ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ"

Transcript

1 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Όνομα. Ημερομηνία. Ζήτημα Α : Να βάλετε ςε κφκλο τθ ςωςτι απάντθςθ 1. Κυτταρικόσ κφκλοσ είναι το χρονικό διάςτθμα που μεςολαβεί: α. μεταξφ δφο μιτωτικϊν διαιρζςεων β. μεταξφ δφο μειωτικϊν διαιρζςεων γ. από τθ ςτιγμι που κα αρχίςει θ μεςόφαςθ ενόσ κυττάρου ωσ το τζλοσ τθσ μιτωτικισ του διαίρεςθσ δ. από τθ ςτιγμι που κα αρχίςει θ μιτωτικι διαίρεςθ ενόσ κυττάρου ωσ το τζλοσ τθσ επομζνθσ διαίρεςθσ 2. Σφνκεςθ DNA μπορεί να γίνει: α. μόνο με αντιγραφι του DNA β. μόνο με αντίςτροφθ μεταγραφι του RNA γ. με αντιγραφι του DNA ι με αντίςτροφθ μεταγραφι του RNA δ. με αντιγραφι ι μεταγραφι του DNA 3. Σφνκεςθ RNA μπορεί να γίνει: α. με μεταγραφι του DNA ι με πρότυπο RNA χωρίσ μεςολάβθςθ του DNA β. μόνο με αντιγραφι του DNA γ. μόνο με μεταγραφι του RNA δ. και με πρότυπο πρωτεΐνεσ 4. Ο τρόποσ αυτοδιπλαςιαςμοφ του DNA ονομάηεται θμιςυντθρθτικόσ γιατί: α. κάκε κυγατρικό μόριο αποτελείται από ζνα παλαιό και ζναν νζο κλϊνο β. το ζνα κυγατρικό μόριο αποτελείται από τουσ παλαιοφσ κλϊνουσ και το άλλο από τουσ νζουσ κλϊνουσ γ. κάκε κυγατρικό μόριο αποτελείται από τουσ νζουσ κλϊνουσ δ. τίποτα από τα παραπάνω 5. Με τθ μεταγραφι του DNA παράγονται: α. μόνο μόρια m-rna β. όλα τα είδθ RNA γ. μόνο μόρια mrna και rrna δ. μόνο μόρια mrna και trna 6. Η αλλθλουχία των νουκλεοτιδίων, που προκφπτει από τθ μεταγραφι τθσ αλλθλουχίασ των νουκλεοτιδίων ATACAG του DNA, είναι: α. AUACAG β. TATGTC γ. UAUGUC δ. ATACAG 7. Τα διαφορετικά κωδικόνια του γενετικοφ κϊδικα είναι: α. 16 β. 64 γ. 32 δ. 48 1

2 8. Από το ςφνολο των διαφορετικϊν κωδικονίων του γενετικοφ κϊδικα, αμινοξζα κωδικοποιοφν: α. τα 61 κωδικόνια β. και τα 64 κωδικόνια γ. τα 60 κωδικόνια δ. τα 20 κωδικόνια 9. Με βάςθ το γενετικό κϊδικα, τα αμινοξζα που κωδικοποιοφνται από περιςςότερα του ενόσ κωδικόνια είναι: α. 20 β. 61 γ. 18 δ Στα διάφορα είδθ trna τα διαφορετικά αντικωδικόνια είναι: α. 64 β. 61 γ. 60 δ Το DNA ςυναντιζται να ζχει κυκλικι μορφι: α. ςτα βακτιρια β. ςτα μιτοχόνδρια γ. ςτουσ χλωροπλάςτεσ δ. ςε όλα τα παραπάνω 12. Οι αδελφζσ χρωματίδεσ του χρωμοςϊματοσ περιζχουν θ κακεμιά: α. από δφο ίδια μόρια DNA β. το ίδιο μόριο DNA γ. από ζνα διαφορετικό μόριο DNA δ. από μία αλυςίδα DNA 13. Η μιτωτικι άτρακτοσ των φυτικϊν κυττάρων αποτελείται: α. από μικροςωλθνίςκουσ β. από μικροςωλθνίςκουσ και ζνα κεντροςωμάτιο γ. από μικροςωλθνίςκουσ και δφο κεντροςωμάτια δ. από μικροςωλθνίςκουσ και χρωμοςϊματα 14. Ένα ανκρϊπινο κφτταρο αποτελείται από 46 χρωμοςϊματα και κατά το ςτάδιο τθσ μετάφαςθσ περιζχει: α. 46 μόρια DNA β. 92 μόρια DNA γ. 23 μόρια DNA δ. 69 μόρια DNA 15. Η ςφναψθ των ομολόγων χρωμοςωμάτων πραγματοποιείται κατά τθν: α. πρόφαςθ ΙΙ β. μετάφαςθ Ι γ. μίτωςθ δ. πρόφαςθ Ι 2

3 Ζήτημα Β : Να ςθμειωκεί δίπλα από κάκε πρόταςθ ζνα Σ ι ζνα Λ εάν πρόκειται αντίςτοιχα για ςωςτι ι λάκοσ πρόταςθ. 1. Το κεντροςωμάτιο διαιρείται κατά τθ διάρκεια του ςταδίου G2 τθσ μεςόφαςθσ ενόσ φυτικοφ κυττάρου. 2. Το RNA ςυντίκεται πάντοτε με πρότυπο το DNA. 3. Τα κυγατρικά μόρια DNA, που προκφπτουν κατά τθν αντιγραφι, αποτελοφνται από τουσ νζουσ κλϊνουσ. 4. Στα ευκαρυωτικά κφτταρα, όπωσ και ςτα βακτιρια, θ ζναρξθ τθσ αντιγραφισ γίνεται από πολυάρικμα ςθμεία ταυτοχρόνωσ. 5. Για τθ μεταγραφι ανοίγει θ διπλι ζλικα του DNA ςτα άκρα του μορίου. 6. Τα λάκθ τθσ μεταγραφισ δεν επθρεάηουν τθ ςφνκεςθ του μορίου τθσ αντίςτοιχθσ πρωτεΐνθσ. 7. Ο γενετικόσ κϊδικασ είναι εκφυλιςμζνοσ διότι όλα τα αμινοξζα κωδικοποιοφνται από περιςςότερα του ενόσ κωδικόνια. 8. Τα trna ςυνδζονται με τα αντίςτοιχα κωδικόνια του mrna με δεςμοφσ υδρογόνου ςφμφωνα με τθν αρχι τθσ ςυμπλθρωματικότθτασ των βάςεων. 9. Κάκε αμινοξφ ςυνδζεται με ζνα μόνο είδοσ trna. 10. Το πρϊτο trna που τοποκετείται ςτο ριβόςωμα φζρει το αντικωδικόνιο UAC. 11. Το τελευταίο trna που τοποκετείται ςτο ριβόςωμα φζρει αντικωδικόνιο που αντιςτοιχεί ςτο ζνα από τα τρία κωδικόνια λιξθσ. 12. Ένα μόριο mrna μπορεί να ςυνδεκεί ταυτόχρονα με πολλά ριβοςϊματα. 13. Το DNA εμφανίηεται με κυκλικι ι με γραμμικι μορφι. 14. Στα ομόλογα χρωμοςϊματα οι ίδιεσ γενετικζσ κζςεισ καταλαμβάνονται από γονίδια που ελζγχουν τα ίδια γνωρίςματα, με τον ίδιο ι διαφορετικό ίςωσ τρόπο. 15. Όλα τα κφτταρα του ανκρϊπου φζρουν τον ίδιο αρικμό χρωμοςωμάτων. 16. Απλοειδι χαρακτθρίηονται τα κφτταρα που περιζχουν μια απλι ςειρά χρωμοςωμάτων και γονιδίων Με τον επιχιαςμό γίνεται αναςυνδυαςμόσ των γονιδίων των μθ ομολόγων χρωμοςωμάτων. 19. Κατά τθ μετάφαςθ Ι τα κεντρομερίδια των ηευγϊν των ομολόγων χρωμοςωμάτων διαιροφνται και τα χρωμοςϊματα ςτθ ςυνζχεια μποροφν να κατευκυνκοφν ςτουσ αντίκετουσ πόλουσ. 20. Τα ηεφγθ των ομολόγων χρωμοςωμάτων τοποκετοφνται ανεξάρτθτα το ζνα από το άλλο ςτο ιςθμερινό επίπεδο τθσ ατράκτου κατά τθ μετάφαςθ Ι. 3

4 Ζήτημα Γ : 1. Να ςυμπλθρωκεί ο αρικμόσ α) μορίων DNA β) χρωμοςωμάτων και γ) χρωματίδων που ζχει κάκε χρωμόςωμα ανκρϊπινου κυττάρου ςτο τζλοσ κάκε ςταδίου, που αναφζρεται ςτθ δεφτερθ ςτιλθ. Στάδιο Αριθμός μορίων DNA Αριθμός Χρωμοσωμάτων Χρωματίδες ανά χρωμόσωμα G 1 Μεσόφαση S G 2 Πρόφαςθ Μίτωση Μείωση Μετάφαςθ Τελόφαςθ Πρόφαςθ Ι Τελόφαςθ Ι Πρόφαςθ ΙΙ Τελόφαςθ ΙΙ 2. Συμπλθρϊςτε τον παρακάτω πίνακα με τισ αντίςτοιχεσ τριπλζτεσ γνωρίηοντασ ότι θ ςτιλθ DNA 1 αναφζρεται ςτθν αλυςίδα που μεταγράφεται και θ ςτιλθ DNA 2 ςτθ ςυμπλθρωματικι τθσ. DNA 1 DNA 2 Κωδικόνια Αντικωδικόνια AAA AAA CAG TAG 4

5 Ζήτημα Δ : 1. Δίνεται θ ακόλουκθ αλλθλουχία βάςεων ςτθ μθ μεταγραφόμενθ αλυςίδα του DNA: 5...TAC-GAC-ATG-GAG-CCA-GTA-TAC-TGA-TAG-TAA-ACC-GCT...3 Να βρεκεί θ αλλθλουχία: I. των βάςεων ςτο αντίςτοιχο mrna II. των κωδικονίων και των αντίςτοιχων αμινοξζων (με χριςθ του γενετικοφ κϊδικα) ςε περίπτωςθ που θ αλυςίδα περιζχει το μινυμα για τθ ςφνκεςθ ενόσ ολιγοπεπτιδίου III. των κωδικονίων και των αντίςτοιχων αμινοξζων (με χριςθ του γενετικοφ κϊδικα) ςε περίπτωςθ που θ αλυςίδα περιζχει τμιμα μόνο τθσ κωδικοποιθμζνθσ πλθροφορίασ για ζνα πολυπεπτίδιο 2. Ποιοι είναι οι βαςικοί τφποι κυτταρικισ διαίρεςθσ και ςε ποια κφτταρα πραγματοποιείται ο κακζνασ; 3. Ποιεσ οι διαφορζσ μεταξφ πρόφαςθσ τθσ μίτωςθσ και τθσ πρόφαςθσ Ι τθσ μείωςθσ; 4. Ποια είναι τα χαρακτθριςτικά του γενετικοφ κϊδικα; Παλαφοφτασ Δθμιτρθσ Βιολόγοσ 5

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ Ονομάςτθκε ΚΕΝΣΡΙΚΟ ΔΟΓΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ή ά DN RN ή ί ή ί 1 Κάκε κφτταρο και κάκε

Διαβάστε περισσότερα

Γαμέτης μητρικής προέλεσσης

Γαμέτης μητρικής προέλεσσης 1 Μίτωση-Μείωση Ο άνκρωποσ ζχει ζναν τεράςτιο αρικμό κυττάρων.σα κφτταρα του ςώματοσ του ανκρώπου είναι ςτθ μορφι διαφορετικά το ζνα από το άλλο. Σα κφτταρα των οςτών, τα νευρικά κφτταρα, τα κφτταρα του

Διαβάστε περισσότερα

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1 Παράδειγμα 1. Ο ανκρώπινοσ καρυότυποσ διακζτει 46 χρωμοςώματα και το ανκρώπινο γονιδίωμα 3x10 9 ηεφγθ βάςεων. Από τα παραπάνω βιοχθμικά δεδομζνα,τι μποροφμε να γνωρίηουμε για το γενετικό υλικό των ανκρωπίνων

Διαβάστε περισσότερα

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. ελ. 123-124 «Η γονιδιακι κεραπεία εφαρμόςτθκε και ειςάγονται πάλι ς αυτόν.» Β2. ελ. 133 «Διαγονιδιακά ονομάηονται

Διαβάστε περισσότερα

Απαντήςεισ_βιολογία προςανατολιςμοφ 2016

Απαντήςεισ_βιολογία προςανατολιςμοφ 2016 Θζμα Α Α1: β Α2:β Α3:δ Α4:γ Α5:γ Θζμα Β Β1 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. κεωρία ςελίδα 24 τι είναι ο καρυότυποσ Σα ςυμπεράςματα που μποροφμε να εξάγουμε από τθν μελζτθ του Καρυότυπου είναι : Σο φφλο

Διαβάστε περισσότερα

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 Λόγοι για τουσ οποίουσ αναγκαςτικαμε να δθμιουργιςουμε τθ cdna βιβλιοκικθ Σα γονίδια των ευκαρυωτικών είναι αςυνεχι. Οι περιοριςτικζσ ενδονουκλεάςεισ δεν κόβουν ςτθν

Διαβάστε περισσότερα

επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (1 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 2 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Θεωρία (1 Ο Κεφάλαιο) 3 4 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Θεωρία (1 Ο Κεφάλαιο) ΒΙΟΧΗΜΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ TO DNA (υποςτθρίηουν

Διαβάστε περισσότερα

Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων.

Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων. 1 Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων. Α. Σι μορφι ζχει το γενετικό υλικό των προκαρυωτικών κυττάρων; α. Μονόκλωνο και γραμμικό DNA β.

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016 ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Μονάδες 7 Β2. χολικό βιβλίο ςελ. 24 Σα χρωμοςώματα τοποκετοφνται κατά ηεφγθ

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΘΕΜΑ Α Α1 δ Α2 β Α3 α Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ.17 Τα κφτταρα διπλοειδι Β2. Σελ.14 Το DNA φωςφοδιεςτερικόσ δεςμόσ Β3. Σελ.37,38 Σθμειϊνεται.αντίγραφα ενόσ γονιδίου

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΠΑΝΕΛΛΑΔΙΚΕ ΕΞΕΣΑΕΙ Γ ΣΑΞΗ ΗΜΕΡΗΙΟΤ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΘΕΜΑ Α ΑΠΑΝΣΗΕΙ Α.1. δ Α.2. δ Α.3. β Α.4. γ Α.5. α ΘΕΜΑ Β Β.1. Ι ΙΙ ΙΙΙ ΙV V VI VII Α Ε Σ Β Z Γ Δ Β.2.

Διαβάστε περισσότερα

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Λόγοι για τουσ οποίουσ κάνουμε γονιδιωματικι βιβλιοκικθ Για οργανιςμοφσ που κινδυνεφουν να εξαφανιςτοφν. Για εκπαιδευτικοφσ λόγουσ. Για να κάνουμε μελζτθ ςτθν εξελικτικι

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Αςκιςεισ 2 ου Κεφαλαίου

Αςκιςεισ 2 ου Κεφαλαίου Αςκιςεισ 2 ου Κεφαλαίου Με ςυνδιαςμό από άλλα κεφάλαια Dipl.Biol.cand.med. Stylianos Kalaitzis «Απλι» άςκθςθ 2 ου κεφαλαίου (Sep.2007) Δίνεται το παρακάτω τμιμα μορίου βακτθριακοφ DNA που κωδικοποιεί ζνα

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1 1 Αρχιτεκτονική του κυττάρου-μεταβολισμός Γενικά : Οποιοδιποτε κφτταρο αποτελείται από χθμικζσ ενϊςεισ του άνκρακα που ονομάηονται οργανικζσ ενϊςεισ. Οι ενϊςεισ που αποτελοφν ςυςτατικά του κφτταρου χωρίηονται

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι. τιλθ-ιι Γενικοί μοριακοί τφποι. Ομόλογεσ ςειρζσ Α.

1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι. τιλθ-ιι Γενικοί μοριακοί τφποι. Ομόλογεσ ςειρζσ Α. 1 1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι τιλθ-ιι Γενικοί μοριακοί τφποι Ομόλογεσ ςειρζσ Α. C ν Η 2ν+2 1. Εςτζρεσ των κορεςμζνων μονοκαρβοξυλικϊν οξζων με τισ Β.

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία, από τα οποία 27 μόνο είναι απαραίτητα για τη ζωή. ΠΟΣΟΣΤΟ ΣΤΟΙΧΕΙΑ 96% ο άνθρακας (C), το υδρογόνο (H), το οξυγόνο (O) και

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων. (v.1.0.7)

Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων. (v.1.0.7) Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων (v.1.0.7) 1 Περίληψη Το ςυγκεκριμζνο εγχειρίδιο δθμιουργικθκε για να βοθκιςει τθν κατανόθςθ τθσ διαδικαςίασ διαχείριςθσ ςτθλών βιβλίου Εςόδων - Εξόδων.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη Ριζηνίας 69 & Λασαίας 21 τηλ.2810313170 www.kmathisi.com ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:..

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1) Τμήμα μορίου βακτηριακού DNA έχει την ακόλουθη αλληλουχία βάσεων: 3 TACTGGAATGGTCGCCCCTGCATT 5 a. Ποια είναι η αλληλουχία του συμπληρωματικού κλώνου και ποιος είναι ο προσανατολισμός της. b. Ποιο είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΘΕΜΑ 1 Ο Α) 1. Β 2. Δ 3. Δ Β) 1. 1.Δ 2. 1. ΣΤ 2. Γ 2. Ε 3. Ε 3. Β 4. Α 4. Γ 5. Β 5. Α 6. Ζ 6. Δ 7. ΣΤ 7. Ζ ΘΕΜΑ

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ Φιλιοποφλου Ειρινθ Προςθήκη νζων πεδίων Ασ υποκζςουμε ότι μετά τθ δθμιουργία του πίνακα αντιλαμβανόμαςτε ότι ζχουμε ξεχάςει κάποια πεδία. Είναι ζνα πρόβλθμα το οποίο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ. Ειρινθ Φιλιοποφλου

ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ. Ειρινθ Φιλιοποφλου ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ Ειρινθ Φιλιοποφλου Ειςαγωγι Ο Παγκόςμιοσ Ιςτόσ (World Wide Web - WWW) ι πιο απλά Ιςτόσ (Web) είναι μία αρχιτεκτονικι για τθν προςπζλαςθ διαςυνδεδεμζνων εγγράφων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

Μεθοδολογία επίλυσης ασκήσεων Γενετικής

Μεθοδολογία επίλυσης ασκήσεων Γενετικής Μεθοδολογία επίλυσης ασκήσεων Γενετικής Νόμοι του Mendel 1. ε όλεσ τισ αςκιςεισ διαςταυρϊςεων αναφζρουμε τον 1 ο νόμο του Mendel (νόμο διαχωριςμοφ των αλλθλόμορφων γονιδίων). 2. ε αςκιςεισ διυβριδιςμοφ

Διαβάστε περισσότερα

ΘΥ101: Ειςαγωγι ςτθν Πλθροφορικι

ΘΥ101: Ειςαγωγι ςτθν Πλθροφορικι Παράςταςη κινητήσ υποδιαςτολήσ ςφμφωνα με το πρότυπο ΙΕΕΕ Δρ. Χρήστος Ηλιούδης το πρότυπο ΙΕΕΕ 754 ζχει χρθςιμοποιθκεί ευρζωσ ςε πραγματικοφσ υπολογιςτζσ. Το πρότυπο αυτό κακορίηει δφο βαςικζσ μορφζσ κινθτισ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου

Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου 1 Θζματα Πανελλθνίων 2015. 1.Στθν εικόνα 1 φαίνεται ζνα μζροσ μίασ βιολογικισ διαδικαςίασ, θ οποία βρίςκεται ςε εξζλιξθ. Α. Να ονομάςετε τθ διαδικαςία, που βρίςκεται ςε εξζλιξθ, ςτθν εικόνα 1 και να εντοπίςετε

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία: Σάββατο 13 Ιανουαρίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 δ, Α4 δ, Α5 α ΘΕΜΑ Β B1. α. Γονίδια,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ςυςτιματα γραμμικϊν εξιςϊςεων

ςυςτιματα γραμμικϊν εξιςϊςεων κεφάλαιο 7 Α ςυςτιματα γραμμικϊν εξιςϊςεων αςικζσ ζννοιεσ Γραμμικά, λζγονται τα ςυςτιματα εξιςϊςεων ςτα οποία οι άγνωςτοι εμφανίηονται ςτθν πρϊτθ δφναμθ. Σα γραμμικά ςυςτιματα με δφο εξιςϊςεισ και δφο

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΑΠΑΝΤΗΣΕΙΣ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Επειδή στο σχολικό βιβλίο Βιολογία Β Γενικού Λυκείου Γενικής παιδείας πρόσφατα προστέθηκαν ερωτήσεις και άλλαξε η αρίθμηση των προϋπαρχουσών ασκήσεων,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ. 3. Τι γενετικές πληροφορίες μπορεί να φέρει ένα πλασμίδιο;

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ. 3. Τι γενετικές πληροφορίες μπορεί να φέρει ένα πλασμίδιο; ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΕΝΟΤΗΤΑ 1.4. Οργάνωση του γενετικού υλικού προκαρυωτικών και ευκαρυωτικών κυττάρων. 1. Ποια είναι η μορφή του DNA των προκαρυωτικών κυττάρων και ποιο είναι το μήκος τους; 2. Ποια είναι

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

Εγχειρίδιο Χρήςησ Support

Εγχειρίδιο Χρήςησ Support Εγχειρίδιο Χρήςησ Support Περιεχόμενα 1) Αρχικι Σελίδα...2 2) Φόρμα Σφνδεςθσ...2 3) Μετά τθ ςφνδεςθ...2 4) Λίςτα Υποκζςεων...3 5) Δθμιουργία Νζασ Υπόκεςθσ...4 6) Σελίδα Υπόκεςθσ...7 7) Αλλαγι Κωδικοφ...9

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. δ 3. β 4. δ 5. β ΘΕΜΑ 2ο 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ

ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ ΗΛΕΚΣΡΟΝΙΚΗ ΤΠΗΡΕΙΑ ΑΠΟΚΣΗΗ ΑΚΑΔΗΜΑΪΚΗ ΣΑΤΣΟΣΗΣΑ Οδηγός Χρήσης Εφαρμογής Ελέγχου Προσφορών Αφοφ πιςτοποιθκεί ο λογαριαςμόσ που δθμιουργιςατε ςτο πρόγραμμα ωσ Πάροχοσ Προςφορϊν, κα λάβετε ζνα e-mail με

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας

ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ. Ζαρφτζιάν Μαριλένα Πειραματικό Σχολείο Πανεπιστημίου Μακεδονίας ΚΥΤΤΑΡΙΚΗ ΔΙΑΙΡΕΣΗ ΜΙΤΩΣΗ Τι σχέση έχουν η μονογονική αναπαραγωγή Κυτταρική διαίρεση η ανάπτυξη η αμφιγονική αναπαραγωγή η αντικατάσταση των κυττάρων Η σημασία της μίτωσης Η μίτωση ευνοεί την κυτταρική

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Δομι και λειτουργία των πρωτεϊνϊν

Δομι και λειτουργία των πρωτεϊνϊν Δομι και λειτουργία των πρωτεϊνϊν Τισ πρωτεΐνεσ κατατάςςουμε ςε: Δομικέσ: αποτελοφν βαςικό υλικό για τθν δόμθςθ του κυτταρικοφ τοιχϊματοσ, των μεμβρανϊν, κ.λ.π. π.χ. το κoλλαγόνο, θ ελαςτίνθ και οι γλυκοπρωτείνεσ.

Διαβάστε περισσότερα

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ Γίνεται σύνθεση DNA. Γίνεται σύνθεση RNA. Εξασφαλίζεται η διαιώνιση της γενετικής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Αυτόματη δημιουργία στηλών Αντιστοίχηση νέων λογαριασμών ΦΠΑ

Αυτόματη δημιουργία στηλών Αντιστοίχηση νέων λογαριασμών ΦΠΑ Αυτόματη δημιουργία στηλών Αντιστοίχηση νέων λογαριασμών ΦΠΑ 1 Περίληψη Το ςυγκεκριμζνο εγχειρίδιο δημιουργήθηκε για να βοηθήςει την κατανόηςη τησ διαδικαςίασ αυτόματησ δημιουργίασ ςτηλών και αντιςτοίχιςησ

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό

Ασκήσεις. 1 ο Κεφάλαιο: Το Γενετικό Υλικό Ασκήσεις 1. Αν ο λόγος A + Τ / C + G στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α. στη συμπληρωματική της αλυσίδα, β. στο μόριο; 2. Αν ο λόγος A + G / T + C στη μια αλυσίδα του DNA

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ

Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Ε νότητα 4 η : ΓΕΝΕΤΙΚΗ ΓΕΝΙΚΟΙ ΣΤΟΧΟΙ Στο τέλος της διδασκαλίας της ενότητας αυτής ο μαθητής θα πρέπει: Να διακρίνει τη σχέση του γενετικού υλικού με τα ι- διαίτερα χαρακτηριστικά των οργανισμών. Να αναγνωρίζει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα