Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς γ. µεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισµού δ. διαφέρει στα κύτταρα οργανισµών που ανήκουν σε διαφορετικά είδη 2. Στους διπλοειδείς οργανισµούς α. το γονιδίωµα των σωµατικών κυττάρων υπάρχει σε ένα αντίγραφο β. το γονιδίωµα των γαµετών υπάρχει σε δύο αντίγραφα γ. τα σωµατικά κύτταρα περιέχουν διπλάσια ποσότητα DNA από τους γαµέτες δ. ισχύουν όλα όσα περιγράφονται στα α, β, γ 3. To RNΑ αποτελείται από β. αµινοξέα, που συνδέονται µεταξύ τους µε πεπτιδικό δεσµό α. πεπτίδια, που συνδέονται µεταξύ τους µε πεπτιδικό δεσµό γ. νουκλεοτίδια, που συνδέονται µε φωσφοδιεστερικό δεσµό δ. διαφορετικά µόρια πεντοζών, που συνδέονται µε αζωτούχες βάσεις 4. Οι γαµέτες είναι απλοειδή κύτταρα γιατί α. το γενετικό τους υλικό υπάρχει σε ένα µόνο αντίγραφο β. το γονιδίωµα τους είναι µονόκλωνο γ. η δοµή τους είναι όµοια µε των προκαρυωτικών κυττάρων δ. το γονιδίωµα τους υπάρχει σε δύο µόνο αντίγραφα. 5. Οι αδελφές χρωµατίδες α. ενώνονται στο κεντροµερίδιο β. παράγονται στο στάδιο µεταγραφής του DNA γ. παραµένουν ενωµένες µετά τη διαίρεση του κυττάρου δ. συσπειρώνονται κατά το τέλος της µίτωσης για να αποκτήσουν τη µορφή των ινιδίων της χρωµατίνης. 6. Τα ινίδια χρωµατίνης α. είναι ορατά στο οπτικό µικροσκόπιο κατά τη µεσόφαση β. αποτελούνται από DNA και πρωτεΐνες γ. διπλασιάζονται κατά τη µετάφασης της µιτωτικής διαίρεσης δ. αποτελούνται από δύο αδελφές χρωµατίδες ενωµένες στο κεντροµερίδιο 7. Το γενετικό υλικό βρίσκεται σε κυκλική µορφή: α. στα προκαρυωτικά κύτταρα β. σε κάποιους ιούς γ. στους χλωροπλάστες και στα µιτοχόνδρια των περισσότερων ευκαρυωτικών κυττάρων δ. σε όλα τα παραπάνω 1

2 8. Με ποιον, από τους τρόπους που αναφέρονται πιο κάτω, συνδέεται κάθε νουκλεοτίδιο µε το αµέσως επόµενο του στην πολυνουκλεοτιδική αλυσίδα του DNA; α. η φωσφορική οµάδα του ενός, µε την αζωτούχο βάση του εποµένου β. η φωσφορική οµάδα του ενός, µε την δεσοξυριβόζη του εποµένου γ. οι αζωτούχες βάσεις δύο συνεχόµενων νουκλεοτίδιων µε δεσµούς υδρογόνου δ. η δεσοξυριβόζη του ενός, µε την φωσφορική οµάδα του εποµένου ε. η αζωτούχος βάση του ενός, µε την δεσοξυριβόζη του εποµένου 9.Για τις δυο αλυσίδες του DNA ισχύει: α. Α = Τ β. A + T = C + G γ. C = G δ. A + G = C + T 10. Το γενετικό υλικό των προκαρυωτικών κυττάρων: α. είναι γραµµικό δίκλωνο µόριο DNA β. περιέχει δύο αντίγραφα του γονιδιώµατος του και άρα διπλοειδές γ. είναι κυκλικό, δίκλωνο DNA δ. είναι κυκλικό, µονόκλωνο RNA 11. Ένα φυσιολογικό ανθρώπινο σπερµατοζωάριο περιέχει: α. 22 ζεύγη αυτοσωµικών χρωµοσωµάτων και ένα Χ ή ένα Υ β. 23 χρωµοσώµατα γ. 22 αυτοσωµικά οµόλογα χρωµοσώµατα και ένα ζεύγος φυλετικών δ. 23 αυτοσωµικά χρωµοσώµατα και ένα Χ ή ένα Υ 12.Το νουκλεόσωµα αποτελεί τη βασική µονάδα οργάνωσης της χρωµατίνης: α. στους προκαρυωτικούς οργανισµούς β. στους ιούς γ. στους ευκαρυωτικούς οργανισµούς δ. σε όλα τα παραπάνω 13. Υψηλός βαθµός συσπείρωσης του DNA παρατηρείται: α. κατά την αντιγραφή του DNA β. στο τέλος της µίτωσης γ. στο στάδιο της µετάφασης δ. στη µεσόφαση 14. Σε ένα διπλοειδές κύτταρο στο τέλος της µίτωσης το γενετικό υλικό των δυο θυγατρικών κυττάρων αποτελείται από: α. δυο µη αδελφές χρωµατίδες κάθε οµολόγου ζεύγους χρωµοσωµάτων β. ένα µόριο DNA, κάθε διπλασιασµένου χρωµοσώµατος γ. δυο αλυσίδες DNA κάθε αρχικού χρωµοσώµατος δ. όλα τα παραπάνω 15. Το πλασµίδιο των βακτηρίων είναι α. το γονιδίωµα τους β. ένα επί πλέον κυκλικό µόριο DNA γ. τµήµα του κυκλικού µορίου του DNA δ. κυκλικό DNA, µεγαλύτερο από το γονιδίωµα τους 18 Τα φυλετικά χρωµοσώµατα α εντοπίζονται µόνο στα γεννητικά κύτταρα των πολυκύτταρων οργανισµών β διατάσσονται πάντοτε σε ζεύγη οµολόγων χρωµοσωµάτων γ είναι ορατά στα σωµατικά κύτταρα κατά τη µεσόφαση δ υπάρχουν τόσο στα σωµατικά όσο και στα γεννητικά κύτταρα 2

3 19. Τα βακτήρια που χρησιµοποιήθηκαν στο πείραµα του Griffith και ευθύνονται για το θάνατο ποντικού ήταν: α. νεκρά «λεία» και νεκρά «αδρά» β ζωντανά αδρά και νεκρά λεία γ. ζωντανά «αδρά» και νεκρά «αδρά» δ. όλα τα παραπάνω 20 Τα πειράµατα των Hershey & Chase απέδειξαν: α. ότι ολόκληρος ο φάγος εισέρχεται στα βακτήρια β. ότι το πρωτεϊνικό περίβληµα εισέρχεται στο βακτήριο γ. ότι το DNA είναι το γενετικό υλικό δ. όλα τα παραπάνω 21. Το νουκλεϊκό οξύ RNA είναι το γενετικό υλικό: α. των προκαρυωτικών κυττάρων β. των µιτοχονδρίων και των χλωροπλαστών γ. των διπλοειδών οργανισµών δ. κάποιων ιών 22. Τα πλασµίδια που υπάρχουν σε ένα προκαρυωτικό κύτταρο: α. είναι δίκλωνα µόρια DNA µε το ίδιο µέγεθος β. φέρουν γενετικές πληροφορίες για το σύνολο των ιδιοτήτων βακτηρίου γ. µεταφέρουν γενετικό υλικό σε άλλα βακτήρια δ. αντιγράφονται ταυτόχρονα µε το κύριο µόριο DNA του βακτηρίου 23. Μόρια DNA από διαφορετικά είδη οργανισµών διαφέρουν: α. στη δευτεροταγή τους δοµή β. στην αναλογία των βάσεων γ.στον προσανατολισµό των αλυσίδων δ. στην αλληλουχία των πεντοζών 24. Ο φωσφοδιεστερικός δεσµός: α. είναι δεσµός 5->3' Συνδέει δυο συµπληρωµατικά δεοξυριβονουκλεοτίδια γ. είναι δεσµός υδρογόνου δ. χρειάζεται ένα µόριο νερού για την υδρόλυση του 25.Στην αντιγραφή του DNA τα κοµµάτια της αλυσίδας που αντιγράφεται κατά ασυνεχή τρόπο συνδέονται µεταξύ τους: α. µε το πριµόσωµα β. µε τη DNA πολυµεράση γ. µε τη DNA δεσµάση δ. µε τις DNA ελικάσες 26.Στην αντιγραφή του DNA τα πρωταρχικά τµήµατα RNA συντίθεται: α. από τη DNA πολυµεράση β. από το πριµόσωµα γ. από τη DNA δεσµάση δ. από τα επιδιορθωτικά ένζυµα 27. Για την αντιγραφή του DNA, είναι απαραίτητο να ξετυλιχτούν στις θέσεις έναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται: α. µε τη DNA δεσµάση β. µε τις DNA ελικάσες γ. µε το πριµόσωµα δ. µε τη DNA πολυµεράση 3

4 28. Στην αντιγραφή του DNA δεν συµµετέχει: α. η DNA ελικάση β. η DNA δεσµάση γ. η αντίστροφη µεταγραφάση δ. το πριµόσωµα 29. Κατά την αντιγραφή του DNA το ένζυµο που επιµηκύνει τα πρωταρχικά τµήµατα RNA είναι: α. η RNA πολυµεράση β. η αντίστροφη µεταγραφάση γ. το πριµόσωµα δ. η DNA πολυµεράση 30. Ποια από τις παρακάτω διαδικασίες δεν συµπεριλαµβάνεται στην αντιγραφή του DNA; α. συντίθενται τµήµατα πολυπεπτιδικής αλυσίδας β. ανοίγει η διπλή έλικα του DNA γ. συντίθενται µικρά τµήµατα RNA δ. δηµιουργούνται ζεύγη συµπληρωµατικών αζωτούχων βάσεων 31. Ποια από τις παρακάτω προτάσεις δεν ισχύει για την DNA πολυµεράση; α. κωδικοποιείται από γονίδιο β. αποτελείται από αµινοξέα γ. καταλύει το σχηµατισµό 3-5' φωσφοδιεστερικών δεσµών δ. αποτελείται από δεοξυριβονουκλεοτίδια 32. Ποια από τις παρακάτω προτάσεις δεν ισχύει για την RNA πολυµεράση; α. αποτελείται από αµινοξέα β. αποτελείται από ριβονουκλεοτίδια γ. συντίθεται στα ριβοσώµατα δ. η πληροφορία για τη σύνθεση της βρίσκεται στο DNA 33. Ο ηµισυντηρητικός διπλασιασµός του DNA παρατηρείται: α. µόνο στους ιούς β. µόνο στα προκαρυωτικά κύτταρα γ. µόνο στα ευκαρυωτικά κύτταρα δ. σε όλους τους οργανισµούς 34. Κατά την επιµήκυνση µιας αλυσίδας DNA ή RNA η αλληλουχία των νουκλεοτδίων καθορίζεται: α. από την DNA ή RNA πολυµεράση β. από τη συµπληρωµατικότητα των βάσεων της αλυσίδας «καλούπι» γ. το πριµόσωµα δ. τη DNA δεσµάση 35. Η γενετική πληροφορία που υπάρχει σε ένα γονίδιο ενός κυττάρου: α. είναι γραµµένη στην αλληλουχία των αζωτούχων βάσεων των ριβονουκλεοτιδίων β. αντιγράφεται σε λειτουργικά µόρια RNA γ. µεταφέρεται από γενιά σε γενιά δ. όλα τα παραπάνω 36. Η µεγάλη ταχύτητα µε την οποία αντιγράφεται το ευκαρυωτικό DNA του πυρήνα οφείλεται στο γεγονός: α. ότι η διπλή έλικα του DNA ανοίγει ταυτόχρονα σε πολλά σηµεία β. ότι η αντιγραφή πραγµατοποιείται µε τη βοήθεια των κατάλληλων ενζύµων γ. ότι η αντιγραφή γίνεται ταυτόχρονα και προς τις δύο κατευθύνσεις δ. όλα τα παραπάνω 4

5 37. Για τη DNA δεσµάση ισχύει: α. ότι καταλύει τη σύνθεση πεπτιδικού και φωσφοδιεστερικού δεσµού β. ότι ενώνει τα κοµµάτια mrna που προκύπτουν από τη δράση του ριβονουκλεοπρωτείνικού (snrna, πρωτεΐνες) σωµατιδίου γ. ότι η δράση της δεν επηρεάζεται από το ρη και τη θερµοκρασία δ. τίποτε από τα παραπάνω 38. Μεταγραφή είναι η µεταφορά της γενετικής πληροφορίας από το µόριο DNA: α. στο µόριο RNA β. στη πολυπεπτιδική αλυσίδα γ. σε ένα δεύτερο µόριο DNA δ. σε όλα τα παραπάνω 39. Στη διαδικασία της µεταγραφής δεν συµµετέχουν: α. η RNA πολυµεράση β. ο υποκινητής γ. η DNA δεσµάση δ. οι µεταγραφικοί παράγοντες 40. Η πληροφορία για τη σύνθεση ενός ενζύµου βρίσκεται: α. στο RNA β. στα ριβοσώµατα γ. στο DNA δ. στο trna 41. Η σωστή σειρά µεταξύ ενός γονιδίου και κυτταρικής λειτουργίας είναι: a. RNA -» DNA -»πρωτεΐνη -» λειτουργία β. DNA - RNA- πρωτεΐνη -» λειτουργία γ. λειτουργία -» DNA - πρωτεΐνη -» RNA δ. πρωτεΐνη -» λειτουργία -- πρωτεΐνη -» DNA 42. Η µεταβολική δραστηριότητα διαφόρων κυτταρικών τύπων σε έναν πολυκύτταρο οργανισµό ποικίλλει λόγω διαφορών: α. στα γονίδια β. στα ριβοσώµατα γ.στις πρωτεΐνες δ. στα µόρια trna 43. To DNA ελέγχει τις κυτταρικές λειτουργίες: α. προµηθεύοντας την απαραίτητη ενέργεια για το κύτταρο β. καθορίζοντας τη σύνθεση πρωτεϊνών γ. παρέχοντας µε την υδρόλυση του δεοξυριβονουκλεοτίδια δ. αντιγράφοντας τον εαυτό του 44. Για έναν ευκαρυωτικό οργανισµό µπορούµε να κατασκευάσουµε: α) µια γονιδιωµατική και µια cdna βιβλιοθήκη β) µια γονιδιωµατική και πολλές cdna βιβλιοθήκες γ) πολλές γονιδιωµατικές και µια cdna βιβλιοθήκη δ) πολλές γονιδιωµατικές και πολλές cdna βιβλιοθήκες 45. Οι δύο αλυσίδες του DNA είναι αντιπαράλληλες. Αυτό σηµαίνει ότι: α) Απέναντι από το 5' άκρο της µιας βρίσκεται το 3' άκρο της άλλης β) Η µία είναι δεξιόστροφη και η άλλη αριστερόστροφη. γ), Η µία έχει προσανατολισµό 5' > 3' ενώ η άλλη 3' > 5'. 5

6 δ) Τα νουκλεοτίδια της µιας αλυσίδας συνδέονται µε 3'- 5' φωσφοδιεστερικό δεσµό ενώ τα νουκλεοτίδια της άλλης µε 5' - 3'. 46. Τα άτοµα του άνθρακα της ριβόζης ενός νουκλεοτιδίου που συνδέονται ι) µε τη φωσφορική οµάδα του νουκλεοτιδίου, ιι) µε την αζωτούχο βάση, και ιιι) µε τη φωσφορική οµάδα του επόµενου νουκλεοτιδίου, είναι µε τη σειρά που αναφέρθηκαν: α)1'-5'-3' β)5'-3'-1' γ)3'-1'-5' δ)5'-1-3' 47.Τα ένζυµα που χρησιµοποιούνται in vitro για την κατασκευή και των δυο τύπων βιβλιοθηκών είναι: α) DΝΑ δεσµάση β) ειδικοί ανιχνευτές γ) περιοριστικές ενδονουκλεάσες δ) αντίστροφη µεταγραφάση ε) RNA πολυµεράση στ) Τα α και γ 48. Η αντίστροφη µεταγραφάση: α) περιέχεται φυσιολογικά σε όλα τα ευκαρυωτικά κύτταρα β) χρησιµοποιείται για την κατασκευή γονιδιωµατικών βιβλιοθηκών γ) υπάρχει και σε κάποιους RNA ιούς δ) χρησιµοποιείται για την κατασκευή cdna βιβλιοθηκών ε) υπάρχει σε όλους τους RNA ιούς 49. Η γονιδιωµατική βιβλιοθήκη είναι: α. το σύνολο των βακτηριακών κλώνων που περιέχει το ώριµο mrna ενός ιστού β. το σύνολο των βακτηριακών κλώνων που περιέχει το συνολικό DNA του δότη γ. το συνολικό DNA του δότη δ. το συνολικό DNA του δότη ενσωµατωµένο σε φορέα κλωνοποίησης. 50. Μετασχηµατισµός είναι: α. η αλλαγή στη µορφή ενός βακτηρίου β. η εισαγωγή ιχνηθετηµένων ανιχνευτών µορίων DNA ή RΝΑ σε φορέα γ. η είσοδος του DNA του φάγου σε βακτήριο δ. η εισαγωγή ανασυνδυασµένου DNA σε βακτήριο. 51. Φορέας κλωνοποίησης µπορεί να είναι: α. ένα κύτταρο ξενιστής β. το γενετικό υλικό ιού γ. το γενετικό υλικό βακτηρίου δ. όλα τα παραπάνω. 52. Για τις περιοριστικές ενδονουκλεάσες ισχύει ότι: α. παράγονται στα ευκαρυωτικά κύτταρα β. κόβουν την κάθε αλυσίδα του DNA σε ίσα µέρη γ. υδρολύουν φωσφοδιεστερικούς δεσµούς δ. ανήκουν στα µόρια φορέων κλωνοποίησης 53. Με τη cdna βιβλιοθήκη αποµονώνονται: α. όλα τα γονίδια ενός κυττάρου β. όλα τα γονίδια ενός οργανισµού γ. µόνο τα επικρατή γονίδια 6

7 δ. τα mrna των γονιδίων που µεταγράφονται στο συγκεκριµένο ιστό. 54.Πώς ονοµάζονται τα κυκλικά µόρια DNA που αναπαράγονται ανεξαρτήτως; α. ιακεκοµένα γονίδια β. Εσώνια γ. Ρυθµιστικά γονίδια δ. Πλασµίδια 55. Αποδιάταξη είναι το φαινόµενο κατά το οποίο α. ωριµάζει το πρόδροµο RNA β. µεταφράζεται το DNA γ. αποχωρίζονται οι κλώνοι του DNA δ. συνδέονται µεταξύ τους οι κλώνοι του DNA 56. Το ένζυµο ECoRI κόβει την αλυσίδα του γονιδιώµατος ενός ευκαρυωτικού κυττάρου στις θέσεις µεταξύ G και Α. Έτσι προκύπτουν α. χιλιάδες τµήµατα του DNA µε τον ίδιο αριθµό νουκλεοτιδίων. που µπορούν να συνδεθούν µε το πλασµίδιο φορέα β. πολλά τµήµατα του DNA από τα οποία µόνο ένα µπορεί να συνδεθεί µε το πλασµίδιο φορέα γ. πολλά διαφορετικά τµήµατα του DNA που έχουν τη δυνατότητα να συνδεθούν µε το πλασµίδιο φορέα δ. δύο τµήµατα του DNA µε διαφορετικό αριθµό νουκλεοτιδίων από τα οποία µόνο το ένα µπορεί να συνδεθεί µε το πλασµίδιο φορέα. 57. Μια γονιδιωµατική βιβλιοθήκη περιέχει α. αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου β. αντίγραφα του συνολικού γονιδιώµατος ενός οργανισµού γ. αντίγραφα του mrna του οργανισµού δότη δ. τα απαραίτητα ένζυµα για την παραγωγή ανασυνδυασµένου DNA. 58. Η αποδιάταξη του DNA γίνεται µε α. τη χρήση των περιοριστικών ενδονουκλεασών β. αύξηση της θερµοκρασίας γ. ραδιενεργά σηµασµένα µόρια τους ανιχνευτές δ. το ένζυµο DNA δεσµάση. 59.Στους ανώτερους οργανισµούς το µιτοχοδριακό DNA: α. ελέγχει τη σύνθεση όλων των πρωτεϊνών του µιτοχονδρίου β. είναι γραµµικό µόριο γ. περιέχει πληροφορίες σχετικά µε την οξειδωτική φωσφορυλίωση δ. είναι πατρικής προέλευσης Να «απαντήσετε σε καθεµία από τις παρακάτω ερωτήσεις: 1. Τι είναι τα νουκλεοτίδια. από τι αποτελούνται; Ποια χηµική ποσότητα είναι συνδεδεµένη στην 1 ποια στη 3 και ποια στη 5 θέση της πεντόζης; 2. Τι είναι το πλασµίδιο, ποια η κατασκευή του, τι δυνατότητες δίνει στο κύτταρο που το περιέχει και πως βοηθάει τους γενετιστές σήµερα 3. Τι είναι το νουκλεόσωµα και από τι αποτελείται. 4. Τι είναι ο καρυότυπος και ποιες εργασίες πρέπει να κάνουµε ώστε να τον λάβουµε 7

8 5.Ποιο από τα παρακάτω µόρια DNA θα υποστεί πιο εύκολα αποδιάταξη; TACGGTTTAAGTAGA ATCGACCTGCACTGA ATGCCAAATTCATCT TAGCTGGACGTGACT Συµπληρώστε τις έννοιες στις οποίες αντιστοιχούν οι παρακάτω προτάσεις: 1. Πρωτεΐνες του πυρήνα του κυττάρου, που έχουν στηρικτικό ρόλο στο µόριο του DNA: 2. Ο προσανατολισµός της πολυνουκλεοτιδικής αλυσίδας:.. 3. Το σύνολο των 22 ζευγών χρωµοσωµάτων, που είναι µορφολογικά ίδια και στον άνδρα και στη γυναίκα: 4. Η απεικόνιση, κατά το τέλος της µετάφασης των χρωµοσωµάτων ενός κυττάρου:. 5. Χαρακτηρισµός των οµοίων ζευγών χρωµοσωµάτων ενός διπλοειδούς κυττάρου: 6. Είδος βακτηρίου του οποίου η «λεία» µορφή είναι παθογόνος για τα ποντίκια:. 7. Χαρακτηρισµός των κύτταρων, των οποίων το γενετικό υλικό υπάρχει σε δύο αντίγραφα 8. Έκφραση που χρησιµοποιείται για την περιγραφή βιολογικής διαδικασίας, όταν αυτή πραγµατοποιείται στο δοκιµαστικό σωλήνα:. 9. οµικό συστατικό των νουκλεϊκών οξέων που αποτελείται από µια πεντόζη, από ένα µόριο φωσφορικού οξέος και από µία οργανική αζωτούχο βάση Ο οµοιοπολικός χηµικός δεσµός που συνδέει µεταξύ τους δύο νουκλεοτίδια: 11. Ονοµασία του µοντέλου του µορίου του DNA πού προτάθηκε από τους Watson και Crick 12. Μικρό δίκλωνο µόριο DNA, που φέρνει µικρό ποσοστό της γενετικής πληροφορίας σε µερικά βακτήρια:. 13. Ιδιότητα των βάσεων του µορίου του DNA που έχει τεράστια σηµασία στη δυνατότητα αυτοδιπλασιασµού του:. 14. Λειτουργικές µονάδες, τµήµατα του DNA, µε συγκεκριµένη αλληλουχία βάσεων, οι οποίες µπορούν να µεταγραφούν: Χαρακτηρισµός των κύτταρων, των οποίων το γενετικό υλικό υπάρχει σε ένα µόνο αντίγραφο:. 16. Χαρακτηρισµός των χρωµοσωµάτων εκείνων που σε πολλούς οργανισµούς καθορίζουν το φύλο: 17. Σχηµατισµός στο χρωµόσωµα που συγκρατεί µεταξύ τους τις αδελφές χρωµατίδες: 18. Χαρακτηρισµός των χλωροπλαστών και των µιτοχονδρίων λόγω της ιδιότητας τους µερικές από τις λειτουργίες τους να ελέγχονται από το δικό τους γενετικό υλικό:. 19. Όρος που χρησιµοποιείται για την περιγραφή του µήκους ενός νουκλείκού οξέος: Η βασική µονάδα οργάνωσης της χρωµατίνης και αποτελείται από οκτώ µόρια πρωτεϊνών γύρω από τα οποία τυλίγεται DNA µήκους 146 ζευγών βάσεων:.. 8

9 21. Το σύνολο του γενετικού υλικού ενός κυττάρου που βρίσκεται στον πυρήνα του: Ευδιάκριτες δοµές που εµφανίζονται στη κυτταροδιαίρεση και προέρχονται από τη συµπύκνωση της χρωµατίνης: 1. Από την ανάλυση έξι µορίων νουκλεϊνικών οξέων πήραµε τα αποτελέσµατα του παρακάτω πίνακα: Α Β Γ Ε Ζ Βάσεις Α Τ G C U Νουκλεοτίδια Φωσφοδιεστερικοί δεσµοί α) Να αναγνωρίσετε τον τύπο κάθε νουκλεϊνικού οξέος. β) Από ποιους οργανισµούς είναι δυνατόν να προήλθαν αυτά τα νουκλεϊνικά οξέα; 2.. Στον παρακάτω πίνακα καταγράφονται οι ποσοστιαίες αναλογίες των αζωτούχων βάσεων ενός µορίου DNA και του mrna που προήλθε από τη µεταγραφή αυτού του DNA. Να βρεθεί ποια από τις δύο αλυσίδες του DNA είναι η µεταγραφόµενη: Α G C Τ U 1 αλυσίδα DNA 21% 33% 20% 26% 0% 2 αλυσίδα DNA 26% 20% 33% 21% 0% mrna 21% 33% 20% 0% 26% Α..Νουκλεόσωµα 1.Ι 1.ΙΙ 1 Βρίσκεται στους ιούς Β..Πλασµίδιο Γ.Κεντροµερίδιο.. ίκλωνο µόριο RNA Ε...Απλοειδές κύτταρο 2. Το γονιδίωµα υπάρχει σε ένα αντίγραφο 3 Συνδέει τα οµόλογα χρωµοσώµατα 4 ίκλωνο, κυκλικό µόριο DNA 5 Συνδέει τις αδελφές χρωµατίδες 9

10 6 Βασική µονάδα οργάνωσης των ινιδίων Χρωµατίνης 2.Ι 2.ΙΙ Α..Γαµέτης 1... Το νουκλεϊκό του οξύ µπορεί να είναι µονόκλωνο µόριο DNA Β... ιπλοειδές κύτταρο 2... Περιέχει τη µισή ποσότητα DNA από ένα σωµατικό κύτταρο Γ. Ιός 3 Είναι ηµιαυτόνοµο οργανίδιο..μιτοχόνδριο Ε.Βακτήριο 4. Το γονιδίωµα υπάρχει σε δύο αντίγραφα 5 Περιέχει πλασµίδια 6.Το γενετικό υλικό ενός κυττάρου 3.Ι 3.ΙΙ Α.. «Λείο» βακτήριο 1.. DNA ιός Β Ραδιενεργό 35S Γ Βακτηριοφάγος Τ 2... Βακτήριο χωρίς κάλυµµα Ε....Γενετικό υλικό κυττάρων 2.. Πνευµονιόκοκκος µη παθογόνος 3. Πρωτεΐνες 4.. Πνευµονιόκοκκος παθογόνος 5..RNA ιός 6 DNA 4.Ι 4.ΙΙ Α..Νουκλεοτίδια 1 Ένα αντίγραφο γονιδιώµατος Β..Νουκλεόσωµα 2... Πρωτεΐνες που συµµετέχουν στην αναδίπλωση του DNA Γ.. Απλοειδή κύτταρα. Πλασµίδια Ε. Μη-ιστόνες 3 Κυκλικά µόρια DNA βακτηρίων 4 Αζωτούχες βάσεις 5. ύο αντίγραφα γονιδιώµατος 6. Βασική µονάδα οργάνωσης της χρωµατίνης Καλή Επιτυχία Τολιόπουλος Απόστολος Βιοχηµικός MSc Biochemistry 10

11 11


ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 1: Το γενετικό υλικό ΘΕΜΑ: 1 ο (Μονάδες 25 ) Να επιλέξετε τη σωστή απάντηση στις παρακάτω ερωτήσεις. 1. Το πείραµα των Hershey και Chase ήταν:

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου 2013-2014 ΓΕ.Λ. ΣΟΡΩΝΗΣ ΜΑΣΤΗ ΧΡΙΣΤΙΝΑ Κεφάλαιο 1 ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ταξίδι στο χρόνο 1869 Απομονώνεται DNA από τον κυτταρικό πυρήνα 1903 Αποδεικνύεται ότι τα χρωμοσώματα

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό

Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό Ασκήσεις για το Κεφάλαιο 1: Το γενετικό υλικό A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 1 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1 ΚΕΦΑΛΑΙΟ 1 Ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Οι επιστήµονες αρχικά πίστευαν ότι το γενετικό υλικό ήταν οι πρωτεΐνες και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ κατεύθυνσης

ΒΙΟΛΟΓΙΑ κατεύθυνσης Κεφάλαιο 1 ο ΒΙΟΛΟΓΙΑ κατεύθυνσης Θέματα μικρής δυσκολίας (κατάλληλα για 2 ο Θέμα Πανελληνίων) 1. Ποιο είναι το συμπέρασμα στο οποίο κατέληξε ο Griffith με το πείραμα που πραγματοποίησε; Ο Griffith κατέληξε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι:

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 1 Ο ΚΕΦΑΛΑΙΟ (ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ) 2000 ΗΜΕΡΗΣΙΟ 3. Στα προκαρυωτικά κύτταρα το γενετικό υλικό είναι: α. γραµµικό δίκλωνοdνα β. γραµµικό

Διαβάστε περισσότερα


ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7

Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 Α1. 1. δ 2. α 3. δ 4. γ 5. γ Βιολογία ΘΕΜΑ A κατεύθυνσης Α2. Κατάταξη Αδενίνη 1 Γονίδιο 4 Νουκλεοτίδιο 2 Νουκλεόσωμα 3 Βραχίονας 5 Χρωματίδα 6 Γονιδίωμα 8 Καρυότυπος 9 Μεταφασικό χρωμόσωμα 7 ΘΕΜΑ Β 1.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 2/12/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΚΕΦΑΛΑΙΟ 1 Μ.ΒΡΑΧΝΟΥΛΑ Σελίδα 1 ΑΣΚΗΣΕΙΣ 1. Σε ένα δίκλωνο µόριο DNA ο λόγος Α / C είναι 1/ 4. Το μήκος του είναι 20.000 ζεύγη βάσεων. Ποια η εκατοστιαία σύσταση και ποιος ο αριθµός των νουκλεοτιδίων που

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα


ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια

Με την ανάπτυξη αυτής της τεχνολογίας το DNA που ήταν τόσο δύσκολο να µελετηθεί έγινε «παιχνίδι» στα ανθρώπινα χέρια ΚΕΦΑΛΑΙΟ 4ο: Η τεχνολογία του ανασυνδυασµένου DNA έδωσε στον άνθρωπο την ικανότητα όχι µόνο να ερευνά αλλά και να τροποποιεί το γενετικό υλικό των οργανισµών ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA Η τεχνολογία

Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα


ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε)

ΠΑΘΟΓΟΝΟ (σκότωνε τα ποντίκια που µόλυνε) ΚΕΦΑΛΑΙΟ 1ο: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1 ΠΟΙΟ ΜΟΡΙΟ ΜΕΤΑΦΕΡΕΙ ΤΗ ΓΕΝΕΤΙΚΗ ΠΛΗΡΟΦΟΡΙΑ; Το 1969 εντοπίστηκε στον πυρήνα των κυττάρων το DNA Μέχρι το 1944 δεν ήταν γνωστό ότι αποτελεί το γενετικό υλικό των οργανισµών

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας

Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας Θεωρία (4 Ο Κεφάλαιο) επιμέλεια: Μιχάλης Χαλικιόπουλος καθηγητής Βιολογίας 1 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 2 Θεωρία (4 Ο Κεφάλαιο) 3 ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 1 2 3 ΚΛΩΝΟΠΟΙΗΣΗ 4 5 6 ορισμός:

Διαβάστε περισσότερα

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών.

Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Κεφάλαιο 1: ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Βιομόρια: Τα μόρια που βρίσκονται στα κύτταρα των οργανισμών και αποτελούν απαραίτητο συστατικό αυτών. Βιολογικά μακρομόρια ( ή πολυμερή ): Κατηγορία βιομορίων με μεγάλο ΜΒ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA

B4-Ασκήσεις για το Κεφάλαιο 4: Η τεχνολογία του ανασυνδυασμένου DNA A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Οι περιοριστικές ενδονουκλεάσες

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ Τα προβλήματα αυτού του κεφαλαίου αναφέρονται στον υπολογισμό : 1. νουκλεοτιδίων ή αζωτούχων βάσεων ή πεντοζών ή φωσφορικών ομάδων 2. φωσφοδιεστερικών δεσμών ή μορίων

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α ΘΕΜΑ Β. Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Το 1928 ο Griffith χρησιµοποίησε δύο στελέχη του βακτηρίου πνευµονιόκοκκος (Dίplococcus pneumoniae),τα οποία ξεχωρίζουν µορφολογικά, όταν καλλιεργηθούν

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA

ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA ΚεφάΠαιο 4 ΤεχνοΠογία ίου ανασυνουασμένου DNA 1. Γιατί οι περιοριστικές ενδονουκλεάσες και οι φορείς κλωνοποίησης είναι απαραίτητα εργαλεία για τη Γενετική Μηχανική; Οι περιοριστικές ενδονουκλεάσες είναι

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Παρασκευή, 22 Μαΐου 2009 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης

Σημειώσεις Μοριακής Βιολογίας Βιολογία Γ Λυκείου Θετικής Κατεύθυνσης 1 Προαπαιτούμενες Γνώσεις για την κατανόηση της Κλωνοποίησης 1. Περιοριστικές ενδονουκλεάσες α. Είναι ένζυμα που σπάνε (υδρολύουν) 3-5 φωσφοδιεστερικούς δεσμούς ενδιάμεσα στο μόριο του DNA, και όχι στα

Διαβάστε περισσότερα


ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΡΩΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΡΩΤΗΣΕΙΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. Πότε ανακαλύφτηκε το DNA και πότε αποδείχτηκε για πρώτη φορά ότι το DNA είναι το γενετικό υλικό; Τι πίστευαν οι επιστήμονες μέχρι να αποδειχτεί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 B ΦΑΣΗ. ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ÏÅÖÅ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Τετάρτη 4 Μαΐου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή τη φράση, η

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης

Το γενετικό υλικό. κεφάλαιο. Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης Το γενετικό υλικό κεφάλαιο Πνευμονιόκοκκοι (Diploccoccus pneumoniae) Φωτογραφία από ηλεκτρονικό μικροσκόπιο σάρωσης To DNA είναι το γενετικό υλικό Η απάντηση δόθηκε το 1944, όταν οι Avery, Mac-Leod και

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα