Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:




2 ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,(( κωδικόνιαlαντικωδικόνια(&(το(μεταφορικό(rna (( (( ΡιβοσωμάτιοLο(χώρος(αποκωδικοποίησης.(( Ριβοσωμικά(RNA(&(βιοσύνθεση(ριβοσωματίων. (( Η(Διαδικασία(και(η(Ρύθμιση(της(Μετάφρασης ( (( Συνοδοί(Πρωτείνες(και(Αναδίπλωση(Πρωτεϊνών( ΜεταLμεταφραστικές(τροποποιήσεις(&(αποδόμηση( Πρωτεϊνών(!

3 Το(βασικό(δόγμα(της(μοριακής(βιολογίας( Γονιδιακή(έκφραση( Mεταγραφή! Aγγελιαφόρο!RNA! (mrna)! Kωδικόνιο! Mετάφραση! Πρωτεΐνη! (πολυπεπτιδική! αλυσίδα)!

4 Πως(επιτυγχάνεται(η(μεταφορά( της(γενετικής(πληροφορίας(από( τα(νουκλεϊνικά(οξέα(στις(πρωτεΐνες;( 1. Τα!αμινοξέα!έχουν!τελείως!διαφορετική!σύσταση!από!το!mRNA.!Πως! λοιπόν!θα!μπορέσουν!να!συνταχθούν!με!το!mrna!κατά!τη!μετάφραση! για!να!γίνει!η!αποκωδικοποίηση;! 2. Πως!είναι!δυνατόν!μια!αλληλουχία!τεσσάρων!βάσεων!να!κωδικοποιεί!20! αμινοξέα;!ποιος!είναι!ο!κώδικας;! 3. Πως! έσπασε!ο!κώδικας;!

5 Ο(γενετικός(κώδικας(

6 Για(τη(μετατροπή(της(γενετικής(πληροφορίας( (αλληλουχία(νουκλεοτιδικών(βάσεων)( (σε(πρωτεΐνες( (αλληλουχία(αμινοξέων)( απαιτείται(ένα(ενδιάμεσο(μόριο(! ΤΟ!!ΜΕΤΑΦΟΡΙΚΟ!RNA!(tRNA)!

7 Η(δομή(του(μεταφορικού(RNA((tRNA)(

8 Η(εκλεκτικότητα(της(μετάφρασης(απαιτεί(τη( μεσολάβηση(δύο(μορίων(προσαρμογής( αμινοξύ! (τρυπτοφάνη)! δεσμός!υψηλής! ενέργειας! συνθετάση! (τρυπτοφάνυλο! trna!συνθετάση)! Σύνδεση!του! αμινοξέως!στο!rna! το!!trna!συνδέεται!στο! κωδικόνιο!του!στο!mrna! ζευγάρωμα! βάσεων! ΚΑΘΑΡΟ(ΑΠΟΤΕΛΕΣΜΑ:(Η(ΕΠΙΛΟΓΗ(ΤΟΥ(ΑΜΙΝΟΞΕΩΣ( ΚΑΘΟΡΙΖΕΤΑΙ(ΑΠΟ(ΤΟ(ΚΩΔΙΚΟΝΙΟ(ΤΟΥ(

9 Πλαίσια(ανάγνωσης(στην(πρωτεϊνοσύνθεση(

10 Το(ριβοσωμάτιο( RNA! RNA! RNA! RNA! ~49!πρωτεΐνες!+!3!μόρια!RNA! ~33!πρωτεΐνες!+!1!μόριο!RNA! Μεγάλη!υπομονάδα! Μικρή!υπομονάδα! MW!=! ! Μεγάλη! υπομονάδα! Μικρή! υπομονάδα! ~82!πρωτεΐνες!! +!4!μόρια!RNA! Ολοκληρωμένο!ριβοσωμάτιο! MW!=! !

11 Θέσεις(σύνδεσης(tRNA(στο(ριβοσωμάτιο( Θέση!Ε! Θέση!P! Θέση!Α! Θέση!πρόσδεσης! mrna! Μεγάλη! ριβοσωμική! υπομονάδα! Μικρή! ριβοσωμική! υπομονάδα!

12 συντιθέμενη!ολυπεπτιδική!αλυσίδα! Η(διαδικασία(της(επιμήκυνσης(

13 Η(έναρξη(της(μετάφρασης( RNA! καλύπτρα! εναρκτήριο!trna! μικρή!υπομονάδα!μαζί!με! παράγοντες!έναρξης!(δεν! δείχνονται!στο!σχήμα)! σύνδεση!mrna! mrna! το!σύμπλοκο!μικρής! υπομονάδας/ εναρκτήριου!trna! ψάχνει!το!πρώτο!aug! του!mrna!! Απομάκρυνση!των! παραγόντων!έναρξης! Σύνδεση!της!μεγάλης! ροβοσωμικής! υπομονάδας! Σύνδεση! αμινοακυλοltrna! (Βήμα!1)! Σχηματισμός!πρώτου! πεπτιδικού!δεσμού! (Βήμα!2)!

14 Ειδικές(αλληλουχίες(βάσεων(( στα(προκαρυωτικά(mrna(καθορίζουν(( τα(σημεία(έναρξης(της(μετάφρασης( Θέσεις!πρόσδεσης!ριβοσωματίου! Πρωτεΐνη!Α! Πρωτεΐνη!Β! Πρωτεΐνη!Γ!

15 Το(τέλος(της(μετάφρασης( Πρόσδεση! παράγοντα! απελευθέρωσης! ΤΕΡΜΑΤΙΣΜΟΣ!

16 Το(πολυριβοσωμάτιο:(ένα(mRNA(που( μεταφράζεται(ταυτόχρονα(από(πολλά( ριβοσωμάτια( Κωδικόνιο! τερματισμού! Εναρκτήριο! κωδικόνιο! Αγγελιοφόρο!RNA!(mRNA)! Πολυπεπτιδική! αλυσίδα!

17 Οι(νεοσυντιθέμενες(πρωτεΐνες(χρειάζονται( συνοδούςxπρωτεΐνες(για(να(αναδιπλωθούν( σωστά( αναδιπλωμένη πρωτεΐνη! Συνοδός! πρωτεΐνη! (σαπερόνη)! Απελευθέρωση! ολοκληρωμένου! πολυπεπτιδίου!

18 H(πληροφορία(για(την(αναδίπλωση(μιας( πρωτεΐνης(βρίσκεται(μέσα(στην(ίδια(τη( πρωτοταγή(της(δομή( H!δομή!της!Pιβονουκλεάσης!I! (RNαση!I,!124!αμινοξέα),! σταθεροποιείται!από! τέσσερις!ενδομοριακούς! δισουλφιδικούς!δεσμούς!(oι! μπλέ!κύκλοι=!μόρια!του! αμινοξέος!κυστεΐνη!που! συμμετέχουν!στους! δισουλφιδικούς!δεσμούς).! δισουλφιδικοί!δεσμοί Αναδιπλωμένη!RNαση!I! Θέρμανση!μιάς!πρωτεΐνης! (RNαση!I)!παρουσία! αναγωγικού!παράγοντα,! που!διασπά!τους! δισουλφιδικούς!δεσμούς,! καταστρέφει!τη!δομή!της! πρωτεΐνης,!μετουσιώνοντας! την.! Μετουσιωμένη!RNαση!I! Eάν!η!μετουσιωμένη! RNαση!I!επανέλθει!στις! κανονικές!συνθήκες!θα! ανακτήσει!την!κανονική! της!διαμόρφωση.! Αναδιπλωμένη!RNαση!I!


20 Το(πρόβλημα(του(συνωστισμού(των( μακρομορίων( <0.1 mg/ml in(vitro( κυτταρόπλασμα(e.(coli( ~340 mg/ml Ellis and Hartl (1996) FASEB J. 10:20-26 ριβόσωμα! πρωτεΐνες! συνοδόςlπρωτεΐνη! νουκλεϊνικά!οξέα! Άλλα!μακρομόρια!

21 Αναδίπλωση(ή(συσσωμάτωση;( Σωστές!αλληλεπιδράσεις! μεταξύ!των!πλευρικών! αλυσίδων!της!πρωτεΐνης! Λάθος!αλληλεπιδράσεις! μεταξύ!πλευρικών!αλυσίδων! διαφορετικών!πρωτεϊνών!

22 ΕΠΟΜΕΝΩΣ( Ο(ρόλος(των(συνοδώνLπρωτεϊνών(ή( πρωτεϊνών(της(θερμικής(καταπόνησης( (HeatLshock(proteins,(HSPs)( ΕΙΝΑΙ:(

23 Οι(συνοδοίXπρωτεΐνες(εμπλέκονται(στην( αναδίπλωση(των(πρωτεϊνών( Eμποδίζουν(τα(υδρόφοβα( τμήματα(των(πρωτεϊνών(να( έρθουν(σε(επαφή(με(άλλα( υδρόφοβα(μόρια( ΚΑΝΟΝΙΚΟ!ΜΟΝΟΠΑΤΙ! ΑΝΑΔΙΠΛΩΣΗΣ! ΕΝΑΛΛΑΚΤΙΚΟ!ΜΟΝΟΠΑΤΙ! ΑΝΑΔΙΠΛΩΣΗΣ! ΑΝΕΠΑΝΩΡΘΩΤΑ! (ΚΑΤΑΣΤΡΟΦΙΚΑ)! ΛΑΘΗ! Βοηθούν(στη(σωστή( αναδίπλωση( λιωμένο! σφαιρίδιο! Eπάγονται(από(έκθεση(των( κυττάρων(σε(υψηλές( θερμοκρασίες( Oι(δύο(κύριες(ομάδες(των( συνοδώνlπρωτεϊνών(αυτών( είναι(οι(hsp70(και(οι(hsp60! Ορθά! αναδιπλωl μένη! πρωτεΐνη! συνοδοί! πρωτεΐνες! συνοδοί! πρωτεΐνες! πρωτεάσες/ αποικοδόμηση!

24 Οι(πρωτεΐνες(μοριακοίXσυνοδοί(βοηθούν( στη(πρωτεϊνική(αναδίπλωση( Αποσυσσωμάτωση! J K T F 3' 5' ClpB0 GrpE0 ATP ADP J K ATP Μερικώς αναδιπλωμένη πρωτεΐνη GrpE Αναδίπλωση! ADP Αναδιπλωμένη πρωτεΐνη ADP IbpA/B ATP Αναδίπλωση! Κατακράτηση! Hsp31" GroEL GroES Hsp33"

25 Συνοδοί(πρωτεΐνες(εμπλέκονται(στη( μεταφορά(σε(μεμβρανικά(οργανίδια( (Το( παράδειγμα(του(μιτοχονδρίου( Πολυπεπτιδική!αλυσίδα! Κυτταροπλασματική!συνοδός! πρωτεΐνη! Μιτοχονδριακή!συνοδός! πρωτεΐνη! Αναδιπλωμένη! πρωτεΐνη! Μιτοχόνδριο!

26 Η(είσοδος(των(πρωτεϊνών(στο(ΕΔ(γίνεται( ταυτόχρονα(με(τη(μετάφραση( σηματοδοτική!αλληλουχία! Σωματίδιο!αναγνώρισης!σήματος!(ΣΑΣ)! κυτταρόπλασμα( αυλός(του(εδ( Υποδοχέας! του!σασ! σύμπλοκο!μεταφοράς!sec61! (=κανάλι!μετατόπισης)! σηματοδοτική! πεπτιδάση!!2000!by!geoffrey!m.! Cooper!

27 ΣυνοδοίXπρωτεΐνες(αναδιπλώνουν(αλλά(και( συγκρατούν(τις(πρωτεΐνες(στον(αυλό(του(εδ( Αυλός του ΕΔ 2000 by Geoffrey M. Cooper

28 Συνοδοί(πρωτεΐνες(εμπλέκονται(και(στον( ποιοτικό(έλεγχο(των(πρωτεϊνών(του(εδ( EΔ! Λάθος! αναδιπλωμένη! πρωτείνη! Σωστά!αναδιπλωμένη! πρωτείνη! Συνοδός! πρωτείνη! Eκβλαστάνον! κυστίδιο!μεταφοράς!

29 Ρύθμιση(της(πρωτεϊνικής(αναδίπλωσης(στο(ΕΔ( μεταφορά!έξω! από!το!εδ! Ουβικιτινωση!! πρωτεασωμική! αποικοδόμηση! Προϊόντα! αποικοδόμησης! Golgi! ριβοσωμάτιο! λάθος!αναδίπλωση! κυστίδιο! Είσοδος! στο!εδ! Μετατροπή!&! αναδίπλωση! Ορθή! αναδίπλωση! ΕΔ( CM!Dobson,! Protein!folding!and!misfolding,!Nature,!426,!884l890!(2003)! Πολλές!νεοσυντιθέμενες!πρωτεΐνες! μεταφέρονται!στο!εδ!όπου!και!αποκτούν!τις! ανώτερες!δομές!τους!με!τη!βοήθεια!συνοδώνl πρωτεϊνών!ή!άλλων!παραγόντων!που!προάγουν! την!πρωτεϊνική!αναδίπλωση.! Οι!σωστά!αναδιπλωμένες!πρωτεΐνες! μεταφέρονται!κατόπιν!στη!συσκευή!golgi!και! στη!συνέχεια!κατευθύνονται!(με!κυστιδιακή! μεταφορά)!στο!σωστό!μεμβρανικό!οργανίδιο!ή! στον!εξωκυττάριο!χώρο.! Πρωτεΐνες!που!δεν!έχουν!αναδιπλωθεί!σωστά! ανιχνεύονται!από!τους!μηχανισμούς!ποιοτικού! ελέγχου!της!πρωτεϊνικής!αναδίπλωσης!και! ανακατευθύνονται!με!διαφορετικό!μηχανισμό! (unfolded!protein!response,!απόκριση!σε!μη! αναδιπλωμένες!πρωτεΐνες).!ο!μηχανισμός!αυτός! οδηγεί!στην!ουβικιτίνωση!των!λάθος! αναδιπλωμένων!πρωτεϊνών!και!στην! αποικοδόμηση!τους!από!τα!πρωτεασωμάτια.!

30 Μετά(τη(σύνθεση(τους(πολλές(πρωτεΐνες( συνδέονται(μη(ομοιοπολικά(με(μικρά(μόρια( Ρετινάλη( Αίμη(

31 Η(φωσφορυλίωση(των(πρωτεϊνών(είναι(μία( από(τις(σημαντικότερες(ομοιοπολικές( τροποποιήσεις(! Η!φωσφορυλίωση!των!πρωτεϊνών! έχει!ως!αποτέλεσμα!την!μεταβολή! των!φυσικοχημικών!τους!ιδιοτήτων! και!κατα!συνέπεια!της!δομής!τους.!! Οι!παραπάνω!δομικές!αλλαγές! μπορεί!να!επηρεάσουν!την! ενεργότητα!της!πρωτεΐνης!ή/και!τις! αλληλεπιδράσεις!της!με!άλλα! Πλευρική! αλυσίδα! σερίνης! Κινάση! πρωτεϊνών! Φωσφατάση! πρωτεϊνών! Κινάση! βιομόρια.! ΑΝΕΝΕΡΓΟ( φωσφατάση! ΕΝΕΡΓΟ( Κινάση! ΕΝΕΡΓΟ( ΑΝΕΝΕΡΓΟ( φωσφατάση!

32 Η(φωσφορυλίωση(των(πυρηνικών(λαμινών( οδηγεί(σε(αποσυναρμολόγηση( του(πυρηνικού(υμένα( Σύντηξη!των! κυστιδίων!του! πυρηνικού!φακέλου! Πυρηνικός!πόρος! λαμίνες! εσωτερική!πυρηνική! μεμβράνη! εξωτερική!πυρηνική! μεμβράνη! Πυρηνικός! φάκελλος! Φωσφορυλίωση! των!λαμινών! ΜΕΣΟΦΑΣΙΚΟΣ!ΠΥΡΗΝΑΣ! χρωματίδη! χρωμόσωμα! κυστίδιο!πυρηνικού! φακέλου! ΤΕΛΟΦΑΣΗ! Αποφωσφορυλίωση! των!λαμινών! φωσφορυλιωμένες! λαμίνες! ΠΡΟΦΑΣΗ!

33 Σύνδεση(υδατανθρακικών(αλυσίδων(στις( γλυκοπρωτεΐνες( ΝLΔεσμός( Ασπαραγίνη! Νlακετυλογλυκοζαμίνη! συνδεδεμένη!με! ασπαραγίνη! ΟLΔεσμός( Σερίνη! Νlακετυλογαλακτοζαμίνη! συνδεδεμένη!με!σερίνη!

34 Σύνδεση(πρωτεϊνών(με(μεμβρανικά( γλυκολιπίδια( κυτταρόπλασμα! Αλυσίδες!λιπαρών!οξέων! αιθανολαμίνη! ολιγοσακχαρίτης! Αυλός! ενδοπλασματικού! δικτύου!

35 Ωρίμανση(πρωτεϊνών(με(μερική(πρωτεόλυση( και(με(σχηματισμό(δισουλφιδικών(δεσμών( ΠρεLπροϊνσουλίνη( Οσχηματισμός(των( δισουλφιδικών(δεσμών( απαιτεί(οξειδωτικό( περιβάλλον(και(επιταχύνεται( από(εξειδικευμένα(ένζυμα( (π.χ.(την(ισομεράση(των( δισουλφιδικών(δεσμών,(pdi)( Σηματοδοτική! αλληλουχία! Αποκοπή!σηματοδοτικής!αλληλουχίας! Σχηματισμός!δισουλφιδικών!δεσμών! Ενδιάμεσο!(συνδετικό)! πολυπεπτίδιο! Αποκοπή!συνδετικού! πολυπεπτιδίου! προϊνσουλίνη( ϊνσουλίνη(

36 Πολλά(οργανίδια(και(πρωτεΐνες( αποδομούνται(στα(λυσοσωμάτια( βακτήριο! φαγόσωμα! φαγοκυττάρωση! Kυτταρική! Mεμβράνη! Πρώιμο!ενδόσωμα! ενδοκυττάρωση! Όψιμο! ενδοσωμάτιο! Λυσοσωμάτιο! Eνδοπλασματικό! δίκτυο! Mιτοχόνδριο! αυτοφαγοσωμάτιο! αυτοφαγία!

37 Η(αποδόμηση(των(πρωτεϊνών(των( ευκαρυωτών(επιτελείται(κυρίως(στα( πρωτεοσωμάτια( Μηχανισμός! εισόδου! εξαρτώμενος! από!την! ουβικιτίνη! Πρωτεΐνη!που! προορίζεται!για! αποικοδόμηση! πεπτίδια! Πρωτεολυτική! μηχανή!

38 Αποδόμηση(ευκαρυωτικών(πρωτεϊνών( στα(πρωτεοσωμάτια(

39 Οι(λιγάσες(της(ουβικιτίνης(«μαρκάρουν»(τις( πρωτεΐνες(για(αποικοδόμηση( ουβικιτίνη! Πρωτεΐνη! στόχος! Πολυουβικιτίνωση! Πρωτεάσωμα! πεπτίδιο!

40 Ο(μηχανισμός(της(ουβικιτίνωσης( Ε1(ενεργοποιητής(της(ουβικιτίνης( Ε2(μεταφορέας(της( ουβικιτίνης( Ε3(λιγάση(της( ουβικιτίνης( Πρωτεϊνικά( υποστρώματα( ουβικιτίνη! Ενεργοποίηση( Εξειδικευμένη( ουβικιτίνωση( Αναγνώριση( υποστρώματος(

41 ( Σας(Ευχαριστώ(για(την( Προσοχή(σας(


Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Τα κύρια σημεία της σημερινής διάλεξης είναι τα παρακάτω: Aποκωδικοποίηση του

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΤΑΦΟΡΑ ΜΕ ΚΥΣΤΙΔΙΑ, ΛΥΣΟΣΩΜΑΤΙΑ & ΑΥΤΟΦΑΓΙΑ ΔIAΛEΞΕΙΣ 6 & 7 (8 & 13/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 6 & 7 (8 & 13/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΤΑΦΟΡΑ ΜΕ ΚΥΣΤΙΔΙΑ, ΛΥΣΟΣΩΜΑΤΙΑ & ΑΥΤΟΦΑΓΙΑ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα

Aναδίπλωση και επεξεργασία των πρωτεϊνών

Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση

Διαβάστε περισσότερα

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα

Kυτταρική Bιολογία. Κυτταρική διαίρεση ΔIAΛEΞΕΙΣ 18 & 19 (8/5 & 10/5/2017) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία. Κυτταρική διαίρεση ΔIAΛEΞΕΙΣ 18 & 19 (8/5 & 10/5/2017) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 18 & 19 (8/5 & 10/5/2017) Κυτταρική διαίρεση Τα κύρια σημεία της διάλεξης είναι τα παρακάτω: Ο κυτταρικός κύκλος και τα στάδια του Ρύθμιση του κυτταρικού κύκλου ü Ο ΡΟΛΟΣ ΚΑΙ

Διαβάστε περισσότερα

Moριακή Kυτταρική Bιολογία & Έλεγχος Μεταβολισμού ΔIAΛEΞΕΙΣ 4 & 5 Κυτταρική διαίρεση & Απόπτωση

Moριακή Kυτταρική Bιολογία & Έλεγχος Μεταβολισμού ΔIAΛEΞΕΙΣ 4 & 5 Κυτταρική διαίρεση & Απόπτωση Moριακή Kυτταρική Bιολογία & Έλεγχος Μεταβολισμού ΔIAΛEΞΕΙΣ 4 & 5 Κυτταρική διαίρεση & Απόπτωση Τα κύρια σημεία της διάλεξης είναι τα παρακάτω: Ο κυτταρικός κύκλος και τα στάδια του Ρύθμιση του κυτταρικού

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 3 (7/3/2012) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΗ 3 (7/3/2012) ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΕΣ ΤΩΝ ΠΡΩΤΕΪΝΩΝ AΣ ΘYMHΘOYME Στην προηγούμενη διάλεξη μιλήσαμε για τη χημική σύσταση των κυττάρων και για τα βιολογικά πολυμερή που αποτελούν

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

Γιατί διαιρούνται τα κύτταρα;

Γιατί διαιρούνται τα κύτταρα; Η κυτταροδιαίρεση Γιατί διαιρούνται τα κύτταρα; Για να αναπαραχθούν. Για να αυξηθεί το µέγεθος των οργανισµών. Για να αναπληρωθούν φθαρµένα ή κατεστραµµένα κύτταρα. ιαδικασία κυτταροδιαίρεσης µε εκβλάστηση

Διαβάστε περισσότερα

Η κυτταρική µετατόπιση των πρωτεϊνών

Η κυτταρική µετατόπιση των πρωτεϊνών 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα

Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα Η µελέτη της ρύθµισης της πρωτεινοσύνθεσης στο επίπεδο του Ριβοσώµατος εντοπίζεται σε τρία επίπεδα ΣτονΣτον ρόλο των διαφόρων οµάδων των ριβοσωµικών πρωτεινών. Κατά πόσο δηλαδή υπάρχει ετερογένεια στις

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας ΤΟ ΚΥΤΤΑΡΟ Προκαρυωτικό κύτταρο: πυρηνοειδές Αρχαία Βακτήρια Ευκαρυωτικό κύτταρο: πυρήνας Δομή: μεμβρανικά οργανίδια Παραγωγή ενέργειας Δομή γενετικού υλικού Διαίρεση / Αναπαραγωγή Γενετικός ανασυνδυασμός

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Λειτουργική Περιοχή της GTP-ασης

Λειτουργική Περιοχή της GTP-ασης Λειτουργική Περιοχή της GTP-ασης Οι πρωτεΐνες πού φαίνεται να εµπλέκονται στην περιοχή είναι οι πρωτεΐνες L7/L12. Οι πρωτεΐνες αυτές φαίνεται να είναι απαραίτητες για την ενεργότητα του ριβοσώµατος και

Διαβάστε περισσότερα

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά και ευκαρυωτικά κύτταρα. Aντιβιοτικά και πρωτεϊνοσύνθεση ΜΕΤΑΦΡΑΣΗ DNA RNA protein Aντιγραφή Μεταγραφή Μετάφραση Kεντρικό

Διαβάστε περισσότερα

Ο γενετικός κώδικας και πρωτεϊνική σύνθεση

Ο γενετικός κώδικας και πρωτεϊνική σύνθεση Ο γενετικός κώδικας και πρωτεϊνική σύνθεση Περίγραμμα Ο γενετικός κώδικας συνδέει τα νουκλεοτίδια με τα αμινοξέα Τα αμινοξέα ενεργοποιούνται με την πρόσδεση στο trna Το ριβοσωμα αποτελείται από RNA και

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S

Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S Κεφάλαιο 14 Γονιδιακή έκφραση: Μετάφραση Τρισδιάστατη δομή της ριβοσωμικής υπομονάδας 30S 1 2 Γενικευμένος τύπος αμινοξέος Οι δομές των 20 αμινοξέων που συναντώνται στη φύση, ταξινομημένες σύμφωνα με το

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα


Kυτταρική$Bιολογία$ ΜΕΤΑΦΟΡΑ(ΜΕ(ΚΥΣΤΙΔΙΑ,(ΕΚΚΡΙΣΗ,( ΕΝΔΟΚΥΤΤΑΡΩΣΗ,(ΛΥΣΟΣΩΜΑΤΙΑ(&( ΑΠΟΙΚΟΔΟΜΗΣΗ( ΔIAΛEΞΗ(5! (16!&!19/3/2012)! Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(5! (16!&!19/3/2012)! ΜΕΤΑΦΟΡΑ(ΜΕ(ΚΥΣΤΙΔΙΑ,(ΕΚΚΡΙΣΗ,( ΕΝΔΟΚΥΤΤΑΡΩΣΗ,(ΛΥΣΟΣΩΜΑΤΙΑ(&( ΑΠΟΙΚΟΔΟΜΗΣΗ( Η(εκκριτική(οδός( επισημασμένη! πρωτεΐνη! κυστίδια! Συσκευή! Golgi! Αδρό! ΕΔ!

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6

Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 Μοριακή Bιολογία ΔIAΛEΞΕΙΣ 5 & 6 EIΣAΓΩΓH ΣTHN METAΓPAΦH Χρήστος Παναγιωτίδης, Ph.D. Καθηγητής Κυτταρικής/Μοριακής Βιολογίας Εργαστήριο Φαρμακολογίας, Τομέας Φαρμακογνωσίας/Φαρμακολογίας Τμήμα Φαρμακευτικής,

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα


ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Kυτταρική Bιολογία ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΣ ΔIAΛEΞΕΙΣ 11 & 12 (28 & 30/3/2016) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ.

Kυτταρική Bιολογία ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΣ ΔIAΛEΞΕΙΣ 11 & 12 (28 & 30/3/2016) Δρ. Xρήστος Παναγιωτίδης, Τμήμα Φαρμακευτικής Α.Π.Θ. Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 11 & 12 (28 & 30/3/2016) ΚΥΤΤΑΡΟΣΚΕΛΕΤΟΣ Τα κύρια σημεία της σημερινής διάλεξης είναι τα παρακάτω: Κυτταροσκελετός και ο ρόλος του Eνδιάμεσα ινίδια και η σημασία τους στη δομή

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους. Δημήτρης Λιακόπουλος

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους. Δημήτρης Λιακόπουλος ΚΕΦΑΛΑΙΟ 8 Σύνθεση πρωτεϊνών, επεξεργασία και ρύθμιση της λειτουργίας τους Δημήτρης Λιακόπουλος Μετάφραση (translation) Στάδια σχηματισμού μίας πρωτεϊνης: 1. Μετάφραση 2. Αναδίπλωση προς κατάλληλη στερεοδιαμόρφωση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής

ΠΡΩΤΕΪΝΕΣ. Φατούρος Ιωάννης Αναπληρωτής Καθηγητής ΠΡΩΤΕΪΝΕΣ Φατούρος Ιωάννης Αναπληρωτής Καθηγητής Θέματα Διάλεξης Δομή, αριθμός και διαχωρισμός των αμινοξέων Ένωση αμινοξέων με τον πεπτιδικό δεσμό για τη δημιουργία πρωτεΐνης Λειτουργίες των πρωτεϊνών

Διαβάστε περισσότερα

Εργασία στην Βιολογία

Εργασία στην Βιολογία Εργασία στην Βιολογία Μεμβράνη του Πυρήνα του Κυττάρου Χρονιά: 2013-2014 Επιμέλεια: Σταμάτης Ορφανός, Μάριος Παναγιωτόπουλος [1] Πυρήνας του Κυττάρου Ο πυρήνας είναι το πιο μεγάλο και ευδιάκριτο οργανίδιο

Διαβάστε περισσότερα


ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-oA Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική φωσφορυλίωση

Διαβάστε περισσότερα

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία

Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Ο Μεταφραστικός ελεγχος και η διερευνηση των μοντελλων που θα μελετηθούν εστιαζεται σε τεσσερα σημεία Στην μελέτη του ριβοσώματος, των στοιχείων που το συγκροτούν αλλά και του τρόπου με τον οποίο αυτά

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2017 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2017 1η ΦΑΣΗ Να γράψετε στο απαντητικό φύλο, δίπλα στον αριθμό κάθε θέματος το γράμμα που αντιστοιχεί στη σωστή ε- πιλογή ή να διατυπώσετε την απάντηση. 1. Ποια

Διαβάστε περισσότερα


ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ Σε ποιες κατηγορίες κατατάσσονται οι ορµόνες µε βάση τη χηµική τους φύση. Αναφέρετε από ένα παράδειγµα Περιγράψτε πως γίνεται η επικοινωνία των κυττάρων µε µηνυµατοφόρα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2007 Β φάση Σάββατο 17 Μαρτίου 2007

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2007 Β φάση Σάββατο 17 Μαρτίου 2007 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2007 Β φάση Σάββατο 17 Μαρτίου 2007 1 Οι πυρκαγιές των μεσογειακών δασών από φυσικά αίτια, χωρίς ανθρωπογενή επίδραση και υπό τον όρο ότι

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

regulatory mechanisms). stringency).

regulatory mechanisms). stringency). ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ Αποτελεί µια άλλη περίπτωση ρύθµισης των γονιδίωνκαιδιακρίνεται: 1) Στην αυτόνοµη καταστολή και 2) Στηναυτόνοµηεπαγωγή. ΑΥΤΟΝΟΜΗ ΡΥΘΜΙΣΗ 1) Αυτόνοµη καταστολή: Η µεταβολική πορεία καταλήγει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 11 : Κυτταρική διαίρεση. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής Α.Π.Θ. ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ

Κυτταρική Βιολογία. Ενότητα 11 : Κυτταρική διαίρεση. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής Α.Π.Θ. ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 11 : Κυτταρική διαίρεση Παναγιωτίδης Χρήστος Φαρμακευτικής Α.Π.Θ. Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

1. Τα διαφόρων τυπων συστήματα ελευθέρων κυττάρων 2.Τα. εξατομικευμένα κύτταρα στα οποία

1. Τα διαφόρων τυπων συστήματα ελευθέρων κυττάρων 2.Τα. εξατομικευμένα κύτταρα στα οποία Για τον εντοπισμό των μεταβολών πού επισυμβαίνουν στις διάφορες παραμέτρους της πρωτεινοσύνθεσης υπό την επίδραση διαφόρων παραγόντων χρησιμοποιούνται τα In vitro συστήματα Με τον ορο In vitro συστήματα

Διαβάστε περισσότερα

πρωτεινοσύνθεσης που έχουν χρησιμοποιηθεί σε μεγάλη έκταση είναι

πρωτεινοσύνθεσης που έχουν χρησιμοποιηθεί σε μεγάλη έκταση είναι Για τον εντοπισμό των μεταβολών πού επισυμβαίνουν στις διάφορες παραμέτρους της πρωτεινοσύνθεσης υπό την επίδραση διαφόρων παραγόντων χρησιμοποιούνται τα In vitro συστήματα Με τον ορο In vitro συστήματα

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 02 : Χημική σύσταση κυττάρων- Δομή και λειτουργίες πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν

Διαβάστε περισσότερα

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων

Θέµατα ιάλεξης ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ ΠΡΩΤΕΪΝΕΣ. ιαχωρισµός Αµινοξέων MANAGING AUTHORITY OF THE OPERATIONAL PROGRAMME EDUCATION AND INITIAL VOCATIONAL TRAINING ΠΡΩΤΕΪΝΕΣ - ΕΝΖΥΜΑ Θέµατα ιάλεξης οµή, αριθµός και διαχωρισµός των αµινοξέων Ένωση αµινοξέων µε τον πεπτιδικό δεσµό

Διαβάστε περισσότερα


ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-CoA Αναπνευστική Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Μια εξωτερική µεµβράνη Τα κύτταρα συντίθενται από διάλυµα πρωτεϊνών, ηλεκτρολυτών και υδατανθράκων Με τη βοήθεια εσωτερικών µεµβρανικών συστηµάτων δια

Μια εξωτερική µεµβράνη Τα κύτταρα συντίθενται από διάλυµα πρωτεϊνών, ηλεκτρολυτών και υδατανθράκων Με τη βοήθεια εσωτερικών µεµβρανικών συστηµάτων δια Πόσα είναι τα κύτταρα του ανθρώπινου οργανισµού; Περισσότερα από 200 Μια εξωτερική µεµβράνη Τα κύτταρα συντίθενται από διάλυµα πρωτεϊνών, ηλεκτρολυτών και υδατανθράκων Με τη βοήθεια εσωτερικών µεµβρανικών

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2016 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2016 Α ΦΑΣΗ Να γράψετε τον αριθμό καθενός από τα παρακάτω θέματα και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Ποιο από τα παρακάτω ισχύει στην

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Μεταβολισμός πρωτεϊνών και των αμινοξέων

Μεταβολισμός πρωτεϊνών και των αμινοξέων Μεταβολισμός πρωτεϊνών και των αμινοξέων Πρωτεΐνες Πολυσακχαρίτες Λίπη Γαλακτικό Γλυκόζη Αμινοξέα Πρωτεΐνες οργανισμού Δεξαμενή Αζώτου Πυροστα φυλικό Γλυκονεογένεση Γλυκόλυση Acetyl-CoA 6- φωσφορική Γλυκόζη

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ Α φάση ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2006 Α φάση Να επιλέξετε τη σωστή απάντηση 1. Από τους φυσικούς πόρους δεν είναι ανανεώσιμοι: Α. Ο αέρας. Β. Το νερό. Γ. Το φυσικό αέριο. Δ. Η ηλιακή ενέργεια. 2. Κατά

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, Eπεξεργασία και Ρύθμιση της λειτουργίας τους. Ευάγγελος Κωλέττας

ΚΕΦΑΛΑΙΟ 8. Σύνθεση πρωτεϊνών, Eπεξεργασία και Ρύθμιση της λειτουργίας τους. Ευάγγελος Κωλέττας ΚΕΦΑΛΑΙΟ 8 Σύνθεση πρωτεϊνών, Eπεξεργασία και Ρύθμιση της λειτουργίας τους Ευάγγελος Κωλέττας Αναπληρωτής Καθηγητής Μοριακής Κυτταρικής Βιολογίας Εργαστήριο Γενικής Βιολογίας, Τμήμα Ιατρικής Σχολή Επιστημών

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2007 ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2007 Τίποτα στη Βιολογία δεν έχει νόημα παρά μόνο υπό το φως της εξέλιξης Α ΦΑΣΗ 1. Τα στοιχεία που είναι κοινά σε όλα τα βιομόρια είναι: Α. C, H, O Β. C, H, O, N Γ. C,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 Α ΦΑΣΗ Να γράψετε στο τετράδιό σας τον αριθμό καθενός από τα παρακάτω θέματα και δίπλα του το γράμμα που α- ντιστοιχεί στη σωστή απάντηση. 1. Στο διπεπτίδιο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

Μεταβολισμός του γλυκογόνου

Μεταβολισμός του γλυκογόνου Μεταβολισμός του γλυκογόνου Μεταβολισμός του γλυκογόνου Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ Γλυκόζη ΤΡΟΦΗ Κυκλοφορία ΓΛΥΚΟΓΟΝΟ Γλυκόζη ΗΠΑΡ Κυτταρόπλασμα ΗΠΑΡ (Οξέωση) NADH CO 2 ΟΞΕΙΔ. ΦΩΣΦ. ATP

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Μοριακή Αναγνώριση Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών 1 Μοριακή Αναγνώριση Με τον όρο μοριακή αναγνώριση περιγράφουμε την αλληλεπίδραση μεταξύ δύο

Διαβάστε περισσότερα


BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ BIOXHMEIA, TOMOΣ I ΠANEΠIΣTHMIAKEΣ EKΔOΣEIΣ KPHTHΣ Ο μεταβολισμός (του υδατάνθρακα) γλυκογόνου (Gn) Gn μια ενδιάμεση και άμεσα κινητοποιούμενη πηγή ενέργειας Ποσότητα (ενέργειας) λίπη > γλυκογόνο > Γλυκόζη

Διαβάστε περισσότερα

Χημική σύσταση του κυττάρου

Χημική σύσταση του κυττάρου 1 Χημική σύσταση του κυττάρου Τα χημικά στοιχεία, που συμμετέχουν στη δομή των βιολογικών μορίων, συγκαταλέγονται στα στοιχεία που συνθέτουν τον φλοιό της γης. Όλοι οι οργανισμοί από τον πιο απλό μέχρι

Διαβάστε περισσότερα

Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες

Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες 7-1 Κεφάλαιο 7 Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες 7.1. Το δίπλωµα των πρωτεϊνών 7.1.1. Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε µία µοναδική τρισδιάστατη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Κεφάλαιο 6. Αναδίπλωση και ευκαμψία

Κεφάλαιο 6. Αναδίπλωση και ευκαμψία Κεφάλαιο 6 Αναδίπλωση και ευκαμψία Κεφάλαιο 6 Αναδίπλωση και Ευκαμψία Εικόνα 6.1 Μια πολυπεπτιδική αλυσίδα είναι εκτεταμένη και εύκαμπτη στην αδίπλωτη, αποδιαταγμένη κατάσταση, ενώ είναι σφαιρική και συμπαγής

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2013 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2013 Α ΦΑΣΗ Να γράψετε τον αριθμό καθενός από τα παρακάτω θέματα και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Οι δεσμοί που συμβάλλουν στη συγκρότηση

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα