Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:"

Transcript

1 1 ΚΕΦΑΛΑΙΟ 1 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι επιστήµονες αρχικά πίστευαν ότι το γενετικό υλικό ήταν οι πρωτεΐνες και όχι το DNA διότι: α) To DNA βρίσκεται κυρίως στον πυρήνα του κυττάρου, ενώ οι πρωτεΐνες σε όλες τις περιοχές του κυττάρου β) οι πρωτεΐνες εφόσον δοµούνται από 20 µονοµερή εµφανίζουν πολύ µεγαλύτερη ποικιλία συγκριτικά µε το DNA που δοµείται µόνο από 4 διαφορετικά δεοξυριβονουκλεοτίδια γ) To DNA χρειάζεται πρωτεΐνες για να αντιγραφεί ενώ οι πρωτεΐνες όχι. δ) Για όλους τους παραπάνω λόγους 2.Τα βακτήρια που χρησιµοποίησε ο Griffith στο τέλος του πειράµατος ήταν: α) Νεκρά αδρά, ζωντανά λεία, ζωντανά αδρά. β])ζωντανά και νεκρά λεία και ζωντανά αδρά γ) Νεκρά λεία και αδρά και ζωντανά λεία δ) Ζωντανά αδρά και νεκρά λεία 3.Στο πείραµα του Griffith, η εµφάνιση ζωντανών λείων βακτηρίων στο αίµα των ποντικών κατά το τέλος του πειράµατος, οφείλεται σε µεταφορά: α) Περιβλήµατος από τα νεκρά στα ζωντανά β) Κάποιου παράγοντα που µετέτρεψε τα νεκρά λεία σε ζωντανά γ) DΝΑ από τα νεκρά στα ζωντανά D) DNA από τα ζωντανά στα νεκρά 4.Οι επιστήµονες κατάφεραν να αποδείξουν ότι το DNA αποτελεί το γενετικό υλικό στηριζόµενοι στα πειράµατα Griffith κάνοντας τα παρακάτω: α) αποµόνωσαν όλα τα βιολογικά µακροµόρια του παθογόνου ή «λείου» βακτηρίου και µαζί µε ζωντανά «αδρά» βακτήρια τα ένεσαν σε ποντίκια β) αποµόνωσαν τα βιολογικά µακροµόρια του µη παθογόνου ή «αδρού» βακτηρίου και µαζί µε «λεία» βακτήρια τα ένεσαν σε ποντίκια Γ) αποµόνωσαν τα βιολογικά µακροµόρια των «λείων» βακτηρίων και το καθένα χωριστά µαζί µε «αδρά» βακτήρια τα ένεσαν σε ποντίκια δ) αποµόνωσαν τα βιολογικά µακροµόρια των «λείων» βακτηρίων και ανά δυο µαζί µε «αδρά» βακτήρια τα ένεσαν σε ποντίκια ε) δεν έκαναν τίποτε από τα παραπάνω 5.Στα πειράµατα των Hershey - Chase αποδείχθηκε ότι: α) Μόνο το DNA του φάγου εισέρχεται στο βακτήριο β) Ολόκληρος ο φάγος εισέρχεται στο βακτήριο γ) To DNA του βακτηρίου εισέρχεται στο φάγο δ) Το DΝΑ είναι το Γενετικό υλικό ε) Η είσοδος του DNA του φάγου στο βακτήριο βοηθά στη σύνθεση των πρωτεϊνών του βακτηρίου στ) Ta a και δ είναι σωστά. 6.Η οριστική επιβεβαίωση ότι το γενετικό υλικό είναι το DNA ήρθε από τα πειράµατα των Hershey και Chase στον βακτηριοφάγο Τ2 διότι έδειξαν ότι: α) όλα τα βιολογικά µακροµόρια που περιέχει ο Τ2 εισέρχονται στο βακτήριο στο οποίο παρασιτεί, προκειµένου να αναπαραχθεί β) µόνο το DNA του βακτηριοφάγου Τ2 εισέρχεται στο βακτήριο, γεγονός απαραίτητο

2 2 προκειµένου να αναπαραχθεί ο ιός γ) το DNA και ορισµένες πρωτεΐνες του βακτηριοφάγου Τ2 πρέπει να εισέλθουν στο βακτήριο, προκειµένου να αναπαραχθεί ο ιός δ) ορισµένες πρωτεΐνες του βακτηριοφάγου Τ2 πρέπει να εισέλθουν στο βακτήριο, προκειµένου να αναπαραχθεί ο ιός 7.Σχετικά µε το DNA υπάρχουν βιοχηµικά δεδοµένα ότι: α) Η ποσότητα του DNA ενός οργανισµού δεν µεταβάλλεται από αλλαγές στο περιβάλλον. β) Όλα ανεξαιρέτως τα είδη κυττάρων ενός οργανισµού έχουν ίδια ποσότητα DNA. γ) Η εξέλιξη ενός οργανισµού σχετίζεται µε την αλλαγή της ποσότητας του DNA του και όχι µε την αλλαγή της ποιότητας της γενετικής πληροφορίας, δ) Τίποτα από τα παραπάνω δεν είναι σωστό 8.Η ποσότητα του DNA είναι: α. σταθερή σε κάθε οργανισµό και σε όλα του τα κύτταρα β. είναι ανάλογη, κατά κανόνα, µε την πολυπλοκότητα του οργανισµού γ. είναι η ίδια στα σωµατικά και στα γαµετικά κύτταρα ενός ανώτερου οργανισµού δ. είναι η ίδια σε συγγενικά είδη οργανισµών 9.Ποιο από τα παρακάτω αποτελεί βασική δοµική µονάδα του DNA; α) η ριβόζη β)η πεντόζη γ)η δεοξυριβόζη δ) το φωσφορικό οξύ ε) το ριβονουκλεοτίδιο ζ) το δεοξυριβονουκλεοτίδιο 10.Σε κάθε νουκλεοτίδιο τα επιµέρους δοµικά συστατικά του συνδέονται ως εξής: α) η αζωτούχος βάση συνδέεται µε τον 1 άνθρακα της δεσοξυριβόζης, ενώ η φωσφορική οµάδα µε τον 3' άνθρακα. β) η αζωτούχος βάση συνδέεται µε τον 1 άνθρακα της δεσοξυριβόζης, ενώ η φωσφορική οµάδα µε τον 2' άνθρακα. γ) αζωτούχος βάση συνδέεται µε τον 1 άνθρακα της δεσοξυριβόζης, ενώ η φωσφορική οµάδα µε τον 5' άνθρακα, δ) µε κανέναν από τους παραπάνω τρόπους 11.Ποια από τα παρακάτω διατυπώνονται στο µοντέλο της διπλής έλικας; α) το µόριο του DNA αποτελείται από δυο πολυνουκλεοτιδικές αλυσίδες που σχηµατίζουν αριστερόστροφη έλικα β) ο σκελετός του DNA είναι υδρόφοβος στο εξωτερικό του και υδρόφοβος στο εσωτερικό του γ) οι αζωτούχες βάσεις της µιας αλυσίδας συνδέονται µε δεσµούς υδρογόνου µε τις αζωτούχες βάσεις της άλλης αλυσίδας µε βάση τον κανόνα της συµπληρωµατικότητας. δ) ανάµεσα στις Α και τις Τ αναπτύσσονται 3 δεσµοί υδρογόνου, ενώ 2 ανάµεσα στις G και C. ε) Οι δυο αλυσίδες δεν είναι συµπληρωµατικές στ) Οι δυο αλυσίδες είναι παράλληλες ζ) τίποτε από τα παραπάνω δεν ισχύει 12.Για τις δυο αλυσίδες του DNA ισχύει: α. Α = Τ β. A + T = C + G γ. C = G δ. A + G = C + T 13.Αν η µια αλυσίδα του DNA έχει λόγο A+T / C+G = 2/3, τότε ο ίδιος λόγος στη συµπληρωµατική της αλυσίδα είναι: α. 2/3 β. 3/2 γ. 2 δ. 3

3 3 14.Οι δύο αλυσίδες του DNA είναι αντιπαράλληλες. Αυτό σηµαίνει ότι: α) Απέναντι από το 5' άκρο της µιας βρίσκεται το 3' άκρο της άλλης β) Η µία είναι δεξιόστροφη και η άλλη αριστερόστροφη. γ), Η µία έχει προσανατολισµό 5' > 3' ενώ η άλλη 3' > 5'. δ) Τα νουκλεοτίδια της µιας αλυσίδας συνδέονται µε 3'- 5' φωσφοδιεστερικό δεσµό ενώ τα νουκλεοτίδια της άλλης µε 5' - 3'. 15.Με ποιον, από τους τρόπους που αναφέρονται πιο κάτω, συνδέεται κάθε νουκλεοτίδιο µε το αµέσως επόµενο του στην πολυνουκλεοτιδική αλυσίδα του DNA; α. η φωσφορική οµάδα του ενός, µε την αζωτούχο βάση του εποµένου β. η φωσφορική οµάδα του ενός, µε την δεσοξυριβόζη του εποµένου γ. οι αζωτούχες βάσεις δύο συνεχόµενων νουκλεοτίδιων µε δεσµούς υδρογόνου δ. η δεσοξυριβόζη του ενός, µε την φωσφορική οµάδα του εποµένου ε. η αζωτούχος βάση του ενός, µε την δεσοξυριβόζη του εποµένου 16.Τα άτοµα του άνθρακα της ριβόζης ενός νουκλεοτιδίου που συνδέονται ι) µε τη φωσφορική οµάδα του νουκλεοτιδίου, ιι) µε την αζωτούχο βάση, και ιιι) µε τη φωσφορική οµάδα του επόµενου νουκλεοτιδίου, είναι µε τη σειρά που αναφέρθηκαν: α)1'-5'-3' β)5'-3'-1' γ)3'-1'-5' δ)5'-1-3' 17.Οι δεσµοί υδρογόνου στο DNA: α. συνδέουν τα νουκλεοτίδια µεταξύ τους β. δηµιουργούν πολικότητα, γιαυτό και τα µόρια του DNA διαλύονται εύκολα στο νερό γ. συνδέουν τις συµπληρωµατικές βάσεις των δύο αλυσίδων δ. εµποδίζουν το µόριο να συµµετέχει στη διαδικασία µετάφρασης πρωτεϊνών 18.Ο φωσφοδιεστερικός δεσµός είναι: α) ιοντικός δεσµός, β) οµοιοπολικός δεσµός, γ) δεσµός υδρογόνου, δ) υδρόφοβος δεσµός. 19.Ο φωσφοδιεστερικός δεσµός: α. είναι δεσµός 5->3' β. συνδέει δυο συµπληρωµατικά δεοξυριβονουκλεοτίδια γ. είναι δεσµός υδρογόνου δ. χρειάζεται ένα µόριο νερού για την υδρόλυση του 20.Μόρια DNA από διαφορετικά είδη οργανισµών διαφέρουν: α. στη δευτεροταγή τους δοµή β. στην αναλογία των βάσεων γ.στον προσανατολισµό των αλυσίδων δ. στην αλληλουχία των πεντοζών 21.Στους διπλοειδείς οργανισµούς α. το γονιδίωµα των σωµατικών κυττάρων υπάρχει σε ένα αντίγραφο β. το γονιδίωµα των γαµετών υπάρχει σε δύο αντίγραφα γ. τα σωµατικά κύτταρα περιέχουν διπλάσια ποσότητα DNA από τους γαµέτες δ. ισχύουν όλα όσα περιγράφονται στα α, β, γ 22.Με τον όρο γονιδίωµα συνήθως εννοούµε: α) µόνο το γενετικό υλικό των γαµετών β) το γενετικό υλικό που υπάρχει στον πυρήνα και στα µιτοχόνδρια γ) το γενετικό υλικό που υπάρχει στον πυρήνα στα µιτοχόνδρια και στους χλωροπλάστες δ) το γενετικό υλικό που υπάρχει στον πυρήνα

4 4 ε) τίποτε από τα παραπάνω 23.Το γονιδίωµα στους προκαρυωτικούς είναι: α. δυο αντίγραφα κυκλικών µορίων DNA β. µόνο δίκλωνα κυκλικά µόρια DNA, τα πλασµίδια γ. ένα δίκλωνο κυκλικό µόριο DNA και τα πλασµίδια δ. ένα κυκλικό µόριο DNA και πρωτεΐνες 24.Στο δίκλωνο µόριο του DNA: α. οι δύο πολυνουκλεοτιδικές αλυσίδες σχηµατίζουν στο χώρο µία δεξιόστροφη διπλή έλικα β. οι αζωτούχες βάσεις της µιας αλυσίδας συνδέονται µε δεσµούς υδρογόνου µε τις αζωτούχες βάσεις της απέναντι αλυσίδας, µε βάση τον κανόνα της συµπληρωµατικότητας γ. οι δεσµοί υδρογόνου που αναπτύσσονται µεταξύ των συµπληρωµατικών βάσεων σταθεροποιούν τη δευτεροταγή δοµή του µορίου δ. όλα τα παραπάνω 25.Ο όρος αλληλουχία βάσεων α. εκφράζει την ακολουθία των νουκλεοτιδίων σε ένα νουκλεικό οξύ β. εκφράζει την ακολουθία των πεντοζών µιας πολυνουκλεοτιδικής αλυσίδας γ. αναφέρεται στον αριθµό φωσφοδιεστερικών δεσµών δ. αναφέρεται στην ακολουθία των φωσφορικών οµάδων 26.Οι γαµέτες είναι απλοειδή κύτταρα γιατί α. το γενετικό τους υλικό υπάρχει σε ένα µόνο αντίγραφο β. το γονιδίωµα τους είναι µονόκλωνο γ. η δοµή τους είναι όµοια µε των προκαρυωτικών κυττάρων δ. το γονιδίωµα τους υπάρχει σε δύο µόνο αντίγραφα. 27.Γονιδίωµα είναι α. το σύνολο των αλληλοµόρφων γονιδίων ενός απλοειδούς κυττάρου β το γενετικό υλικό των απλοειδών η των διπλοειδων κύτταρων γ το µόριο του DNA ενός απλοειδούς κυττάρου δ τµήµα ενός µορίου DNA µε καθορισµένη ακολουθία νουκλεοτιδίων. 28.To RNΑ αποτελείται από α. αµινοξέα, που συνδέονται µεταξύ τους µε πεπτιδικό δεσµό β. πεπτίδια, που συνδέονται µεταξύ τους µε πεπτιδικό δεσµό γ. νουκλεοτίδια, που συνδέονται µε φωσφοδιεστερικό δεσµό δ. διαφορετικά µόρια πεντοζών, που συνδέονται µε αζωτούχες βάσεις 29.Οι γαµέτες είναι απλοειδή κύτταρα γιατί α. διότι διαιρούντα κατά την µεσόφαση β. το γονιδίωµα τους είναι µονόκλωνο γ. διότι προέρχονται από µειωτική διαίρεση των γενετικών κυττάρων δ.. διότι προέρχονται από µειωτική διαίρεση των σωµατικών κυττάρων 30.Ένα φυσιολογικό ανθρώπινο σπερµατοζωάριο περιέχει: α. 22 ζεύγη αυτοσωµικών χρωµοσωµάτων και ένα Χ ή ένα Υ β. 23 χρωµοσώµατα γ. 22 αυτοσωµικά οµόλογα χρωµοσώµατα και ένα ζεύγος φυλετικών

5 5 δ. 23 αυτοσωµικά χρωµοσώµατα και ένα Χ ή ένα Υ 31.Τα φυλετικά χρωµοσώµατα α εντοπίζονται µόνο στα γεννητικά κύτταρα των πολυκύτταρων οργανισµών β διατάσσονται πάντοτε σε ζεύγη οµολόγων χρωµοσωµάτων γ είναι ορατά στα σωµατικά κύτταρα κατά τη µεσόφαση δ υπάρχουν τόσο στα σωµατικά όσο και στα γεννητικά κύτταρα 32.Το νουκλεϊκό οξύ RNA είναι το γενετικό υλικό: α. των προκαρυωτικών κυττάρων β. των µιτοχονδρίων και των χλωροπλαστών γ. των διπλοειδών οργανισµών δ. κάποιων ιών 33.Το γενετικό υλικό των προκαρυωτικών κυττάρων: α. είναι γραµµικό δίκλωνο µόριο DNA β. περιέχει δύο αντίγραφα του γονιδιώµατος του και άρα διπλοειδές γ. είναι κυκλικό, δίκλωνο DNA δ. είναι κυκλικό, µονόκλωνο RNA 34.Το γενετικό υλικό βρίσκεται σε κυκλική µορφή: α. στα προκαρυωτικά κύτταρα β. σε κάποιους ιούς γ. στους χλωροπλάστες και στα µιτοχόνδρια των περισσότερων ευκαρυωτικών κυττάρων δ. σε όλα τα παραπάνω 35.Τα νουκλεοτίδια του DNA προέρχονται από τη σύνδεση: α. Μιας δεσοξυριβόζης, ενός φωσφορικού οξέος και µιας οργανικής αζωτούχου βάσης β. µιας σακχαρόζης, ενός φωσφορικού οξέος και µιας οργανικής αζωτούχου βάσης γ) µιας δεσοξυριβόζης, ενός φωσφορικού οξέος και µιας ουρακίλης δ) του ΑΤΡ, ενός φωσφορικού οξέος και µιας οργανικής αζωτούχου βάσης. 36.To DNA διαφέρει από το RNA διότι: α) εντοπίζεται σε όλα τα κυτταρικά οργανίδια β) τα νουκλεοτίδια του περιέχουν τον υδατάνθρακα γαλακτόζη γ. είναι το γενετικό υλικό όλων των κυττάρων δ) µετακινείται ελεύθερα από τον πυρήνα προς το κυτταρόπλασµα ε) έχει δευτεροταγή δοµή 37.Στο DNA δεν υπάρχουν: α) δεσµοί υδρογόνου β) υδρόφοβοι δεσµοί γ) φωσφοδιεστερικοί δεσµοί (3' - 5') δ. δισουλφιδικοί δεσµοί 38.Τα οµόλογα χρωµοσώµατα: α) έχουν ίδιο σχήµα και µέγεθος, β) περιέχουν γονίδια που ελέγχουν το ίδιο γνώρισµα. γ) υπάρχουν µόνο στους διπλοειδείς οργανισµούς. ) όλα τα παραπάνω είναι σωστά. 39.Τι από τα παρακάτω ισχύουν για τα συστατικά του DNA: α) Οι φωσφορικές οµάδες και οι βάσεις είναι υδρόφιλες ενώ οι δεοξυριβόζες υδρόφοβες. β) Οι βάσεις και οι δεοξυριβόζες είναι υδρόφιλες ενώ τα φωσφορικά οξέα υδρόφοβα γ) Τα φωσφορικά οξέα και οι δεοξυριβόζες αποτελούν τον υδρόφιλο εξωτερικό σκελετό ενώ οι ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

6 6 βάσεις που είναι υδρόφοβες βρίσκονται στο εσωτερικό δ) Τα φωσφορικά οξέα και οι δεοξυριβόζες αποτελούν τον υδρόφοβο εξωτερικό σκελετό ενώ οι βάσεις που είναι υδρόφιλες βρίσκονται στο εσωτερικό 40.Ένα ζεύγος οµολόγων χρωµοσωµάτων κατά τη µετάφαση περιλαµβάνει: α) 2 χρωµατίδες και 2 µόρια DNA β) 2 χρωµοσώµατα, 4 χρωµατίδες, 8 µονόκλωνα DNA γ) 2 χρωµοσώµατα, 4 χρωµατίδες, 8 δίκλωνα DNA δ) 2 χρωµοσώµατα, 4 χρωµατίδες, 4 δίκλωνα DNA 41.Στο τέλος της µίτωσης καθένα από τα 2 θυγατρικά κύτταρα περιέχει: α) Ένα από τα 2 χρωµοσώµατα κάθε ζεύγους οµολόγων χρωµοσωµάτων β) Μία από τις 2 αδελφές χρωµατίδες κάθε χρωµοσώµατος γ) Από κάθε µόριο DNA του γονικού κυττάρου κατά την αρχή της διαίρεσης, τον έναν κλώνο, δ) Μία µόνο χρωµατίδα από κάθε ζευγάρι χρωµοσωµάτων 42.Τα πλασµίδια που υπάρχουν σε ένα προκαρυωτικό κύτταρο: α. είναι δίκλωνα µόρια DNA µε το ίδιο µέγεθος β. φέρουν γενετικές πληροφορίες για το σύνολο των ιδιοτήτων βακτηρίου γ. µεταφέρουν γενετικό υλικό σε άλλα βακτήρια δ. αντιγράφονται ταυτόχρονα µε το κύριο µόριο DNA του βακτηρίου 43.Τα ινίδια χρωµατίνης α. είναι ορατά στο οπτικό µικροσκόπιο κατά τη µεσόφαση β. αποτελούνται από DNA και πρωτεΐνες γ. διπλασιάζονται κατά τη µετάφαση της µιτωτικής διαίρεσης δ. αποτελούνται από δύο αδελφές χρωµατίδες ενωµένες στο κεντροµερίδιο 44.Οι αδελφές χρωµατίδες α. ενώνονται στο κεντροµερίδιο β. παράγονται στο στάδιο µεταγραφής του DNA γ. παραµένουν ενωµένες µετά τη διαίρεση του κυττάρου δ. συσπειρώνονται κατά το τέλος της µίτωσης για να αποκτήσουν τη µορφή των ινιδίων της χρωµατίνης. 45.Το πλασµίδιο των βακτηρίων είναι α. το γονιδίωµα τους β. ένα επί πλέον κυκλικό µόριο DNA γ. τµήµα του κυκλικού µορίου του DNA δ. κυκλικό DNA, µεγαλύτερο από το γονιδίωµα τους. 46.Τι από τα παρακάτω ισχύουν για τα πλασµίδια; α) αποτελούν το γενετικό υλικό των βακτηρίων β) είναι δίκλωνα, κυκλικά µόρια DNA που έχουν πάντα το ίδιο µέγεθος, γ) όλα τα βακτήρια περιέχουν ένα πλασµίδιο δ) αντιγράφεται ταυτόχρονα µε το κύριο DNA του βακτηρίου ε) υπάρχουν πολύ σηµαντικά για την επιβίωση των βακτηρίων γονίδια, όπως π.χ. γονίδια που προσδίδουν ανθεκτικότητα σε αντιβιοτικά στ) δεν ανταλλάσουν γενετικό υλικό µεταξύ τους ή µε το κύριο µόριο DNA του βακτηρίου ζ) τίποτε από τα παραπάνω δεν ισχύει ΗΡΩΩΝ ΠΟΛΥΤΕΧΝΕΙΟ Υ 79 ΑΣΟΣ ΧΑΪ ΑΡΙΟΥ ΤΗΛ:

7 7 47.Ποιο από τα παρακάτω δεν αποτελεί διαφορά ανάµεσα στο γενετικό υλικό των ευκαρυωτικών και των προκαρυωτικών κυττάρων; α) Το γενετικό υλικό των ευκαρυωτικών είναι µεγαλύτερου µήκους από αυτό των προκαρυωτικών β) Το συνολικό DNA των ευκαρυωτικών κυττάρων δεν είναι ενιαίο µόριο αλλά αποτελείται από πολλά ευθύγραµµα κοµµάτια που διαφέρουν ανάλογα µε τον οργανισµό, ενώ στα προκαρυωτικά είναι ένα κυκλικό µόριο DNA. γ) Στο γενετικό υλικό των ευκαρυωτικών µεταβάλλεται η συσπείρωση ανάλογα µε τον κυτταρικό τους κύκλο (χρωµατίνη στη µεσόφαση, χρωµοσώµατα κατά τη διαίρεση) κάτι που δεν συµβαίνει στα προκαρυωτικά δ) Στα ευκαρυωτικά κύτταρα το γενετικό υλικό πακετάρεται υπό τη µορφή νουκλεοσωµάτων κάτι που δεν συµβαίνει στα προκαρυωτικά ε) Στα ευκαρυωτικά κύτταρα δεν υπάρχουν πλασµίδια, όπως συµβαίνει στα προκαρυωτικά στ))στα ευκαρυωτικά κύτταρα το γενετικό υλικό πακετάρεται µε πρωτεΐνες ενώ στα προκαρυωτικά όχι 48.Ο αριθµός και η µορφολογία των χρωµοσωµάτων, όπως φαίνονται στον καρυότυπο, είναι ιδιαίτερο χαρακτηριστικό: α) για κάθε οργανισµό β) για κάθε είδος γ) για κάθε πληθυσµό δ) για τα έµβια όντα γενικά. 49.Υψηλός βαθµός συσπείρωσης του DNA παρατηρείται: α. κατά την αντιγραφή του DNA β. στο τέλος της µίτωσης γ. στο στάδιο της µετάφασης δ. στη µεσόφαση 50.Το νουκλεόσωµα αποτελεί τη βασική µονάδα οργάνωσης της χρωµατίνης: α. στους προκαρυωτικούς οργανισµούς β. στους ιούς γ. στους ευκαρυωτικούς οργανισµούς δ. σε όλα τα παραπάνω 51.Η κατανοµή όλων των χρωµοσωµάτων σε ένα σωµατικό κύτταρο ανθρώπου σε ζεύγη οµολόγων, σχετίζεται µε: α) Το ότι το DNA είναι δίκλωνο β) Το ότι όταν το DNA διπλασιάζεται, σχηµατίζεται το ζευγάρι των αδελφών χρωµατίδων γ))το ότι κάθε οργανισµός προέρχεται από ένα πατρικό και ένα µητρικό άτοµο δ) Τον κανόνα της συµπληρωµατικότητας 52. Τα χρωµοσώµατα ενός άνδρα σε σχέση µε τα χρωµοσώµατα µιας γυναίκας: α) ιαφέρουν στον αριθµό β) Έχουν διαφορετικό σχήµα και µέγεθος γ) Τα 45 από τα 46 είναι ίδια στο µέγεθος στο σχήµα ενώ το 46 είναι το Υ χρωµόσωµα "που είναι µικρότερο από το Χ. δ) εν διαφέρουν σε τίποτα. 53.Στους ανώτερους οργανισµούς το µιτοχοδριακό DNA: α. ελέγχει τη σύνθεση όλων των πρωτεϊνών του µιτοχονδρίου β. είναι γραµµικό µόριο γ. περιέχει πληροφορίες σχετικά µε την οξειδωτική φωσφορυλίωση δ. είναι πατρικής προέλευσης

8 8 54.Τα µιτοχονδριακά γονίδια ενός ανθρώπου: α) Έχουν µερικά πατρική προέλευση και µερικά µητρική β) Ο ένας κλώνος είναι από τα µιτοχόνδρια του σπερµατοζωαρίου και ο άλλος από τα µιτοχόνδρια του ωαρίου γ. Έχουν αποκλειστικά µητρική προέλευση δ. Έχουν αποκλειστικά πατρική προέλευση 55.Το µιτοχονδριακό DNA: α) Ελέγχει τη σύνθεση όλων των πρωτεϊνών που χρειάζεται το µιτοχόνδριο β. Ελέγχει τη σύνθεση µερικών από τις πρωτεΐνες του µιτοχονδρίου, οι οποίες κατασκευάζονται στα ριβοσώµατα που αυτό περιέχει γ) Ελέγχει τη σύνθεση µερικών πρωτεϊνών του µιτοχονδρίου, καθώς και τη σύνθεση µερικών πρωτεϊνών που γενικότερα χρειάζεται το κύτταρο. δ) τίποτα από τα παραπάνω, 56.Στους ανώτερους οργανισµούς το µιτοχοδριακό DNA: Α) αποτελείται από 2 έως 8 αντίγραφα DNA Β) αποτελείται από 2 έως 10 αντίγραφα RNA Γ) αποτελείται από 2 έως 10 κυκλικά µόρια DNA ) αποτελείται από 2 έως 10 γραµµικά µόρια DNA 57.Στους ιούς το γενετικό υλικό είναι Α) γραµµικό και κυκλικό Β) µονόκλωνο και δίκλωνο Γ) µόνο το α ) Το α και β 1) Η ποσότητα του DNA σε κάθε οργανισµό είναι σταθερή και δε µεταβάλλεται από αλλαγές στο περιβάλλον 2) Το γονιδίωµα των σωµατικών κυττάρων του ανθρώπου αποτελείται από 46 µόρια DNA 3) Η ποσότητα του DNA είναι ίδια σε όλα τα είδη κυττάρων του οργανισµού. 4) Ένα γονίδιο αποτελείται από πολλά νουκλεοσώµατα 5) Η ποσότητα του DNA είναι κατά κανόνα ανάλογη µε την πολυπλοκότητα του οργανισµού. 6) Συνήθως, όσο εξελικτικά ανώτερος είναι ο οργανισµός τόσο λιγότερο DNA περιέχει σε κάθε κύτταρο του 7) Στα απλοειδή κύτταρα, τα οµόλογα χρωµοσώµατα είναι µορφολογικά όµοια. 8) Η ποσότητα του DNA είναι ίδια σε όλα τα σωµατικά κύτταρα ενός πολυκύτταρου οργανισµού. 9) Τα γαµετικά κύτταρα των ανώτερων οργανισµών, τα οποία είναι απλοειδή, περιέχουν τη µισή ποσότητα DNA από τα σωµατικά κύτταρα που είναι διπλοειδή 10) Στους άνδρες τα φυλετικά χρωµοσώµατα των σωµατικών κυττάρων είναι οµόλογα. 11) Για την αναπαραγωγή των DNA φάγων αρκεί µόνο το DNA τους να µπεί στο βακτηριακό κύτταρο 12) Ο δεσµός που συνδέει τα νουκλεοτίδια σε µια αλυσίδα DNA καλείται 5'-3' Φωσφοδιεστερικός 13) Με τον καρυότυπο µπορούµε να µελετήσουµε τη µορφή και αριθµό των χρωµοσωµάτων.

9 9 14) Σε κάθε κλώνο DNA ισχύει Α = Τ και G = C. 15) Τα πλασµίδια προσδίδουν καινούργιες ιδιότητες στα βακτήρια στα οποία εισέρχονται. 16) Κατά τη µεσόφαση της µίτωσης οι αδερφές χρωµατίδες είναι ορατές στο οπτικό µικροσκόπιο 17) Το κεντροµερίδιο συνδέει τους δύο κλώνους του DNA 18) Ο καρυότυπος απεικονίζει τα µεταφασικά χρωµοσώµατα. 19) Στα πλασµίδια εντοπίζονται γονίδια ανθεκτικότητας σε αντιβιοτικά 20) Ένα γαµετικό κύτταρο ανθρώπου περιέχει στον πυρήνα του 6. ΙΟ 9 βάσεις 21) Ένα απλοειδές κύτταρο ανθρώπου, δεν περιέχει ζεύγη οµολόγων χρωµοσωµάτων. 22) Ένα µιτοχόνδριο περιέχει πολλά µόρια κυκλικού DNA. 23) Στα δίκλωνα RNA το άθροισµα A+G είναι ίσο µε το άθροισµα U+C. 24) Η ποσότητα του DNA σε ένα κύτταρο είναι σταθερή. 25) Με Ρ 32 µπορούµε να ιχνηθετήσουµε µόνο DNA. 26) Οι δεσµοί υδρογόνου είναι ισχυρότεροι από τους φωσφοδιεστερικούς 27) Το πλασµίδιο περιέχει γενετικό υλικό, που ρυθµίζει τις λειτουργίες του DNA και δεν περιέχει γονίδια. 28) Στα κύτταρα το DNA είναι πάντα δίκλωνο, ενώ το RNA είναι πάντα µονόκλωνο. 29) Μόνο το DNA του φάγου Τ2 εισέρχεται στο βακτηριακό κύτταρο, όταν το µολύνει. 30) Υπάρχουν ορισµένα βακτήρια που περιέχουν δίκλωνο RNA ως γενετικό υλικό 31) Στα απλοειδή κύτταρα δεν συµβαίνει µίτωση. 32) Οι πρωτεΐνες του φάγου καταστρέφονται µέσα στο βακτηριακό κύτταρο. 33) Στα δίκλωνα νουκλεϊκά οξέα εξαιτίας της αρχής της συµπληρωµατικότητας των βάσεων η αναλογία µεταξύ των συµπληρωµατικών βάσεων είναι 1:1. Έτσι στο DNA του κυττάρου οι αναλογίες Α/Τ και G/C είναι 1:1. αντίθετα στο RNA του κυττάρου οι αναλογίες A/U και G/C δεν είναι σταθερές. 34) To DNA στα ευκαρυωτικά κύτταρα υπάρχει στο πυρήνα, στα µιτοχόνδρια και στους χλωροπλάστες. 35) Σε κάθε νουκλεοτίδιο η αζωτούχος βάση συνδέεται µε τον 3' άνθρακα της δεσοξυριβόζης και η φωσφορική οµάδα µε τον 5' άνθρακα. 36) Οι αναρίθµητες αλληλουχίες νουκλεοτιδίων που µπορεί θεωρητικά να έχει ένα νουκλεϊνικό οξύ, είναι ουσιαστικά αλληλουχίες των αζωτούχων βάσεων. 37) Η αδενίνη συνδέεται µε την θυµίνη µε τρεις δεσµούς υδρογόνου. 38) Το µήκος ενός δίκλωνου µορίου DNA µπορεί να εκφραστεί σε ζεύγη βάσεων. 39) Το γονιδίωµα, στα ευκαρυωτικά κύτταρα, βρίσκεται στον πυρήνα. 40) Το βακτηριακό DNA πακετάρεται µε τη βοήθεια πρωτεϊνών ώστε να έχει τελικό µήκος περίπου 1000 φορές µικρότερο. 41) Η ποσότητα του DNA σε κάθε κύτταρο ενός οργανισµού µεταβάλλεται µε την ηλικία του οργανισµού. 42) Ένα σωµατικό κύτταρο ανθρώπου στη µετάφαση περιέχει 12 ΙΟ 9 βάσεις. 43) Ένα σωµατικό κύτταρο ανθρώπου στη µετάφαση περιέχει τετραπλάσια ποσότητα DNA από ένα γαµέτη. 44) Ιστόνες ονοµάζονται οι πρωτεΐνες µε τις οποίες συνδέεται το DNA στα ευκαρυωτικά ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

10 10 κύτταρα ώστε να πακετάρεται και να χωρά στον περιορισµένο χώρο του πυρήνα 45) Το περιβάλλον µπορεί να µεταβάλλει την ποσότητα DNA ενός οργανισµού. 46) Το κεντροµερίδιο είναι σχηµατισµός του χρωµοσώµατος που συγκρατεί τις αδερφές χρωµατίδες και εποµένως βοηθά στην µεταφορά της γενετικής πληροφορίας από κύτταρο σε κύτταρο και από γενιά σε γενιά. 47) Η γενετική πληροφορία που βρίσκεται κωδικοποιηµένη σε δύο οµόλογα χρωµοσώµατα είναι εντελώς διαφορετική, αφού το ένα έχει µητρική και το άλλο πατρική προέλευση 48) Στο δίκλωνο µόριο του DNA ισχύει πάντα η ισότητα: A + T = C + G. 49) Τα µιτοχονδριακά γονίδια όλων των παιδιών µιας οικογένειας είναι ίδια µε της µητέρ ας τους 50) Τα κύτταρα που προκύπτουν από τη µίτωση ενός διπλοειδούς κυττάρου είναι και πάλι διπλοειδή. 51) Τα νουκλεοσώµατα αποτελούνται από DNA και πρωτεΐνες. 52) Τα µιτοχόνδρια και οι χλωροπλάστες έχουν γενετικό υλικό DNA ή RNA. 53) Το κεντροµερίδιο είναι οργανίδιο που βρίσκεται έξω από τον πυρήνα του κυττάρου. 54) Ο αριθµός των ζευγών βάσεων στο γονιδίωµα ενός σωµατικού κυττάρου άνδρα είναι µικρότερος από τον αντίστοιχο αριθµό σε σωµατικό κύτταρο γυναίκας. 55) DNA µονόκλωνο και κυκλικό είναι δυνατό να συναντήσουµε µόνο σε ορισµένους ιούς. 56) Το γενετικό υλικό των χλωροπλαστών είναι γραµµικό και περιέχει γονίδια για τον σχηµ ατισµό λίγων δεκάδων πρωτεϊνών. 57) Τα ζευγάρια των οµολόγων χρωµοσωµάτων δηµιουργούνται µε την αντιγραφή 58) Ο Griffith (1928) πειραµατίστηκε µε δυο στελέχη του βακτηρίου πνευµονιοκόκκου τα οποία τα ξεχώριζε µορφολογικά, λόγω του διαφορετικού χρώµατος τους στις καλλιέργειες τους. 59) Όταν ο Griffith ανέµειξε νεκρά «λεία» µε ζωντανά «αδρά» βακτήρια, ενώ ανέµενε ότι τα ποντίκια θα επιβιώσουν, διαπίστωσε ότι τα ποντίκια πέθαιναν και στο αίµα τους ανίχνευε ζωντανά «λεία» βακτήρια. 60) Το γενετικό υλικό ορισµένων βακτηρίων µπορεί να είναι RNA. 61) Η πειραµατική διαδικασία που ακολούθησε ο Griffith ήταν in vivo. 62) Στα ευκαρυωτικά κύτταρα η αντιγραφή του DNA γίνεται κατά τη µεσόφαση 63) Το γονιδίωµα περιέχει το σύνολο των γονιδίων ενός κυττάρου 64) Το γονιδίωµα των γεννετικών κυττάρων του ανθρώπου αποτελείται από 23 µόρια DNA. 65) Η ποσότητα του γενετικού υλικού στα κύτταρα ενός οργανισµού µεταβάλλεται από αλλαγές του περιβάλλοντος, προκειµένου να αναπτύξει προσαρµοστικές λειτουργίες. 66) Το DNA, όπως και το RNA, είναι µακροµόριο, που αποτελείται από νουκλεοσώµατα. 67) Τα γαµετικά κύτταρα των ανώτερων οργανισµών δεν περιέχουν την ίδια ποσότητα γενετικού υλικού µε τα σωµατικά, αλλά ακριβώς τη µισή ποσότητα 68) Οι γαµέτες των ανώτερων ζώων περιέχουν τη µισή ποσότητα DNA από τα σωµατικά κύτταρα. 69) Η οριστική επιβεβαίωση του ρόλου του DNA ως γενετικού υλικού προήλθε από πειράµατα στον Τ2 ιό που είναι ένας RNA ιός.

11 11 φωσφορικού-δεοξυριβόζης ενωµένες µε φωσφοδιεστερικό δεσµό 77) Τα οµόλογα χρωµοσώµατα κάθε ζεύγους στον άνδρα έχουν το ίδιο µέγεθος 78) Στο εσωτερικό του σκελετού του µορίου του DNA βρίσκονται οι αζωτούχες βάσεις που είναι υδρόφοβες 70) Στους ανώτερους οργανισµούς µπορεί να έχουµε, τόσο διπλοειδή, όσο και απλοειδή κύτταρα. 71) Ένα νουκλεοτίδιο αδενίνης που συναντάµε ως συστατικό του DNA είναι διαφορετικό από ένα νουκλεοτίδιο αδενίνης που συναντάµε ως συστατικό του RNA. 72) Οι γαµέτες του ανθρώπου περιέχουν 23 οµόλογα χρωµοσώµατα. 73) Ο προσανατολισµός του κάθε κλώνου του DNA είναι 3 '-> 5'. 74) Σε µερικές περιπτώσεις το RNA είναι φορέας γενετικών πληροφοριών. 75) Το µόριο του DNA σχηµατίζει αριστερόστροφη έλικα. 76) Η διπλή έλικα του DNA έχει ένα σταθερό σκελετό που είναι υδρόφιλος και βρίσκ εται στο εξωτερικό του µορίου, και αποτελείται από επαναλαµβανόµενες µονάδες 79) Οι δεσµοί υδρογόνου που αναπτύσσονται µεταξύ των συµπληρωµατικών βάσεων στο µ όριο του DNA σταθεροποιούν την τριτοταγή δοµή του 80) Τα φυλετικά χρωµοσώµατα σε ένα ανθρώπινο µυϊκό κύτταρο είναι δυο. 81) Οι δυο αλυσίδες του DNA είναι παράλληλες. 82) Η µια πολυνουκλεοτιδική αλυσίδα ενός µορίου DNA ονοµάζεται αδελφή χρωµατίδα 83) Το γονιδίωµα υπάρχει σε δυο αντίγραφα στα σωµατικά κύτταρα των ανώτερων ευκαρυωτικών οργανισµών, ενώ σε ένα αντίγραφο στα γαµετικά κύτταρα 84) Η χηµική σύσταση ενός µορίου DNA µεταβάλλεται κατά τη διάρκεια της µίτωσης. 85) To DNA των προκαρυωτικών κυττάρων είναι ένα δίκλωνο κυκλικό µόριο που αναδιπλώνεται και πακετάρεται µε τη βοήθεια πρωτεϊνών. 86) Τα προκαρυωτικά κύτταρα είναι διπλοειδή. 87) Η οξειδωτική φωσφορυλίωση είναι µεταβολική διαδικασία που επιτελείται στους χλωροπλάστες. 88) Τα πλασµίδια είναι ποικίλου µεγέθους δίκλωνα γραµµικά µόρια DNA, και υπάρχουν µόνο στα βακτήρια. 89) Τα πλασµίδια διαθέτουν πολύ σηµαντικά γονίδια όπως π.χ της ανθεκτικότητας σε αντιβ ιοτικά, ή άλλα που σχετίζονται µε τη µεταφορά γενετικού υλικού από βακτήριο σε βακτήριο. 90) Στα ευκαρυωτικά κύτταρα η αντιγραφή του DNA γίνεται στο κυτταρόπλασµα 91) Το γενετικό υλικό στα ευκαρυωτικά κύτταρα δεν είναι ένα ενιαίο µόριο DNA, αλλά πολλά γραµµικά κοµµάτια, που ο αριθµός και το µήκος τους είναι χαρακτηριστικά για τα διάφορα είδη των οργανισµών 92) Η βασική µονάδα οργάνωσης της χρωµατίνης είναι το νουκλεόσωµα που αποτελείται από DNA µήκους 146 ζευγών βάσεων και από 8 µόρια πρωτεϊνών που ονοµάζονται ιστόνες. 93) Η συσπείρωση της χρωµατίνης στον πυρήνα των κυττάρων παραµένει σταθερή, κατά τις διάφορες φάσεις του κυτταρικού κύκλου 94) Τόσο η χρωµατίνη όσο και τα χρωµοσώµατα είναι ορατά µε το οπτικό µικροσκόπιο. 95) Το κεντροσωµάτιο συνδέει µεταξύ τους τα ινίδια χρωµατίνης µετά το διπλασιασµό τους 96) Μετά τη µιτωτική διαίρεση τα δυο κύτταρα που προκύπτουν περιέχουν την ίδια ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

12 12 ποσοτική αλλά όχι και ποιοτική σύσταση στο DNA τους. 97) Για την κατασκευή καρυότυπου στον άνθρωπο, µπορούµε να χρησιµοποιήσουµε οποιοδήποτε κυτταρικό του τύπο. 98) Ο καρυότυπος αρσενικών και θηλυκών ανθρώπινων σωµατικών κυττάρων είναι ακριβώς ίδιος. 99) Από τα 46 χρωµοσώµατα του ανθρώπου τα 44 είναι αυτοσωµικά και τα 2 φυλετικά 100 Στον καρυότυπο απεικονίζονται τα µεταφασικά χρωµοσώµατα που δεν αποτελούνται από δυο αδελφές χρωµατίδες. 101 Τα µιτοχόνδρια και οι χλωροπλάστες είναι ηµιαυτόνοµα οργανίδια διότι παρότι διαιρούνται ανεξάρτητα από τη διαίρεση του κυττάρου δεν µπορούν να συνθέσουν καµιά από τις πρω τεΐνες που χρειάζονται. 102 Κάθε µιτοχόνδριο περιέχει 2 έως 10 αντίγραφα του DNA του 103 Τα παιδιά µιας οικογένειας έχουν όλα το ίδιο µιτοχονδριακό DNA 104 Το µιτοχονδριακό DNA και το DNA του χλωροπλάστη είναι πάντα κυκλικά δίκλωνα µόρια 105 Οι δύο γονείς συνεισφέρουν ακριβώς ίσες ποσότητες DNA στον απόγονο στην περίπτωση που αυτός είναι XX 106 Το µιτοχονδριακό DNA είναι µεγαλύτερου µεγέθους από το DNA του χλωροπλάστη. 107 Οι ιοί, αντίθετα από τα κύτταρα, διαθέτουν µόνο ένα είδος νουκλεϊνικού οξέος (DNA ή RNA σε όλους τους δυνατούς συνδυασµούς δηλαδή κυκλικό ή γραµµικό, µονόκλωνο ή δίκλωνο, Συµπληρώστε τις έννοιες στις οποίες αντιστοιχούν οι παρακάτω προτάσεις: 1. Πρωτεΐνες του πυρήνα του κυττάρου, που έχουν στηρικτικό ρόλο στο µόριο του DNA: 2. Ο προσανατολισµός της πολυνουκλεοτιδικής αλυσίδας:.. 3. Το σύνολο των 22 ζευγών χρωµοσωµάτων, που είναι µορφολογικά ίδια και στον άνδρα και στη γυναίκα: 4. Η απεικόνιση, κατά το τέλος της µετάφασης των χρωµοσωµάτων ενός κυττάρου:. 5. Χαρακτηρισµός των οµοίων ζευγών χρωµοσωµάτων ενός διπλοειδούς κυττάρου: 6. Είδος βακτηρίου του οποίου η «λεία» µορφή είναι παθογόνος για τα ποντίκια:. 7. Χαρακτηρισµός των κύτταρων, των οποίων το γενετικό υλικό υπάρχει σε δύο αντίγραφα 8. Έκφραση που χρησιµοποιείται για την περιγραφή βιολογικής διαδικασίας, όταν αυτή πραγµ ατοποιείται στο δοκιµαστικό σωλήνα:. 9. οµικό συστατικό των νουκλεϊκών οξέων που αποτελείται από µια πεντόζη, από ένα µόριο φωσφορικού οξέος και από µία οργανική αζωτούχο βάση:. 10. Ο οµοιοπολικός χηµικός δεσµός που συνδέει µεταξύ τους δύο νουκλεοτίδια: 11. Ονοµασία του µοντέλου του µορίου του DNA πού προτάθηκε από τους Watson και Crick..: 12. Μικρό δίκλωνο µόριο DNA, που φέρνει µικρό ποσοστό της γενετικής πληροφορίας σε µερικά βακτήρια: 13. Ιδιότητα των βάσεων του µορίου του DNA που έχει τεράστια σηµασία στη δυνατότητα αυτοδιπλασιασµού του:. 14. Λειτουργικές µονάδες, τµήµατα του DNA, µε συγκεκριµένη αλληλουχία βάσεων, οι οποίες µπορούν να µεταγραφούν:.. ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

13 Χαρακτηρισµός των κύτταρων, των οποίων το γενετικό υλικό υπάρχει σε ένα µόνο αντίγραφο:. 16. Χαρακτηρισµός των χρωµοσωµάτων εκείνων που σε πολλούς οργανισµούς καθορίζουν το φύλο: 17. Σχηµατισµός στο χρωµόσωµα που συγκρατεί µεταξύ τους τις αδελφές χρωµατίδες: 18. Χαρακτηρισµός των χλωροπλαστών και των µιτοχονδρίων λόγω της ιδιότητας τους µερικές από τις λειτουργίες τους να ελέγχονται από το δικό τους γενετικό υλικό Όρος που χρησιµοποιείται για την περιγραφή του µήκους ενός νουκλείκού οξέος: 20. Μορφή του φωσφόρου µε την οποία µπορούµε να ιχνηθετήσουµε DNA: 21. Η βασική µονάδα οργάνωσης της χρωµατίνης και αποτελείται από οκτώ µόρια πρωτεϊνών γύρω από τα οποία τυλίγεται DNA µήκους 146 ζευγών βάσεων: Το σύνολο του γενετικού υλικού ενός κυττάρου που βρίσκεται στον πυρήνα του: Ευδιάκριτες δοµές που εµφανίζονται στη κυτταροδιαίρεση και προέρχονται από τη συµπύκνωση της χρωµατίνης: 24. Όµοια µόρια DNA, που συνδέονται µεταξύ τους µε κεντροµερίδιο για να αποτελέσουν το χρωµόσωµα:... ΕΡΩΤΗΣΕΙΣ ΑΝΟΙΚΤΟΥ ΤΥΠΟΥ (ΣΥΝΤΟΜΗΣ ΑΠΑΝΤΗΣΗΣ ) ΝΑ ΑΠΑΝΤΗΣΕΤΕ ΣΕ ΚΑΘΕΜΙΑ ΑΠΟ ΤΙΣ ΠΑΡΑΚΑΤΩ ΕΡΩΤΗΣΕΙΣ.(ΣΥΝ ΥΑΣΤΙΚΕΣ - ΚΡΙΣΕΩΣ) 1. Για ποιους λόγους αρχικά οι επιστήµονες κατέληγαν στην άποψη ότι η γενετική πληροφορία είναι γραµµένη στις πρωτεΐνες; 2. Ποιο είναι το πείραµα του Griffith γιατί έγινε, ποιο είναι το συµπέρασµα που εξάγεται από αυτό: Γιατί δεν είναι πειστικά τα αποτελέσµατα του: Πως το ίδιο πείραµα αποτελέσµατα; 3. Σε τι διέφεραν τα βακτήρια που χρησιµοποίησε ο Griffith στα πειράµατα του; 4. Τι ονοµάζουµε αποικία; έδωσε πειστικά 5. Γιατί οι Hershey & Chase επέλεξαν να χρησιµοποιήσουν Ρ32 και S35 για την Ιχνηθέτηση του DNA και των πρωτεϊνών αντίστοιχα; 6. Ποια ήταν τα βιοχηµικά αποτελέσµατα που ήταν γνωστά τη δεκαετία το 40 50, ώστε να θεµελιώνεται ότι το DNA είναι φορέας της γενετικής πληροφορίας: 7. Πώς οι Τ2 ιοί έδωσαν την οριστική απόδειξη για το ποιος είναι φορέας της γενετικής πληροφορίας; 8. Ποια είναι τα µονοµερή των νουκλεϊκών οξέων; χηµική ποσότητα είναι συνδεδεµένη στην 9. Τι είναι τα νουκλεοτίδια. από τι αποτελούνται; Ποια 1 ποια στη 3 και ποια στη 5 θέση της πεντόζης; 10. Ποιος δεσµός λέγεται 3-5' Φωσφοδιεστερικός ; 11. Τι εννοούµε όταν λέµε ότι ο προσανατολισµός της αλυσίδας του DΝΑ είναι Από τι αποτελείται ο σκελετός του DΝΑ και γιατί λέµε ότι είναι σταθερό µέρος στη δοµή νουκλεϊκών οξέων; 13. Ποια µέρη του µορίου του DΝΑ είναι υδρόφιλα και ποια είναι υδρόφοβα; πως ενώνονται 14. Τι είναι η συµπληρωµατικότατα; Ποιες είναι οι συµπληρωµατικές βάσεις και µεταξύ τους; 15. Ποιο είναι το µεταβλητό µέρος της δοµής του DΝΑ και τι καθορίζει αυτό:

14 Τι είναι η γενετική πληροφορία, πού βρίσκεται πώς περιέχεται και πως εκφράζεται 17. Τι είναι το γενετικό υλικό και ποια µόρια το αποτελούν; Σε ποιες θέσεις του ευκαρυωτικού κυττάρου το συναντούµε: 18. Ποιες είναι οι ιδιότητες του γενετικού υλικού: 19. Τι είναι τα γονίδια; Σε ποιο χηµικό µόριο βρίσκονται; Σε ποιες δοµές του ευκαρυωτικού κυττάρου βρίσκονται: 20. Ποια κύτταρα λέγονται απλοειδή και ποια διπλοειδή: Να δώσετε παράδειγµα κυττάρων 21. Τι ονοµάζουµε γονιδίωµα ενός κυττάρου; 22. Τι σηµαίνει και τι εκφράζει η έννοια αλληλουχία των βάσεων. 23. Ποια είναι η κατασκευή του γενετικού υλικού των προκαρυωτικών κυττάρων. 24. Τι είναι τα πλασµίδια; Τι γνωρίζετε για το σχήµ α, το µέγεθος, τον αριθµό και το περιεχόµενο τους; τι δυνατότητες δίνει στο κύτταρο που το περιέχει και πως βοηθάει τους γενετιστές σήµερα 25. Τι είδους γονίδια περιέχονται σε ένα πλασµίδιο; 26. Ποια η οργάνωση του ΝΑ µέσα στα χρωµοσώµατα. 27. Τι είναι το νουκλεόσωµα ; Τι είναι οι ιστόνες;; 28. Τι είναι τα ινίδια χρωµατίνης. 29. Τι είναι το κεντροµερίδιο και ποιος ο ρόλος του; 30. Ποια χρωµοσώµατα χαρακτηρίζονται ως οµόλογα; 31. Ποια είναι η σηµασία του διπλασιασµού του DNA; 32. Ποιες είναι οι µορφές των χρωµοσωµάτων στις φάσεις του κυτταρικού κύκλου. 33. Τι είναι ο καρυότυπος και ποιες εργασίες πρέπει να κάνουµε ώστε να τον λάβουµε, Τι συµπεράσµατα βγαίνουν από την παρατήρηση του καρυότυπου 34. Σε ποια φάση του κυτταρικού κύκλου είναι ορατά τα χρωµοσώµατα µε τη βοήθεια του οπτικού µικροσκοπίου; 35. Σε τι διαφέρει το γονίδιο από το γονιδίωµα; 36. Τι ονοµάζονται οµόλογα χρωµοσώµατα, τι διαφέρουν δυο µη οµόλογα µεταφασικά χρωµοσώµατα; 37. Που βρίσκονται µόρια DNA τα οποία αντιγράφονται ανεξάρτητα από την αντιγραφή του κύριου DNA ενός κυττάρου; 38. Ποσά είναι τα χρωµοσώµατα του ανθρώπου; Ποια λέγονται φυλετικά και ποια αυτοσωµικά 39. Σε τι διαφέρει το γενετικό υλικό των σωµατικών κυττάρων από εκείνο των γεννητικών κυττάρων; 41. Ποια κυκλικά µόρια DNA γνωρίζεται, ποιος ο ρόλος του καθενός 42. Ποιο το είδος και η µορφή του γενετικού υλικού των µιτοχονδρίων και των χλωροπλαστών; 43. Γιατί τα µιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται σαν ηµιαυτόνοµα οργανίδια 44. Να βάλετε σε σειρά, ώστε το προηγούµενο να περιέχεται στο επόµενο, τις παρακάτω έννοιες λέξεις, χρωµόσωµα, γονίδιο, αζωτούχος βάση, πυρήνας, νουκλεοτίδια, γενετικό υλικό, κύτταρο, ΝΑ, γονιδίωµα νουκλεόσωµα. 45. Ποιο είναι το είδος και η κατασκευή του γενετικού υλικού των ίών; 46. Τι σηµαίνουν οι εκφράσεις in vivo και in vitro; Να αναφέρετε παραδείγµατα. 47. Τι είναι η Ιχνηθέτηση και για ποιους λόγους χρησιµοποιείται; 48. Τι είναι το γονιδίωµα; Πού βρίσκεται το γονιδίωµα των προκαρυωτικών και ευκαρυωτικών κυττάρων; 49. Ποιον όρο χρησιµοποιούµε για την απόδοση του µήκους ενός νουκλεϊνικού οξέος και γιατί; Να αναφέρετε παραδείγµατα για όλα τα είδη νουκλεϊνικών οξέων. 50 «Η µελέτη των χρωµοσωµάτων είναι δυνατή µόνο σε κύτταρα τα οποία διαιρούνται.» Συµφωνείτε ή διαφωνείτε µε την παραπάνω πρόταση και γιατί; 51. Από τι αποτελείται το ανθρώπινο γονιδίωµα; 52. Θέλετε να διαπιστώσετε στο εργαστήριο σας αν το DNA των φάγων εισέρχεται στο βακτήριο ή το πρωτεϊνικό του κάλυµµα ή και τα δύο. Κατά τη διαδικασία της ιχνηθέτησης του DNA και των ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

15 15 πρωτεϊνών, ποια άτοµα ενδείκνυται να χρησιµοποιήσετε και ποια να αποφύγετε; ΚΕΦΑΛΑΙΟ 2 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1.Ηµισηντηριτικός τρόπος αντιγραφής ονοµάζεται διότι : Α. το κάθε θυγατρικό µόριο DNA διπλασιάζεται Β. Σε κάθε θυγατρικό µόριο DNA η µια αλυσίδα είναι µητρικής προέλευσης Γ. Σε κάθε θυγατρικό µόριο DNA η µια αλυσίδα είναι ραδιενεργή.. Σε κάθε θυγατρικό µόριο DNA οι αλυσίδες του DNA είναι συµπληρωµατικές 2.Κατά την αντιγραφή: α. το DNA ανοίγει σε πολλά σηµεία β. συµµετέχουν οι RNA πολυµεράσες γ. δεν απαιτείται ενέργεια δ. συντίθεται µία θυγατρική αλυσίδα για κάθε µόριο DNA 3.Στην αντιγραφή του DNA τα κοµµάτια της αλυσίδας που αντιγράφεται κατά ασυνεχή τρόπο συνδέονται µεταξύ τους: α. µε το πριµόσωµα β. µε την DNA πολυµεράση γ. µε την DNA δεσµάση δ. µε τις DNA ελικάσες. 4.Στην αντιγραφή του DNA δεν συµµετέχει: α. η DNA ελικάση β. η DNA δεσµάση γ. η αντίστροφη µεταγραφάση δ. το πριµόσωµα. 5.Ποια από τις παρακάτω διαδικασίες δεν συµπεριλαµβάνεται στην αντιγραφή του DNA; α. συντίθενται τµήµατα πολυπεπτιδικής αλυσίδας β. ανοίγει η διπλή έλικα του DNA γ. συντίθενται µικρά τµήµατα RNA δ. δηµιουργούνται ζεύγη συµπληρωµατικών αζωτούχων βάσεων. 6.Ποια από τις παρακάτω προτάσεις δεν ισχύει για την DNA πολυµεράση; α. κωδικοποιείται από γονίδιο β. αποτελείται από αµινοξέα γ. καταλύει το σχηµατισµό 3' -> 5' φωσφοδιεστερικών δεσµών δ. αποτελείται από δεοξυριβονουκλεοτίδια. 7.Κατά την επιµήκυνση µιας αλυσίδας DNA ή RNA, η αλληλουχία των νουκλεοτιδίων καθορίζεται: α. από την DNA ή RNA πολυµεράση β. από την συµπληρωµατικότητα των βάσεων της αλυσίδας "καλούπι" γ. από το πριµόσωµα δ. από τη DNA δεσµάση. 8.Ποιο από τα παρακάτω αποτελείται από DNA; α. οι µεταγραφικοί παράγοντες β. ο υποκινητής ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

16 16 γ. το πριµόσωµα δ. η DNA πολυµεράση. 9.Τα µόρια µε τα οποία µεταφέρονται οι γενετικές πληροφορίες από κύτταρο σε κύτταρο, σε έναν οργανισµό είναι: α.. DNA β πρωτεΐνες γ. RNA δ. τίποτε από τα πιο πάνω. 10.Τα µόρια µε τα οποία µεταφέρονται οι γενετικές πληροφορίες από ένα οργανισµό στους απογόνους του είναι: α πρωτεΐνες β. λιπίδια και πολυσακχαρίτες γ. DNA δ. RNA 11.Η γενετική πληροφορία που υπάρχει σε ένα γονίδιο ενός κυττάρου: α. είναι γραµµένη στην αλληλουχία των αζωτούχων βάσεων των ριβονουκλεοτιδίων β. µεταγράφεται σε λειτουργικά µόρια RNA γ. µεταφέρεται από γενιά σε γενιά δ. όλα τα παραπάνω. 12.Ποιο από τα παρακάτω σχήµατα µας δείχνει τη σωστή σύνδεση σε µόριο mrna; 13.Η µάζα κάθε αµινοξέος είναι 5 µονάδες µάζας, ποια θα είναι η µάζα της πολυπεπτιδικής αλυσίδας, κατά τη σύνθ εση της, που έχει προέλθει από έν α mrna µε 1200 νουκλεοτίδια; (Να µην ληφθεί υπόψη η τριπλέτα λήξης), α β.6000 γ.2000 δ Ποιο από τα παρακάτω αποτελείται από RNA α. ο υποκινητής β. ο χειριστής γ. τα πρωταρχικά τµήµατα δ. η RNA πολυµεράση 15.Η γενετική πληροφορία µεταφέρεται στα ριβοσώµατα µε: α. πρωτεΐνες β. DNA γ. RNA δ.. λιπίδια ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

17 17 16.Στη µετάφραση δεν χρειάζεται: α. το DNA β. τα ριβοσώµατα γ. ένζυµα δ. trna. 17.Ποια από τις παρακάτω προτάσεις δεν ισχύει για την RNA πολυµεράση; α. αποτελείται από αµινοξέα β. αποτελείται από ριβονουκλεοτίδια γ. συντίθεται στα ριβοσώµατα δ. η πληροφορία για τη σύνθεση της βρίσκεται στο DNA. 18.Οι υποκινητές είναι ειδικές περιοχές του DNA, που ; α. γίνεται η πρόσδεση της DNA πολυµεράσης β. αποτελούν το σηµείο έναρξης της αντιγραφής του DNA γ. γίνεται η πρόσδεση της RNA πολυµεράσης δ. βρίσκονται πριν από το ρυθµιστικό γονίδιο. 19.Οι µεταγραφικοί παράγοντες; α. είναι ρυθµιστικά στοιχεία αντιγραφής του DNA β. είναι ειδικές περιοχές του DNA που πρόκειται να γίνει η µεταγραφή γ. επιτρέπουν στην RNA πολυµεράση τη σωστή έναρξη της µεταγραφής δ. είναι πρωτεΐνες, οι οποίες ρυθµίζουν τη µεταγραφή του DNA. 20.Η πρώτη τριάδα των νουκλεοτιδίων του mrna είναι η ; α. AGU β. AUG γ. UGA δ. UAG 21.Ο όρος κωδικόνιο αναφέρεται; α. σε µια τριάδα νουκλεοτιδίων του γονιδίου και του mrna β. µόνο σε µια τριάδα νουκλεοτιδίων έναρξης ή λήξης του mrna γ. στα συνώνυµα αµινοξέα του γονιδίου δ. στα αµινοξέα που κωδικοποιούνται από τρία νουκλεοτίδια του m RNA 22.Κατά τη µεταγραφή: α. παράγεται µία πολυπεπτιδική αλυσίδα, β. παράγεται ένα µόριο DNA γ. παράγεται ένα µόριο RNA δ. παράγεται ένα µόριο mrna 23.Η µεταγραφή του DNA στο ευκαρυωτικο κύτταρο γίνεται: α. στον πυρήνα β. στο µιτοχόνδριο γ. στο κυτταρόπλασµα δ. όπου υπάρχει DNA 24.Το κωδικόνιο το συναντούµε: α. στο rrna β. στο trna γ. στο mrna δ. σε όλα τα RNA 25.Η µεταγραφή οδηγεί: α. στη σύνθεση µιας πολυπεπτιδικής αλυσίδας β. στο διπλασιασµό του γενετικού υλικού γ. στη σύνθεση γονιδίων

18 18 δ. σε κανένα από τα παραπάνω 26.Οι «υποκινητές» βρίσκονται: α. στο mrna β. προσδεµένοι στους µεταγραφικούς παράγοντες γ. στο DNA δ. στα ριβοσώµατα 27.Ο τύπος του RNA, που βρίσκεται σε µεγαλύτερη συγκέντρωση στο κύτταρο, είναι το ; α. mrna β. trna γ. snrna δ. rrna 28.Η µεταβολική δραστηριότητα διαφόρων κυτταρικών τύπων σε ένα πολυκύτταρο οργανισµό ποικίλλει λόγω διαφορών: α. στα γονίδια β. στα ριβοσώµατα γ. στις πρωτεΐνες δ. στα µόρια trna. 29.Το µικρό πυρηνικό RNA (snrna): α. παράγεται από γονίδιο, που µεταγράφεται σε snrna και µεταφράζεται σε πρωτεΐνες β. συνδέεται µε πρωτεΐνες και σχηµατίζει το ριβόσωµ α γ. το συναντάµε σε όλα κύτταρα δ. συνδέεται µε πρωτεΐνες και λειτουργεί ως ένζυµο. 30.Τα κύτταρα ενός πολυκύτταρου οργανισµού διαφέρουν στη δοµή και τη λειτουργία τους, επειδή συνθέτουν διαφορετικά µόρια: α. µη-ιστονών β. ιστονών γ. trna δ. mrna. 31.Από το µικρό πυρηνικό (SnRNA), µε κατάλληλες πρωτεΐνες, ; α. συρράπτονται τα εσώνια β. κόβονται τα εξώνια και συρράπτονται τα εσώνια του rrna γ. προκαλείται η ωρίµανση του trna δ. κόβονται τα εσώνια και ενώνονται τα εξώνια. 32.Στα προκαρυωτικά κύτταρα έχουν εντοπιστεί ; α. mrna, snrna, trna γ. t RNA,r RNA, m RNA β. m RNA, r RNA sn RNA, δ. sn RNA t RNA, r RNA 33.Εκφυλισµός του γενετικού κώδικα σηµαίνει ότι: α. είναι κοινός για όλους τους οργανισµούς β. κάθε κωδικόνιο κωδικοποιεί ένα ή περισσότερα αµινοξέα γ. κάθε αµινοξύ κωδικοποιείται από ένα ή περισσότερα κωδικόνια δ. κάθε οργανισµός έχεις τις ίδιες κατηγορίες RNA 34.Ποιο από τα παρακάτω κωδικόνια δεν είναι λήξης: α. UGA β. UAC γ. UAG δ. UAA 35.Για τις τριπλέτες νουκλεοτιδίων του γενετικού κώδικα ισχύει ότι: α. όλες κωδικοποιούν αµινοξύ β. µια τριπλέτα µπορεί να κωδικοποιεί από ένα µέχρι και τέσσερα διαφορετικά αµινοξέα γ. υπάρχουν συνώνυµες τριπλέτες που κωδικοποιούν το ίδιο νουκλεοτίδιο ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

19 19 δ. τίποτε από τα παραπάνω. 36.To trna µετά την αποµάκρυνση του από το ριβόσωµα: α. συνδέεται µε το αµινοξύ που αντιστοιχεί στο επόµενο κωδικόνιο β. συνδέεται ξανά µε το ίδιο κωδικόνιο, χωρίς να φέρει αµινοξύ γ. συνδέεται µε ίδιο αµινοξύ για να το µεταφέρει σε αντίστοιχη θέση της αναπτυσσόµενης πολυπεπτιδικής αλυσίδας δ. διασπάται και επανασυντίθεται για επόµενη χρήση. 37.Κατά την πρωτεϊνοσύνθεση το ριβόσωµα µετακινείται από α. το 5' προς το 3' άκρο του mrna β. το 3' προς το 5' άκρο του mrna γ. το κωδικόνιο UAG προς το κωδικόνιο AUG του mrna δ. το κωδικόνιο AGU προς το κωδικόνιο UAG του m RNA. 38. Η µετάφραση γίνεται: α. στον πυρήνα β. στο ενδοπλασµατικό δίκτυο γ. στο κεντρόσωµα δ. στα ριβοσώµατα. 40.Το αντικωδικόνιο το συναντούµε: α. στην πολυπεπτιδική αλυσίδα β. σto RNA γ. στο trna δ. στο DNA 41.Τα αντικωδικόνια συνδέονται κατά τη µετάφραση: α. µε τα κωδικόνια του mrna β. µε τα κωδικόνια του DNA γ. µε το κατάλληλο αµινοξύ δ. µε τα κωδικόνια του DNA από το οποίο προέκυψε 42.To snrna το συναντούµε: α. στα ηµιαυτόνοµα οργανίδια β. στο κυτταρόπλασµα γ. στο προκαρυωτικό κύτταρο δ. στον πυρήνα 43.Για την παραγωγή πολλών αντιγράφων ενός πολυπεπτιδίου δεν χρειάζεται: α. να µεταγράφονται πολλά µόρια mrna από ένα γονίδιο β. να µεταφράζεται από πολλά ριβοσώµατα το ίδιο µόριο mrna γ. ο σωστός συνδυασµός µεταγραφικών παραγόντων δ. να αντιγράφεται πολλές φορές το DNA. 44.Η πρωτεϊνοσύνθεση είναι µια οικονοµική διαδικασία, γιατί: α. για την ολοκλήρωση της ξοδεύονται µικρά ποσά ενέργειας β. παράγονται πολλά µ όρια πρωτεϊνών που παίρνουν µέρος σε πολλές λειτουργίες το καθένα γ. παράγονται µεγάλες ποσότητες µιας πρωτεΐνης δ. όλα τα παραπάνω. 45.Ως πλαίσιο ανάγνωσης ορίζουµε: ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

20 20 α. το µεταγραφόµενο τµήµα του DNA β. το RNA που προκύπτει από τη διαδικασία «ωρίµανσης» γ. το τµήµα του mrna από το κωδικόνιο έναρξης έως το κωδικόνιο λήξης µε βήµα τριπλέτας. δ. όλα τα παραπάνω 46.Πολύσωµα είναι: α. το οργανίδιο που συµµετέχει στην Πρωτεϊνοσΰνθεση β. οµάδα ριβοσωµάτων στο ενδοπλασµατικό δίκτυο γ. το σύνολο των εξωνίων του µετάγραφα µενού DNA δ. το σύµπλεγµα των ριβοσωµάτων µε το mrna 47.Το οπερόνιο είναι µια οµάδα γονιδίων που, εκτός από τα δοµικά γονίδια, περιέχει ; α. τον υποκινητή και το ρυθµιστικό γονίδιο β. το χειριστή και το ρυθµιστικό γονίδιο γ. το ρυθµιστικό γονίδιο, τον υποκινητή και το χειριστή δ. τον υποκινητή και το χειριστή. 48.Στο ρυθµιστικό µηχανισµό διάσπασης της λακτόζης ο καταστολέας του οπερονίου της λακτόζης είναι; α. µια αλληλουχία δεοξυριβονουκλεοτιδίων β. µια αλληλουχία αµινοξέων γ. το mrna που προέρχεται από τη µεταγραφή του ρυθµιστικού γονιδίου δ δισακχαρίτης λακτόζη. 49.Όταν τα δοµικά γονίδια του οπερονίου της λακτόζης βρίσκονται υπό καταστολή, Ο χειριστής συνδέεται µε: α. τη λακτόζη β. την πρωτεΐνη-καταστολέα γ. τους µεταγραφικούς παράγοντες δ. την RNA πολυµεράση. 50.Στο βακτήριο Ε. coli, επαγωγέας για τη µεταγραφή των γονιδίων που κωδικοποιούν τη σύνθεση των ενζύµων για τη διάσπαση της λακτόζης, είναι ; α. η λακτόζη β. η πρωτεΐνη - καταστολέας γ. ο υποκινητής δ. ένα ρυθµιστικό γονίδιο. 51.Στην Ε.coli, το mrna, που προκύπτει κατά τη µεταγραφή του οπερονίου της λακτόζης, ; α. µεταφράζεται σε τρία ένζυµα απαραίτητα για τη διαδικασία αποικοδόµησης της β. µεταφράζεται σε πρωτεΐνη καταστολέα της λακτόζης γ. ενεργοποιείται από τον απαγωγέα του οπερονίου της λακτόζης δ. µεταφράζεται σε RNA πολυµεράση του οπερονίου της λακτόζης. 52.Για να γίνει η µεταγραφή του οπερονίου της λακτόζης πρέπει να; α συνδεθεί ο επαγωγέας µε την πρωτεΐνη καταστολέας β διεγερθεί η ενζυµική αντίδραση της RNA πολυµεράσης στον υποκινητή γ εισέλθει η λακτόζη στο κύτταρο της E. coli δ συνδεθεί µε τον καταστολέα το ρυθµιστικό γονίδιο 53.Το οπερόνιο της λακτόζης είναι: α. Σύνολο τριών γονιδίων που κωδικοποιούν τρία ένζυµα και βρίσκονται το ένα δίπλα στο άλλο. β. Το λειτουργικό σύστηµα που αποτελείται από το χειριστή, τον καταστολέας και τον απαγωγέα. γ. Το µεταµεταγραφικό σύστηµα ρύθµισης της έκφρασης του ενζύµου που συνθέτει τη λακτόζη. δ. Ο µηχανισµός ρύθµισης της έκφρασης των γονιδίων για τη σύνθεση της λακτόζης στο επίπεδο ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

21 21 της µετάφρασης. 1. Κάθε κωδικόνιο του trnα έχει αντικωδικόνιο στο mrna. 2. Στα κωδικόνια λήξης αντιστοιχούν τα αµινοξέα βαλίνη, αλανίνη ή µεθειονίνη. 3..Στα προκαρυωτικά κύτταρα η έναρξη της σύνθεσης ενός δευτέρου µορίου πρωτεΐνης µπορεί να αρχίσει πριν ολοκληρωθεί η σύνθεση του πρώτου µορίου της πρωτεΐνης. 4..Στους ευκαρυωτικούς οργανισµούς το οπερόνιο της λακτόζης κωδικοποιεί τα ένζυµα που συµµετέχουν στη διάσπαση της λακτόζης. 5..Στο οπερόνιο της λακτόζης της Ε. coli περιλαµβάνονται τα δοµικά γονίδια, το ρυθµιστικό γονίδιο, ο υποκινητής και ο χειριστής. 6..Στην Ε. coli το ρυθµιστικό γονίδιο του οπερονίου της λακτόζης, κωδικοποιεί τη σύνθεση του καταστολέα της λακτόζης. 7..Στην Ε. coli η µεταγραφή του οπερονίου της λακτόζης διακόπτεται όταν διασπαστεί όλη η λακτόζη. 8..Στα διαφοροποιηµένα κύτταρα ενός πολυκύτταρου οργανισµού µεταγράφονται διαφορετικά γονίδια. 9..Στα προκαρυωτικά κύτταρα η πρωτεΐνη αρχίζει να µεταφράζεται πριν ολοκληρωθεί η µεταγραφή του αντίστοιχου γονιδίου σε mrna. 10..Στα ευκαρυωτικά κύτταρα η ύπαρξη της πυρηνικής µεµβράνης έχει ως συνέπεια να ολοκληρώνεται η µεταγραφή και η µεταφορά του m RNA στο κυτταρόπλασµα, πριν αρχίσει η διαδικασία της µετάφρασης. 11..Το ποσό του RNA σε ένα κύτταρο είναι σταθερό γιατί σχηµατίζεται από το DNA. 12..Κατά τον διπλασιασµό του DNA. n DNA πολυµεράση αναγνωρίζει και τοποθετεί τα νουκλεοτίδια στη σωστή τους θέση. 13..Κατά την διαδικασία της ωρίµανσης το DNA γίνεται µικρότερο. 14..Στα κύτταρα του ανθρώπου το mrna αρχίζει να µεταφράζεται πριν ολοκληρωθεί η µεταγραφή του. 15..Υποκινητές βρίσκονται στο DNA και των προκαρυωτικών οργανισµών Κάθε µόριο mrna στους ευκαρυωτικούς οργανισµούς έχει ένα και µόνο κωδικόνιο έναρξης και λήξης. 17..To mrna στους προκαρυωτικούς έχει δυο περιοχές που δεν µεταφράζονται Η µετακίνηση των ριβοσωµάτων στο mrna γίνεται προς το 3' άκρο του mrna. 19..Τα εσώνια δεν µεταγράφονται. 20..Τα κύτταρα του ήπατος περιέχουν τα γονίδια των αιµοσφαιρινών. 21..Όλα τα γονίδια των ευκαρυωτικών οργανισµών είναι ασυνεχή ή διακεκοµµένα. 22..Ο υποκινητής είναι ειδική περιοχή του DNA πριν από την αρχή κάθε γονιδίου. 23..Στη µεσόφαση γίνεται σύνθεση ιστονών Όταν απουσιάζει η λακτόζη στο θρεπτικό υλικό, δεν µεταγράφεται το ρυθµιστικό γονίδιο. ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

22 Το ριβόσωµα συγκροτείται από τις δυο υποµονάδες του κατά την έναρξη της πρωτεϊνοσύνθεσης. 26..Η αντίστροφη µεταγραφάση κωδικοποιείται από γονίδιο. 27..Για το ξετύλιγµα της διπλής έλικας του DNA υπεύθυνα είναι µόνο τα ένζυµα DNA ελικάσες. 28..Για κάθε κωδικόνιο του mrna υπάρχει ένα συµπληρωµατικό αντικωδικόνιο σε κάποιο trna. 29..Σε προκαρυωτικούς οργανισµούς και σε ιούς δεν υπάρχουν ασυνεχή ή διακεκοµµένα γονίδια. 30..Ο καταστολέας, στο οπερόνιο της λακτόζης, έχει δυο θέσεις πρόσδεσης, µια για τον επαγωγέα -λακτόζη και µια για το χειριστή εν υπάρχουν αντικωδικόνια συµπληρωµατικά µε τα κωδικόνια λήξης. 32..Λέγοντας ότι ο γενετικός κώδικας είναι εκφυλισµένος, εννοούµε ότι σε κάθε κωδικόνιο αντιστοιχούν περισσότερα του ενός αµινοξέα αριθµός νουκλεοτιδίων είναι πολλαπλάσιο του τρία σε όλα τα γονίδια. 34..Ο αριθµός νουκλεοτιδίων είναι πολλαπλάσιο του τρία σε όλα τα mrna. 35..Ο αριθµός νουκλεοτιδίων είναι πολλαπλάσιο του τρία σε όλα τα πρόδροµα mrna. 36..Υποκινητές βρίσκονται στο ριβόσωµα των προκαρυωτικών οργανισµών. 37..To trna είναι ένα αντικωδικόνιο. 38..Στους προκαρυωτικούς οργανισµούς ένα µόριο mrna περιέχει και εσώνια και εξώνια 39..Κάθε µόριο mrna στους ευκαρυωτικούς οργανισµούς σχηµατίζει σύµπλοκο έναρξης. 40..To mrna στους προκαρυωτικούς οργανισµούς έχει δύο περιοχές που δεν µεταφράζονται. 41..Η µετακίνηση των ριβοσωµάτων στο DNA γίνεται προς το 3' άκρο του DNA. 42..Στους προκαρυωτικούς οργανισµούς βρίσκονται µόρια rrna και trna. 43..To mrna της ανθρώπινης προϊνσουλίνης σε εκχυλίσµατα βακτηριακών κυττάρων in vitro παράγει προϊνσουλίνη. 44..Στους ευκαρυωτικούς οργανισµούς υπάρχουν οµάδες γονιδίων που υπόκεινται σε κοινό έλεγχο της έκφρασης τους. 45..Τα εσώνια δεν µεταφράζονταιι. 46..Η DNA δεσµάση καταλύει το σχηµατισµό 3' -5' φωσφοδιεστερικών δεσµών. 47..Τα κύτταρα των γενετικών κυττάρων περιέχουν τα γονίδια των αιµοσφαιρινών. 48..Όλα τα γονίδια των ευκαρυωτικών οργανισµών περιέχουν και εσώνια και εξώνια. 49..Στους ευκαρυωτικούς οργανισµούς το «ώριµο» mrna περιέχει στη σειρά την πληροφορία για δύο ή περισσότερες πολυπεπτιδικές αλυσίδες. 50..Ο υποκινητής είναι ειδική περιοχή του trna Στη µεσόφαση διµιούργουνται τα χρωµοσώµατα. 52..Ο γενετικός κώδικας είναι η αντιστοίχιση τριάδων νουκλεοτιδίων mrna µε αµινοξέα. 53..To DNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. 54..Τα ριβοσώµατα των βακτηρίων µπορούν να χρησιµοποιηθούν ως θέση µετάφρασης για το mrna της ανθρώπινης αιµοσφαιρίνης. 55..Μεταγραφικοί παράγοντες βρίσκονται και στους προκαρυωτικούς οργανισµούς. 56..Η RNA πολυµεράση συντίθεται στον πυρήνα. 57..Όταν απουσιάζει η λακτόζη στο θρεπτικό υλικό, µετάφραζεται το ρυθµιστικό γονίδιο. ΞΑΝΘΟΥ 7 & 25ΗΣ ΜΑΡΤΙΟΥ ΑΙΓΑΛΕΩ ΤΗΛ:

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ...

ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ... 8 ΠΡΟΒΛΗΜΑΤΑ... ΚΕΦΑΛΑΙΟ 1 ο ΚΕΦΑΛΑΙΟ 1 ο... 2 I. Το γενετικό υλικό... 2 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ... 5 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.... 8 ΠΡΟΒΛΗΜΑΤΑ... 9 ΙΑΓΩΝΙΣΜΑ...12 ΚΕΦΑΛΑΙΟ 1 ο I. Το γενετικό

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ

θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ Βιολογία θετικής κατεύθυνσης Παραδόσεις του μαθήματος Επιμέλεια: ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ 1ο κεφάλαιο Το γενετικό υλικό Τι αποτελεί το γενετικό υλικό; Από το 1869, που το DNA εντοπίστηκε στον πυρήνα των κυττάρων,

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΓΙΑ ΤΟ 1 Ο ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΥΓΟΥΣΤΟΣ 2015 ΘΕΜΑ 1 Ο 1. γ 2. δ 3. α 4. δ 5. δ ΘΕΜΑ 2 Ο Α) Το γενετικό υλικό των προκαρυωτικών κυττάρων είναι ένα δίκλωνο

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 1 ο -Το γενετικό υλικό Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 1 ο -Το γενετικό υλικό Το γενετικό υλικό Ιστορική αναδρομή 1869: Το DNA εντοπίζεται στον πυρήνα των κυττάρων 1944: Μέχρι τότε δεν ήταν γνωστό ότι αποτελεί το γενετικό

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς

ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ. Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Με αναφορά τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς Λειτουργίες Γενετικού Υλικού o Αποθήκευση της γενετικής πληροφορίας. Η οργάνωση της γενετικής πληροφορίας

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού

Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Ενδεικτικές απαντήσεις στα Θέματα Βιολογίας Προσανατολισμού Θέμα Α Α1) γ Α2) γ Α3) δ Α4) β Α5) β Θέμα Β Β1. Α = υδροξύλιο, Β = πρωταρχικό τμήμα, Γ = θέση έναρξης αντιγραφής, Δ = φωσφορική ομάδα, Ε = τμήμα

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α ΘΕΜΑ Α Α1. γ Α2. α Α3. δ Α4. β Α5. α 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 5 ΣΕΠΤΕΜΒΡΙΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής.

ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ. ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1 ΤΕΣΤ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΘΕΜΑ 1 Ο Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. 1. Γραμμικό μόριο DNA θα βρούμε: Α. Σε πλασμίδια Β. Στο κύριο μόριο DNA του βακτηρίου. Γ. Σε

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΚΕΦΑΛΑΙΟ 1ο : ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Το DNA είναι το γενετικό υλικό. Ποιο πίστευαν αρχικά οι επιστήμονες πως είναι το μόριο που μεταφέρει τη γενετική πληροφορία; Παρ όλο που το DNA εντοπίστηκε στον πυρήνα των

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Αντιγραφή του DNA Οι Watson & Crick το 1953 μαζί με το μοντέλο της διπλής έλικας, πρότειναν και έναν τρόπο

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού ΘΕΜΑ Α Στις προτάσεις από Α1-Α5 να βρείτε την σωστή απάντηση. Α1. Ένας ερευνητής απομόνωσε ένα ασυνεχές γονίδιο από το γονιδίωμα ανθρώπινων κυττάρων. Το γονίδιο συνδέθηκε με βακτηριακό

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΡΙΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

τα βιβλία των επιτυχιών

τα βιβλία των επιτυχιών Τα βιβλία των Εκδόσεων Πουκαμισάς συμπυκνώνουν την πολύχρονη διδακτική εμπειρία των συγγραφέων μας και αποτελούν το βασικό εκπαιδευτικό υλικό που χρησιμοποιούν οι μαθητές των φροντιστηρίων μας. Μέσα από

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ

Φ Ρ Ο Ν Τ Ι Σ Τ Η Ρ Ι Α ΘΕΩΡΗΤΙΚΗ ΘΕΤΙΚΗ ΤΕΧΝΟΛΟΓΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΕΠΑ.Λ Βιολογία ΘΕΜΑ Α κατεύθυνσης 1. δ 2. α 3. γ 4. δ 5. γ 6. α 7. δ 8. α 9. α 10. α ΘΕΜΑ Β Β1. Η ραδιενέργεια 32 Ρ θα βρίσκεται στο κλάσμα Β, δηλαδή στο κλάσμα εκείνο που περιλαμβάνει τα βακτήρια που έχουν

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ_ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ_1.1 In vivo πειράματα απόδειξης της έννοιας του μετασχηματισμού και in vitro απόδειξη ότι το DNA είναι αυτό που προκαλεί το μετασχηματισμό. ΕΡΩΤΗΣΕΙΣ 1. Γιατί πιστεύετε ότι θανατώνονται τα βακτήρια

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ & ΧΕΙΜΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι ΚΕΦΑΛΑΙΟ 2ο: Σελίδες 27-43 ANTIΓΡΑΦΗ, ΕΚΦΡΑΣΗ & ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 1 O µηχανισµός µε τον οποίο το DNA αντιγράφεται χαρακτηρίζεται ηµισυντηρητικός Ο Watson και Crick φαντάστηκαν µια διπλή

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1

ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ / Β Λ ΠΡΟΕΤΟΙΜΑΣΙΑ Γ Λ ΗΜΕΡΟΜΗΝΙΑ: 28/02/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα

Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Ερευνητική εργασία Β τετραμήνου των μαθητών: Μελαμπιανάκη Ειρήνη Νίμεσχαϊμ Κάτριν Πολόβινα Σοφία Σαμιόγλου Νικολέτα Στυλιανάκη Κωνσταντίνα Υπεύθυνη καθηγήτρια: Δασκαλάκη Κατερίνα Μοίρες 2012-2013 Περιεχόμενα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΛΥΚΕΙΟ ΠΑΝ/ΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΠΕΙΡΑΜΑΤΑ 1. Σε ένα πείραμα παρόμοιο με αυτό που διεξήγαγε ο Griffith, αφού θανατώσατε με

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2014 ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4, 2, 1, 6, 3, 5 Β2. α.

Διαβάστε περισσότερα

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων

Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων Κεφάλαιο 1 ο Το γενετικό υλικό Μεθοδολογία Ασκήσεων 1. Ένα μόριο νουκλεϊκού οξέος για να χαρακτηρισθεί πλήρως θα πρέπει να γνωρίζουμε αν είναι: i. DNA ή RNA ii. iii. Μονόκλωνο ή δίκλωνο Γραμμικό ή κυκλικό

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α. συνεπικρατή

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα