Η κυτταρική µετατόπιση των πρωτεϊνών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Η κυτταρική µετατόπιση των πρωτεϊνών"


1 9-1 Κεφάλαιο 9 Η κυτταρική µετατόπιση των πρωτεϊνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από µόνο ένα τύπο ριβοσώµατος (εκτός των µιτοχονδριακών και των χλωροπλαστικών που µοιάζουν µε αυτά των προκαρυωτικών οργανισµών και έχουν τοπική δράση) που βρίσκεται στο κυτόπλασµα. Το ποια πρωτείνη συντίθεται είναι αποτέλεσµα του mrna που µεταφράζεται κάθε χρονική στιγµή. Όµως η κάθε πρωτείνη του συντίθεται στο κυτόπλασµα έχει ένα διαφορετικό προορισµό. Κάποιες είναι κυτοπλασµατικές αλλά άλλες είτε είναι µεµβρανικές και έχουν προορισµό την κυτταρική µεµβράνη ενώ άλλες είναι εξωκυττάριες και πρέπει να διασχίσουν την κυτταρική µεµβράνη. Έτσι οι πρωτείνες του πλάσµατος αίµατος παράγονται στα κύτταρα του ήπατος όµως έχουν προορισµό τα αιµοσφαίρια, οι εξωκυττάριες ινσουλίνη και πεπτικά ένζυµα παράγονται στα κύτταρα του παγκρέατος αλλά έχουν άλλους προορισµούς. Οι περισσότερες µιτοχονδριακές πρωτείνες συντίθενται στο κυτόπλασµα και επιλεκτικά µεταφέρονται στα µιτοχόνδρια. Η µεταφορά των νεοσυντιθεµένων πρωτείνων γίνεται µε διαφορετικούς τρόπους ο κυριότερος των οποίων είναι µέσω του ενδοπλασµατικού δικτύου (endoplasmic reticulum ή ER) (εικ.9.1) Η λειτουργία του ενδοπλασµατικού δικτύου. Το ενδοπλασµατικό δίκτυο είναι ένα πολύπλοκο δίκτυο µεµβρανών στο εσωτερικό των κυττάρων που σχηµατίζει κλειστούς πεπιεσµένους θύλακες. Το κυτόπλασµα βρίσκεται εκτός του ER. Στο ένα τµήµα του ER εξωτερικά βρίσκονται επικολληµένα πολλά ριβοσώµατα δίνοντας στην µεµβράνη µία ανώµαλη εµφάνιση ενώ το υπόλοιπο ER δεν έχει ριβοσώµατα δίνοντας στην µεµβράνη µία λεία εµφάνιση (εικ.9.1). Εικόνα 9.1. Το ενδοπλασµατικό δίκτυο (ER).

2 9-2 Οι πρωτείνες που δεν έχουν προορισµό το κυτόπλασµα µεταφέρονται πρώτα στο ER και µετά στον προορισµό τους. Πώς όµως διαχέονται οι πρωτείνες διαµέσου της µεµβράνης του ER. Οι πρωτείνες που έχουν προορισµό είτε το εξωτερικό του κυττάρου ή τις κοιλότητες του ενδοπλασµατικού δικτύου έχουν στο αµινοτελικό άκρο τους µία αµινοξική ακολουθία οδηγό µήκους 25 +/- 11 αµινοξέα. Η ακολουθία οδηγός ακολουθεί ένα καθορισµένο πρότυπο χωρίς όµως να είναι απόλυτα καθορισµένη (Πιν.1). Αυτή διαδοχικά συνοδεύεται από µία ακολουθία διάσπασης που αναγνωρίζεται από πρωτεολυτικά ένζυµα αµέσως πριν την ακολουθία της πρωτείνης. Πίνακας 9.1. Τυπικές οδηγοί ακολουθίες Τύπος σήµατος Εισαγωγή στο ER Παράδειγµα οδηγού ακολουθίας + H 3 N-Met-Met-Ser-Phe-Val-Ser-Leu- Leu-Leu-Val-Gly-Ile-Leu-Phe-Trp-Ala- Thr-Glu-Ala-Glu-Gln-Leu-Thr-Lys-Cys- Glu-Val-Phe-Gln- Παρακράτηση στην κοιλότητα -Lys-Asp-Glu-Leu-COO - του ER Εισαγωγή στα µιτοχόνδρια Εισαγωγή στο πυρήνα Εισαγωγή σε περοξισώµατα + H 3 N-Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile- Arg-Phe-Phe-Lys-Pro-Ala-Thr-Arg- Thr-Leu-Cys-Ser-Ser-Arg-Tyr-Leu-Leu- -Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val- -Ser-Lys-Leu- Επειδή η ακολουθία οδηγός βρίσκεται στο αµινοτελικό άκρο συντίθεται πρώτη από το ριβόσωµα. Αµέσως αυτή η ακολουθία αναγνωρίζεται από ένα σύµπλεγµα RNAπρωτείνης, που λέγεται σωµατίδιο αναγνώρισης σήµατος ή SRP (signal recognition particle), δεσµεύει το νεοπαραχθέν ολιγοπεπτίδιο και σταµατά την µετάφραση. Στην µεµβράνη του ER υπάρχουν υποδοχείς του SRP όπου το σύµπλεγµα ριβοσώµατος-srp προσκολλάται. Με µία σειρά βηµάτων όπου ένα µόριο GTP υδρολύεται σε GDP, το ριβόσωµα προσκολλάται σε πρωτείνες της µεµβράνης του ER που σχηµατίζουν τον µεταφορικό πόρο του πολυπεπτιδίου ενώ το SRP απελευθερώνεται και πάλι στο κυτόπλασµα (εικ.9.2).

3 9-3 Εικόνα 9.2. Η πρόσδεση της νεοσυσταθείσας πρωτεΐνης στο translocon. Με την απελευθέρωση του SRP η µετάφραση του πολυπεπτιδίου συνεχίζεται για µέσου του µεταφορικού πόρου µε την ακολουθία οδηγό προσδεδεµένη στον πόρο. Μία πεπτιδάση που αναγνωρίζει την ακολουθία οδηγό (πεπτιδάση σήµατος) υδρολύει την ακολουθία αυτή απελευθερώνοντας το πολυπεπτίδιο στις κοιλότητες του ενδοπλασµατικού δικτύου όπου θα ακολουθήσει το δίπλωµα (εικ.9.3). Εικόνα 9.3. Η διεργασία µεταφοράς σφαιρικής πρωτεΐνης από την κυτταρική µεµβράνη. εν είναι απόλυτα κατανοητό τι οδηγεί την πολυπεπτιδική ακολουθία διαµέσου του πόρου.

4 9-4 Εικόνα 9.4. Η διεργασία µεταφοράς σφαιρικής πρωτεΐνης από την κυτταρική µεµβράνη µε τις ενεργειακές συµµετοχές. Το ER είναι ένας κλειστός σάκος χωρίς εξόδους. Οι πρωτείνες στις κοιλότητες του ER εισάγονται σε µεταφορικά κυστίδια και µεταφέρονται σε ένα άλλο οργανίδιο, στο σύµπλοκο Golgi (εικ.9.5) µετά την σύµφυση των κυστιδίων µε την µεµβράνη του (εικ.9.6). Εικόνα 9.5. Το οργανίδιο Golgi. Η δοµή του οργανιδίου Golgi είναι απλή. Περίπου έξη επίπεδοι µεµβρανικοί σάκοι χωρίς εισόδους ή εξόδους. Λαµβάνει πρωτείνες από το ER µέσω µεταφορικών κυστιδίων και στέλνει πρωτείνες στον προορισµό τους δηµιουργώντας πάλι κυστίδια. Ένα µόνον µέρος των πρωτεϊνών που λαµβάνει από το ER εκκρίνονται και πάλι. Ένα άλλο µέρος εισάγονται σε λυσοσώµατα και περοξισώµατα. Μερικές πρωτείνες όπως η ισοµεράση του δισουλφιδίου και τα ένζυµα γλυκοσυλίωσης επιστρέφονται στο ER.

5 9-5 Εικόνα 9.6. Η µεταφορά πρωτεϊνών δια µέσου του οργανιδίου Golgi. Το οργανίδιο Golgi εκκρίνει τις πρωτείνες αφού πρώτα τις ενσωµατώσει σε κυστίδια που µετατοπίζονται προς την εξωκυττάρια µεµβράνη (εικ.9.6). Υπάρχουν δύο τύποι έκκρισης. Στον πρώτο οι πρωτείνες απελευθερώνονται συνεχώς όπως παράγονται. Σε αυτή την κατηγορία ανήκουν οι πρωτείνες του πλάσµατος που απελευθερώνονται από το ήπαρ χωρίς άλλη διέγερση. Σε αυτή τη διαδικασία τα κυστίδια ενσωµατώνονται µε την κυτταρική µεµβράνη απελευθερώνοντας το πρωτεϊνικό τους φορτίο. Στη δεύτερη, όπως στην περίπτωση των πεπτικών ενζύµων στο πάγκρεας, η απελευθέρωση των ενζύµων γίνεται µόνον όταν υπάρχει τροφή για πέψη. Σε αυτή την περίπτωση τα κυστίδια από το Golgi είναι µεγαλύτερα και αποθηκεύουν τα ένζυµα µέχρι να δηµιουργηθεί κάποια διέγερση, ορµονική ή νευρική οπότε µε εξωκύττωση γίνεται η απελευθέρωση των ενζύµων.

6 Αναγνώριση του στόχου και σηµατοδότες προορισµού. Τα κυστίδια µπορούν και αναγνωρίζουν συγκεκριµένες µεµβρανικές περιοχές διαµέσου πρωτεϊνών αναγνώρισης που βρίσκονται στην επιφάνεια τους. Ο µηχανισµός διαχωρισµού των πρωτεϊνών στο Golgi εµπλέκει υποδοχείς που αναγνωρίζουν συγκεκριµένες ακολουθίες των πρωτεϊνών που θα διαχωριστούν. Για την περίπτωση των πρωτεϊνών που θα επιστρέψουν στο ER η πεπτιδική ακολουθία σήµα είναι το τετραπεπτίδιο Λυσίνη-Ασπαρτικό-Γλουταµικό-Λευκίνη ή KDEL από τα αρχικά των αµινοξέων. Στην περίπτωση των ενζύµων µε προορισµό τα λυσοσώµατα το σήµα προορισµού βρίσκεται στο πολυσακχαρίτη της γλυκοπρωτείνης. Τα γλυκοσυλιωµένα ένζυµα µε προορισµό λυσοσώµατα αναγνωρίζονται από ένα σύστηµα ενζύµων στο Golgi και το σάκχαρο µανόζη φωσφορυλιώνεται. Το φωσφορυλιωµένο σάκχαρο προσδένεται σε εσωτερικούς υποδοχείς του Golgi και το ένζυµο ενσωµατώνεται στο εσωτερικό του κυστιδίου (εικ.9.6). Οι µεµβρανικές πρωτείνες επίσης συντίθενται στο ER τοποθετούνται στην µεµβράνη του ER µεταφέρονται στο Golgi σε κυστίδια και κατόπιν στην κυτταρική µεµβράνη. Η διαφορά από τις σφαιρικές πρωτείνες είναι πώς ενώ στις πρώτες το πολυπεπτίδιο διέρχεται δια µέσου του πόρου από την άλλη πλευρά της µεµβράνης στην περίπτωση των µεµβρανικών προσαρτάται σε αυτήν (εικ.9.7,9.8). Εικόνα 9.7. Η ενσωµάτωση ιδιοσυστατικών µεµβρανικών πρωτεϊνών µε ένα διαµεµβρανικό τµήµα στην κυτταρική µεµβράνη. Όλη η απαραίτητη πληροφορία που ορίζει αν και πως η πολυπεπτιδική αλυσίδα θα ενσωµατωθεί στην µεµβράνη περιέχεται στην αµινοξική ακολουθία. Η απλούστερη περίπτωση είναι αυτή που περιέχεται στο πολυπεπτίδιο µία ακολουθία διακοπής της µεταφοράς (stop transfer) ή ακολουθία πρόσδεσης. Αυτή προσκολλάται στο εσωτερικό στο υδρόφοβο εσωτερικό της διλιπιδικής στοιβάδας και σταµατά κάθε

7 9-7 περαιτέρω µεταφορά. Το ριβόσωµα κατόπιν ολοκληρώνει την µετάφραση/σύνθεση του καρβοξυλοτελικού άκρου από την άλλη πλευρά της µεµβράνης (εικ.9.7). Στην περίπτωση µεµβρανικών πρωτεϊνών µε περισσότερα του ενός διαµεµβρανικά τµήµατα η ακολουθία οδηγός δεν προηγείται του αµινοτελικού άκρου του πολυπεπτιδίου αλλά βρίσκεται ενσωµατωµένη σε αυτό (εικ.9.8). Εικόνα 9.8. Η ενσωµάτωση ιδιοσυστατικών µεµβρανικών πρωτεϊνών µε περισσότερα του ενός διαµεµβρανικά τµήµατα στην κυτταρική µεµβράνη.

8 Μετάθεση των πρωτεϊνών στα µιτοχόνδρια, τους χλωροπλάστες και στο πυρήνα. Στα ευκαρυωτικά κύτταρα υπάρχει ένας τελείως διαφορετικός τρόπος µετάθεσης των πρωτεϊνών στα µιτοχόνδρια ή χλωροπλάστες. Το µιτοχόνδριο παρ ότι έχει το δικό του γενετικό υλικό και µηχανισµούς µετάφρασης εισάγει το 95% των πρωτεινών από το κυτόπλασµα. Οι µιτοχονδριακές αυτές πρωτείνες, που κωδικοποιούνται από το πυρήνα, παράγονται στο κυτόπλασµα από ελεύθερα ριβοσώµατα στην µορφή των ανενεργών προ-πρωτεϊνών. Όπως αναδύεται το πολυπεπτίδιο από το ριβόσωµα µοριακοί ακόλουθοι προσδένονται που το κρατούν σε αποδιατεταγµένη µορφή. Η πρωτείνη διασχίζει την µιτοχονδριακή µεµβράνη σε αυτή την µορφή και λαµβάνει την στερεοδοµή της µε την βοήθεια άλλων µοριακών ακολούθων στο εσωτερικό του µιτοχονδρίου. Εικόνα 9.9. Η µεταφορά πρωτεϊνών στο µιτοχόνδριο. Η µιτοχονδριακή αµινοξική ακολουθία οδηγός είναι αµινοξέα. Οι ακολουθίες αυτές διαφέρουν από πρωτείνη σε πρωτείνη αλλά όλες έχουν µία κοινή στερεοδοµή που είναι µία αµφιπαθική α-έλικα µε την µία πλευρά της θετικά φορτισµένη και την άλλη κυρίως υδρόφοβη. Αυτή προσδένεται στους υποδοχείς της εξωτερικής µεµβράνης του µιτοχονδρίου. Στην απλούστερη περίπτωση η ακολουθία οδηγός σύρει την πολυπεπτιδική αλυσίδα για µέσω πόρου της µιτοχονδριακής µεµβράνης και µετά αποκόπτεται (εικ.9.9). Εάν ο προορισµός της πρωτείνης είναι διαµεµβρανική θέση τότε η προ-πρωτείνη έχει δύο ακολουθίες οδηγούς. Η πρώτη την οδηγεί στο µιτοχονδριακό ενδόπλασµα και αποκόπτεται. Η αποκοπή αυτή προβάλει την δεύτερη που οδηγεί το πολυπεπτίδιο πίσω διαµέσου της µιτοχονδριακής µεµβράνης στο µεσοµεµβρανικό διάστηµα. Τότε και η δεύτερη ακολουθία οδηγός αποκόπτεται.

9 9-9 Εικόνα Η µεταφορά πρωτεϊνών στο κυτταρικό πυρήνα. Ο πυρήνας ενός κυττάρου περιβάλλεται από διπλή πυρηνική µεµβράνη. Οι πρωτείνες που παράγονται στο κυτόπλασµα µετατίθενται στο πυρήνα δια µέσω ειδικών πόρων (εικ.9.10). Και σε αυτή την περίπτωση ένα ολιγοπεπτίδιο είναι η ακολουθία οδηγός που υποβοηθά την πρωτείνη να περάσει διαµέσου του µεµβρανικού πόρου. Οι µικρές ιστόνες δεν έχουν τέτοια ακολουθία ενώ στους µεταγραφικούς παράγοντες η ακολουθία σήµατος ενσωµατώνεται στην πολυπεπτιδική αλυσίδα της πρωτείνης.

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Η κυτταρική μετατόπιση των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Στο κύτταρο η έκφραση των πρωτεϊνών γίνεται από μόνο ένα τύπο ριβοσώματος

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (29/2 & 2/3/2016) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 4 & 5 (3/3 & 6/3/2017) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες λειτουργούν ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 08 : Βιολογικές μεμβράνες, μεμβρανικά διαμερίσματα, μεταφορά πρωτεϊνών Παναγιωτίδης Χρήστος Φαρμακευτικής ΑΠΘ

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΗ 4 (6/3/2013) Kυτταρική Bιολογία ΔIAΛEΞΗ 4 (6/3/2013) ΒΙΟΛΟΓΙΚΕΣ ΜΕΜΒΡΑΝΕΣ, ΜΕΜΒΡΑΝΙΚΑ ΔΙΑΜΕΡΙΣΜΑΤΑ & ΔΙΑΛΟΓΗ ΠΡΩΤΕΪΝΩΝ Οι λιπιδικές διπλοστιβάδες ως φραγμοί Νερό Υδρόφιλες φωσφολιπιδικές κεφαλές Φωσφολιπιδική μεμβράνη

Διαβάστε περισσότερα

Aναδίπλωση και επεξεργασία των πρωτεϊνών

Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Aναδίπλωση και επεξεργασία των πρωτεϊνών Πρωτεϊνοσύνθεση: τελευταίο στάδιο της ροής της γενετικής πληροφορίας * Αλληλουχία νουκλεοτιδίων DNA Μεταγραφή - Μετάφραση

Διαβάστε περισσότερα

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια)

ρευστότητα (εξασφαλίζεται µε τα φωσφολιπίδια) Λειτουργίες Πλασµατική µεµβράνη οριοθέτηση του κυττάρου εκλεκτική διαπερατότητα ή ηµιπερατότητα αναγνώριση και υποδοχή µηνυµάτων πρόσληψη και αποβολή ουσιών Πλασµατική µεµβράνη Ιδιότητες σταθερότητα ρευστότητα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα

ΚΕΦΑΛΑΙΟ 1. Οργάνωση της ζωής βιολογικά συστήματα ΚΕΦΑΛΑΙΟ 1 Οργάνωση της ζωής βιολογικά συστήματα 1.2 Κύτταρο: η μονάδα της ζωής Ιστορικά 1665: Ο Ρ.Χουκ μιλά για κύτταρα. Σύγχρονη κυτταρική θεωρία: Το κύτταρο είναι η θεμελιώδης δομική και λειτουργική

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών

Μετα-μεταφραστικές τροποποιήσεις. των πρωτεϊνών Μετα-μεταφραστικές τροποποιήσεις των πρωτεϊνών Στερεοδιαμόρφωση των πρωτεϊνών Η δομή των πρωτεϊνών εξαρτάται από την αμινοξική τους αλληλουχία Η πρωτεϊνική δομή ξεκινάει από δημιουργία α-ελίκων και β-φύλλων.

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 06 : Σύνθεση, αναδίπλωση, τροποποιήσεις και αποικοδόμηση πρωτεϊνών Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το

Διαβάστε περισσότερα

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου.

ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου. ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΚΕΦΑΛΑΙΟ 2 ΚΥΤΤΑΡΟ: Η ΘΕΜΕΛΙΩΔΗΣ ΜΟΝΑΔΑ ΤΗΣ ΖΩΗΣ ΘΕΜΑ Β 1. Η εικόνα απεικονίζει τμήμα μιας δομής του κυττάρου. I. Πώς ονομάζεται η κυτταρική δομή που απεικονίζεται στην εικόνα; Οι αριθμοί:

Διαβάστε περισσότερα

Δομικές κατηγορίες πρωτεϊνών

Δομικές κατηγορίες πρωτεϊνών 3-1 Κεφάλαι ο Δομικές κατηγορίες πρωτεϊνών 3.1. α-δομές πρωτεϊνών Οι α-έλικες είναι δομικά στοιχεία που μπορούν να σχηματίσουν πολλές κατηγορίες στερεοδομών και με πολλές διαφορετικές λειτουργίες. Εκτός

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 09 : Η εκκριτική οδός, μεταφορά με κυστίδια, λυσοσώματα Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ 1. Περιγράψτε τη δομή της πλασματικής μεμβράνης. Στην απάντησή σας να α- ναφερθείτε στη διευθέτηση των χημικών μορίων που συνθέτουν

Διαβάστε περισσότερα

Μάθηµα: Κίνηση πρωτεινών

Μάθηµα: Κίνηση πρωτεινών Μάθηµα: Κίνηση πρωτεινών ιάλεξη 1:Σύνθεση πρωτεινών- Ριβόσωµα Κώστας Τοκατλίδης Η σύνθεση πρωτεινών απαιτεί την µετάφραση αλληλουχίας νουκλεοτιδίων σε αλληλουχία αµινοξέων Οι συνθετάσες των αµινοακυλο-trna

Διαβάστε περισσότερα


Kυτταρική Bιολογία ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 8, 9 & 10 (15, 17 & 20/3/2017) ΣΥΝΘΕΣΗ, ΑΝΑΔΙΠΛΩΣΗ, ΤΡΟΠΟΠΟΙΗΣΕΙΣ & ΑΠΟΙΚΟΔΟΜΗΣΗ ΤΩΝ ΠΡΩΤΕΪΝΩΝ Τα κύρια σημεία της σημερινής διάλεξης είναι τα παρακάτω: Aποκωδικοποίηση του

Διαβάστε περισσότερα

Γιατί διαιρούνται τα κύτταρα;

Γιατί διαιρούνται τα κύτταρα; Η κυτταροδιαίρεση Γιατί διαιρούνται τα κύτταρα; Για να αναπαραχθούν. Για να αυξηθεί το µέγεθος των οργανισµών. Για να αναπληρωθούν φθαρµένα ή κατεστραµµένα κύτταρα. ιαδικασία κυτταροδιαίρεσης µε εκβλάστηση

Διαβάστε περισσότερα

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες;

ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ. Τι γνωρίζετε για τους υδατάνθρακες; 1 ΤΑ ΜΟΡΙΑ ΤΗΣ ΖΩΗΣ Το κύτταρο αποτελείται από χηµικές ενώσεις, στις οποίες περιλαµβάνονται τα µικρά βιολογικά µόρια και τα βιολογικά µακροµόρια. Στα µικρά βιολογικά µόρια ανήκουν, τα ανόργανα στοιχεία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής

ΚΥΤΤΑΡΟ. Η θεμελιώδης μονάδα της ζωής ΚΥΤΤΑΡΟ Η θεμελιώδης μονάδα της ζωής Κύτταρο Η βασική δομική και λειτουργική μονάδα που εκδηλώνει το φαινόμενο της ζωής. Πρώτος ο Βρετανός Robert Hooke το 1665 παρατηρώντας με το μικροσκόπιο λεπτές τομές

Διαβάστε περισσότερα

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13

Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Τμήμα Βιολογίας Μάθημα: ΒΙΟΛΟΓΙΑ ΚΥΤΤΑΡΟΥ Γ εξάμηνο 2014-2015 Διαλέξεις κάθε Τρίτη 13-15 μ.μ. και Παρασκευή 11-13 Ισιδώρα Παπασιδέρη, Καθηγήτρια...για περισσότερα... http://kyttariki.biol.uoa.gr, ttp://multimedia.biol.uoa.gr

Διαβάστε περισσότερα


ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ ΜΕΜΒΡΑΝΕΣ - ΟΡΜΟΝΕΣ - ΜΕΤΑΓΩΓΗ ΣΗΜΑΤΟΣ Σε ποιες κατηγορίες κατατάσσονται οι ορµόνες µε βάση τη χηµική τους φύση. Αναφέρετε από ένα παράδειγµα Περιγράψτε πως γίνεται η επικοινωνία των κυττάρων µε µηνυµατοφόρα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου

Ρύθμιση της μετάφρασης. Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης Η μετάφραση του mrna της φερριτίνης ρυθμίζεται από τη διαθεσιμότητα σιδήρου Ρύθμιση της μετάφρασης 2. Πρόσδεση πρωτεϊνικών καταστολέων σε αλληλουχίες της 3 περιοχής, στη μη-μεταφραζόμενη

Διαβάστε περισσότερα

Μεταφορά µέσω κυστιδίων. (transport vesicles)

Μεταφορά µέσω κυστιδίων. (transport vesicles) Μεταφορά µέσω κυστιδίων (transport vesicles) Μετακίνηση µε κυστίδια Μεταφορά πρωτεϊνών και λιπιδίων τροποίηση κατά τη µευταφορά (S-S bonds, γλυκοζυλίωση Συνεχής ροή πρωτεινών και λιπιδίων εξειδικευµένη

Διαβάστε περισσότερα

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος

Βιολογικές Μεμβράνες και Μεταγωγή Σήματος ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογικές Μεμβράνες και Μεταγωγή Σήματος Διαλογή Στόχευση Διδάσκουσα: Καθ. Μαρία - Ελένη Ε. Λέκκα Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται

Διαβάστε περισσότερα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα

Συστήματα επικοινωνίας Ανθρωπίνου σώματος. ενδοκρινολογικό νευρικό σύστημα Κύτταρο Το κύτταρο αποτελείται από μέρη τα οποία έχουν συγκεκριμένη δομή και επιτελούν μία συγκεκριμένη λειτουργία στην όλη οργάνωση του κυττάρου. Δομή κυτταροπλασματικής μεμβράνης Συστήματα επικοινωνίας

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής

ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής ΚΕΦΑΛΑΙΟ 2ο Κύτταρο, η θεμελιώδης μονάδα της ζωής Ενότητα 2.1: Το πορτραίτο του ευκαρυωτικού κυττάρου Ενότητα 2.2: Πλασματική μεμβράνη: το λεπτό σύνορο ανάμεσα στην άβια ύλη και στη ζωή Ενότητα 2.3: Μια

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών Χηµική Μεταβίβαση Σήµατος Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τµήµα Γεωπονικής Βιοτεχνολογίας, Γεωπονικό Πανεπιστήµιο Αθηνών 1 Η Επικοινωνία στα Ζωϊκά Κύτταρα 1. Δίκτυα εξωκυτταρικών και ενδοκυτταρικών

Διαβάστε περισσότερα

οµή και Αναδίπλωση πρωτεϊνών

οµή και Αναδίπλωση πρωτεϊνών οµή και Αναδίπλωση πρωτεϊνών Νηφόρου Κατερίνα Μεταδιδακτορική Ερευνήτρια, Οµάδα Μοριακής Καρκινογένεσης, Εργ/ριο Ιστολογίας-Εµβρυολογίας, Ιατρική Σχολή Αθηνών Σηµασία των πρωτεϊνών Ενζυµική κατάλυση Μεταφορά

Διαβάστε περισσότερα

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών

Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Το δίπλωμα των πρωτεϊνών Ηλίας Ηλιόπουλος Εργαστήριο Γενετικής, Τμήμα Βιοτεχνολογίας, Γεωπονικό Πανεπιστήμιο Αθηνών Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε μία μοναδική τρισδιάστατη δομή βιολογικά

Διαβάστε περισσότερα

Ο γενετικός κώδικας και πρωτεϊνική σύνθεση

Ο γενετικός κώδικας και πρωτεϊνική σύνθεση Ο γενετικός κώδικας και πρωτεϊνική σύνθεση Περίγραμμα Ο γενετικός κώδικας συνδέει τα νουκλεοτίδια με τα αμινοξέα Τα αμινοξέα ενεργοποιούνται με την πρόσδεση στο trna Το ριβοσωμα αποτελείται από RNA και

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα


Κεφάλαιο 2ο ΔΟΜΗ ΤΟΥ ΚΥΤΤΑΡΟΥ Κεφάλαιο 2ο ΔΟΜΗ ΤΟΥ ΚΥΤΤΑΡΟΥ 1. Κυτταρική μεμβράνη μοντέλο ρευστού μωσαϊκού κατά Singer και Nicolson Αποτελείται από διπλό στρώμα φωσφολιπιδίων με διάσπαρτα μόρια στεροειδών (χοληστερόλης) και μεγάλα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΚΗ ΣΗΜΑΣΙΑ ΜΕΜΒΡΑΝΩΝ ΒΙΟΛΟΓΙΚΗ ΣΗΜΑΣΙΑ ΜΕΜΒΡΑΝΩΝ Μεντζάλη Ευαγγελία Ένα ζωντανό κύτταρο είναι ένα αυτοαναπαραγόµενο σύστηµα µορίων, το οποίο συγκρατείται µέσα σε ένα περίβληµα. Το περίβληµα αυτό είναι η κυτταρική ή πλασµατική

Διαβάστε περισσότερα

Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης Ε. Παρασκευά 0

Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης Ε. Παρασκευά 0 Δοµή και Λειτουργία της Κυτταρικής Μεµβράνης 12.11.2015 Ε. Παρασκευά 0 Η κυτταρική µεµβράνη Αποµόνωση του κυττάρου από το περιβάλλον Καθορισµός του ως οντότητα Περιβάλλει το κύτταρο Καθορίζει τα όρια του

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Αρχές Βιοτεχνολογίας Τροφίμων

Αρχές Βιοτεχνολογίας Τροφίμων Αρχές Βιοτεχνολογίας Τροφίμων Ενότητα 3: Εφαρμογές Βιομηχανικής Βιοτεχνολογίας(1/3), 2ΔΩ Τμήμα: Επιστήμης και Τεχνολογίας Τροφίμων Διδάσκων: Δρ. Σεραφείμ Παπανικολαου Μαθησιακοί Στόχοι Βιοτεχνολογικά Προϊόντα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών

ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών ΚΕΦΑΛΑΙΟ 29 Σύνθεση πρωτεϊνών Αφού είδαμε πως το DNA αντιγράφεται και μεταγράφεται, τώρα θα εξετάσουμε τη διαδικασία με την παράγονται οι πρωτεϊνες Στην ουσία θα πρέπει να συνδυαστεί ο κώδικας δύο βιβλιοθηκών,

Διαβάστε περισσότερα


Ο ΑΠΙΣΤΕΥΤΟΣ ΜΕΓΑΚΥΤΤΑΡΟΣ 1 Ο ΑΠΙΣΤΕΥΤΟΣ ΜΕΓΑΚΥΤΤΑΡΟΣ 2 3 4 5 6 7 ΠΛΑΝΗΤΗΣ ORGANELLE Πυρήνας: Ο πυρήνας περιέχει το κατασκευαστικό σχέδιο (τα γονίδια) του κυττάρου. Το μακρομόριο που περιέχει τα γονίδια λέγεται DNA. Το DNA είναι

Διαβάστε περισσότερα

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις

Μετάφραση - Translation Μετα-μεταφραστικές τροποποιήσεις Μετάφραση Πρωτεϊνοσύνθεση Μετάφραση - Translation Διαδικασία κατά την οποία η γενετική πληροφορία μετατρέπεται σε λειτουργικά μόρια, τις πρωτεΐνες. Μετα-μεταφραστικές τροποποιήσεις Post-translational modifications

Διαβάστε περισσότερα

Kυτταρική$Bιολογία$ Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)!

Kυτταρική$Bιολογία$ Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)! Kυτταρική$Bιολογία$ ΔIAΛEΞΕΙΣ*17*&*18! (23!&!25/5/2012)! Μιτοχόνδρια*&*Χλωροπλάστες*A** Τα*Ενεργειακά*Κέντρα*των* Ευκαρυωτικών*Κυττάρων!! Τα*κύρια*σημεία*των*διαλέξεων*17*&*18 Αποικοδόμηση!&οξείδωση!μακρομορίων,!βιολογικές!οξειδώσεις!&παραγωγή!

Διαβάστε περισσότερα

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες;

Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Ποιος είναι ο ρόλος των πρωτεϊνών στα κύτταρα και ποιες είναι οι δομικές τους μονάδες; Οι πρωτεΐνες αποτελούν δομικά ή λειτουργικά συστατικά των κυττάρων και δομούνται από απλούστερες ενώσεις, τα αμινοξέα.

Διαβάστε περισσότερα

1. Εισαγωγή στο Κύτταρο

1. Εισαγωγή στο Κύτταρο 1. Εισαγωγή στο Κύτταρο 1.1. Ορισμός του κυττάρου. Το κύτταρο είναι η δομική και λειτουργική μονάδα της ζωής (σχήμα 1). Το κύτταρο αποτελεί τη βάση της δομικής και λειτουργικής οργάνωσης ενός οργανισμού.

Διαβάστε περισσότερα

AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία»

AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία» Α ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΜΟΙΡΩΝ ΕΡΕΥΝΗΤΙΚΗ ΕΡΓΑΣΙΑ 2ΟΥ ΤΕΤΡΑΜΗΝΟΥ AN EXPERIMENTAL BIOLOGY MUSEUM «Προετοιμασία δειγμάτων για μικροσκοπία» ΟΙ ΜΑΘΗΤΕΣ: Αδικημενάκη Καλλιόπη Ζαχαριουδάκη Χαρά Λαγουδάκη Αφροδίτη

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας

ΤΟ ΚΥΤΤΑΡΟ. Αρχαία Βακτήρια. Προκαρυωτικό κύτταρο: πυρηνοειδές. Πρώτιστα Μύκητες Φυτά Ζώα. Ευκαρυωτικό κύτταρο: πυρήνας ΤΟ ΚΥΤΤΑΡΟ Προκαρυωτικό κύτταρο: πυρηνοειδές Αρχαία Βακτήρια Ευκαρυωτικό κύτταρο: πυρήνας Δομή: μεμβρανικά οργανίδια Παραγωγή ενέργειας Δομή γενετικού υλικού Διαίρεση / Αναπαραγωγή Γενετικός ανασυνδυασμός

Διαβάστε περισσότερα

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ

Κυτταρική Βιολογία. Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΠΘ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ Κυτταρική Βιολογία Ενότητα 12 : Απόπτωση ή Προγραμματισμένος κυτταρικός θάνατος Παναγιωτίδης Χρήστος ΑΠΘ Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

οµή και Λειτουργία της Κυτταρικής Μεµβράνης

οµή και Λειτουργία της Κυτταρικής Μεµβράνης οµή και Λειτουργία της Κυτταρικής Μεµβράνης Αποµόνωση του κυττάρου από το περιβάλλον 10.1-membrane_fluidity.mov Λειτουργίες της κυτταρικής µεµβράνης 1. Ρυθµίζει τη διεύλευση ουσιών 2. Αναγνωρίζει χηµικά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ.

ΒΙΟΛΟΓΙΑ. Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. ΒΙΟΛΟΓΙΑ Παραδόσεις του μαθήματος γενικής παιδείας (Β λυκείου) Επιμέλεια: ΑΡΓΥΡΗΣ ΙΩΑΝΝΗΣ Βιολόγος M.Sc. Καθηγητής 3 ου λυκ. Ηλιούπολης Κεφάλαιο 1ο ΒΙΟΛΟΓΙΚΑ ΜΑΚΡΟΜΟΡΙΑ Η ΙΕΡΑΡΧΙΑ ΤΩΝ ΒΙΟΜΟΡΙΩΝ ΠΡΟΔΡΟΜΕΣ

Διαβάστε περισσότερα


ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Βιολογία ΙI Κυτταρική Επικοινωνία Διδάσκοντες: Σ. Γεωργάτος, Θ. Τζαβάρας, Π. Κούκλης, Χ. Αγγελίδης Υπεύθυνος μαθήματος: Σ. Γεωργάτος Άδειες Χρήσης Το

Διαβάστε περισσότερα

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016)

Kυτταρική Bιολογία. Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Kυτταρική Bιολογία ΔIAΛEΞΕΙΣ 24 & 25 (27 /5/2016) Μιτοχόνδρια & Χλωροπλάστες - Τα Ενεργειακά Κέντρα των Ευκαρυωτικών Κυττάρων Τα κύρια σημεία των διαλέξεων 24 & 25 Αποικοδόμηση & οξείδωση μακρομορίων,

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες

Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες 7-1 Κεφάλαιο 7 Το δίπλωµα των πρωτεϊνών Μοριακοί ακόλουθοι Ανωµαλίες στο δίπλωµα Ασθένειες 7.1. Το δίπλωµα των πρωτεϊνών 7.1.1. Εισαγωγή Η πλειονότητα των πρωτεϊνών διπλώνει σε µία µοναδική τρισδιάστατη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης

Περιήγηση στο εσωτερικό του Κυττάρου. Φώτης Καρβέλης Περιήγηση στο εσωτερικό του Κυττάρου Φώτης Καρβέλης Όλα τα κύτταρα οριοθετούνται από την πλασματική μεμβράνη ή το κυτταρικό τοίχωμα που την περιβάλλει. Εσωτερικά της πλασματικής μεμβράνης υπάρχουν τα οργανίδια

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ 2014-15 Θέμα 2ο 2ο ΓΕΛ Χαλανδρίου Βιολογία Β Λυκείου Περιεχόμενα ΘΕΜΑ 14306... 2 ΘΕΜΑ 14351... 2 ΘΕΜΑ 14360... 3 ΘΕΜΑ 14363... 3 ΘΕΜΑ 14364... 4 ΘΕΜΑ 14366... 5 ΘΕΜΑ 14367... 5 ΘΕΜΑ 14369...

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% ΔΙΑΚΡΙΣΗ ΣΤΟΙΧΕΙΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΑ (C, H, N, O) 96% ΜΙΚΡΟΘΡΕΠΤΙΚΑ (πχ. Na, K, P, Ca, Mg) 4% ΙΧΝΟΣΤΟΙΧΕΙΑ (Fe, I) 0,01% Ο άνθρακας, το υδρογόνο, το οξυγόνο και το άζωτο συμμετέχουν, σε σημαντικό βαθμό, στη

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΓΗ_Β_ΒΙΟ_0_14306 - Β1 ΚΕΦΑΛΑΙΟ 2 Στα ακόλουθα σχήματα απεικονίζονται δύο κύτταρα. Ι. Να ονομάσετε 3 δομές που υπάρχουν και στα δύο είδη κυττάρων. Να ονομάσετε επίσης μια δομή που ενώ υπάρχει στα κύτταρα

Διαβάστε περισσότερα


Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( Kυτταρική$Bιολογία$ ΔIAΛEΞΗ(6! (21!&!23/3/2012)! ΣΥΝΘΕΣΗ,(ΑΝΑΔΙΠΛΩΣΗ,( ΤΡΟΠΟΠΟΙΗΣΕΙΣ(&(ΑΠΟΙΚΟΔΟΜΗΣΗ( ΤΩΝ(ΠΡΩΤΕΪΝΩΝ( ( Τα(κύρια(σημεία(της(σημερινής( διάλεξης(είναι(τα(παρακάτω:( Aποκωδικοποίηση(του(mRNA,(γενετικός(κώδικας,((

Διαβάστε περισσότερα


ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

Μοριακή Βιολογία. Ενότητα # (6): Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής

Μοριακή Βιολογία. Ενότητα # (6): Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος. Παναγιωτίδης Χρήστος Τμήμα Φαρμακευτικής ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Μοριακή Βιολογία Ενότητα # (6): Oδοί και μηχανισμοί ευκαρυωτικής μεταγωγής σήματος Παναγιωτίδης Χρήστος Άδειες Χρήσης Το παρόν εκπαιδευτικό

Διαβάστε περισσότερα

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων

Θετικών Σπουδών. Ενδεικτικές απαντήσεις θεμάτων Πανελλαδικές Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο μάθημα: Βιολογία Προσανατολισμού Θετικών Σπουδών Παρασκευή, 16 Ιουνίου 2017 Ενδεικτικές απαντήσεις θεμάτων Θέμα Α Α1. α) 3 CAT 5 β) 3 TAC 5

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΣΥΝΟΨΗ ΠΑΡΑΓΩΓΗΣ ΕΝΕΡΓΕΙΑΣ ΤΡΟΦΗ Λίπη Πολυσακχαρίτες Γλυκόζη κι άλλα σάκχαρα Πρωτεΐνες Αμινοξέα Λιπαρά Οξέα Γλυκόλυση Πυροσταφυλικό Οξύ Ακέτυλο-CoA Αναπνευστική Αλυσίδα μεταφοράς ηλεκτρονίων / Οξειδωτική

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη

ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ. αναπαραγωγή. αύξηση αριθµού κυττάρων ανάπτυξη ΚΥΤΤΑΡΙΚΗ ΙΑΙΡΕΣΗ αναπαραγωγή αύξηση αριθµού κυττάρων ανάπτυξη επιδιόρθωση ιστών Κυτταρική οργάνωση του γενετικού υλικού Γονιδίωµα: Το σύνολο του γενετικού υλικού (DNA) ενός κυττάρου Στα προκαρυωτικά κύτταρα

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

Βιολογικές μεμβράνες

Βιολογικές μεμβράνες Κυτταρική οργάνωση ΕΞΕΤΑΣΤΕΑ ΥΛΗ 4.1 ΕΙΣΑΓΩΓΗ ΣΤΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.2 ΔΟΜΗ ΤΟΥ ΤΥΠΙΚΟΥ ΕΥΚΑΡΥΩΤΙΚΟΥ ΚΥΤΤΑΡΟΥ (απλή αναφορά) 4.3 ΑΠΟ ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΣΤΟ ΕΥΚΑΡΙΩΤΙΚΟ ΚΥΤΤΑΡΟ (απλή αναφορά) 4.4 Η ΚΥΤΤΑΡΙΚΗ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος

Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ. Καρβουντζή Ηλιάνα Βιολόγος Η ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ Χημικά στοιχεία που συνθέτουν τους οργανισμούς Ο C, το H 2, το O 2 και το N 2 είναι τα επικρατέστερα στους οργανισμούς σε ποσοστό 96% κ.β. Γιατί; Συμμετέχουν σε σημαντικό βαθμό στη σύνθεση

Διαβάστε περισσότερα

Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D.

Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής. Ιωάννης Π. Τρουγκάκος, Ph.D. Παν/µιο Αθηνών - Τµήµα Βιολογίας - Τοµέας Βιολογίας Κυττάρου & Βιοφυσικής ΙΑΛΟΓΗ - ΣΤΟΧΕΥΣΗ ΚΑΙ ΜΕΤΑΦΟΡΑ ΠΡΩΤΕΪΝΩΝ Ιωάννης Π. Τρουγκάκος, Ph.D. ΓΕΝΙΚΑ Το επιτυχηµένο σύστηµα αποθήκευσης, κωδικοποίησης

Διαβάστε περισσότερα

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση

ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά Aντιβιοτικά και πρωτεϊνοσύνθεση ιάλεξη 7 Μετάφραση Ο γενετικός κώδικας Το trna Μηχανισµός µετάφρασης σε προκαρυωτικά και ευκαρυωτικά κύτταρα. Aντιβιοτικά και πρωτεϊνοσύνθεση ΜΕΤΑΦΡΑΣΗ DNA RNA protein Aντιγραφή Μεταγραφή Μετάφραση Kεντρικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 ΤΑΞΗ Β ΠΑΝΕΛΛΗΝΙΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΒΙΟΛΟΓΙΑΣ 2012 Α ΦΑΣΗ Να γράψετε στο τετράδιό σας τον αριθμό καθενός από τα παρακάτω θέματα και δίπλα του το γράμμα που α- ντιστοιχεί στη σωστή απάντηση. 1. Στο διπεπτίδιο

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2015 Β ΦΑΣΗ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: ΜΑΘΗΜΑ: 3 η ΤΑΞΗ ΕΠΑ.Λ. (Β ΟΜΑ Α) ΒΙΟΛΟΓΙΑ ΙΙ Ηµεροµηνία: Παρασκευή 19 Απριλίου 2015 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1-β, Α2-γ, Α3-γ, Α4-α, Α5-α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Με τη µέθοδο της επιλογής

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα