Η κυτταρική µετατόπιση των πρωτεϊνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η κυτταρική µετατόπιση των πρωτεϊνών"

Transcript

1 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά των προκαρυωτικών οργανισµών και έχουν τοπική δράση) που βρίσκεται στο κυτόπλασµα. Το ποια πρωτείνη συντίθεται είναι αποτέλεσµα του mrna που µεταφράζεται κάθε χρονική στιγµή. Όµως η κάθε πρωτείνη του συντίθεται στο κυτόπλασµα έχει ένα διαφορετικό προορισµό. Κάποιες είναι κυτοπλασµατικές αλλά άλλες είτε είναι µεµβρανικές και έχουν προορισµό την κυτταρική µεµβράνη ενώ άλλες είναι εξωκυττάριες και πρέπει να διασχίσουν την κυτταρική µεµβράνη. Έτσι οι πρωτείνες του πλάσµατος αίµατος παράγονται στα κύτταρα του ήπατος όµως έχουν προορισµό τα αιµοσφαίρια, οι εξωκυττάριες ινσουλίνη και πεπτικά ένζυµα παράγονται στα κύτταρα του παγκρέατος αλλά έχουν άλλους προορισµούς. Οι περισσότερες µιτοχονδριακές πρωτείνες συντίθενται στο κυτόπλασµα και επιλεκτικά µεταφέρονται στα µιτοχόνδρια. Η µεταφορά των νεοσυντιθεµένων πρωτείνων γίνεται µε διαφορετικούς τρόπους ο κυριότερος των οποίων είναι µέσω του ενδοπλασµατικού δικτύου (endoplasmic reticulum ή ER) (εικ.9.1) Η λειτουργία του ενδοπλασµατικού δικτύου. Το ενδοπλασµατικό δίκτυο είναι ένα πολύπλοκο δίκτυο µεµβρανών στο εσωτερικό των κυττάρων που σχηµατίζει κλειστούς πεπιεσµένους θύλακες. Το κυτόπλασµα βρίσκεται εκτός του ER. Στο ένα τµήµα του ER εξωτερικά βρίσκονται επικολληµένα πολλά ριβοσώµατα δίνοντας στην µεµβράνη µία ανώµαλη εµφάνιση ενώ το υπόλοιπο ER δεν έχει ριβοσώµατα δίνοντας στην µεµβράνη µία λεία εµφάνιση (εικ.9.1). Εικόνα 9.1. Το ενδοπλασµατικό δίκτυο (ER).

2 9-2 Οι πρωτείνες που δεν έχουν προορισµό το κυτόπλασµα µεταφέρονται πρώτα στο ER και µετά στον προορισµό τους. Πώς όµως διαχέονται οι πρωτείνες διαµέσου της µεµβράνης του ER. Οι πρωτείνες που έχουν προορισµό είτε το εξωτερικό του κυττάρου ή τις κοιλότητες του ενδοπλασµατικού δικτύου έχουν στο αµινοτελικό άκρο τους µία αµινοξική ακολουθία οδηγό µήκους 25 +/- 11 αµινοξέα. Η ακολουθία οδηγός ακολουθεί ένα καθορισµένο πρότυπο χωρίς όµως να είναι απόλυτα καθορισµένη (Πιν.1). Αυτή διαδοχικά συνοδεύεται από µία ακολουθία διάσπασης που αναγνωρίζεται από πρωτεολυτικά ένζυµα αµέσως πριν την ακολουθία της πρωτείνης. Πίνακας 9.1. Τυπικές οδηγοί ακολουθίες Τύπος σήµατος Εισαγωγή στο ER Παράδειγµα οδηγού ακολουθίας + H 3 N-Met-Met-Ser-Phe-Val-Ser-Leu- Leu-Leu-Val-Gly-Ile-Leu-Phe-Trp-Ala- Thr-Glu-Ala-Glu-Gln-Leu-Thr-Lys-Cys- Glu-Val-Phe-Gln- Παρακράτηση στην κοιλότητα -Lys-Asp-Glu-Leu-COO - του ER Εισαγωγή στα µιτοχόνδρια Εισαγωγή στο πυρήνα Εισαγωγή σε περοξισώµατα + H 3 N-Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile- Arg-Phe-Phe-Lys-Pro-Ala-Thr-Arg- Thr-Leu-Cys-Ser-Ser-Arg-Tyr-Leu-Leu- -Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val- -Ser-Lys-Leu- Επειδή η ακολουθία οδηγός βρίσκεται στο αµινοτελικό άκρο συντίθεται πρώτη από το ριβόσωµα. Αµέσως αυτή η ακολουθία αναγνωρίζεται από ένα σύµπλεγµα RNAπρωτείνης, που λέγεται σωµατίδιο αναγνώρισης σήµατος ή SRP (signal recognition particle), δεσµεύει το νεοπαραχθέν ολιγοπεπτίδιο και σταµατά την µετάφραση. Στην µεµβράνη του ER υπάρχουν υποδοχείς του SRP όπου το σύµπλεγµα ριβοσώµατος-srp προσκολλάται. Με µία σειρά βηµάτων όπου ένα µόριο GTP υδρολύεται σε GDP, το ριβόσωµα προσκολλάται σε πρωτείνες της µεµβράνης του ER που σχηµατίζουν τον µεταφορικό πόρο του πολυπεπτιδίου ενώ το SRP απελευθερώνεται και πάλι στο κυτόπλασµα (εικ.9.2).

3 9-3 Εικόνα 9.2. Η πρόσδεση της νεοσυσταθείσας πρωτεΐνης στο translocon. Με την απελευθέρωση του SRP η µετάφραση του πολυπεπτιδίου συνεχίζεται για µέσου του µεταφορικού πόρου µε την ακολουθία οδηγό προσδεδεµένη στον πόρο. Μία πεπτιδάση που αναγνωρίζει την ακολουθία οδηγό (πεπτιδάση σήµατος) υδρολύει την ακολουθία αυτή απελευθερώνοντας το πολυπεπτίδιο στις κοιλότητες του ενδοπλασµατικού δικτύου όπου θα ακολουθήσει το δίπλωµα (εικ.9.3). Εικόνα 9.3. Η διεργασία µεταφοράς σφαιρικής πρωτεΐνης από την κυτταρική µεµβράνη. εν είναι απόλυτα κατανοητό τι οδηγεί την πολυπεπτιδική ακολουθία διαµέσου του πόρου.

4 9-4 Εικόνα 9.4. Η διεργασία µεταφοράς σφαιρικής πρωτεΐνης από την κυτταρική µεµβράνη µε τις ενεργειακές συµµετοχές. Το ER είναι ένας κλειστός σάκος χωρίς εξόδους. Οι πρωτείνες στις κοιλότητες του ER εισάγονται σε µεταφορικά κυστίδια και µεταφέρονται σε ένα άλλο οργανίδιο, στο σύµπλοκο Golgi (εικ.9.5) µετά την σύµφυση των κυστιδίων µε την µεµβράνη του (εικ.9.6). Εικόνα 9.5. Το οργανίδιο Golgi. Η δοµή του οργανιδίου Golgi είναι απλή. Περίπου έξη επίπεδοι µεµβρανικοί σάκοι χωρίς εισόδους ή εξόδους. Λαµβάνει πρωτείνες από το ER µέσω µεταφορικών κυστιδίων και στέλνει πρωτείνες στον προορισµό τους δηµιουργώντας πάλι κυστίδια. Ένα µόνον µέρος των πρωτεϊνών που λαµβάνει από το ER εκκρίνονται και πάλι. Ένα άλλο µέρος εισάγονται σε λυσοσώµατα και περοξισώµατα. Μερικές πρωτείνες όπως η ισοµεράση του δισουλφιδίου και τα ένζυµα γλυκοσυλίωσης επιστρέφονται στο ER.

5 9-5 Εικόνα 9.6. Η µεταφορά πρωτεϊνών δια µέσου του οργανιδίου Golgi. Το οργανίδιο Golgi εκκρίνει τις πρωτείνες αφού πρώτα τις ενσωµατώσει σε κυστίδια που µετατοπίζονται προς την εξωκυττάρια µεµβράνη (εικ.9.6). Υπάρχουν δύο τύποι έκκρισης. Στον πρώτο οι πρωτείνες απελευθερώνονται συνεχώς όπως παράγονται. Σε αυτή την κατηγορία ανήκουν οι πρωτείνες του πλάσµατος που απελευθερώνονται από το ήπαρ χωρίς άλλη διέγερση. Σε αυτή τη διαδικασία τα κυστίδια ενσωµατώνονται µε την κυτταρική µεµβράνη απελευθερώνοντας το πρωτεϊνικό τους φορτίο. Στη δεύτερη, όπως στην περίπτωση των πεπτικών ενζύµων στο πάγκρεας, η απελευθέρωση των ενζύµων γίνεται µόνον όταν υπάρχει τροφή για πέψη. Σε αυτή την περίπτωση τα κυστίδια από το Golgi είναι µεγαλύτερα και αποθηκεύουν τα ένζυµα µέχρι να δηµιουργηθεί κάποια διέγερση, ορµονική ή νευρική οπότε µε εξωκύττωση γίνεται η απελευθέρωση των ενζύµων.

