίτες,

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ. Θερινό εξάμηνο ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων

ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ. Θερινό εξάμηνο ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΕΙΣΑΓΩΓΗ Θερινό εξάμηνο 2015 Αριστοτέλης Χ. Παπαγεωργίου Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Πρωτεινική αναδίπλωση

Πρωτεινική αναδίπλωση Πρωτεινική αναδίπλωση Η αμινοξική αλληλουχία καθορίζει την τριτοταγή δομή - Οι πληροφορίες για τη βιολογικά δραστική στερεοδιάταξη είναι κωδικοποιημένες στην αμινοξική αλληλουχία Ριβονουκλεάση- Anfinsen,

Διαβάστε περισσότερα

ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ

ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-oA Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική φωσφορυλίωση

Διαβάστε περισσότερα

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved

Κεφάλαιο 2. Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Κεφάλαιο 2 1 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved ΟΡΓΑΝΙΚΗ ΜΟΡΙΑΚΗ ΔΟΜΗ ΤΩΝ ΖΩΝΤΑΝΩΝ ΟΡΓΑΝΙΣΜΩΝ «Οργανική» ένωση αναφέρεται σε ενώσεις του C Συμμετέχουν

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΦΥΣΙΟΛΟΓΙΑ ΤΟΥ ΑΝΘΡΩΠΟΥ ΤΟ ΚΥΤΤΑΡΟ Δ.ΑΡΕΘΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΦΥΣΙΟΛΟΓΙΑ ΤΟΥ ΑΝΘΡΩΠΟΥ ΤΟ ΚΥΤΤΑΡΟ Δ.ΑΡΕΘΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΦΥΣΙΟΛΟΓΙΑ ΤΟΥ ΑΝΘΡΩΠΟΥ ΤΟ ΚΥΤΤΑΡΟ Δ.ΑΡΕΘΑ ΚΥΤΤΑΡΟ 2 Κατά την Βιολογία, κύτταρο ονομάζεται η βασική δομική και λειτουργική μονάδα που εκδηλώνει το φαινόμενο της ζωής. Έτσι, ως κύτταρο νοείται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ Γίνεται σύνθεση DNA. Γίνεται σύνθεση RNA. Εξασφαλίζεται η διαιώνιση της γενετικής

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΣΠΕΡΙΝΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Σύντομη εισαγωγή στη βιολογία. Δρ. Μαργαρίτα Θεοδωροπούλου

Σύντομη εισαγωγή στη βιολογία. Δρ. Μαργαρίτα Θεοδωροπούλου Σύντομη εισαγωγή στη βιολογία Δρ. Μαργαρίτα Θεοδωροπούλου Εισαγωγή Το κύτταρο είναι η θεμελιώδης μονάδα της ζωής Όλα τα όντα αποτελούνται από κύτταρα (μεμβράνη με χημικό υλικό) Αυξάνονται με τη διαίρεση

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων

Διαλέξεις Χημείας Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων Διαλέξεις Χημείας -2014 Αγγελική Μαγκλάρα, PhD Εργαστήριο Κλινικής Χημείας Ιατρική Σχολή Πανεπιστημίου Ιωαννίνων 1. Κατάταξη 2. Λειτουργίες 1. Πεπτιδικές ορμόνες 3. Πεπτιδικός δεσμός 1. Χαρακτηριστικά

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2. Η σύσταση των κυττάρων

ΚΕΦΑΛΑΙΟ 2. Η σύσταση των κυττάρων ΚΕΦΑΛΑΙΟ 2 Η σύσταση των κυττάρων Τα μόρια των κυττάρων Νερό Υδατάνθρακες Λιπίδια Νουκλεϊκά οξέα Πρωτεΐνες Νερό Νερό: ένα μόριο με πολικότητα 1: 554 million Copyright 2002 Pearson Education, Inc., publishing

Διαβάστε περισσότερα

Η ροή της γενετικής πληροφορίας

Η ροή της γενετικής πληροφορίας Η ροή της γενετικής πληροφορίας 6.1. Γενικά Όλες οι πληροφορίες για τις λειτουργίες και τα χαρακτηριστικά ενός οργανισμού περιέχονται στο DNA του. To DNA του οργανισμού αποτελεί το γενετικό του υλικό.

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα