ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ"

Transcript

1 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Όνομα. Ημερομηνία. Ζήτημα Α : Να βάλετε ςε κφκλο τθ ςωςτι απάντθςθ 1. Κυτταρικόσ κφκλοσ είναι το χρονικό διάςτθμα που μεςολαβεί: α. μεταξφ δφο μιτωτικϊν διαιρζςεων β. μεταξφ δφο μειωτικϊν διαιρζςεων γ. από τθ ςτιγμι που κα αρχίςει θ μεςόφαςθ ενόσ κυττάρου ωσ το τζλοσ τθσ μιτωτικισ του διαίρεςθσ δ. από τθ ςτιγμι που κα αρχίςει θ μιτωτικι διαίρεςθ ενόσ κυττάρου ωσ το τζλοσ τθσ επομζνθσ διαίρεςθσ 2. Σφνκεςθ DNA μπορεί να γίνει: α. μόνο με αντιγραφι του DNA β. μόνο με αντίςτροφθ μεταγραφι του RNA γ. με αντιγραφι του DNA ι με αντίςτροφθ μεταγραφι του RNA δ. με αντιγραφι ι μεταγραφι του DNA 3. Σφνκεςθ RNA μπορεί να γίνει: α. με μεταγραφι του DNA ι με πρότυπο RNA χωρίσ μεςολάβθςθ του DNA β. μόνο με αντιγραφι του DNA γ. μόνο με μεταγραφι του RNA δ. και με πρότυπο πρωτεΐνεσ 4. Ο τρόποσ αυτοδιπλαςιαςμοφ του DNA ονομάηεται θμιςυντθρθτικόσ γιατί: α. κάκε κυγατρικό μόριο αποτελείται από ζνα παλαιό και ζναν νζο κλϊνο β. το ζνα κυγατρικό μόριο αποτελείται από τουσ παλαιοφσ κλϊνουσ και το άλλο από τουσ νζουσ κλϊνουσ γ. κάκε κυγατρικό μόριο αποτελείται από τουσ νζουσ κλϊνουσ δ. τίποτα από τα παραπάνω 5. Με τθ μεταγραφι του DNA παράγονται: α. μόνο μόρια m-rna β. όλα τα είδθ RNA γ. μόνο μόρια mrna και rrna δ. μόνο μόρια mrna και trna 6. Η αλλθλουχία των νουκλεοτιδίων, που προκφπτει από τθ μεταγραφι τθσ αλλθλουχίασ των νουκλεοτιδίων ATACAG του DNA, είναι: α. AUACAG β. TATGTC γ. UAUGUC δ. ATACAG 7. Τα διαφορετικά κωδικόνια του γενετικοφ κϊδικα είναι: α. 16 β. 64 γ. 32 δ. 48 1

2 8. Από το ςφνολο των διαφορετικϊν κωδικονίων του γενετικοφ κϊδικα, αμινοξζα κωδικοποιοφν: α. τα 61 κωδικόνια β. και τα 64 κωδικόνια γ. τα 60 κωδικόνια δ. τα 20 κωδικόνια 9. Με βάςθ το γενετικό κϊδικα, τα αμινοξζα που κωδικοποιοφνται από περιςςότερα του ενόσ κωδικόνια είναι: α. 20 β. 61 γ. 18 δ Στα διάφορα είδθ trna τα διαφορετικά αντικωδικόνια είναι: α. 64 β. 61 γ. 60 δ Το DNA ςυναντιζται να ζχει κυκλικι μορφι: α. ςτα βακτιρια β. ςτα μιτοχόνδρια γ. ςτουσ χλωροπλάςτεσ δ. ςε όλα τα παραπάνω 12. Οι αδελφζσ χρωματίδεσ του χρωμοςϊματοσ περιζχουν θ κακεμιά: α. από δφο ίδια μόρια DNA β. το ίδιο μόριο DNA γ. από ζνα διαφορετικό μόριο DNA δ. από μία αλυςίδα DNA 13. Η μιτωτικι άτρακτοσ των φυτικϊν κυττάρων αποτελείται: α. από μικροςωλθνίςκουσ β. από μικροςωλθνίςκουσ και ζνα κεντροςωμάτιο γ. από μικροςωλθνίςκουσ και δφο κεντροςωμάτια δ. από μικροςωλθνίςκουσ και χρωμοςϊματα 14. Ένα ανκρϊπινο κφτταρο αποτελείται από 46 χρωμοςϊματα και κατά το ςτάδιο τθσ μετάφαςθσ περιζχει: α. 46 μόρια DNA β. 92 μόρια DNA γ. 23 μόρια DNA δ. 69 μόρια DNA 15. Η ςφναψθ των ομολόγων χρωμοςωμάτων πραγματοποιείται κατά τθν: α. πρόφαςθ ΙΙ β. μετάφαςθ Ι γ. μίτωςθ δ. πρόφαςθ Ι 2

3 Ζήτημα Β : Να ςθμειωκεί δίπλα από κάκε πρόταςθ ζνα Σ ι ζνα Λ εάν πρόκειται αντίςτοιχα για ςωςτι ι λάκοσ πρόταςθ. 1. Το κεντροςωμάτιο διαιρείται κατά τθ διάρκεια του ςταδίου G2 τθσ μεςόφαςθσ ενόσ φυτικοφ κυττάρου. 2. Το RNA ςυντίκεται πάντοτε με πρότυπο το DNA. 3. Τα κυγατρικά μόρια DNA, που προκφπτουν κατά τθν αντιγραφι, αποτελοφνται από τουσ νζουσ κλϊνουσ. 4. Στα ευκαρυωτικά κφτταρα, όπωσ και ςτα βακτιρια, θ ζναρξθ τθσ αντιγραφισ γίνεται από πολυάρικμα ςθμεία ταυτοχρόνωσ. 5. Για τθ μεταγραφι ανοίγει θ διπλι ζλικα του DNA ςτα άκρα του μορίου. 6. Τα λάκθ τθσ μεταγραφισ δεν επθρεάηουν τθ ςφνκεςθ του μορίου τθσ αντίςτοιχθσ πρωτεΐνθσ. 7. Ο γενετικόσ κϊδικασ είναι εκφυλιςμζνοσ διότι όλα τα αμινοξζα κωδικοποιοφνται από περιςςότερα του ενόσ κωδικόνια. 8. Τα trna ςυνδζονται με τα αντίςτοιχα κωδικόνια του mrna με δεςμοφσ υδρογόνου ςφμφωνα με τθν αρχι τθσ ςυμπλθρωματικότθτασ των βάςεων. 9. Κάκε αμινοξφ ςυνδζεται με ζνα μόνο είδοσ trna. 10. Το πρϊτο trna που τοποκετείται ςτο ριβόςωμα φζρει το αντικωδικόνιο UAC. 11. Το τελευταίο trna που τοποκετείται ςτο ριβόςωμα φζρει αντικωδικόνιο που αντιςτοιχεί ςτο ζνα από τα τρία κωδικόνια λιξθσ. 12. Ένα μόριο mrna μπορεί να ςυνδεκεί ταυτόχρονα με πολλά ριβοςϊματα. 13. Το DNA εμφανίηεται με κυκλικι ι με γραμμικι μορφι. 14. Στα ομόλογα χρωμοςϊματα οι ίδιεσ γενετικζσ κζςεισ καταλαμβάνονται από γονίδια που ελζγχουν τα ίδια γνωρίςματα, με τον ίδιο ι διαφορετικό ίςωσ τρόπο. 15. Όλα τα κφτταρα του ανκρϊπου φζρουν τον ίδιο αρικμό χρωμοςωμάτων. 16. Απλοειδι χαρακτθρίηονται τα κφτταρα που περιζχουν μια απλι ςειρά χρωμοςωμάτων και γονιδίων Με τον επιχιαςμό γίνεται αναςυνδυαςμόσ των γονιδίων των μθ ομολόγων χρωμοςωμάτων. 19. Κατά τθ μετάφαςθ Ι τα κεντρομερίδια των ηευγϊν των ομολόγων χρωμοςωμάτων διαιροφνται και τα χρωμοςϊματα ςτθ ςυνζχεια μποροφν να κατευκυνκοφν ςτουσ αντίκετουσ πόλουσ. 20. Τα ηεφγθ των ομολόγων χρωμοςωμάτων τοποκετοφνται ανεξάρτθτα το ζνα από το άλλο ςτο ιςθμερινό επίπεδο τθσ ατράκτου κατά τθ μετάφαςθ Ι. 3

4 Ζήτημα Γ : 1. Να ςυμπλθρωκεί ο αρικμόσ α) μορίων DNA β) χρωμοςωμάτων και γ) χρωματίδων που ζχει κάκε χρωμόςωμα ανκρϊπινου κυττάρου ςτο τζλοσ κάκε ςταδίου, που αναφζρεται ςτθ δεφτερθ ςτιλθ. Στάδιο Αριθμός μορίων DNA Αριθμός Χρωμοσωμάτων Χρωματίδες ανά χρωμόσωμα G 1 Μεσόφαση S G 2 Πρόφαςθ Μίτωση Μείωση Μετάφαςθ Τελόφαςθ Πρόφαςθ Ι Τελόφαςθ Ι Πρόφαςθ ΙΙ Τελόφαςθ ΙΙ 2. Συμπλθρϊςτε τον παρακάτω πίνακα με τισ αντίςτοιχεσ τριπλζτεσ γνωρίηοντασ ότι θ ςτιλθ DNA 1 αναφζρεται ςτθν αλυςίδα που μεταγράφεται και θ ςτιλθ DNA 2 ςτθ ςυμπλθρωματικι τθσ. DNA 1 DNA 2 Κωδικόνια Αντικωδικόνια AAA AAA CAG TAG 4

5 Ζήτημα Δ : 1. Δίνεται θ ακόλουκθ αλλθλουχία βάςεων ςτθ μθ μεταγραφόμενθ αλυςίδα του DNA: 5...TAC-GAC-ATG-GAG-CCA-GTA-TAC-TGA-TAG-TAA-ACC-GCT...3 Να βρεκεί θ αλλθλουχία: I. των βάςεων ςτο αντίςτοιχο mrna II. των κωδικονίων και των αντίςτοιχων αμινοξζων (με χριςθ του γενετικοφ κϊδικα) ςε περίπτωςθ που θ αλυςίδα περιζχει το μινυμα για τθ ςφνκεςθ ενόσ ολιγοπεπτιδίου III. των κωδικονίων και των αντίςτοιχων αμινοξζων (με χριςθ του γενετικοφ κϊδικα) ςε περίπτωςθ που θ αλυςίδα περιζχει τμιμα μόνο τθσ κωδικοποιθμζνθσ πλθροφορίασ για ζνα πολυπεπτίδιο 2. Ποιοι είναι οι βαςικοί τφποι κυτταρικισ διαίρεςθσ και ςε ποια κφτταρα πραγματοποιείται ο κακζνασ; 3. Ποιεσ οι διαφορζσ μεταξφ πρόφαςθσ τθσ μίτωςθσ και τθσ πρόφαςθσ Ι τθσ μείωςθσ; 4. Ποια είναι τα χαρακτθριςτικά του γενετικοφ κϊδικα; Παλαφοφτασ Δθμιτρθσ Βιολόγοσ 5

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ

ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ. Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ ΜΟΙΑΚΗ ΓΕΝΕΤΙΚΗ Α. ΤΟ ΚΕΝΤΙΚΟ ΔΟΓΜΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ Η κατεφκυνςθ με τθν οποία θ γενετικι πλθροφορία ρζει προσ τισ πρωτεΐνεσ Ονομάςτθκε ΚΕΝΣΡΙΚΟ ΔΟΓΜΑ ΣΗ ΒΙΟΛΟΓΙΑ ή ά DN RN ή ί ή ί 1 Κάκε κφτταρο και κάκε

Διαβάστε περισσότερα

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1

Ασκήσεις βιολογίας. Καρυότυποσ-DNA. Φιρφιρισ Χριςτοσ ΦΡΟΝΣΙΣΗΡΙΑ ΠΡΟΟΠΣΙΚΗ 1 Παράδειγμα 1. Ο ανκρώπινοσ καρυότυποσ διακζτει 46 χρωμοςώματα και το ανκρώπινο γονιδίωμα 3x10 9 ηεφγθ βάςεων. Από τα παραπάνω βιοχθμικά δεδομζνα,τι μποροφμε να γνωρίηουμε για το γενετικό υλικό των ανκρωπίνων

Διαβάστε περισσότερα

Γαμέτης μητρικής προέλεσσης

Γαμέτης μητρικής προέλεσσης 1 Μίτωση-Μείωση Ο άνκρωποσ ζχει ζναν τεράςτιο αρικμό κυττάρων.σα κφτταρα του ςώματοσ του ανκρώπου είναι ςτθ μορφι διαφορετικά το ζνα από το άλλο. Σα κφτταρα των οςτών, τα νευρικά κφτταρα, τα κφτταρα του

Διαβάστε περισσότερα

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013

ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. ελ. 123-124 «Η γονιδιακι κεραπεία εφαρμόςτθκε και ειςάγονται πάλι ς αυτόν.» Β2. ελ. 133 «Διαγονιδιακά ονομάηονται

Διαβάστε περισσότερα

Β3. Χρωμοςωμικι ανωμαλία-ζλλειψθ Σελ.101 «Η ζλλειψθ είναι θ απϊλεια διανοθτικι κακυςτζρθςθ».

Β3. Χρωμοςωμικι ανωμαλία-ζλλειψθ Σελ.101 «Η ζλλειψθ είναι θ απϊλεια διανοθτικι κακυςτζρθςθ». ΠΑΝΕΛΛΑΔΙΚΕ ΕΞΕΣΑΕΙ Γ ΣΑΞΗ ΗΜΕΡΗΙΟΤ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΣΡΙΣΗ 19 ΙΟΤΝΙΟΤ 2018 ΕΞΕΣΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α1.δ Α2.β Α3.α Α4.α Α5.β ΘΕΜΑ Β Β1. 1γ 2β 3γ 4α 5γ 6γ 7β Β2.

Διαβάστε περισσότερα

ΥΡΟΝΣΙΣΗΡΙΟ ΜΕΗ ΕΚΠΑΙΔΕΤΗ Ο Μ Η Ρ Ο Σ

ΥΡΟΝΣΙΣΗΡΙΟ ΜΕΗ ΕΚΠΑΙΔΕΤΗ Ο Μ Η Ρ Ο Σ ΠΑΝΕΛΛΗΝΕ ΕΞΕΣΑΕ Γϋ ΣΑΞΗ ΗΜΕΡΗΟΤ ΓΕΝΚΟΤ ΛΤΚΕΟΤ ΣΕΣΑΡΣΗ 4 ΟΤΝΟΤ 2 0 1 4 ΒΟΛΟΓΑ ΘΕΣΚΗ ΚΑΣΕΤΘΤΝΗ ΑΠΑΝΤΗΣΕΣ ΘΕΜΑ Α: Α 1 - δ Α 2 -γ Α 3 -β Α 4 -γ Α 5 -β ΘΕΜΑ Β : Β1: 4 2 1 6 3 5 Β2: Α)DNA Πολυμεράςθ Β) Πριμόςωμα

Διαβάστε περισσότερα

Απαντήςεισ_βιολογία προςανατολιςμοφ 2016

Απαντήςεισ_βιολογία προςανατολιςμοφ 2016 Θζμα Α Α1: β Α2:β Α3:δ Α4:γ Α5:γ Θζμα Β Β1 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. κεωρία ςελίδα 24 τι είναι ο καρυότυποσ Σα ςυμπεράςματα που μποροφμε να εξάγουμε από τθν μελζτθ του Καρυότυπου είναι : Σο φφλο

Διαβάστε περισσότερα

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1

cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 cdna ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης Φώτο 1 Λόγοι για τουσ οποίουσ αναγκαςτικαμε να δθμιουργιςουμε τθ cdna βιβλιοκικθ Σα γονίδια των ευκαρυωτικών είναι αςυνεχι. Οι περιοριςτικζσ ενδονουκλεάςεισ δεν κόβουν ςτθν

Διαβάστε περισσότερα

επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (1 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 2 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Θεωρία (1 Ο Κεφάλαιο) 3 4 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Θεωρία (1 Ο Κεφάλαιο) ΒΙΟΧΗΜΙΚΑ ΔΕΔΟΜΕΝΑ ΓΙΑ TO DNA (υποςτθρίηουν

Διαβάστε περισσότερα

ΚΤΣΣΑΡΟ ΙΙ. Κυτταρόπλαςμα. Οργανίδια. Πυρήνασ. Κυτταρικό τοίχωμα. = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα.

ΚΤΣΣΑΡΟ ΙΙ. Κυτταρόπλαςμα. Οργανίδια. Πυρήνασ. Κυτταρικό τοίχωμα. = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα. ΚΤΣΣΑΡΟ ΙΙ Πρωτόπλαςμα Κυτταρόπλαςμα Κυτταρόπλαςμα = Ημίρρευςτθ και οριοκετθμζνθ ομογενισ μάηα. Οργανίδια = Δομζσ που επιτελοφν ςυγκεκριμζνθ λειτουργία Πυρήνασ Κυτταρικό τοίχωμα = Σο κζντρο ελζγχου του

Διαβάστε περισσότερα

Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων.

Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων. 1 Ι.Απλοειδή-Διπλοειδή κφτταρα: 1.ασ δίνονται παρακάτω 2 εικόνεσ (απλοποιθμζνεσ) προκαρυωτικών κυττάρων. Α. Σι μορφι ζχει το γενετικό υλικό των προκαρυωτικών κυττάρων; α. Μονόκλωνο και γραμμικό DNA β.

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016 ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ ΠΑΡΑΚΕΤΗ 27 ΜΑΪΟΤ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Μονάδες 7 Β2. χολικό βιβλίο ςελ. 24 Σα χρωμοςώματα τοποκετοφνται κατά ηεφγθ

Διαβάστε περισσότερα

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση.

Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. Κεφάλαιο 4: Γενετική Α. Αντιγραφή - Μεταγραφή - Μετάφραση του DNA Να απαντήσετε σε καθεμιά από τις παρακάτω ερωτήσεις με μια πρόταση. 1. Τι είναι κωδικόνιο; 2. Που γίνεται η σύνθεση πρωτεϊνών στο κύτταρο;

Διαβάστε περισσότερα

ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ. Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 2 ο ΑΝΣΙΓΡΑΥΗ ΕΚΥΡΑΗ ΡΤΘΜΙΗ ΣΗ ΓΕΝΕΣΙΚΗ ΠΛΗΡΟΥΟΡΙΑ (ΘΕΩΡΙΑ)

ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ. Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 2 ο ΑΝΣΙΓΡΑΥΗ ΕΚΥΡΑΗ ΡΤΘΜΙΗ ΣΗ ΓΕΝΕΣΙΚΗ ΠΛΗΡΟΥΟΡΙΑ (ΘΕΩΡΙΑ) ΠΤΡΟ ΤΓΓΕΛΑΚΗ ΒΙΟΛΟΓΙΑ Γ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΚΕΥΑΛΑΙΟ 2 ο ΑΝΣΙΓΡΑΥΗ ΕΚΥΡΑΗ ΡΤΘΜΙΗ ΣΗ ΓΕΝΕΣΙΚΗ ΠΛΗΡΟΥΟΡΙΑ ΕΝΟΣΗΣΑ 1 (ΘΕΩΡΙΑ) ΕΡΩΣΗΕΙ ΘΕΩΡΙΑ ΜΕ ΧΗΜΑΣΑ ΚΑΙ ΕΠΙΗΜΑΝΕΙ ΕΡΩΣΗΕΙ ΠΟΛΛΑΠΛΗ ΕΠΙΛΟΓΗ ΕΡΩΣΗΕΙ ΣΤΠΟΤ ΩΣΟ

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010

ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΛΥΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2010 ΘΕΜΑ Α Α1 δ Α2 β Α3 α Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ.17 Τα κφτταρα διπλοειδι Β2. Σελ.14 Το DNA φωςφοδιεςτερικόσ δεςμόσ Β3. Σελ.37,38 Σθμειϊνεται.αντίγραφα ενόσ γονιδίου

Διαβάστε περισσότερα

Οι φάσεις που περιλαμβάνει ο κυτταρικός κύκλος είναι:

Οι φάσεις που περιλαμβάνει ο κυτταρικός κύκλος είναι: ΚΥΚΛΟΣ ΖΩΗΣ ΤΟΥ ΚΥΤΤΑΡΟΥ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Τι είναι ο κυτταρικός κύκλος; ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 4 ο ΚΕΦΑΛΑΙΟ «ΓΕΝΕΤΙΚΗ» 2. Οι φάσεις που περιλαμβάνει ο κυτταρικός κύκλος είναι: 3. Κατά τη

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού Γ Λυκείου

Βιολογία Προσανατολισμού Γ Λυκείου Β ΓΕΛ 05/ 05/ 2019 Βιολογία Προσανατολισμού Γ Λυκείου ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Εσώνια δεν υπάρχουν: Α. Στο DNA των ιών που προσβάλλουν

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΑ 1 & 2 Θέμα Α: Να γράψετε στο τετράδιό σας τον αριθμό της καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ

ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ 19 6 2018 ΘΕΜΑ Α Α1) δ Α2) β Α3) α Α4) α Α5) β ΘΕΜΑ Β Β1) 1 γ 2 β 3 γ 4 α 5 γ 6 γ 7 β Β2. Στο γζνοσ Lactobacillus ανικει ο Β. Γνωρίηουμε ότι τα βακτιρια του γζνουσ Lactobacillus

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΒΙΟΛΟΓΙΑΣ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 04/11/2018 Νότα Λαζαράκη Αλέξανδρος Παπαγιαννακόπουλος ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 04/11/2018 Νότα Λαζαράκη Αλέξανδρος Παπαγιαννακόπουλος ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Σε ένα

Διαβάστε περισσότερα

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ

ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΦΡΟΝΣΙΣΗΡΙΑΚΟ ΟΡΓΑΝΙΜΟ ΠΑΝΕΛΛΑΔΙΚΕ ΕΞΕΣΑΕΙ Γ ΣΑΞΗ ΗΜΕΡΗΙΟΤ ΓΕΝΙΚΟΤ ΛΤΚΕΙΟΤ ΒΙΟΛΟΓΙΑ ΠΡΟΑΝΑΣΟΛΙΜΟΤ ΘΕΜΑ Α ΑΠΑΝΣΗΕΙ Α.1. δ Α.2. δ Α.3. β Α.4. γ Α.5. α ΘΕΜΑ Β Β.1. Ι ΙΙ ΙΙΙ ΙV V VI VII Α Ε Σ Β Z Γ Δ Β.2.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο DNA των μιτοχονδρίων περιέχονται πληροφορίες για: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1.

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΑ 1 & 2 Θέμα Α: Να γράψετε στο τετράδιό σας τον αριθμό της καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ

Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Καρβέλης Φώτης ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ Λόγοι για τουσ οποίουσ κάνουμε γονιδιωματικι βιβλιοκικθ Για οργανιςμοφσ που κινδυνεφουν να εξαφανιςτοφν. Για εκπαιδευτικοφσ λόγουσ. Για να κάνουμε μελζτθ ςτθν εξελικτικι

Διαβάστε περισσότερα

Φάσμα προπαραςκευι για

Φάσμα προπαραςκευι για ςφγχρονο Φάσμα προπαραςκευι για Α.Ε.Ι. & Σ.Ε.Ι. μακθτικό φροντιςτιριο 25 θσ Μαρτίου 74 ΠΛΑΣΕΙΑΠΕΣΡΟΤΠΟΛΗ 50.50.658 50.60.845 25 θσ Μαρτίου 111 ΠΕΣΡΟΤΠΟΛΗ 50.20.990 50.27.990 Γραβιάσ 85 ΚΗΠΟΤΠΟΛΗ 50.51.557

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΑ 1 & 2 ΑΠΑΝΤΗΣΕΙΣ Θέμα Α: Α1.β, Α2.δ, Α3.γ, Α4.γ, Α5.γ Θέμα Β: Β1. Ο 1 ος ιός παρατηρούμε ότι περιέχει Τ, άρα το γενετικό του υλικό είναι DNA, στο οποίο παρατηρούμε ότι δεν

Διαβάστε περισσότερα

Αςκιςεισ 2 ου Κεφαλαίου

Αςκιςεισ 2 ου Κεφαλαίου Αςκιςεισ 2 ου Κεφαλαίου Με ςυνδιαςμό από άλλα κεφάλαια Dipl.Biol.cand.med. Stylianos Kalaitzis «Απλι» άςκθςθ 2 ου κεφαλαίου (Sep.2007) Δίνεται το παρακάτω τμιμα μορίου βακτθριακοφ DNA που κωδικοποιεί ζνα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑΣ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 05/03/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1

1 Αρχιτεκτονική του κυττάρου-μεταβολισμός. Χ. Κ. Φ Ι Ρ Φ Ι Ρ Η - Φ Ρ Ο Ν Σ Ι Σ Η Ρ Ι Α Π Ρ Ο Ο Π Σ Ι Κ Η - Π Α Π Α Ν Α Σ Α Ι Ο Τ 1 0 1 ελίδα 1 1 Αρχιτεκτονική του κυττάρου-μεταβολισμός Γενικά : Οποιοδιποτε κφτταρο αποτελείται από χθμικζσ ενϊςεισ του άνκρακα που ονομάηονται οργανικζσ ενϊςεισ. Οι ενϊςεισ που αποτελοφν ςυςτατικά του κφτταρου χωρίηονται

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ. Αντιγραφή, μεταγραφή και μετάφραση

ΓΕΝΕΤΙΚΗ. Αντιγραφή, μεταγραφή και μετάφραση ΓΕΝΕΤΙΚΗ Αντιγραφή, μεταγραφή και μετάφραση Κύκλος ζωής του κυττάρου Κυτταρικός κύκλος (ή κύκλος ζωής του κυττάρου) είναι το χρονικό διάστημα που μεσολαβεί από τη δημιουργία ενός κυττάρου ως τότε που και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ /12/2017

ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ /12/2017 ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ 1-2-4 03/12/2017 ΘΕΜΑ A Α. Να επιλέξετε την ορθή πρόταση στα παρακάτω: Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το α. νουκλεοτίδιο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΧΡΗΣΤΟΣ ΚΑΚΑΒΑΣ 1 ΚΑΘΗΓΗΤΗΣ ΒΙΟΛΟΓΟΣ Μ.Δ.Ε

ΧΡΗΣΤΟΣ ΚΑΚΑΒΑΣ 1 ΚΑΘΗΓΗΤΗΣ ΒΙΟΛΟΓΟΣ Μ.Δ.Ε ΚΕΦΑΛΑΙΟ 2 ον. ΑΝΤΙΓΡΑΦΗ ΚΑΙ ΕΚΦΡΑΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΤΙ ΠΡΕΠΕΙ ΝΑ ΞΕΡΩ. 1. Τη δομή της δίκλωνης έλικας πάρα πολύ καλά. 2. Τους δεσμούς υδρογόνου μεταξύ των συμπληρωματικών βάσεων και την επίπτωσή

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ ΑΛΓΟΡΙΘΜΟΣ

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ ΑΛΓΟΡΙΘΜΟΣ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία: Σάββατο 13 Ιανουαρίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Παίζοντας με τα χρωμοσώματα ΙΙ

Παίζοντας με τα χρωμοσώματα ΙΙ Παίζοντας με τα χρωμοσώματα ΙΙ Μαυροματάκης Γιώργος Βιολόγος 2016-2017 τάκης Γιώργος Βιολόγος 1 Θεωρητικό μέρος Ομόλογα χρωμοσώματα: Ζευγάρι χρωμοσωμάτων που έχουν το ίδιο σχήμα και μέγεθος, και περιέχουν

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ

ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ ΑΠΑΡΑΙΤΗΤΕΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΝΝΟΙΕΣ Στο φλοιό της Γης απαντώνται 92 χημικά στοιχεία, από τα οποία 27 μόνο είναι απαραίτητα για τη ζωή. ΠΟΣΟΣΤΟ ΣΤΟΙΧΕΙΑ 96% ο άνθρακας (C), το υδρογόνο (H), το οξυγόνο (O) και

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι. τιλθ-ιι Γενικοί μοριακοί τφποι. Ομόλογεσ ςειρζσ Α.

1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι. τιλθ-ιι Γενικοί μοριακοί τφποι. Ομόλογεσ ςειρζσ Α. 1 1. Να αντιςτοιχίςετε τουσ όρουσ τθσ ςτιλθσ-ι με τουσ όρουσ τθσ ςτιλθσ-ιι τιλθ-ι τιλθ-ιι Γενικοί μοριακοί τφποι Ομόλογεσ ςειρζσ Α. C ν Η 2ν+2 1. Εςτζρεσ των κορεςμζνων μονοκαρβοξυλικϊν οξζων με τισ Β.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΚΕΦΑΛΑΙΑ: 1 Ο,2 Ο και 4 Ο ΘΕΜΑ 1 Ο Α) 1. Β 2. Δ 3. Δ Β) 1. 1.Δ 2. 1. ΣΤ 2. Γ 2. Ε 3. Ε 3. Β 4. Α 4. Γ 5. Β 5. Α 6. Ζ 6. Δ 7. ΣΤ 7. Ζ ΘΕΜΑ

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ

ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ. Φιλιοποφλου Ειρινθ ΕΦΑΡΜΟΓΕ ΒΑΕΩΝ ΔΕΔΟΜΕΝΩΝ ΣΗ ΝΟΗΛΕΤΣΙΚΗ Φιλιοποφλου Ειρινθ Προςθήκη νζων πεδίων Ασ υποκζςουμε ότι μετά τθ δθμιουργία του πίνακα αντιλαμβανόμαςτε ότι ζχουμε ξεχάςει κάποια πεδία. Είναι ζνα πρόβλθμα το οποίο

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1) Τμήμα μορίου βακτηριακού DNA έχει την ακόλουθη αλληλουχία βάσεων: 3 TACTGGAATGGTCGCCCCTGCATT 5 a. Ποια είναι η αλληλουχία του συμπληρωματικού κλώνου και ποιος είναι ο προσανατολισμός της. b. Ποιο είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων. (v.1.0.7)

Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων. (v.1.0.7) Διαδικαςία Διαχείριςθσ Στθλϊν Βιβλίου Εςόδων - Εξόδων (v.1.0.7) 1 Περίληψη Το ςυγκεκριμζνο εγχειρίδιο δθμιουργικθκε για να βοθκιςει τθν κατανόθςθ τθσ διαδικαςίασ διαχείριςθσ ςτθλών βιβλίου Εςόδων - Εξόδων.

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι φγχρονο ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι Μαθητικό Φροντιςτήριο 25 ησ Μαρτίου 74 ΠΛΑΣΕΙΑ ΠΕΣΡΟΤΠΟΛΗ 50.50.658 50.60.845 25 ησ Μαρτίου 111 ΠΕΣΡΟΤΠΟΛΗ 50.20.990 50.27.990 Γραβιάσ 85 ΚΗΠΟΤΠΟΛΗ 50.51.557

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη Ριζηνίας 69 & Λασαίας 21 τηλ.2810313170 www.kmathisi.com ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:..

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ. Ειρινθ Φιλιοποφλου

ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ. Ειρινθ Φιλιοποφλου ΕΦΑΡΜΟΓΖσ ΒΆΕΩΝ ΔΕΔΟΜΖΝΩΝ ΚΑΙ ΔΙΑΔΙΚΣΥΟΤ Ειρινθ Φιλιοποφλου Ειςαγωγι Ο Παγκόςμιοσ Ιςτόσ (World Wide Web - WWW) ι πιο απλά Ιςτόσ (Web) είναι μία αρχιτεκτονικι για τθν προςπζλαςθ διαςυνδεδεμζνων εγγράφων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ)

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ) ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ) ΘΕΜΑ Α Να γράψετε στο τετράδιο σας τον αριθμό κάθε μιας από τις παρακάτω ημιτελείς προτάσεις 1-5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΘΥ101: Ειςαγωγι ςτθν Πλθροφορικι

ΘΥ101: Ειςαγωγι ςτθν Πλθροφορικι Παράςταςη κινητήσ υποδιαςτολήσ ςφμφωνα με το πρότυπο ΙΕΕΕ Δρ. Χρήστος Ηλιούδης το πρότυπο ΙΕΕΕ 754 ζχει χρθςιμοποιθκεί ευρζωσ ςε πραγματικοφσ υπολογιςτζσ. Το πρότυπο αυτό κακορίηει δφο βαςικζσ μορφζσ κινθτισ

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου

Χ.Κ.Φιρφιρισ Επανάλθψθ ςτθ βιολογία προςανατολιςμοφ Γ Λυκείου 1 Θζματα Πανελλθνίων 2015. 1.Στθν εικόνα 1 φαίνεται ζνα μζροσ μίασ βιολογικισ διαδικαςίασ, θ οποία βρίςκεται ςε εξζλιξθ. Α. Να ονομάςετε τθ διαδικαςία, που βρίςκεται ςε εξζλιξθ, ςτθν εικόνα 1 και να εντοπίςετε

Διαβάστε περισσότερα

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι φγχρονο ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι Μαθητικό Φροντιςτήριο 25 ησ Μαρτίου 74 ΠΛΑΣΕΙΑ ΠΕΣΡΟΤΠΟΛΗ 50.50.658 50.60.845 25 ησ Μαρτίου 111 ΠΕΣΡΟΤΠΟΛΗ 50.20.990 50.27.990 Γραβιάσ 85 ΚΗΠΟΤΠΟΛΗ 50.51.557

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία: Σάββατο 13 Ιανουαρίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 δ, Α4 δ, Α5 α ΘΕΜΑ Β B1. α. Γονίδια,

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι

ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι φγχρονο ΦάςμαGroup προπαραςκευή για Α.Ε.Ι. & Σ.Ε.Ι Μαθητικό Φροντιςτήριο 25 ησ Μαρτίου 74 ΠΛΑΣΕΙΑ ΠΕΣΡΟΤΠΟΛΘ 50.50.658 50.60.845 25 ησ Μαρτίου 111 ΠΕΣΡΟΤΠΟΛΘ 50.20.990 50.27.990 Γραβιάσ 85 ΚΘΠΟΤΠΟΛΘ 50.51.557

Διαβάστε περισσότερα