ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ"

Transcript

1 ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου 10. Δεοξυριβονουκλεοτίδιο 11. Διπλή έλικα 12. Διπλοειδές κύτταρο 13. Διπλοειδής οργανισμός 14. Ινίδιο χρωματίνης 15. Ιστόνες 16. Ιχνηθέτηση 17. Καλλιέργια 18. Καρυότυπος 19. Μεσόφαση 20. Μετασχηματισμός 21. Μεταφασικό χρωμόσωμα 22. Μη ιστόνες 23. Μιτωγόνος ουσία 24. Μίτωση 25. Νουκλεόσωμα 26. Νουκλεοτίδιο 27. Ομόλογα χρωμοσώματα 28. Πλασμίδια 29. Ριβονουκλεοτίδιο 30. Στέλεχος 31. Φάγος ή βακτηριοφάγος 32. Φυλετικά χρωμοσώματα 33. Φωσφοδιεστερικός δεσμός

2 ΟΡΟΛΟΓΙΑ 2 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. Αγγελιοφόρο RNA 2. DNA πολυμεράσες 3. DNA δεσμάση 4. DNA ελικάσες 5. RNA πολυμεράση 6. Αλληλουχίες λήξης της μεταγραφής 7. Αμετάφραστες περιοχές 8. Ανοιχτό πλαίσιο ανάγνωσης 9. Αντιγραφή 10. Αντικωδικόνιο 11. Αντίστροφη μεταγραφάση 12. Αντίστροφη μεταγραφή 13. Ασυνεχής αντιγραφή 14. Γενετικός κώδικας 15. Γενετικός κώδικας 16. Γονιδιακή έκφραση 17. Γονιδιακή ρύθμιση 18. Γονίδιο 19. Εκφυλισμένος γενετικός κώδικας 20. Έναρξη 21. Εξώνια 22. Επαγωγέας 23. Επιδιορθωτικά ένζυμα 24. Επιμήκυνση 25. Εσώνια 26. Ημισυντηρητικός μηχανισμός 27. Θέσεις έναρξης αντιγραφής 28. Καταστολέας 29. Κεντρικό δόγμα της βιολογίας 30. Κυτταρική διαφοροποίηση

3 31. Κωδική αλυσίδα 32. Κωδικόνιο 33. Κωδικόνιο έναρξης 34. Κωδικόνιο λήξης 35. Λήξη 36. Μεταγραφή 37. Μεταγραφικοί παράγοντες 38. Μεταγραφόμενη ή μη κωδική αλυσίδα 39. Μεταφορικό RNA 40. Μετάφραση 41. Μη επικαλυπτόμενος γενετικός κώδικας 42. Μικρό πυρηνικό RNA 43. Οπερόνιο 44. Πλαίσιο ανάγνωσης 45. Πολύσωμα 46. Πριμόσωμα 47. Πρόδρομο mrna 48. Πρωταρχικά τμήματα 49. Ριβοσώματα 50. Ριβοσωμικό RNΑ 51. Ρυθμιστικό γονίδιο 52. Σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης 53. Συνεχής αντιγραφή 54. Συνεχής γενετικός κώδικας 55. Συνώνυμα κωδικόνια 56. Σχεδόν καθολικός γενετικός κώδικας 57. Τριαδικός γενετικός κώδικας 58. Υποκινητής 59. Χειριστής 60. Ωρίμανση mrna 61. Ώριμο mrna

4 ΟΡΟΛΟΓΙΑ 4 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. cdna βιβλιοθήκη 2. Ecoli 3. EcoRI 4. Αλυσιδωτή αντίδραση πολυμεράσης 5. Ανασυνδυασμένο DNA 6. Ανιχνευτής 7. Αποδιάταξη DNA 8. Γενετική μηχανική 9. Γονιδιωματική βιβλιοθήκη 10. Κλωνοποίηση 11. Κλώνος 12. Κύτταρο ξενιστής 13. Μετασχηματισμός 14. Περιοριστικές ενδονουκλεάσες 15. Τεχνητά ανασυνδυασμένο DNA 16. Υβρίδιο 17. Υβριδοποίηση 18. Φορέας κλωνοποίησης ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ Στο δίκλωνο DNA η αζωτούχος βάση Α είναι συμπληρωματική της Τ και η αζωτούχος βάση G είναι συμπληρωματική της C. Μεταξύ Α-Τ σχηματίζονται δύο δεσμοί υδρογόνου ενώ μεταξύ G C σχηματίζονται τρεις δεσμοί υδρογόνου. Ο δεσμός που συνδέει Τα νουκλεοτίδια στα νουκλεϊκά οξέα είναι ο 3-5 φωσφοδιεστερικός δεσμός. Ο δεσμός που συνδέει τα αμινοξέα μιας πρωτεΐνης είναι ο πεπτιδικός δεσμός. Για να διαπιστώσουμε αν δύο οργανισμοί ανήκουν στο ίδιο είδος συγκρίνουμε τους λόγους (Α+Τ)/(G+C).

5 Το νουκλεόσωμα αποτελείται από DNA μήκους 146 ζευγών βάσεων και από οκτώ μόρια πρωτεϊνών που ονομάζονται ιστόνες. Το μήκος του τμήματος που συνδέει τα νουκλεοσώματα δίνεται (34 ζεύγη βάσεων στον άνθρωπο). Όταν μια άσκηση αναφέρεται σε τμήμα DNA κυττάρου π.χ. γονίδιο τότε λύνουμε την άσκηση λαμβάνοντας υπόψη ότι το τμήμα του DNA είναι δίκλωνο και γραμμικό ενώ αν δεν αναφέρεται σε κύτταρο παίρνουμε και δεύτερη περίπτωση που ισχύει σε ορισμένους ιούς, το DNA να είναι μονόκλωνο και γραμμικό. Όταν μια άσκηση αναφέρεται σε μόριο DNA κυττάρου τότε λύνουμε την άσκηση διακρίνοντας δύο περιπτώσεις : α) το μόριο να είναι δίκλωνο και γραμμικό β) το μόριο να είναι δίκλωνο και κυκλικό Γραμμικό μόριο DNA υπάρχει στον πυρήνα ευκαρυωτικών κυττάρων,στα μιτοχόνδρια κατώτερων πρωτόζωων και σε ορισμένους ιούς. Κυκλικό μόριο DNA υπάρχει στα μιτοχόνδρια και τους χλωροπλάστες ευκαρυωτικών κυττάρων, στα προκαρυωτικά κύτταρα και σε ορισμένους ιούς. Αν η άσκηση δεν αναφέρεται σε κύτταρο τότε παίρνουμε 4 περιπτώσεις: α) το μόριο να είναι δίκλωνο και γραμμικό. β) το μόριο να είναι δίκλωνο και κυκλικό. γ) το μόριο να είναι μονόκλωνο και γραμμικό. δ) το μόριο να είναι μονόκλωνο και κυκλικό. Όταν μια άσκηση μας δίνει αριθμό φωσφοδιεστερικών δεσμών και δεσμών υδρογόνου, τμήματος ή μορίου DNA, λύνουμε την άσκηση με σύστημα υποθέτοντας ότι είναι x τα ζεύγη Α-Τ και ψ τα ζεύγη G-C. Ο σχηματισμός ενός φωσφοδιεστερικού ή ενός πεπτιδικού δεσμού συνοδεύεται από αποβολή ενός μορίου νερού και αντίστροφα. Τα απλοειδή κύτταρα έχουν γενετικό υλικό μήκους ζεύγη βάσεων. Τα διπλοειδή κύτταρα έχουν γενετικό υλικό μήκους ζεύγη βάσεων. Ο αριθμός των ατόμων φωσφόρου είναι ίσος με τον αριθμό των νουκλεοτιδίων Ο αριθμός των ριβοζών ή των δεοξυριβοζών είναι ίσος με τον αριθμό των νουκλεοτιδίων Κάθε ριβόζη ή δεοξυριβοζή είναι πεντόζη έχει δηλαδή 5 άτομα άνθρακα.

6 ΑΣΚΗΣΕΙΣ 1. Σε δύο κύτταρα έγινε ανάλυση γενετικού υλικού και βρέθηκε η ακόλουθη επί τις εκατό σύσταση σε αζωτούχες βάσεις : Α Τ G C Κύτταρο Κύτταρο Να αιτιολογήσετε αν τα κύτταρα ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών. 2. Αν στην μία αλυσίδα ενός τμήματος DNA ο λόγος (Α+Τ)/(G+C) =0,125, να υπολογιστεί ο αντίστοιχος λόγος στη συμπληρωματική αλυσίδα. 3. Ένα ινίδιο χρωματίνης έχει στην αρχή της μεσόφασης του κυττάρου 400 νουκλεοσώματα. Να βρείτε : i. Πόσα νουκλεοσώματα, ii. Πόσες αζωτούχες βάσεις και iii. Πόσα μόρια ιστονών Θα υπάρχουν μετά την αντιγραφή του DNA κατά την μεσόφαση. 4. Ένα τμήμα DNA έχει 10 φωσφοδιεστερικούς και 15 δεσμούς υδρογόνου. Πόσες Α, Τ, G και C περιέχει; 5. Ένα πλασμίδιο έχει νουκλεοτίδια. Πόσοι είναι οι φωσφοδιεστερικοί δεσμοί του μορίου; 6. Ένα μόριο DNA έχει φωσφοδιεστερικούς δεσμούς. Ποίος είναι ο αριθμός των νουκλεοτιδίων του μορίου; 7. Ο λόγος (Α+Τ)/(G+C) σε ένα μόριο DNA είναι ¾ και το σύνολο των δεσμών υδρογόνου είναι Να βρείτε τον αριθμό των νουκλεοτιδίων για κάθε μια αζωτούχο βάση. 8. Ένα μόριο DNA κυττάρου υπολογίστηκε ότι περιέχει αζωτούχες βάσεις. Το 30% των βάσεων είναι G. Βρείτε : i. το ποσοστό των υπολοίπων βάσεων ii. τον αριθμό των δεσμών υδρογόνου που υπάρχουν στο μόριο 9. Ένα μόριο DNA κυττάρου περιέχει ζεύγη νουκλεοτιδίων. Αν τα 500 νουκλεοτίδια περιέχουν Α, να βρείτε:

7 i. Τον αριθμό των υπολοίπων βάσεων ii. Τον αριθμό των φωσφοδιεστερικών δεσμών iii. Τον αριθμό των δεσμών υδρογόνου. 10. Ένα μόριο DNA έχει μήκος nm. Αν σε κάθε βήμα της διπλής έλικας του υπάρχουν 10 ζεύγη βάσεων με μήκος 3,4 nm και το 15% των αζωτούχων βάσεων είναι Α,να βρείτε : i. τον αριθμό των νουκλεοτιδίων του μορίου ii. τον αριθμό των δεσμών υδρογόνου που υπάρχουν σε αυτό 11. Ένα μόριο DNA ευκαρυωτικού κυττάρου έχει φωσφοδιεστερικούς δεσμούς και δεσμούς υδρογόνου. Ποιος είναι ο αριθμός των νουκλεοτιδίων για κάθε μια αζωτούχο βάση; 12. Ποιο είναι το μέσο μήκος, σε ζεύγη αζωτούχων βάσεων, ενός χρωμοσώματος στο γαμέτη του ανθρώπου; 13. Δύο μόρια DNA έχουν 30% G. i. θα έχουν το ίδιο μήκος; ii. θα έχουν τον ίδιο αριθμό δεσμών υδρογόνου; 14. Έστω ένα κύτταρο με 10 χρωμοσώματα. Πόσα χρωμοσώματα και πόσα μόρια DNA θα έχει ένα θυγατρικό του κύτταρο μετά από την κυτταρική διαίρεση (αρχή της μεσόφασης); 15. Κατά τον σχηματισμό ενός πλασμιδίου αφαιρούνται μόρια νερού και σχηματίζονται δεσμοί υδρογόνου. Να βρεθεί ο αριθμός των διαφορετικών νουκλεοτιδίων που περιέχει. 16. Μιτοχονδριακό DNA του ανθρώπου περιέχει ζεύγη βάσεων. Αν ισχύει A/C = 1/3, να βρεθεί: α) ο ακριβής αριθμός των αζωτούχων βάσεων και β) τα μόρια του νερού που αποσπάστηκαν κατά την δημιουργία του μορίου. 17. Μεσοφασικό ανθρώπινο χρωμόσωμα έχει ζεύγη βάσεων. Αν το κομμάτι του DNA μεταξύ δύο διαδοχικών νουκλεοσωμάτων έχει μήκος 34 ζεύγη βάσεών να βρεθεί ο αριθμός των μορίων των ιστονών που υπάρχουν στο παραπάνω χρωμόσωμα. Να θεωρήσετε ότι στα άκρα του χρωμοσώματος βρίσκονται νουκλεοσώματα και ότι κάθε νουκλεόσωμα αποτελείται από 146 ζεύγη βάσεών. 18. Κυκλικό δίκλωνο μόριο DNA περιέχει φωσφοδιεστερικούς δεσμούς και δεσμούς υδρογόνου.

8 Ποιο είναι το ποσοστό (%) καθεμιάς από τις τέσσερις αζωτούχες βάσεις στο μόριο; 19. Ένα τμήμα μορίου DNA έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Ποιος είναι ο ακριβής αριθμός κάθε αζωτούχου βάσης; 20. Αν ο λόγος A+G/T+C στην μια αλυσίδα του DNA είναι 7/10 πόσος είναι ο ίδιος λόγος α) στην συμπληρωματική της και β) στο μόριο; 21. Αν ο λόγος A+τ/G+C στην μια αλυσίδα του DNA είναι 7/10 πόσος είναι ο ίδιος λόγος α) στην συμπληρωματική της και β) στο μόριο; 22. Τμήμα DNA αποτελούμενο από 200 ζεύγη βάσεων περιέχει 110 βάσεις Τ. Ποιος ο αριθμός και το ποσοστό (%) των υπολοίπων βάσεων; 23. Στο DNA ενός νουκλεοσώματος η διαφορά αδενίνης και κυτοσίνης είναι 80. Ποιος ο αριθμός των υπολοίπων βάσεων; 24. Μόριο DNA αποτελείται από νουκλεοτίδια. Το ποσοστό των αζωτούχων βάσεων στην μία αλυσίδα είναι Α:15%, Τ:25%, G:40% και C:20%. Να βρεθεί ο αριθμός των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών που υπάρχουν στο μόριο. 25. Τμήμα DNA περιέχει 80 ζεύγη βάσεων και ο αριθμός των δεσμών υδρογόνου στο μόριο είναι 190. Να βρεθούν: α) τα ποσοστά(%) των αζωτούχων βάσεων του τμήματος, β)ο αριθμός των φωσφοδιεστερικών δεσμών, γ)το πλήθος των μορίων του νερού που απαιτούνται για την υδρόλυση του παραπάνω τμήματος; 26. Μια πλήρης στροφή της έλικας του DNA έχει μήκος 3,4nm και περιέχει 10 ζεύγη βάσεων. Αν ένα τμήμα DNA έχει μήκος 13600nm και το 30% των βασεών του είναι αδενίνη, να βρεθεί ο αριθμός α) όλων των βάσεων, β) των δεσμών υδρογόνου και γ) των φωσφοδιεστερικών δεσμών. 27. Το συνολικό DNA μιας μύγας έχει 1, ζεύγη βάσεων. Από πόσα περίπου νουκλεοσώματα αποτελείται και με πόσα περίπου μόρια ιστονών πακετάρονται αυτά αν είναι γνωστό ότι: α) το DNA είναι ενιαίο μόριο, β)στα άκρα του βρίσκονται

9 νουκλεοσώμτα, γ)κάθε νουκλεόσωμα αποταλείται από 146 ζεύγη βάσεων και δ) το DNA που ενώνει δύο διαδοχικά νουκλεοσώματα έχει μήκος 54 ζεύγη βάσεων. 28. Βακτηριακό DNA αποτελείται από 800 ζεύγη νουκλεοτιδίων,περιέχει θυμίνη σε ποσοστό 12% του συνόλου των βάσεων και η απόσταση μεταξύ δύο διαδοχικών νουκλεοτιδίων είναι 0,4`nm.Να βρεθούν : α) το ποσοστό και ο αριθμός των υπολοίπων βάσεων, β) το πλήθος των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών, γ)ο αριθμός των ατόμων φωσφόρου, δ) ο αριθμός των δεσοξυριβοζών και ο αριθμός των ατόμων άνθρακα, ε)το μήκος του μορίου και στ) το μήκος της διπλής έλικας αν το βήμα της είναι 3,4nm και αποτελείται από 16 ζεύγη νουκλεοτιδίων. 29. Το μοριακό βάρος του DNA ενός διπλοειδούς κυττάρου είναι ,το μέσο μοριακό βάρος των νουκλεοτιδίων του είναι 300 και η απόσταση δύο διαδοχικών νουκλεοτιδίων 0,34nm.Να βρεθούν : α) ο αριθμός των δεοξυριβονουκλεοτιδίων και β)το συνολικό μήκος του μορίου. 30. Σε ένα δίκλωνο μόριο DNA βρέθηκε ότι η κυτοσίνη αποτελείτο 17% των αζωτούχων βάσεων του. Ποιο είναι το ποσοστό των υπολοίπων βάσεων στο μόριο του DNA; Πόσοι δεσμοί υδρογόνου αναπτύσσονται στο μόριο του δίκλωνου DNA, αν αποτελείται από νουκλεοτίδια; 31. Σε ένα δίκλωνο μόριο DNA βρέθηκε ότι η γουανίνη (G) αποτελείτο 21% των αζωτούχων βάσεων του. Σε ποιες αναλογίες (%) θα βρίσκεται η καθεμιά από τις υπόλοιπες αζωτούχες βάσεις του; Πόσα μόρια νερού χρειάζονται για την υδρόλυση ενός δίκλωνου μορίου DNA, αν αποτελείται από 7000 νουκλεοτίδια; Πόσες διαφορετικές πολυνουκλεοτιδικές αλυσίδες είναι δυνατόν να προκύψουν από τη μια αλυσίδα του παραπάνω μορίου του DNA; 32. Ένα δίκλωνο μόριο DNA περιέχει φωσφοδιεστερικούς δεσμούς. Αν είναι γνωστό ότι το ποσοστό των νουκλεοτιδίων

10 που έχουν ως βάση τη θυμίνη είναι 15%, να υπολογίσετε το ποσοστό των υπολοίπων βάσεων, καθώς και τον αριθμό τους στο μόριο του DNA. 33. H μία αλυσίδα ενός τμήματος δίκλωνου μορίου DNA έχει την παρακάτω αλληλουχία: GGCGTTAAGATCAGTACCTGCTAATGCATCGATAATTCCGATCGTAC TGA Να βρείτε τη συμπληρωματική της, καθώς και τον αριθμό των υδρογονοδεσμών που αναπτύσσονται ανάμεσα στις δύο αυτές συμπληρωματικές αλυσίδες. 34. Στο δίκλωνο μόριο του DNA να συμπληρώσετε τα κενά και να υπολογισθούν οι δεσμοί υδρογόνου, καθώς και οι φωσφοδιεστερικοί δεσμοί που αναπτύσσονται. GTAGCTACGTTGTGATAATCT ATGCAG GCC ΤΑΑ ΑΤΑGΤΑGΑΤΑΑ ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ a) Κεντρικό δόγμα της Βιολογίας: ΜΕΤΑΓΡΑΦΗ DNA RNA ΠΡΩΤΕΪΝΕΣ ΑΝΤΙΓΡΑΦΗ ΑΝΤΙΣΤΡΟΦΗ ΜΕΤΑΓΡΑΦΗ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ b) Τα γονίδια των ευκαρυωτικών κυττάρων περιέχουν εσώνια και εξώνια, οπότε μετά την μεταγραφή προκύπτει το πρόδρομο mrna. Αντίθετα, τα γονίδια των προκαρυωτικών κυττάρων έχουν μόνο εξώνια.

11 c) Το mrna είναι συμπληρωματικό της μη κωδικής (μεταγραφόμενης) αλυσίδας του γονιδίου (του DNA). d) Κατά την μεταγραφή απέναντι από το νουκλεοτίδιο με Α τοποθετείται νουκλεοτίδιο με U, απέναντι από το νουκλεοτίδιο με T τοποθετείται νουκλεοτίδιο με A, απέναντι από το νουκλεοτίδιο με G τοποθετείται νουκλεοτίδιο με C και απέναντι από το νουκλεοτίδιο με C τοποθετείται νουκλεοτίδιο με G. e) Το ώριμο mrna εκτός από το ανοιχτό πλαίσιο ανάγνωσης, περιέχει τις 3 και 5 αμετάφραστες περιοχές και το κωδικόνιο λήξης. f) Τα αντικωδικόνια των trna είναι συμπληρωματικά των κωδικονίων του mrna. g) Κάθε αντικωδικόνιο αντιστοιχεί και σε ένα ξεχωριστό μόριο trna. h) Κωδικόνιο έναρξης της πρωτεϊνοσύνθεσης είναι το AUG που κωδικοποιεί ταυτόχρονα το αμινοξύ μεθειονίνη. i) Κωδικόνια λήξης της πρωτεϊνοσύνθεσης είναι τα : UAA, UAG και UGA, και δεν κωδικοποιούν κανένα αμινοξύ και δεν έχουν αντικωδικόνια. j) Σε πολλές πρωτεϊνες,αμέσως μετά την ολοκλήρωση της σύνθεσής τους απομακρύνονται ορισμένα αμινοξέα, επομένως και η μεθειονίνη από το αρχικό αμινικό άκρο. k) Αν α είναι τα νουκλεοτίδια ενός γονιδίου τότε τα νουκλεοτίδια της κωδικής αλυσίδας του είναι α/2 και της μη κωδικής (μεταγραφόμενης ) α/2 και τα νουκλεοτίδια του mrna θα είναι α/2. l) Όταν μας δίνονται τα νουκλεοτίδια του mrna (έστω α) και δεν υπάρχουν 3, 5 αμετάφραστες περιοχές τα κωδικόνια είναι α/3 και τα αμινοξέα (α/3 1) αφού στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ. m) Όταν μας δίνονται τα νουκλεοτίδια του mrna και πρέπει να ληφθούν υπόψη οι 3, 5 αμετάφραστες περιοχές αφαιρούμε τον ελάχιστο αριθμό που απαιτείται ώστε ο αριθμός νουκλεοτιδίων να γίνει πολλαπλάσιος του 3 και να μένουν σε κάθε άκρο 1 ή 2 αμετάφραστα νουκλεοτίδια και ακολουθούμε την διαδικασία της παραγράφου (l).

12 n) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν τα εξώνια ή τα εσώνια βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna και εργαζόμαστε σε μια από τις προηγούμενες παραγράφους (Ι) ή (m) ανάλογα με την περίπτωση. o) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν το πλαίσιο ανάγνωσης βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna (έστω α) τα κωδικόνια είναι α/3 και τα αμινοξέα (α/3 1) αφού στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ p) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν το ανοιχτό πλαίσιο ανάγνωσης βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna (έστω α) τα κωδικόνια είναι α/3 και τα αμινοξέα α/3. q) Όταν μας δίνεται η αλληλουχία ενός τμήματος DNA ψάχνουμε σε κάθε αλυσίδα του και προς τις δύο κατευθύνσεις να εντοπίσουμε τα κωδικόνια έναρξης και λήξης (με Τ αντί της U),η αλυσίδα που τα περιέχει είναι η κωδική και η συμπληρωματική της η μεταγραφόμενη. r) Από τα τέσσερα είδη RNA τα τρία βρισκονται τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς σε κατά μέσο όρο ποσοστά 5% mrna, 15% trna και 80% rrna, το τέταρτο (snrna) υπάρχει μόνο στους ευκαρυωτικούς οργανισμούς. s) Η ποσοστιαία αναλογία βάσεων στο RNA είναι ίδια με αυτή της κωδικής αλυσίδας του DNA από το οποίο προκύπτει. t) Από ένα μόριο mrna μπορούν να προκύψουν πολλά όμοια πεπτίδια. u) Τα οπερόνια των προκαρυωτικών οργανισμών είναι ομάδες γονιδίων. v) Κατά τον σχηματισμό ενός πεπτιδικού δεσμού αφαιρείται ένα μόριο νερού εκτός και αν αναφέρεται στο πρόβλημα ότι αυτό δεν λαμβάνεται υπόψη. w) Στα μόρια DNA προκαρυωτικών κυττάρων υπάρχουν οι υποκινητές και οι χειριστές τους οποίους αγνοούμε αν δεν

13 έχουμε στοιχεία για αυτούς ή αν αναφέρεται στο πρόβλημα. x) Πίνακας επίλυσης προβλημάτων μεταγραφής μετάφρασης: DNA Κωδική Μεταγραφόμενη (μη κωδική) mrna trna Πεπτίδιο Περιέχει το κωδικόνιο έναρξης (ATG) και ένα από τα κωδικόνια λήξης (TAA, TAG και TGA) Συμπληρωματική και αντιπαράλληλη της κωδικής Συμπληρωματικό και αντιπαράλληλο της μεταγραφόμενης με U αντί Τ. Συμπληρωματικό και αντιπαράλληλο του mrna (ένα μόριο για κάθε κωδικόνιο εκτός από το κωδικόνιο λήξης) Συνδυασμός mrna και γενετικού κώδικα ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ 1. Μόριο DNA με ραδιενεργό Ρ 32 αφήνεται να διπλασιαστεί σε περιβάλλον με κανονικό Ρ 30. Αν ακολουθήσουν δύο διαδοχικές διαιρέσεις, πόσοι κλώνοι DNA θα αποτελούνται από κανονικό Ρ 30 ; 2. Ένα μόριο DNA περιέχει νουκλεοτίδια που στις αζωτούχες βάσεις του έχουν Ν 14. Μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που έχουν μόνο Ν 15 και αυτοδιπλασιάζονται. Πόσες αλυσίδες με Ν 14 και πόσες με Ν 15 θα υπάρχουν μετά τον δεύτερο αυτοδιπλασιασμό;

14 3. Σε ένα μόριο DNA υπάρχουν νουκλεοτίδια που έχουν Ρ 30. Μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που έχουν Ρ 32 και αυτοδιπλασιάζεται. Πόσα νουκλεοτίδια με Ρ 32 θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο αυτοδιπλασιασμό; 4. Ένα μόριο DNA περιέχει στον ένα κλώνο Ν 15 και στον άλλο Ν 14. Το μόριο αυτοδιπλασιάζεται σε περιβάλλον στο οποίο περιέχονται νουκλεοτίδια με Ν 14. Το αρχικό μόριο αποτελείται από 7200 νουκλεοτίδια. Πόσα νουκλεοτίδια με Ν 14 και πόσα με Ν 15 θα υπάρχουν στα μόρια του DNA μετά από δύο συνεχείς αυτοδιπλασιασμούς; 5. Σε ένα μόριο DNA υπάρχουν άτομα φωσφόρου. Το μόριο αυτό μεταφέρεται και διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου. Πόσα άτομα ραδιενεργού φωσφόρου θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο διπλασιασμό; Αιτιολογήστε πλήρως την απάντηση σας. 6. Μόριο DNA διπλασιάζεται σε περιβάλλον ραδιενεργού αζώτου. Πόσες αλυσίδες DNA με ραδιενεργό άζωτο θα υπάρχουν μετά τον πρώτο και πόσες μετά τον τέταρτο διπλασιασμό; 7. Μόριο DNA διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου, τα θυγατρικά του μόρια διπλασιάζονται σε περιβάλλον ραδιενεργού θείου. Τι σύσταση θα έχουν οι πολυνουκλεοτιδικές αλυσίδες που θα προκύψουν από την παραπάνω διαδικασία; 8. Το παρακάτω τμήμα DNA αυτοδιπλασιάζεται σε περιβάλλον που ATATG TATAC υπάρχουν μόνο σημασμένα νουκλεοτίδια Α *,T *, G *,C *. Να γράψετε τα μόρια του DNA που προκύπτουν μετά τον πρώτο και μετά τον δεύτερο διπλασιασμό(αιτιολογήστε την απάντηση σας).

15 9. Μόριο DNA που περιέχει Ν 14 υφίσταται δύο διπλασιασμούς σε περιβάλλον με Ν 15 και ακολούθως άλλους δύο σε περιβάλλον με Ν 14.Ποια θα είναι η σύσταση των μορίων του DNA μετά το πέρας της παραπάνω διεργασίας; 10. Μόριο mrna που προέρχεται από τη μεταγραφή βακτηριακού DNA αποτελείται κατά 30% από αδενίνη, 30% G, 20% C. Ποια θα είναι η αναλογία των βάσεων στο μόριο από το οποίο προήλθε; 11. Μία από τις δύο αλυσίδες του DNA που έχει σύνθεση βάσεων Α:12%, G :29% και C : 20%, αντιγράφεται για να δώσει την συμπληρωματική της αλυσίδα. Στη συνέχεια, η συμπληρωματική αυτή αλυσίδα μεταγράφεται σε mrna. Να βρεθεί η σύνθεση των βάσεων του mrna. Αιτιολογήστε την απάντηση σας. 12. Πως δικαιολογείται η διαφορά(αριθμητική) μεταξύ των νουκλεοτιδίων που υπάρχουν σε ένα γονίδιο ευκαρυωτικού κυττάρου και των αμινοξέων της λειτουργικής πρωτεΐνης που προκύπτει από αυτό; 13. Ένα τμήμα DNA του βακτηρίου E-coli αποτελείται από νουκλεοτίδια. Πόσα αμινοξέα μπορούν να κωδικοποιηθούν από αυτό το τμήμα (θεωρήστε ότι το παραπάνω τμήμα ταυτίζεται με το πλαίσιο ανάγνωσης); 14. Ένα μόριο DNA του βακτηρίου E-coli αποτελείται από νουκλεοτίδια. Αν το μέσο μοριακό βάρος των αμινοξέων είναι 100, πόσες διαφορετικές πρωτεΐνες με ΜΒ μπορεί να κωδικοποιήσει το μόριο DNA (να αγνοηθούν οι υποκινητές και οι χειριστές); 15. Ένα μόριο DNA έχει νουκλεοτίδια. Πόσες περίπου πρωτεΐνες με ΜΒ μπορούν να κωδικοποιηθούν από το παραπάνω DNA, αν το μέσο ΜΒ κάθε αμινοξέος είναι 100 (να αγνοηθούν τα μόρια νερού). 16. Ένα ώριμο μόριο mrna αποτελείται από 100 νουκλεοτίδια. Ποιος είναι ο μέγιστος αριθμός των αμινοξέων της πολυπεπτιδικής αλυσίδας που αυτό κωδικοποιεί;

16 17. Πρωτεΐνη προκαρυωτικού οργανισμού έχει ΜΒ ενώ το μέσο ΜΒ των αμινοξέων της είναι 100. Να βρεθεί ο αριθμός των κωδικονίων και ο ελάχιστος αριθμός των νουκλεοτιδίων που κωδικοποιεί αυτή την πρωτεΐνη. 18. Η α-αλυσίδα της αιμοσφαιρίνης αποτελείται από 141 αμινοξέα με πρώτο την μεθειονίνη. Υπολογίστε από πόσα νουκλεοτίδια αποτελείται το γονίδιο που την κωδικοποιεί αν είναι γνωστό ότι στο πρόδρομο mrna το 40% των νουκλεοτιδίων του είναι εσώνια; 19. Το μόριο της αιμοσφαιρίνης Α του ανθρώπου αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες, δύο α, όμοιες μεταξύ τους με 141 αμινοξέα έκαστη και δύο β, όμοιες μεταξύ τους με 146 αμινοξέα η καθεμία. Θεωρώντας ότι όλες οι αλυσίδες έχουν πρώτο αμινοξύ την μεθειονίνη βρείτε: i. Πόσα είδη mrna είναι υπεύθυνα για την σύνθεση των τεσσάρων πολύπεπτιδικών αλυσίδων; ii. Από πόσες αζωτούχες βάσεις αποτελείται το ώριμο μόριο κάθε είδους mrnaτου ερωτήματος (i); 20. Το ώριμο mrna που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 630 νουκλεοτίδια. Οι 3,5 αμετάφραστες περιοχές αποτελούνται από συνολικά 12 νουκλεοτίδια. Αν η λειτουργική πρωτεΐνη που προκύπτει έχει 185 αμινοξέα να βρείτε πόσα αμινοξέα απομακρύνθηκαν από την πολυπεπτιδική αλυσίδα που σχηματίστηκε στα οργανίδια τροποποίησης των πρωτεϊνών; 21. Το 80% των νουκλεοτιδίων ενός πρόδρομου mrna είναι εσώνια. Το μόριο αυτό έχει συνολικά 560 νουκλεοτίδια, ενώ οι 3,5 αμετάφραστες περιοχές του έχουν 16 νουκλεοτίδια. Ποιος είναι ο μέγιστος αριθμός των αμινοξέων που θα έχει το πρωτεϊνικό μόριο που θα προκύψει από την μετάφραση του παραπάνω μορίου; 22. Το πρόδρομο mrna που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 730 νουκλεοτίδια. Οι 3,5 αμετάφραστες περιοχές αποτελούνται από συνολικά 12 νουκλεοτίδια. Αν η πολυπεπτιδική αλυσίδα (μη λειτουργική πρωτεΐνη) που προκύπτει έχει 205 αμινοξέα να βρείτε τον

17 αριθμό των νουκλεοτιδίων που ανήκουν στα εσώνια του γονιδίου; 23. Ένα μόριο πρόδρομου mrna έχει 522 νουκλεοτίδια ενώ η πρωτεΐνη που προέκυψε από την μετάφραση του έχει 138 αμινοξέα. Αν οι 3,5 αμετάφραστες περιοχές αποτελούνται από 6 νουκλεοτίδια καθεμία,ποιο το ποσοστό των εσωνίων του παραπάνω μορίου; 24. Μόριο mrna βακτηρίου αποτελείται από 640 νουκλεοτίδια και μεταφράζεται σε μία πολυπεπτιδική αλυσίδα. Πόσοι πεπτιδικοί δεσμοί σχηματίζονται και πόσα μόρια νερού απελευθερώνονται; 25. Ένα τμήμα DNA (γονίδιο) αποτελείται από 3600 νουκλεοτίδια. Να βρεθούν: i. Ο αριθμός των κωδικονίων του mrna που δημιουργείται από την μεταγραφή του γονιδίου αν το ανοιχτό πλαίσιο ανάγνωσης αποτελεί το 50% του συνολικού mrna που προκύπτει από την μεταγραφή. ii. Ο αριθμός των trna που θα χρησιμοποιηθούν κατά την μετάφραση του mrna. iii. Ο αριθμός των αμινοξέων που θα περιέχονται στην πολυπεπτιδική αλυσίδα. 26. Το τμήμα DNA που κωδικοποιεί την α-αλυσίδα της αιμοσφαιρίνης αποτελείται από 1128 νουκλεοτίδια. Αν το ανοιχτό πλαίσιο ανάγνωσης αποτελεί το 75% του συνολικού mrna,βρείτε πόσα αμινοξέα περιέχει η α-αλυσίδα. 27. Τμήμα αλυσίδας βακτηριακού DNA μεταγράφεται σε mrna το οποίο μεταφράζεται σε πρωτεΐνη. Έστω ότι κάποια αμινοξέα αυτής της πρωτεΐνης που μεταφέρονται από τα αντίστοιχα trna και συνδέονται στην πολυπεπτιδική αλυσίδα είναι: βαλίνη - βαλίνη - σερίνη, ιστιδίνη, και κωδικοποιούνται αντίστοιχα από τα εξής κωδικόνια: GUU, GUC,UCG, CAU. Ποια η ακολουθία των αζωτούχων βάσεων στο αντίστοιχο τμήμα της αλυσίδας του DNA; 28. Από μία πολυπεπτιδική αλυσίδα ενός βακτηρίου απομακρύνθηκαν 2 αμινοξέα από το αμινικό της άκρο,ώστε τελικά να έχει 100 αμινοξέα.πόσα νουκλεοτίδιαθα έχει το

18 τμήμα DNA που καθόρισε την αλληλουχία των αμινοξέων στην αρχική πολυπεπτιδική αλυσίδα; 29. Ένα μόριοβακτηριακού DNA αποτελείται από νουκλεοτίδια: i. Πόσα δεσόξυριβονουκλεοτίδια θα χρειαστούν για την αντιγραφή του; ii. Να ονομάσετε τα ένζυμα που θα πάρουν μέρος στην αντιγραφή του. iii. Αν το 5% του μήκους του κωδικοποιεί 50 όμοιες πολυπεπτιδικές αλυσίδες ποιος είναι ο αριθμός των αμινοξέων που απαιτούνται για την έκφραση των πληροφοριών του παραπάνω μορίου DNA; 30. Το κύριο κυκλικό μόριο DNA του βακτηρίου Ε-coli αποτελείται από ζεύγη βάσεων. Ένα βακτήριο Ε-coli αναπτύσεται σε περιβάλλον ραδιενεργού φωσφόρου (Ρ 32 ). Αν ο χρόνος διπλασιασμού είναι 20min,να εξηγήσετε μετά από 40min: i. Πόσα μόρια DNA σχηματίστηκαν; ii. Πόσα κανονικά και πόσα ραδιενεργά άτομα φωσφόρου περιέχονται στα μόρια DNA που σχηματίστηκαν; 31. Δίνεται ένας κλώνος DNA με την ακόλουθη αλληλουχία βάσεων: -ACC-CCA-TAC-CGT-TTT-TTT-TTT-ACT-CCG-AGT-CAT- Βρείτε το πλαίσιο ανάγνωσης του mrna που θα προκύψει από την μεταγραφή του παραπάνω τμήματος DNA. 32. Αν ένα τμήμα της κωδικής αλυσίδας ενός μορίου DNA περιέχει την ακόλουθη διαδοχή αζωτούχων βάσεων, να απαντήσετε στις ακόλουθες ερωτήσεις: -ATG-CCT-TTA-AAA-CGA-TCC-GTA-CAC-TCG-TGAi. Ποια είναι η κωδική αλυσίδα του DNA; ii. Ποιο είναι το τμήμα mrna που συντίθεται; iii. Ποια είναι τα αντικωδικόνια των trna που παίρνουν μέρος στη μετάφραση; iv. Το πρωτεϊνικό τμήμα που παράγεται από πόσα και ποια αμινοξέα αποτελείται; v. Ποιο είναι το σύνολο των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών σε αυτό το τμήμα DNA.

19 33. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων: 5 -TCA-CGG-AAT-TTC-TAG-CAT-3 i. Με δεδομένο ότι δεν μεσολαβεί στάδιο ωρίμανσης, να γράψετε το mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA σημειώνοντας ταυτόχρονα την θέση του 5 και 3 άκρου του mrna. ii. Να γραφούν τα αντικωδικόνια των trna με την σειρά με την οποία συμμετέχουν στην μετάφραση του παραπάνω mrna σημειώνοντας ταυτόχρονα την θέση του 5 και 3 άκρου κάθε trna. 34. Η αλληλουχία των αζωτούχων βάσεων ενός τμήματος γονιδίου είναι: 5 -AAATTTCTAATGCCTGCGCGACGGCATGAAAAATTT-3 Να βρείτε: i. Την αλληλουχία των βάσεων στην 2 η αλυσίδα DNA ii. Τα κωδικόνια του mrna iii. Τα αντικωδικόνια των trna με την σειρά που συμμετέχουν στην μετάφραση. iv. Τον αριθμό και το είδος των αμινοξέων του πεπτιδίου που προκύπτει από την μετάφραση. 35. Δίνεται η ακόλουθη αλληλουχία του 3 ου άκρου ενός μορίου mrna : UGGAUUCUCCCUACAAGGUAAGCGGAAU-3 Πόσα αμινοξέα κωδικοποιούνται από αυτό το τμήμα του mrna; Ποια είναι η ακολουθία των νουκλεοτιδίων στο γονίδιο που κωδικοποιεί αυτό το mrna; (θεωρήστε ότι δεν υπάρχουν εσώνια). 36. Δίνεται η ακόλουθη αλληλουχία του τμήματος ενός μορίου mrna : UUUCAGUUUACGUCCUCCUCGAACU i. Ποιο είναι το 3 και ποιο το 5 άκρο αυτού του τμήματος; ii. Το τμήμα αυτό αντιστοιχεί στην αρχή ή στο τέλος του μορίου; iii. Πόσα και ποια αμινοξέα θα προκύψουν από αυτό το τμήμα;

20 iv. Ποια είναι τα αντικωδικόνια αυτού του τμήματος; 37. Έστω ότι γνωρίζετε τον αριθμό των αμινοξέων ενός μορίου μιας ανθρώπινης πρωτεΐνης. Μπορείτε να βρείτε το μήκος του DNA που περιέχει τις πληροφορίες για την σύνθεση της; Αιτιολογήστε την απάντηση σας. 38. Υπολογίστε το πλήθος των πεντοζών και των αζωτούχων βάσεων στο μόριο του mrna που κατά την μετάφραση του δίνει πολυπεπτιδική αλυσίδα, η οποία στην πρόδρομη μορφή της έχει 155 αμινοξέα και στη λειτουργική μορφή της έχει 150 αμινοξέα. Πόσα μόρια mrna πήραν μέρος στην σύνθεση της αλυσίδας και πόσα μόρια νερού κέρδισε τελικά το κύτταρο; 39. Βακτηριακή πρωτεΐνη έχει 98 αμινοξέα. Αν το τμήμα DNA από το οποίο προέκυψε έχει 20% Α, βρείτε: i. τον αριθμό των νουκλεοτιδίων του τμήματος του DNA ii. τον αριθμό των φωσφοδιεστερικών δεσμών που υπάρχουν σ αυτό. iii. Τον αριθμό των δεσμών υδρογόνου αυτού του τμήματος. 40. Δίνεται η παρακάτω αλληλουχία βάσεων σε ένα κλώνο DNA: -AAG-TAG-GGC-TAC-GGC-AGC-GCG-TCC-CAC-ATC-TTTi. Να γραφεί ο συμπληρωματικός κλώνος και να υπολογιστεί ο αριθμός των δεσμών υδρογόνου. ii. Αφού εντοπιστεί η κωδική και η μεταγραφόμενη αλυσίδα να γραφεί η ακολουθία των βάσεων του mrna που προκύπτει κατά την μεταγραφή. iii. Αν δεν υπάρχουν εσώνια να γραφεί το πεπτίδιο που θα προκύψει από την μετάφραση του παραπάνω mrna. 41. Δίνονται οι αλληλουχίες βάσεων ενός μορίου DNA και ενός μορίου RNA: Τι παρατηρείτε; DNA : TATGTTGG ATACTACC RNA : UAUGAUGG 42. Αν υποθέσουμε ότι ένας αρχέγονος οργανισμός που ανακαλύπτεται στον Άρη, βρέθηκε να έχει ένα παρόμοιο γενετικό σύστημα με το δικό μας, δηλαδή το γενετικό του υλικό είναι δίκλωνο DNA, αποτελείται από 5 διαφορετικά

21 είδη νουκλεοτιδίων και οι πρωτεΐνες του δομούνται από 19 διαφορετικά αμινοξέα, να βρείτε: i. Την φύση του γενετικού του κώδικα (είδος και αριθμό κωδικονίων) ii. Αν υπάρχει ένα κωδικόνιο έναρξης και ένα κωδικόνιο λήξης τα οποία δεν κωδικοποιούν αμινοξέα πόσο εκφυλισμένος είναι αυτός; iii. Αν ο οργανισμός παράγει 100 διαφορετικές πρωτεΐνες,που καθεμία περιέχει 10 αμινοξέα, ποιος θα πρέπει να είναι ο μικρότερος αριθμός νουκλεοτιδίων που βρίσκονται στο γενετικό του υλικό; 43. Σε ένα ώριμο μόριο mrna η περιοχή του που καθορίζει την αλληλουχία των αμινοξέων στην πολυπεπτιδική αλυσίδα περιλαμβάνει 2999 φωσφοδιεστερικούς δεσμούς. i. Από πόσα κωδικόνια αποτελείται η παραπάνω περιοχή του mrna; ii. Πόσα αμινοξέα θα έχει η πολυπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του παραπάνω μορίου; 44. Μόρια νουκλεϊνικών οξέων έχουν απομονωθεί από επτά τύπους ιών. Η σύσταση των βάσεων των μορίων αυτών δίνεται από τον πίνακα : ΒΑΣΕΙΣ ΙΟΣ 1 ΙΟΣ2 ΙΟΣ3 ΙΟΣ4 ΙΟΣ5 ΙΟΣ6 ΙΟΣ7 Α Τ G C U Να αναγνωρίσετε τον τύπο του νουκλεϊνικού οξέος σε καθένα από τους 7 τύπους ιών και να αποφανθείτε κατά πόσο μπορούμε να γνωρίζουμε αν αυτό είναι μονόκλωνο ή δίκλωνο. 45. Δίνεται το παρακάτω τμήμα ώριμου mrna : 5 - AUGGUGCACCAGAGUCCUGAGGAGAAGUAA-3 Να βρείτε:

22 i. Την αλληλουχία των βάσεων του δίκλωνου DNA από το οποίο μεταγράφηκε. ii. Τα αντικωδικόνια που αντιστοιχούν στα παραπάνω κωδικόνια. iii. Τα ποσοστά των βάσεων της μεταγραφόμενης αλυσίδας του DNA. iv. Ποσοστά των βάσεων στο κάθε θυγατρικό μόριο που θα προκύψει από την αντιγραφή του παραπάνω μορίου DNA. 46. Αν το μέσο μήκος ενός γονιδίου είναι 2000 ζεύγη βάσεων βρείτε το σύνολο των γονιδίων που υπάρχουν σε ένα ανθρώπινο σωματικό κύτταρο. 47. Το γονίδιο του κολλαγόνου του ανθρώπου έχει 50 εσώνια. Κατά την διαδικασία ωρίμανσης του πρόδρομου mrna το κύτταρο κέρδισε ή έχασε μόρια νερού και πόσα; 48. Βακτηριακό mrna που έχει 2999 φωσφοδιεστερικούς δεσμούς κατευθύνει την σύνθεση πολυπεπτιδικής αλυσίδας που αποτελείται από 989 αμινοξέα. Ποιος είναι ο αριθμός των νουκλεοτιδίων που αντιστοιχούν στις 3,5 αμετάφραστες περιοχές του παραπάνω μορίου; 49. Η αλληλουχία των αμινοξέων μιας πρωτεΐνης δύο διαφορετικών οργανισμών που επιτελεί την ίδια λειτουργία και στους δύο οργανισμούς βρέθηκε όμοια κατά 80%. Όμως τα αντίστοιχα γονίδια των οργανισμών βρέθηκε να έχουν ομοιότητα κατά 40%. Πώς μπορεί να εξηγηθεί αυτή η διαφορά; 50. Το DNA ενός πλασμιδίου έχει 1, φωσφοδιεστερικούς δεσμούς. Πόσες πρωτεΐνες με μέσο μοριακό βάρος θα μπορούσαν να κωδικοποιηθούν από αυτό αν το μέσο μοριακό βάρος των αμινοξέων είναι 100; 51. Το μοριακό βάρος του DNA του βακτηρίου Ε-coli είναι Ποιος είναι ο συνολικός αριθμός των γονιδίων στο μόριο. Δίνεται ότι το μέσο μοριακό βάρος ενός ζεύγους νουκλεοτιδίων είναι 660 και ότι κάθε γονίδιο φέρει την πληροφορία για τον σχηματισμό της ίδιας πρωτεΐνης και ότι όλες οι πρωτεΐνες αποτελούνται από 400 αμινοξέα. 52. Δίνεται η κωδική αλυσίδα του DNA ενός γονιδίου:

23 ATGCCTCATCGTTGT AGTGGTGATGCTGTTTGA i. Να γράψετε την αλληλουχία των βάσεων του πρόδρομου mrna. ii. Αν το λειτουργικό πεπτίδιο που σχηματίστηκε από την μετάφραση του ώριμου mrna ήταν:προλίνη-ιστιδίνηαργινίνη-ασπαρτικό οξύ-αλανίνη-βαλίνη, να βρείτε την αλληλουχία των βάσεων του εσωνίου που βρίσκεται στο γονίδιο. iii. Να γράψετε την αλληλουχία των βάσεων του ώριμου mrna. iv. Πόσοι φωσφοδιεστερικοί δεσμοί δημιουργούνται κατά την συρραφή των εξωνίων; v. Ποια μακρομόρια παίρνουν μέρος στην ωρίμανση του πρόδρομου mrna; ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ A. Οι περιοριστικές ενδονουκλεάσες είναι ένζυμα που αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA, μήκους 4-8 νουκλεοτιδίων. B. Η περιοριστική ενδονουκλεάση EcoRI, η οποία όποτε συναντά την αλληλουχία : G AATTC CTTAA G στο γονιδίωμα,κόβει κάθε αλυσίδα μεταξύ G και Α, οπότε κάθε φορά σπάζουν 2 φωσφοδιεστερικοί δεσμοί και 8 δεσμοί υδρογόνου. C. Η παραπάνω αλληλουχία που αναγνωρίζεται από την EcoRI συναντάται μια φορά στα πλασμίδια.

24 D. Με την μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης (PCR) μπορούμε να αντιγράψουμε επιλεκτικά,εκατομμύρια φορές ειδικές αλληλουχίες DNA από ένα σύνθετο μείγμα μορίων DNA,χωρίς την μεσολάβηση ζωντανού κυττάρου δηλαδή χωρίς κλωνοποίηση. E. Η παραγωγή των αντιγράφων τμήματος DNA στο εργαστήριο με την μέθοδο PCR πραγματοποιείται με ρυθμό γεωμετρικής προόδου. F. Η τεχνολογία του ανασυνδυασμένου DNA βασίζεται στο ότι:! Ο γενετικός κώδικας είναι καθολικός, οπότε τα γονίδια από άλλους οργανισμούς μπορούν να εκφράζονται σε βακτήρια.! Τα βακτήρια μπορούν να αναπαράγονται πολύ γρήγορα, επομένως τα γονίδια που περιέχουν αντιγράφονται πολλές φορές σε μικρό χρονικό διάστημα.

25 ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ 1. Σε ένα κύτταρο Ecoli συμβαίνει μια γονιδιακή μετάλλαξη. Στα δύο θυγατρικά κύτταρα δεν εμφανίζεται καμία φαινοτυπική αλλαγή. Από τα τέσσερα θυγατρικά κύτταρα που αναπτύσσονται σε διαφορετικό περιβάλλον, ένα εμφανίζει νέο φαινοτυπικό γνώρισμα. Εξηγήστε τι μπορεί να συνέβη. 2. Το ένζυμο EcoRI κόβει μικρό γραμμικό δίκλωνο DNA σε δύο τμήματα το Α και το Β. Το Α αποτελείται από 212 νουκλεοτίδια, 40 από τα οποία περιέχουν την αζωτούχο βάση αδενίνη. i. Ποιος είναι ο αριθμός των άλλων αζωτούχων βάσεων του τμήματος Α; ii. Ποιος είναι ο αριθμός των φωσφοδιεστερικών δεσμών που υπάρχουν στο τμήμα Α; iii. Πόσοι δεσμοί υδρογόνου συγκρατούν μεταξύ τους τις συμπληρωματικές αλυσίδες του Α; iv. Ποιος είναι ο αριθμός των αζωτούχων βάσεων κάθε είδους του τμήματος Β, αν το αρχικό μόριο DNA περιέχει 400 φωσφοδιεστερικούς δεσμούς και 85 αδενίνες; 3. Έστω ότι σε ένα γραμμικό μόριο DNA που έχει μήκος 16Kb (1Kb = 1000 βάσεις) επιδρούμε με την περιοριστική ενδονουκλεάση Α και δημιουργούνται δύο τμήματα μήκους 10 και 6Kb αντίστοιχα. Εάν επιδράσουμε με την ενδονουκλεάση Β, τα τμήματα που δημιουργούνται είναι τρία 9,4 και 3Kb. Σε πόσα τμήματα θα χωριστεί το DNA αν επιδράσουμε και με τις δύο ενδονουκλεάσες μαζί; 4. Ένα πλασμίδιο περιέχει γονίδια που το καθιστούν ανθεκτικό στα αντιβιοτικά αμπικιλλίνη και τετρακυκλίνη. Επιδρούμε με την περιοριστική ενδονουκλεάση EcoRI στη θέση του γονιδίου ανθεκτικότητας της αμπικιλλίνης και στο τμήμα αυτό εισάγουμε DNA δροσόφιλας. Το ανασυνδυασμένο DNA μετασχηματίζει κύτταρα Ecoli. Ποιο αντιβιοτικό θα πρέπει να προσθέσουμε στην καλλιέργεια ώστε να επιλέξουμε κύτταρα που έχουν ενσωματώσει το ανασυνδυασμένο πλασμίδιο; Δικαιολογήστε την απάντηση σας. 5. Με την δράση της EcoRI ένα μόριο DNA από ευκαρυωτικό κύτταρο κόπηκε σε 5 κομμάτια. i. Σε πόσα σημεία κόπηκε το μόριο; ii. Πόσων δεσμών την διάσπαση προκάλεσε η EcoRI; iii. Πόσα κατάλληλα πλασμίδια χρειάζονται για την κατασκευή <<βιβλιοθήκης >> του συγκεκριμένου μορίου DNA; iv. Πόσων δεσμών την διάσπαση θα προκαλέσει η EcoRI στα πλασμίδια αυτά; 6. Σε ένα πείραμα PCR επιχειρείται η κατασκευή τουλάχιστον 30 αντιγράφων ενός αρχικού κομματιού από DNA. Το κομμάτι αυτό αποτελείται από νουκλεοτίδια και η αντιγραφή του διαρκεί 2 ώρες. i. Μετά από πόσο χρόνο θα έχουμε τον επιθυμητό αριθμό αντιγράφων;

26 ii. Πόσα νουκλεοτίδια θα υπάρχουν τελικά στα αντίγραφα και πόσα χρειάστηκαν; iii. Πόσοι κλώνοι συντέθηκαν;

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΔΙΑΓΩΝΙΣΜΑ ΣΤΟ 1 ο ΚΕΦΑΛΑΙΟ 12-9-2015 ΘΕΜΑ Α Α1. α. in vitro β. in vivo γ. in vitro δ. in vitro Α2. γ Μεταξύ των δύο δεοξυριβονουκλεοτιδίων έχουμε συμπληρωματικότητα (Α=Τ)

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 1 ΚΕΦΑΛΑΙΟ 1 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας

4 DNA ελικάση Δ Περιέχουν πανομοιότυπο DNA. 6 Πριμόσωμα ΣΤ Σταθερότητα κατά μήκος της κάθε πολυνουκλεοτιδικής αλυσίδας Θέμα 1 ο 1. Αντιστοιχείστε όλες τις έννοιες της στήλης 1 με όλες τις φράσεις της στήλης 2 (Οι αντιστοιχίσεις να γραφούν στην κόλλα απαντήσεων σας & όχι στη φωτοτυπία των θεμάτων) 1 2 1 Αδελφές χρωματίδες

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 22/09/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Το ζεύγος των φυλετικών

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β )

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΗΜΕΡΟΜΗΝΙΑ: 18 / 05 / 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΧΕΙΡΕΣ ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση:

KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: KΕΦΑΛΑΙΟ 1: Το Γενετικό Υλικό Α. ΕΡΩΤΗΣΕΙΣ ΚΛΕΙΣΤΟΥ ΤΥΠΟΥ Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συµπληρώνει σωστά την πρόταση: 1. Η ποσότητα του DNA α. είναι ίδια

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ.

1 ο #Κεφάλαιο# 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. 1 ο #Κεφάλαιο# ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ 1)#Πειράματα: α)$να#περιγράψεις#το#πείραμα#των#hershey#και#chase.# Υπόδειξη:#σελ#14#σχολ. Παραλλαγή:#δίνονται##τα#παρακάτω#διαγράμματα#που#απεικονίζουν# τη#ραδιενέργεια#στο#εσωτερικό#των#βακτηρίων,#μετά#τη#μόλυνση#με#

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 21/09/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Για το γονιδίωμα της γάτας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3

5. Η EcoRI. I. Παράγεται από το βακτήριο E. coli II. Κόβει δίκλωνο DNA μεταξύ G και A όταν συναντήσει την αλληλουχία 3 GAATTC 5 5 CTTAAG 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ζήτημα 1ο 1. Το βακτήριο Agrobacterium tumefaciens I. Παρασιτεί σε ζωικά κύτταρα II. Μετασχηματίζεται με τη μεσολάβηση του πλασμιδίου Ti III. Μολύνει φυτικά και ζωικά κύτταρα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις

Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω απαντήσεις συμπληρώνει σωστά τις ακόλουθες φράσεις ή προτάσεις ΦΡΟΝΤΙΣΤΗΡΙΑΚΟΣ ΟΡΓΑΝΙΣΜΟΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΓΙΑ ΤΑ ΤΜΗΜΑΤΑ ΠΓΘΤ, ΓΘΤ, ΠαΘΤ Θέμα Α Να σημειώσετε στο τετράδιό σας ποια από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α Α1. β Α2. γ Α3. γ Α4. α Α5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 15 ΣΕΠΤΕΜΒΡΙΟΥ 2010 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµίας από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Μονάδες 5 Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ Ω Ν Π Α Ν Ε Λ Λ Α Ι Κ Ω Ν Ε Ξ Ε Τ Α Σ Ε Ω Ν 2 0 1 4 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 04.06.2014 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β

Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΕΚΑ (10) Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ

ÖÑÏÍÔÉÓÔÇÑÉÏ ÈÅÙÑÇÔÉÊÏ ÊÅÍÔÑÏ ÁÈÇÍÁÓ - ÐÁÔÇÓÉÁ ΘΕΜΑ 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2009 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα