ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013"

Transcript

1 ΠΡΟΣΕΙΝΟΜΕΝΕ ΑΠΑΝΣΗΕΙ ΣΗ ΒΙΟΛΟΓΙΑ ΚΑΣΕΤΘΤΝΗ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. ελ «Η γονιδιακι κεραπεία εφαρμόςτθκε και ειςάγονται πάλι ς αυτόν.» Β2. ελ. 133 «Διαγονιδιακά ονομάηονται τα ηϊα χοίρων και αιγϊν.» Β3. ελ. 21 «Σα μιτοχόνδρια και οι χλωροπλάςτεσ ωσ θμιαυτόνομα» Β4. ελ. 35 «Ο γενετικόσ κϊδικασ ςυνϊνυμα.» ΘΕΜΑ Γ Γ1. Βαςιηόμενοι ςτο 2 ο νόμο του Mendel- ςελ «Βαςιηόμενοσ ςτο 2 ο νόμο διυβριδιςμοφ.» διαχωρίηουμε τα χαρακτθριςτικά και τα μελετάμε ανεξάρτθτα. Μζγεκοσ φτερών Θθλυκά: 300 με φυςιολογικά φτερά 100 με ατροφικά φτερά Άρα αναλογία 3 με φυςιολογικά: 1 με ατροφικά Αρςενικά: 300 με φυςιολογικά φτερά 100 με ατροφικά φτερά Άρα αναλογία 3 με φυςιολογικά: 1 με ατροφικά

2 Η εκφϊνθςθ αναφζρει ότι το γονίδιο για το φυςιολογικό μζγεκοσ φτερϊν είναι αυτοςωμικό επικρατζσ Η αναλογία 3:1 προκφπτει από διαςταφρωςθ 2 ετερόηυγων ατόμων Με βάςθ τα παραπάνω ιςχφει υμβολιςμόσ Γονίδιο για φυςιολογικό μζγεκοσ φτερϊν: Μ Γονίδιο για ατροφικά φτερά :μ Πικανοί γονότυποι Άτομο με φυςιολογικό μζγεκοσ φτερϊν : ΜΜ ι Μμ Άτομο με ατροφικά φτερά : μμ Η διαςταφρωςθ είναι P: Μμ Μμ Γαμζτεσ Μ,μ Μ,μ Σετράγωνο Punnett Μ μ M ΜΜ Μμ μ Μμ μμ 3 με φυςιολογικά φτερά : 1 με ατροφικά φτερά Η παραπάνω διαςταφρωςθ βαςίηεται ςτο 1 ο νόμο του Μendel ςελ. 71 «ο τρόποσ με τον οποίο διαχωριςμοφ των αλλθλόμορφων γονιδίων.» Άρα οι γονότυποι των γονζων είναι Μμ Μμ

3 Γ2. Χρώμα ματιών Θθλυκά: 200 με κόκκινα μάτια 200 με λευκά μάτια Άρα αναλογία 1 με κόκκινα: 1 με λευκά Αρςενικά: 200 με κόκκινα μάτια 200 με λευκά μάτια Άρα αναλογία 1 με κόκκινα: 1 με λευκά H εκφϊνθςθ αναφζρει ότι το γονίδιο για το κόκκινο χρϊμα ματιϊν είναι επικρατζσ Ότι το φφλο κακορίηεται ςτα ζντομα όπωσ ςτον άνκρωπο. Δεν γνωρίηουμε αν το γονίδιο κλθρονομείται με αυτοςωμικό ι φυλοςφνδετο τρόπο οπότε πρζπει να διερευνθκοφν και οι δφο περιπτϊςεισ. Α περίπτωςθ Σο γονίδιο για το χρώμα των ματιών να είναι αυτοςωμικό Σότε υμβολιςμόσ Γονίδιο για κόκκινο χρϊμα ματιϊν : Κ Γονίδιο για λευκό χρϊμα ματιϊν :κ Πικανοί γονότυποι Άτομο με κόκκινο χρϊμα ματιϊν: ΚΚ ικκ Άτομο με λευκό χρϊμα ματιϊν : κκ Η αναλογία 1:1 προκφπτει από διαςταφρωςθ ενόσ ατόμου ετερόηυγου με ζνα ομόηυγο ωσ προσ το υπολειπόμενο Επιβεβαίωςθ

4 Η διαςταφρωςθ είναι P: Κκ κκ Γαμζτεσ Κ,κ κ Σετράγωνο Punnett Κ κ κ Κκ κκ 1 με κόκκινα μάτια: 1 με λευκά μάτια Άρα αν το γονίδιο είναι αυτοςωμικό τότε οι γονότυποι των γονζων κα είναι Ρ: κθλυκό Κκ αρςενικό κκ ι αρςενικό Κκ κθλυκό κκ Β περίπτωςθ Σο γονίδιο για το χρώμα των ματιών να είναι φυλοςφνδετο Σότε υμβολιςμόσ Γονίδιο για κόκκινο χρϊμα ματιϊν : Χ Κ Γονίδιο για λευκό χρϊμα ματιϊν :Χ κ Πικανοί γονότυποι Άτομο με κόκκινο χρϊμα ματιϊν: κθλυκό: Χ Κ Χ Κ ι Χ Κ Χ κ αρςενικό Χ Κ Τ Άτομο με λευκό χρϊμα ματιϊν : κθλυκό: Χ κ Χ κ αρςενικό Χ κ Τ Από τθν αναλογία βλζπουμε ότι τα μιςά αρςενικά ζχουν προκφψει με κόκκινα μάτια άρα Χ Κ Τ και ότι τα άλλα μιςά αρςενικά ζχουν προκφψει με λευκά μάτια Χ κ Τ. Γνωρίηουμε ότι τα αρςενικά παίρνουν το Χ φυλετικό χρωμόςωμα από τθ μθτζρα και το Τ από το πατζρα. Άρα ο γονότυποσ τθσ μθτζρασ κα είναι Χ Κ Χ κ.

5 Γνωρίηουμε ότι τα κθλυκά παίρνουν ζνα Χ φυλετικό χρωμόςωμα από τθ μθτζρα και ζνα από το πατζρα. τα κθλυκά θ αναλογία είναι 1:1 άρα ο γονότυποσ του πατζρα είναι Χ κ Τ (αυτό μπορεί να αποδειχτεί και με τον ζλεγχο 2 περιπτϊςεων με διαςταυρϊςεισ). Επιβεβαίωςθ Ρ: κθλυκό Χ Κ Χ κ αρςενικό Χ κ Τ Γαμζτεσ: Χ Κ, Χ κ Χ κ,τ Σετράγωνο Punnett Χκ Τ ΧΚ Χ Κ Χ κ Χ Κ Τ Χκ Χ κ Χ κ Χ κ Τ Αρςενικά 1 με κόκκινα μάτια: 1 με λευκά μάτια Θθλυκά 1 με κόκκινα μάτια: 1 με λευκά μάτια Άρα αν το γονίδιο είναι φυλοςφνδετο τότε οι γονότυποι των γονζων κα είναι Άρα οι γονότυποι των γονζων Ρ: κθλυκό Χ Κ Χ κ αρςενικό Χ κ Τ Για όλα τα παραπάνω ιςχφειουν ο 1 Ο και 2 Ο νόμοσ του Mendel που ζχουν ιδθ αναφερκεί. Σχόλιο: τα ερωτήματα Γ1 και Γ2 μπορούν να αντιμετωπισθούν ενιαία με διασταυρώσεις διυβριδισμού.

6 Γ3. Ατελϊσ επικρατι υνεπικρατι Πολλαπλά αλλθλόμορφα Θνθςιγόνα Φυλοςφνδετα ΘΕΜΑ Δ Δ1. Τβριδοποιθμζνο μόριο 1 (1-3): 5 - AAATGAAACCAGGATAAG TTTACTTTGGTCCTATTCTTAA-5 Τβριδοποιθμζνο μόριο 2 (2-4): 5 - AATTCGGGGGGC GCCCCCCGTTAA- 5 Δ2. Σο υβριδοποιθμζνο μόριο που περιζχει το γονίδιο κα περιζχει τισ τριπλζτεσ που αντιςτοιχοφν ςτο mrna ςτο κωδικόνιο ζναρξθσ 5 -AUG -3 και ςε ζνα από τα κωδικόνια λιξθσ 5 -UAA-3 ι 5 -UAG-3 ι 5 -UGA-3. Ελζγχοντασ ςτο υβριδοποιθμζνο μόριο 1 και τισ δυο αλυςίδεσ τθ πάνω από δεξιά προσ τα αριςτερά και τθ κάτω από αριςτερά προσ τα δεξιά εντοπίηουμε ςτθ κάτω αλυςίδα τθ τριπλζτα νουκλεοτιδίων 3 -TAC-5 που αντιςτοιχεί ςτο mrna ςτο κωδικόνιο ζναρξθσ 5 -AUG-3 και με βιμα τριπλζτασ τθ τριπλζτα νουκλεοτιδίων 3 -ΑΣΣ-5 που αντιςτοιχεί ςτο mrna ςτο κωδικόνιο λιξθσ 5 -UAA-3.

7 Κάνοντασ τον αντίςτοιχο ζλεγχο ςτο υβριδοποιθμζνο μόριο 2 δεν εντοπίηουμε αντίςτοιχεσ αλλθλουχίεσ. Άρα το γονίδιο περιζχεται ςτο υβριδοποιθμζνο μόριο 1 και μθ κωδικι είναι θ κάτω αλυςίδα. Άρα το mrna που κα προκφψει κα είναι 5 - AAAUGAAACCAGGAUAAGAAUU- 3 Αιτιολόγθςθ του mrna με περιγραφι μεταγραφισ ςελ «Η RNA πολυμεράςθ επιτρζπουν τθν απελευκζρωςθ του» Δ3. To επόμενο trna που κα ςυνδεκεί ςτο ριβόςωμα μετά τθν απομάκρυνςθ του trna που μεταφζρει τθν λυςίνθ κα είναι τo trna που μεταφζρει τθν γλυκίνθ και κα ζχει αντικωδικόνιο 3 CCU 5. Αιτιολόγθςθ από περιγραφι τθσ επιμικυνςθσ ςτθ πρωτεινοςφνκεςθ ςελ. 37 «κατά τθν επιμικυνςθ μεταξφ τουσ» Δ4. Η DNA δεςμάςθ ςυνδζει αλυςίδεσ νουκλεικϊν οξζων δθμιουργϊντασ τον 3-5 φωςφοδιεςτερικό δεςμό ελ 14 ςχολικό βιβλίο: «Μια πολυνουκλεοτιδικι αλυςίδα φωςφοδιεςτερικό δεςμό». Από τθ δράςθ τθσ κα προκφψουν τα εξισ μόρια 1θ περίπτωςθ: 5' AAATGAAACCAGGATAAG AATTCGGGGGC 3' 3' TTTACTTTGGTCCTATTCTTAAGCCCCCGTTAA 5' 2θ περίπτωςθ: 5' AAATGAAACCAGGATAAGAATTGCCCCCCG 3' 3' TTTACTTTGGTCCTATTCTTAACGGGGGGCTTAA 5'

8 τθ 1 θ περίπτωςθ θ EcoRI αναγνωρίηει τθν αλλθλουχία μια φορά και κα δθμιουργθκοφν 2 κομμάτια. 1θ περίπτωςθ: 5' AAATGAAACCAGGATAAG AATTCGGGGGC 3' 3' TTTACTTTGGTCCTATTCTTAA GCCCCCGTTAA 5' Και τα κομμάτια που κα προκφψουν κα είναι Α. 5' AAATGAAACCAGGATAAG -3 3' TTTACTTTGGTCCTATTCTTAA-5 Β. 5' AATTCGGGGGC 3' 3' GCCCCCGTTAA 5' τθ 2 θ περίπτωςθ δεν υπάρχει κζςθ αναγνϊριςθσ από τθν EcoRI οπότε κα παραμείνει 1 ενιαίο τμιμα. ελ. 57 ςχολικοφ βιβλίου: «Μια από τισ περιοριςτικζσ ενδονουκλεάςεσ που χρθςιμοποιοφν ευρζωσ με το ίδιο ενηυμο.» υνεπϊσ θ αλλθλουχία που αναγνωρίηει θ ΕcoRI υπάρχει μόνο ςτθν 1θ περίπτωςθ και προκφπτουν 2 κομμάτια Επιμζλεια Χορτάτου Ράνια Βιολόγοσ ΧΟΛΙΟ Σα κζματα των Πανελλθνίων Εξετάςεων 2013 ςτο μάκθμα τθσ Βιολογίασ Θετικισ Κατεφκυνςθσ χαρακτθρίηονται ςφνκετα, απαιτθτικά, με ςαφι διαβάκμιςθ δυςκολίασ ενϊ καλφπτουν ζνα ευρφ φάςμα τθσ διδακτζασ φλθσ. Αρκετά κζματα απαιτοφςαν κριτικι προςζγγιςθ και απευκφνονταν ςε μακθτζσ με βακιά κατανόθςθ του αντικειμζνου που μποροφν να διαχειριςτοφν με άνεςθ τθ γνϊςθ.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες

NH 2 R COOH. Σο R είναι το τμιμα του αμινοξζοσ που διαφζρει από αμινοξφ ςε αμινοξφ. 1 Πρωτεΐνες 1 Πρωτεΐνες Πρωτεΐνεσ : Οι πρωτεΐνεσ είναι ουςίεσ «πρώτθσ» γραμμισ για τουσ οργανιςμοφσ (άρα και για τον άνκρωπο). Σα κφτταρα και οι ιςτοί αποτελοφνται κατά κφριο λόγο από πρωτεΐνεσ. Ο ςθμαντικότεροσ όμωσ

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

η τζχνη τησ εκπαίδευςησ ο καθηγητήσ ςτο ςπίτι, 24 ώρεσ το 24ωρο

η τζχνη τησ εκπαίδευςησ ο καθηγητήσ ςτο ςπίτι, 24 ώρεσ το 24ωρο η τζχνη τησ εκπαίδευςησ ο καθηγητήσ ςτο ςπίτι, 24 ώρεσ το 24ωρο 210-9519043, info@odsk.gr Ειςαγωγή ιμερα, με τθν αλματϊδθ πρόοδο τθσ τεχνολογίασ και ειδικότερα ςτον τομζα των τθλεπικοινωνιϊν, ανοίγονται

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Ν γράψετε στο τετράδιό σς τον ριθμό κθεμιάς πό τις πρκάτω ημιτελείς προτάσεις Α1 έως Α5 κι δίπλ το γράμμ που

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015

ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015 ΑΠΑΝΣΗΕΙ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗ ΠΑΙΔΕΙΑ ΘΕΜΑ Α ΣΕΣΑΡΣΗ 20 ΜΑΪΟΤ 2015 Α1. - γ. ςφφιλθ Α2. - α. ερυκρόσ μυελόσ των οςτών Α3. - β. εντομοκτόνο Α4. - β. καταναλωτζσ 1θσ τάξθσ Α5. - δ. μία οικογζνεια ΘΕΜΑ Β Β1. 1.

Διαβάστε περισσότερα

Εγκατάσταση «Μισθός 2005»

Εγκατάσταση «Μισθός 2005» Εγκατάσταση «Μισθός 2005» Έκδοση 8.5 ΟΔΗΓΙΕΣ ΕΓΚΑΤΑΣΤΑΣΗΣ Βιμα 1 ο. Κάνουμε φφλαξθ των αρχείων από τθν προθγοφμενθ ζκδοςθ του προγράμματοσ. Εργαλεία Φφλαξθ c:\msteuro\20111001 *Εντάξει+ Όποσ: 20111001

Διαβάστε περισσότερα

ΘΕΜΑ: «Ειςαγωγή μαθητών και ςχετικζσ ρυθμίςεισ ςτα Πρότυπα Πειραματικά χολεία (Π.Π..) για το ςχολικό ζτοσ 2013-2014»

ΘΕΜΑ: «Ειςαγωγή μαθητών και ςχετικζσ ρυθμίςεισ ςτα Πρότυπα Πειραματικά χολεία (Π.Π..) για το ςχολικό ζτοσ 2013-2014» Μαροφςι, 12/03/2013 ΘΕΜΑ: «Ειςαγωγή μαθητών και ςχετικζσ ρυθμίςεισ ςτα Πρότυπα Πειραματικά χολεία (Π.Π..) για το ςχολικό ζτοσ 2013-2014» Η ΔΙΟΙΚΟΤΑ ΕΠΙΣΡΟΠΗ ΠΡΟΣΤΠΩΝ ΠΕΙΡΑΜΑΣΙΚΩΝ ΧΟΛΕΙΩΝ (Δ.Ε.Π.Π..) Ανακοινώνει

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ. Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ:

Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ. Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ: Γ' ΛΥΚΕΙΟΥ Η ΤΑΞΗ ΤΗΣ ΤΕΛΙΚΗΣ ΕΠΙΛΟΓΗΣ Στθ ΓϋΛυκείου οι Ομάδεσ Προςανατολιςμοφ είναι τρεισ: 1. Ομάδα Ανκρωπιςτικών Σπουδών 2. Ομάδα Οικονομικών, Πολιτικών, Κοινωνικών & Παιδαγωγικών Σπουδών 3. Ομάδα Θετικών

Διαβάστε περισσότερα

Δείκτησ Αξιολόγηςησ 1.1: χολικόσ χώροσ, υλικοτεχνική υποδομή και οικονομικοί πόροι

Δείκτησ Αξιολόγηςησ 1.1: χολικόσ χώροσ, υλικοτεχνική υποδομή και οικονομικοί πόροι Δείκτησ Αξιολόγηςησ 1.1: χολικόσ χώροσ, υλικοτεχνική υποδομή και οικονομικοί πόροι ΣΟΜΕΑ 1: ΜΕΑ ΚΑΙ ΠΟΡΟΙ ΔΕΔΟΜΕΝΑ ΣΟΤ ΧΟΛΕΙΟΤ Περιγραφή: Ο ςυγκεκριμζνοσ δείκτθσ αναφζρεται ςτον βακμό που οι υπάρχοντεσ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ. Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων

Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ. Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων Επίδραςθ επιγενετικών μθχανιςμών κατά τθ διάρκεια τθσ ηωισ Εμμ. Μ. Καραβιτάκθσ Παιδίατροσ Επιμ. Α ΜΕΝΝ Γ.Ν.Χανίων ΣΟΧΟΙ ΣΗ ΠΑΡΟΤΙΑΗ οριςμόσ τθσ επιγενετικισ και των μθχανιςμϊν τθσ επίδραςθ επιγενετικϊν

Διαβάστε περισσότερα

Ακολουκιακά Λογικά Κυκλώματα

Ακολουκιακά Λογικά Κυκλώματα Ακολουκιακά Λογικά Κυκλώματα Τα ψθφιακά λογικά κυκλϊματα που μελετιςαμε μζχρι τϊρα ιταν ςυνδυαςτικά κυκλϊματα. Στα ςυνδυαςτικά κυκλϊματα οι ζξοδοι ςε κάκε χρονικι ςτιγμι εξαρτϊνται αποκλειςτικά και μόνο

Διαβάστε περισσότερα

ΤΙΤΛΟΣ: "SWITCH-ΠΩ ΝΑ ΚΑΣΑΦΕΡΕΙ ΣΗΝ ΑΛΛΑΓΗ ΟΣΑΝ Η ΑΛΛΑΓΗ ΕΙΝΑΙ ΔΤΚΟΛΗ" Σσγγραφείς: Chip Heath & Dan Heath. Εκδόζεις: Κσριάκος Παπαδόποσλος/ΕΕΔΕ

ΤΙΤΛΟΣ: SWITCH-ΠΩ ΝΑ ΚΑΣΑΦΕΡΕΙ ΣΗΝ ΑΛΛΑΓΗ ΟΣΑΝ Η ΑΛΛΑΓΗ ΕΙΝΑΙ ΔΤΚΟΛΗ Σσγγραφείς: Chip Heath & Dan Heath. Εκδόζεις: Κσριάκος Παπαδόποσλος/ΕΕΔΕ ΤΙΤΛΟΣ: "SWITCH-ΠΩ ΝΑ ΚΑΣΑΦΕΡΕΙ ΣΗΝ ΑΛΛΑΓΗ ΟΣΑΝ Η ΑΛΛΑΓΗ ΕΙΝΑΙ ΔΤΚΟΛΗ" Σσγγραφείς: Chip Heath & Dan Heath Εκδόζεις: Κσριάκος Παπαδόποσλος/ΕΕΔΕ www.dimitrazervaki.com Περιεχόμενα ΣΡΕΙ ΑΝΑΠΑΝΣΕΧΕ ΔΙΑΠΙΣΩΕΙ

Διαβάστε περισσότερα

ΕΞΟΙΚΟΝΟΜΘΘ ΝΕΡΟΤ!!!!

ΕΞΟΙΚΟΝΟΜΘΘ ΝΕΡΟΤ!!!! ΕΞΟΙΚΟΝΟΜΘΘ ΝΕΡΟΤ!!!! Χωρίσ νερό δεν μπορεί να υπάρξει ανκρϊπινθ ηωι! Ζνασ μζςοσ άνκρωποσ μπορεί να αντζξει χωρίσ τροφι 2 μινεσ, ενϊ χωρίσ νερό μόνο 2-3 μζρεσ. Αν ο ανκρϊπινοσ οργανιςμόσ χάςει μεγάλθ ποςότθτα

Διαβάστε περισσότερα

ελ. 11/235, Περιεχόμενα Φακζλου "Σεχνικι Προςφορά"

ελ. 11/235, Περιεχόμενα Φακζλου Σεχνικι Προςφορά υντάκτθσ : Ευάγγελοσ Κρζτςιμοσ χόλιο: ΠΑΡΑΣΗΡΗΗ 1 ελ. 11/235, Περιεχόμενα Φακζλου "Σεχνικι Προςφορά" Για τθν αποφυγι μεγάλου όγκου προςφοράσ και για τθ διευκόλυνςθ του ζργου τθσ επιτροπισ προτείνεται τα

Διαβάστε περισσότερα

Αυτόνομοι Πράκτορες. Αναφορά Εργασίας Εξαμήνου. Το αστέρι του Aibo και τα κόκαλα του

Αυτόνομοι Πράκτορες. Αναφορά Εργασίας Εξαμήνου. Το αστέρι του Aibo και τα κόκαλα του Αυτόνομοι Πράκτορες Αναφορά Εργασίας Εξαμήνου Το αστέρι του Aibo και τα κόκαλα του Jaohar Osman Η πρόταςθ εργαςίασ που ζκανα είναι το παρακάτω κείμενο : - ξ Aibo αγαπάει πάρα πξλύ ρα κόκαλα και πάμρα ρα

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

Οδηγίες αναβάθμισης χαρτών

Οδηγίες αναβάθμισης χαρτών Οδηγίες αναβάθμισης χαρτών Για να κάνετε τθν αναβάκμιςθ χαρτϊν Ελλάδοσ κα πρζπει να εγγραφείτε ωσ νζο μζλοσ ςτθν ιςτοςελίδα http://www.mls.gr. 1) Εγγραφή νέου μέλουσ ςτην ιςτοςελίδα αναβαθμίςεων Α) Αντιγράψτε

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification

Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification Νζεσ Τάςεισ ςτην εκπαιδευτική διαδικαςία: Gamification Δρ. Παναγιϊτθσ Ζαχαριάσ Οικονομικό Πανεπιςτιμιο Ακθνϊν - 15/5/2014 Ημερίδα με κζμα: «Οικονομία τθσ Γνϊςθσ: Αξιοποίθςθ τθσ καινοτομίασ ςτθ Β Βάκμια

Διαβάστε περισσότερα

Ηλεκτρονικά Μαθήματα: Αςφάλεια ςτο Διαδίκτυο

Ηλεκτρονικά Μαθήματα: Αςφάλεια ςτο Διαδίκτυο Ηλεκτρονικά Μαθήματα: Αςφάλεια ςτο Διαδίκτυο Ζργο χρηματοδοτοφμενο από την Ευρωπαϊκή Ζνωςη, με τίτλο: Using New Media to prevent and combat against Media Violence (Αρ. Συμβολαίου: JUST/2010/DAP3/AG/1350)

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων.

Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων. Σί είναι η ακράτεια οφρων; Ακράτεια οφρων είναι οποιαςδιποτε μορφισ ακοφςια απώλεια οφρων. Ποιά είναι η επίπτωςή τησ ςτο γυναικείο πληθυςμό; Γενικά 27% των γυναικών κα παρουςιάςουν κάποιο τφπο ακράτειασ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ Λουκάς Νικολάου ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ 2014 2 Γενετική είναι ο κλάδος της Βιολογίας που ασχολείται με την μελέτη της κληρονομικότητας. Κληρονομικότητα είναι η προγόνους στους απογόνους. μεταβίβαση χαρακτήρων

Διαβάστε περισσότερα

Εφδοξοσ+ Συνδεκείτε ςτθν Εφαρμογι Φοιτθτϊν και μεταβείτε ςτθ ςελίδα «Ανταλλαγι Βιβλίων (Εφδοξοσ+)».

Εφδοξοσ+ Συνδεκείτε ςτθν Εφαρμογι Φοιτθτϊν και μεταβείτε ςτθ ςελίδα «Ανταλλαγι Βιβλίων (Εφδοξοσ+)». Εφδοξοσ+ Διαθζτοντασ βιβλία μζςω του «Εφδοξοσ+» Συνδεκείτε ςτθν Εφαρμογι Φοιτθτϊν και μεταβείτε ςτθ ςελίδα «Ανταλλαγι Βιβλίων (Εφδοξοσ+)». Εμφανίηεται θ λίςτα με όλα ςασ τα βιβλία. Από εδϊ μπορείτε: -

Διαβάστε περισσότερα

25. Ποια είναι τα ψυκτικά φορτία από εξωτερικζσ πθγζσ. Α) Τα ψυκτικά φορτία από αγωγιμότθτα. Β) Τα ψυκτικά φορτία από ακτινοβολία και

25. Ποια είναι τα ψυκτικά φορτία από εξωτερικζσ πθγζσ. Α) Τα ψυκτικά φορτία από αγωγιμότθτα. Β) Τα ψυκτικά φορτία από ακτινοβολία και 25. Ποια είναι τα ψυκτικά φορτία από εξωτερικζσ πθγζσ Α) Τα ψυκτικά φορτία από αγωγιμότθτα. Β) Τα ψυκτικά φορτία από ακτινοβολία και Γ) Τα ψυκτικά φορτία από είςοδο εξωτερικοφ αζρα. 26. Ποιζσ είναι οι

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

4o Τοσρνοσά Basket Σηελετών Επιτειρήζεων 2013-2014 Δήλωζη Σσμμεηοτής

4o Τοσρνοσά Basket Σηελετών Επιτειρήζεων 2013-2014 Δήλωζη Σσμμεηοτής 4o Τοσρνοσά Basket Σηελετών Επιτειρήζεων 2013-2014 Δήλωζη Σσμμεηοτής 4o Τουρνουά Basket Στελεχϊν Επιχειριςεων 2013-2014 Σελ. 1 / 7 Σηοιτεία Αθληηών Ομάδας: 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.

Διαβάστε περισσότερα

υνδζςου με το μζλλον ΤΝΔΕΜΟ ΕΣΑΙΡΙΩΝ ΦΩΣΟΒΟΛΣΑΪΚΩΝ

υνδζςου με το μζλλον ΤΝΔΕΜΟ ΕΣΑΙΡΙΩΝ ΦΩΣΟΒΟΛΣΑΪΚΩΝ υνδζςου με το μζλλον net-metering ΤΝΔΕΜΟ ΕΣΑΙΡΙΩΝ ΦΩΣΟΒΟΛΣΑΪΚΩΝ net-metering ςτθ Ελλάδα Σο net-metering ι αλλιϊσ θ αυτοπαραγωγι επιτρζπει πλζον ςτον Ζλλθνα καταναλωτι να παράγει τθν θλεκτρικι ενζργεια

Διαβάστε περισσότερα

ΧΗΜΕΙΟΘΕΡΑΠΕΙΑ ΣΟΝ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ. Ανκόπουλοσ Μιχάλθσ Ογκολόγοσ Επιμελθτισ μονάδασ Χ/Θ Μποδοςάκειο Νοςοκομείο Πτολεμαΐδασ

ΧΗΜΕΙΟΘΕΡΑΠΕΙΑ ΣΟΝ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ. Ανκόπουλοσ Μιχάλθσ Ογκολόγοσ Επιμελθτισ μονάδασ Χ/Θ Μποδοςάκειο Νοςοκομείο Πτολεμαΐδασ ΧΗΜΕΙΟΘΕΡΑΠΕΙΑ ΣΟΝ ΚΑΡΚΙΝΟ ΣΟΤ ΠΝΕΤΜΟΝΑ Ανκόπουλοσ Μιχάλθσ Ογκολόγοσ Επιμελθτισ μονάδασ Χ/Θ Μποδοςάκειο Νοςοκομείο Πτολεμαΐδασ ΤΠΑΡΧΕΙ ΟΦΕΛΟ ΑΠΟ ΣΗΝ Χ/Θ ΣΟΤ ΑΘΕΝΕΙ ΜΕ ΚΑΡΚΙΝΟ ΠΝΕΤΜΟΝΑ; ΜΜΚΠ Αυξάνει τα

Διαβάστε περισσότερα

Κυκλοφορώ με αςφάλεια ςτο δρόμο

Κυκλοφορώ με αςφάλεια ςτο δρόμο ΡΕΛΦΕΕΛΑΚΟ ΔΘΜΟΤΛΚΟ ΣΧΟΛΕΛΟ ΜΑΩΝΛΟΥ- ΨΕΜΑΤΛΣΜΕΝΟΥ Κυκλοφορώ με αςφάλεια ςτο δρόμο Διαθεματική Εργαςία από τουσ μαθητέσ τησ Γ και Δ τάξησ. Δαςκάλα: Φρυςοβαλάντω Θουκυδίδου ΣΧΟΛΛΚΘ ΧΟΝΛΑ 2010 2011 ΠΕΡΙΕΦΟΜΕΝΑ

Διαβάστε περισσότερα

Megatron ERP Βάςη δεδομζνων Π/Φ - κατηγοριοποίηςη Databox

Megatron ERP Βάςη δεδομζνων Π/Φ - κατηγοριοποίηςη Databox Megatron ERP Βάςη δεδομζνων Π/Φ - κατηγοριοποίηςη Databox 03 05 ΙΛΤΔΑ ΠΛΗΡΟΦΟΡΙΚΗ Α.Ε. αρμά Ιηαμπζλλα Βαρλάμθσ Νίκοσ Ειςαγωγι... 1 Σι είναι το Databox...... 1 Πότε ανανεϊνεται...... 1 Μπορεί να εφαρμοςτεί

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΑΠΑΝΤΗΣΕΙΣ Α.1.

Διαβάστε περισσότερα