6 Αναγνώριση του στόχου και σηµατοδότες προορισµού. Τα κυστίδια µπορούν και αναγνωρίζουν συγκεκριµένες µεµβρανικές περιοχές διαµέσου πρωτεϊνών αναγνώρισης που βρίσκονται στην επιφάνεια τους. Ο µηχανισµός διαχωρισµού των πρωτεϊνών στο Golgi εµπλέκει υποδοχείς που αναγνωρίζουν συγκεκριµένες ακολουθίες των πρωτεϊνών που θα διαχωριστούν. Για την περίπτωση των πρωτεϊνών που θα επιστρέψουν στο ER η πεπτιδική ακολουθία σήµα είναι το τετραπεπτίδιο Λυσίνη-Ασπαρτικό-Γλουταµικό-Λευκίνη ή KDEL από τα αρχικά των αµινοξέων. Στην περίπτωση των ενζύµων µε προορισµό τα λυσοσώµατα το σήµα προορισµού βρίσκεται στο πολυσακχαρίτη της γλυκοπρωτείνης. Τα γλυκοσυλιωµένα ένζυµα µε προορισµό λυσοσώµατα αναγνωρίζονται από ένα σύστηµα ενζύµων στο Golgi και το σάκχαρο µανόζη φωσφορυλιώνεται. Το φωσφορυλιωµένο σάκχαρο προσδένεται σε εσωτερικούς υποδοχείς του Golgi και το ένζυµο ενσωµατώνεται στο εσωτερικό του κυστιδίου (εικ.9.6). Οι µεµβρανικές πρωτείνες επίσης συντίθενται στο ER τοποθετούνται στην µεµβράνη του ER µεταφέρονται στο Golgi σε κυστίδια και κατόπιν στην κυτταρική µεµβράνη. Η διαφορά από τις σφαιρικές πρωτείνες είναι πώς ενώ στις πρώτες το πολυπεπτίδιο διέρχεται δια µέσου του πόρου από την άλλη πλευρά της µεµβράνης στην περίπτωση των µεµβρανικών προσαρτάται σε αυτήν (εικ.9.7,9.8). Εικόνα 9.7. Η ενσωµάτωση ιδιοσυστατικών µεµβρανικών πρωτεϊνών µε ένα διαµεµβρανικό τµήµα στην κυτταρική µεµβράνη. Όλη η απαραίτητη πληροφορία που ορίζει αν και πως η πολυπεπτιδική αλυσίδα θα ενσωµατωθεί στην µεµβράνη περιέχεται στην αµινοξική ακολουθία. Η απλούστερη περίπτωση είναι αυτή που περιέχεται στο πολυπεπτίδιο µία ακολουθία διακοπής της µεταφοράς (stop transfer) ή ακολουθία πρόσδεσης. Αυτή προσκολλάται στο εσωτερικό στο υδρόφοβο εσωτερικό της διλιπιδικής στοιβάδας και σταµατά κάθε

7 9-7 περαιτέρω µεταφορά. Το ριβόσωµα κατόπιν ολοκληρώνει την µετάφραση/σύνθεση του καρβοξυλοτελικού άκρου από την άλλη πλευρά της µεµβράνης (εικ.9.7). Στην περίπτωση µεµβρανικών πρωτεϊνών µε περισσότερα του ενός διαµεµβρανικά τµήµατα η ακολουθία οδηγός δεν προηγείται του αµινοτελικού άκρου του πολυπεπτιδίου αλλά βρίσκεται ενσωµατωµένη σε αυτό (εικ.9.8). Εικόνα 9.8. Η ενσωµάτωση ιδιοσυστατικών µεµβρανικών πρωτεϊνών µε περισσότερα του ενός διαµεµβρανικά τµήµατα στην κυτταρική µεµβράνη.

8 Μετάθεση των πρωτεϊνών στα µιτοχόνδρια, τους χλωροπλάστες και στο πυρήνα. Στα ευκαρυωτικά κύτταρα υπάρχει ένας τελείως διαφορετικός τρόπος µετάθεσης των πρωτεϊνών στα µιτοχόνδρια ή χλωροπλάστες. Το µιτοχόνδριο παρ ότι έχει το δικό του γενετικό υλικό και µηχανισµούς µετάφρασης εισάγει το 95% των πρωτεινών από το κυτόπλασµα. Οι µιτοχονδριακές αυτές πρωτείνες, που κωδικοποιούνται από το πυρήνα, παράγονται στο κυτόπλασµα από ελεύθερα ριβοσώµατα στην µορφή των ανενεργών προ-πρωτεϊνών. Όπως αναδύεται το πολυπεπτίδιο από το ριβόσωµα µοριακοί ακόλουθοι προσδένονται που το κρατούν σε αποδιατεταγµένη µορφή. Η πρωτείνη διασχίζει την µιτοχονδριακή µεµβράνη σε αυτή την µορφή και λαµβάνει την στερεοδοµή της µε την βοήθεια άλλων µοριακών ακολούθων στο εσωτερικό του µιτοχονδρίου. Εικόνα 9.9. Η µεταφορά πρωτεϊνών στο µιτοχόνδριο. Η µιτοχονδριακή αµινοξική ακολουθία οδηγός είναι αµινοξέα. Οι ακολουθίες αυτές διαφέρουν από πρωτείνη σε πρωτείνη αλλά όλες έχουν µία κοινή στερεοδοµή που είναι µία αµφιπαθική α-έλικα µε την µία πλευρά της θετικά φορτισµένη και την άλλη κυρίως υδρόφοβη. Αυτή προσδένεται στους υποδοχείς της εξωτερικής µεµβράνης του µιτοχονδρίου. Στην απλούστερη περίπτωση η ακολουθία οδηγός σύρει την πολυπεπτιδική αλυσίδα για µέσω πόρου της µιτοχονδριακής µεµβράνης και µετά αποκόπτεται (εικ.9.9). Εάν ο προορισµός της πρωτείνης είναι διαµεµβρανική θέση τότε η προ-πρωτείνη έχει δύο ακολουθίες οδηγούς. Η πρώτη την οδηγεί στο µιτοχονδριακό ενδόπλασµα και αποκόπτεται. Η αποκοπή αυτή προβάλει την δεύτερη που οδηγεί το πολυπεπτίδιο πίσω διαµέσου της µιτοχονδριακής µεµβράνης στο µεσοµεµβρανικό διάστηµα. Τότε και η δεύτερη ακολουθία οδηγός αποκόπτεται.

9 9-9 Εικόνα Η µεταφορά πρωτεϊνών στο κυτταρικό πυρήνα. Ο πυρήνας ενός κυττάρου περιβάλλεται από διπλή πυρηνική µεµβράνη. Οι πρωτείνες που παράγονται στο κυτόπλασµα µετατίθενται στο πυρήνα δια µέσω ειδικών πόρων (εικ.9.10). Και σε αυτή την περίπτωση ένα ολιγοπεπτίδιο είναι η ακολουθία οδηγός που υποβοηθά την πρωτείνη να περάσει διαµέσου του µεµβρανικού πόρου. Οι µικρές ιστόνες δεν έχουν τέτοια ακολουθία ενώ στους µεταγραφικούς παράγοντες η ακολουθία σήµατος ενσωµατώνεται στην πολυπεπτιδική αλυσίδα της πρωτείνης.

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013)

Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Aναδίπλωση και επεξεργασία των πρωτεϊνών

Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ

ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΤΡΗΝΑ ΣΟΤ ΚΤΣΣΑΡΟΤ: ΔΟΜΗ, ΛΕΙΣΟΤΡΓΙΑ, ΔΙΑΚΙΝΗΗ ΤΣΑΣΙΚΩΝ ΔΙΑΜΕΟΤ ΣΗ ΠΤΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΓΤΜΝΑΙΟ ΚΕΡΑΣΕΑ ΦΟΛ. ΕΣΟ 2011-12 ΣΜΗΜΑ Γ3 ΟΡΥΑΝΙΔΗ ΓΙΩΡΓΟ ΙΔΕΡΗ ΒΑΓΓΕΛΗ Σο κύτταρο είναι η μικρότερη ζωντανή μονάδα,

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ

ΤΟ ΚΥΤΤΑΡΟ ΠΥΡΗΝΑ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΤΟ ΚΥΤΤΑΡΟ ΚΥΤΤΑΡΟΠΛΑΣΜΑ ΠΥΡΗΝΑ ΟΡΓΑΝΥΛΛΙΑ ΥΑΛΟΠΛΑΣΜΑ ΠΥΡΗΝΙΟ ΠΥΡΗΝΙΚΗ ΜΕΜΒΡΑΝΗ ΠΥΡΗΝΙΚΟΣ ΦΛΟΙΟΣ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΑΝΟΡΓΑΝΕΣ και ΟΡΓΑΝΙΚΕΣ ενώσεις ΑΝΟΡΓΑΝΕΣ C, O, N, H, P, S, Cl,, J, Fe, Cu Άλατα των παραπάνω

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Γιατί διαιρούνται τα κύτταρα;

Γιατί διαιρούνται τα κύτταρα; Η κυτταροδιαίρεση Γιατί διαιρούνται τα κύτταρα; Για να αναπαραχθούν. Για να αυξηθεί το µέγεθος των οργανισµών. Για να αναπληρωθούν φθαρµένα ή κατεστραµµένα κύτταρα. ιαδικασία κυτταροδιαίρεσης µε εκβλάστηση

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής ΚΥΤΤΑΡΟ Η θεμελιώδης μονάδα της ζωής Κύτταρο Η βασική δομική και λειτουργική μονάδα που εκδηλώνει το φαινόμενο της ζωής. Πρώτος ο Βρετανός Robert Hooke το 1665 παρατηρώντας με το μικροσκόπιο λεπτές τομές

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ

ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ Σε ποιες κατηγορίες κατατάσσονται οι ορµόνες µε βάση τη χηµική τους φύση. Αναφέρετε από ένα παράδειγµα Περιγράψτε πως γίνεται η επικοινωνία των κυττάρων µε µηνυµατοφόρα

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΙΣΑΓΩΓΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΗ ΣΧΟΛΗ ΑΓΡΙΝΙΟΥ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΕΤΟΣ ΣΠΟΥΔΩΝ 1ο Ζωολογία Δ. Ματθόπουλος 1 ΥΠΕΥΘΥΝΟΙ Από έδρας Δ. Ματθόπουλος Ζωολογία Δ. Ματθόπουλος

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής Ενότητα 2.1: Το πορτραίτο του ευκαρυωτικού κυττάρου Ενότητα 2.2: Πλασματική μεμβράνη: το λεπτό σύνορο ανάμεσα στην άβια ύλη και στη ζωή Ενότητα 2.3: Μια

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΚΗ ΣΗΜΑΣΙΑ ΜΕΜΒΡΑΝΩΝ

ΒΙΟΛΟΓΙΚΗ ΣΗΜΑΣΙΑ ΜΕΜΒΡΑΝΩΝ ΒΙΟΛΟΓΙΚΗ ΣΗΜΑΣΙΑ ΜΕΜΒΡΑΝΩΝ Μεντζάλη Ευαγγελία Ένα ζωντανό κύτταρο είναι ένα αυτοαναπαραγόµενο σύστηµα µορίων, το οποίο συγκρατείται µέσα σε ένα περίβληµα. Το περίβληµα αυτό είναι η κυτταρική ή πλασµατική

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)!

Kυτταρική$Bιολογία$ Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)! Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)! Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! Τα*κύρια*σημεία*των*διαλέξεων*17*&*18 Αποικοδόμηση!&οξείδωση!μακρομορίων,!βιολογικές!οξειδώσεις!&παραγωγή!

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία»

AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία» Α ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΜΟΙΡΩΝ ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ 2ΟΥ ΤΕΤΡΑΜΗΝΟΥ AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία» ΟΙ ΜΑΘΗΤΕΣ: Αδικημενάκη Καλλιόπη Ζαχαριουδάκη Χαρά Λαγουδάκη Αφροδίτη

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας ΤΟ ΚΥΤΤΑΡΟ Προκαρυωτικό κύτταρο: πυρηνοειδές Αρχαία Βακτήρια Ευκαρυωτικό κύτταρο: πυρήνας Δομή: μεμβρανικά οργανίδια Παραγωγή ενέργειας Δομή γενετικού υλικού Διαίρεση / Αναπαραγωγή Γενετικός ανασυνδυασμός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016)

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων Τα κύρια σημεία των διαλέξεων 24 & 25 Αποικοδόμηση & οξείδωση μακρομορίων,

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης Περιήγηση στο εσωτερικό του Κυττάρου Φώτης Καρβέλης Όλα τα κύτταρα οριοθετούνται από την πλασματική μεμβράνη ή το κυτταρικό τοίχωμα που την περιβάλλει. Εσωτερικά της πλασματικής μεμβράνης υπάρχουν τα οργανίδια

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΕΡΑΣΜΕΙΟΣ ΕΛΛΗΝΟΓΕΡΜΑΝΙΚΗ ΣΧΟΛΗ

ΕΡΑΣΜΕΙΟΣ ΕΛΛΗΝΟΓΕΡΜΑΝΙΚΗ ΣΧΟΛΗ ΕΡΑΣΜΕΙΟΣ ΕΛΛΗΝΟΓΕΡΜΑΝΙΚΗ ΣΧΟΛΗ Ιδιωτικό Γενικό Λύκειο Όνομα: Ημερομηνία:./04/2014 ΤΑΞΗ : A Λυκείου ΕΡΩΤΗΣΕΙΣ ΓΙΑ ΤΟ 1 ο ΘΕΜΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ ΚΕΦΑΛΑΙΟ 11: Ενδοκρινείς αδένες ΒΙΟΛΟΓΙΑ Α ΛΥΚΕΙΟΥ

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ(

Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής

ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ. Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΠΡΟΠΤΥΧΙΑΚΟ ΠΡΟΓΡΑΜΜΑ ΣΠΥΔΩΝ ΤΕΦΑΑ/ΔΠΘ ΜΑΘΗΜΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΠΟΝΗΤΙΚΗΣ ΒΙΟΧΗΜΕΙΑ ΤΗΣ ΑΣΚΗΣΗΣ Φατούρος Γ. Ιωάννης, Επίκουρος Καθηγητής ΔΙΑΛΕΞΗ 1 - ΓΡΗΓΟΡΗ ΑΝΑΣΚΟΠΗΣΗ ΒΑΣΙΚΩΝ ΓΝΩΣΕΩΝ A. Το Περιβάλλον του

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ αναπαραγωγή αύξηση αριθµού κυττάρων ανάπτυξη επιδιόρθωση ιστών Κυτταρική οργάνωση του γενετικού υλικού Γονιδίωµα: Το σύνολο του γενετικού υλικού (DNA) ενός κυττάρου Στα προκαρυωτικά κύτταρα

Διαβάστε περισσότερα

Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D.

Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D. Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής ΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΠΡΩΤΕΪΝΩΝ Ιωάννης Π. Τρουγκάκος, Ph.D. ΓΕΝΙΚΑ Το επιτυχηµένο σύστηµα αποθήκευσης, κωδικοποίησης

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

4 ΣΥΓΚΡΟΤΗΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ

4 ΣΥΓΚΡΟΤΗΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ 4 ΣΥΓΚΡΟΤΗΣΗ ΤΩΝ ΒΙΟΛΟΓΙΚΩΝ ΜΕΜΒΡΑΝΩΝ Σύνοψη Στο κεφάλαιο αυτό εισάγεται η έννοια της τοπολογίας των μεμβρανικών συστατικών και αυτή συνδέεται με την τοπολογία της βιοσύνθεσης και τους μηχανισμούς διαλογής,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ

ΟΛΛΙΝΤΖΑ ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ Κ Kάνιγγος ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΟΛΛΙΝΤΖΑ 10, (5ος όροφ. Τηλ: 210-3300296-7. www.kollintzas.gr 1. Χημική σύσταση του κυττάρου. 2. Δομή και λειτουργία του κυττάρου. 3. Μεταβολισμός: βασικές αρχές,

Διαβάστε περισσότερα

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο

Μοριακή Αναγνώριση. 5.1. Εισαγωγή. 5.2. Σταθερές σύνδεσης και αποχωρισµού. [A][B] k d = ----------- [AB] [ΑΒ] k i = ---------- [Α][Β] Κεφάλαιο Κεφάλαιο 5-1 5 Μοριακή Αναγνώριση 5.1. Εισαγωγή Ένα από τα σηµαντικότερα χαρακτηριστικά των ζωντανών οργανισµών είναι ότι τα µακροµόρια που περιέχουν κάνουν πολύ εξειδικευµένες αλληλεπιδράσεις µε άλλα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

Ε νότητα 2 η : ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 2 η : ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ε νότητα 2 η : ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει: Να αναγνωρίζει το κύπαρο ως τη δομική και λειτουργική μονάδας όλων

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012

ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 Α ΦΑΣΗ Να γράψετε στο τετράδιό σας τον αριθμό καθενός από τα παρακάτω θέματα και δίπλα του το γράμμα που α- ντιστοιχεί στη σωστή απάντηση. 1. Στο διπεπτίδιο

Διαβάστε περισσότερα

Λειτουργίες των µεµβρανών

Λειτουργίες των µεµβρανών Λειτουργίες των µεµβρανών Οιµεµβράνεςδεναπoτελoύvµόνοπαθητικάπεριβλήµατα, τα οποία οριοθετούν προστατεύουν και µονώνουν τα κύτταρα και τα οργανίδιά τους συµµετέχουν στη διατήρηση του σχήµατος και στις

Διαβάστε περισσότερα

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4

ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ. Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Πετρολιάγκης Σταμάτης Τμήμα Γ4 ΕΝΝΟΙΑ ΤΗΣ ΠΛΑΣΜΑΤΙΚΗΣ ΜΕΜΒΡΑΝΗΣ Η κυτταρική μεμβράνη ή πλασματική μεμβράνη είναι η εξωτερική μεμβράνη που περιβάλλει το κύτταρο

Διαβάστε περισσότερα

Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ

Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ Δομή πλασματικής μεμβράνης & διαπερατότητα ΕΥΚΑΡΥΩΤΙΚO ΚYΤΤΑΡΟ ΚΥΤΤΑΡΟ Κύτταρο: Βασική μονάδα της ζωής με δυνατότητα αναπαραγωγής Μονοκύτταροι Πολλαπλασιασμός με απλή διχοτόμηση Πολυκύτταροι Πολλαπλασιασμός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια

Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια ΕΠΙΝΕΦΡΙΔΙΑ Φλοιοτρόπος ορμόνη ή Κορτικοτροπίνη (ACTH) και συγγενή πεπτίδια 39 αμινοξέα Μ.Β. 4500 προοπιομελανοκορτίνη(pomc) 1. κορτικοτροπίνη (ACTH), 2. β λιποτροφίνη (β LPH), 3. γ λιποτροφίνη (γ LPH),

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης 1 Αποµόνωση του κυττάρου από το περιβάλλον 2 Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά σήµατα 3. Συνδέει γειτονικά

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΙV. Το ευκαρυωτικό κύτταρο. Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός

ΙV. Το ευκαρυωτικό κύτταρο. Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός ΙV. Το ευκαρυωτικό κύτταρο Γενικά στοιχεία Μορφή Δομή & Οργάνωση Πυρήνας Ενεργειακά κέντρα Κυτταρικός σκελετός Ευ-καρυωτικοί = εμπύρηνα κύτταρα, με υψηλή οργάνωση και διαμερισματοποίηση 1 ευκ. κύτταρο

Διαβάστε περισσότερα

ΔΟΜΗ ΤΟΥ ΒΑΚΤΗΡΙΑΚΟΥ. Γεώργιος Φιλιούσης Επίκουρος Καθηγητής Τμήμα Κτηνιατρικής Α.Π.Θ

ΔΟΜΗ ΤΟΥ ΒΑΚΤΗΡΙΑΚΟΥ. Γεώργιος Φιλιούσης Επίκουρος Καθηγητής Τμήμα Κτηνιατρικής Α.Π.Θ ΔΟΜΗ ΤΟΥ ΒΑΚΤΗΡΙΑΚΟΥ ΚΥΤΤΑΡΟΥ Γεώργιος Φιλιούσης Επίκουρος Καθηγητής Τμήμα Κτηνιατρικής Α.Π.Θ Βασικά σημεία παρουσίασης Τα βακτήρια είναι οργανισμοί προκαρυωτικοί, μονοκύτταροι, απλής δομής και σχήματος.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ B ΛΥΚΕΙΟΥ ΦΥΛΛΑΔΙΟ ΤΡΙΤΟ ΚΥΤΤΑΡΙΚΗ ΟΡΓΑΝΩΣΗ

ΒΙΟΛΟΓΙΑ B ΛΥΚΕΙΟΥ ΦΥΛΛΑΔΙΟ ΤΡΙΤΟ ΚΥΤΤΑΡΙΚΗ ΟΡΓΑΝΩΣΗ ΒΙΟΛΟΓΙΑ B ΛΥΚΕΙΟΥ ΦΥΛΛΑΔΙΟ ΤΡΙΤΟ ΚΥΤΤΑΡΙΚΗ ΟΡΓΑΝΩΣΗ 2016 2 ΚΥΤΤΑΡΙΚΗ ΟΡΓΑΝΩΣΗ Λέξεις-κλειδιά ΕΙΣΑΓΩΓΗ Τρία βασικά σημεία της κυτταρικής θεωρίας... Κύτταρο... Σχέση επιφάνειας και όγκου του κυττάρου...

Διαβάστε περισσότερα

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη

Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη Ανακεφαλαιώνοντας, οι διάφορες ρυθµίσεις ώστε να µη γίνεται ταυτόχρονα και βιοσύνθεση και β-οξείδωση είναι οι ακόλουθες: Ηγλυκαγόνηκαιηεπινεφρίνη (αδρεναλίνη) ευνοούν τη β-οξείδωση και την κινητοποίηση

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ

ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΧΗΜΙΚΗ ΣΥΣΤΑΣΗ ΤΟΥ ΚΥΤΤΑΡΟΥ ΜΑΚΡΟΜΟΡΙΑ ΕΙΣΑΓΩΓΗ Oι ζωντανοί οργανισμοί αποτελούνται από ένα ή περισσότερα κύτταρα. Χαρακτηρίζονται αντίστοιχα, μονοκύτταροι (μονοκυτταρικοί) και πολυκύτταροι (πολυκυτταρικοί)

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΙ ΒΙΟΔΙΑΒΡΩΣΗ. Σημειώσεις για τους Φοιτητές του ΤΕΙ Ιονίων Νήσων Θεοδώρα Αγαλιώτη PhD

ΒΙΟΛΟΓΙΑ ΚΑΙ ΒΙΟΔΙΑΒΡΩΣΗ. Σημειώσεις για τους Φοιτητές του ΤΕΙ Ιονίων Νήσων Θεοδώρα Αγαλιώτη PhD ΒΙΟΛΟΓΙΑ ΚΑΙ ΒΙΟΔΙΑΒΡΩΣΗ Σημειώσεις για τους Φοιτητές του ΤΕΙ Ιονίων Νήσων Θεοδώρα Αγαλιώτη PhD Κεφάλαιο 1- Κύτταρο Γενικά. Είναι το κύτταρο ένα ασύληπτα πολύπλοκο εργοστάσιο παραγωγής ενέργειας ή ένας

Διαβάστε περισσότερα

Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ

Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Τίτλος Μαθήματος: Γενική Μικροβιολογία Ενότητα: ΕΥΚΑΡΥΩΤΙΚΑ ΚΑΙ ΠΡΟΚΑΡΥΩΤΙΚΑ ΚΥΤΤΑΡΑ Διδάσκων: Καθηγητής Ιωάννης Σαββαΐδης Τμήμα: Χημείας ΚΕΦΑΛΑΙΟ 3 Ευκαρυωτικά και Προκαρυωτικά Κύτταρα Οι διάφορες βιοχημικές

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 13 : Πολυκυτταρική οργάνωση και διακυτταρικές συνδέσεις Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A

ΚΕΦΑΛΑΙΟ 11. Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα. Μέρος A ΚΕΦΑΛΑΙΟ 11 Βιοενεργητική & Μεταβολισµός: Μιτοχόνδρια, Χλωροπλάστες & Υπεροξειδιοσώµατα Μέρος A ΠΕΡΙ ΕΝΕΡΓΕΙΑΣ Α. Η λειτουργία απλών µηχανών εξαρτάται από ενέργεια: - κίνηση αυτοκινήτου= βενζίνη / πετρέλαιο

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ

ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ Ιωάννης Π. Τρουγκάκος Τομέας Βιολογίας Κυττάρου & Βιοφυσικής Τμήμα Βιολογίας, Παν/μιο Αθηνών ΜΕΤΑ-ΜΕΤΑΦΡΑΣΤΙΚΗ ΤΡΟΠΟΠΟΙΗΣΗ ΔΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΠΡΩΤΕΪΝΩΝ ΚΑΙ ΚΥΤΤΑΡΙΚΗ ΠΟΛΙΚΟΤΗΤΑ ΚΥΤΤΟΣΟΛΙΟ ΠΥΡΗΝΑΣ ΥΠΕΡΟΞΕΙΣΩΜΑΤΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α.1. γ Α.2. β Α.3. α Α.4. δ Α.5. α ΘΕΜΑ Β Β.1. σελ. 123-124: «Η γονιδιακή θεραπεία εισάγονται πάλι σ αυτόν.» Β.2. σελ. 133:

Διαβάστε περισσότερα

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους

και χρειάζεται μέσα στο ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. ενζύμων κύτταρο τρόπους Για να εξασφαλιστεί η σωστή και αρμονική έκφραση των ενζύμων μέσα στο κύτταρο χρειάζεται ρύθμιση εναρμόνιση των διαφόρων ενζυμικών δραστηριοτήτων. και Η εναρμόνιση αυτή επιτυγχάνεται με διάφορους τρόπους

Διαβάστε περισσότερα

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Δομή Αντιγραφή Μεταγραφή Μετάφραση DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΝΟΥΚΛΕΪΝΙΚΑ ΟΞΕΑ Είναι τα βιοπολυμερή που η δομική τους μονάδα είναι τα νουκλεοτίδια Διακρίνονται στο DNA (δεσοξυριβονουκλεϊκό οξύ), στο RNA (ριβονουκλεϊκό

Διαβάστε περισσότερα