ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ"

Transcript

1 ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου 10. Δεοξυριβονουκλεοτίδιο 11. Διπλή έλικα 12. Διπλοειδές κύτταρο 13. Διπλοειδής οργανισμός 14. Ινίδιο χρωματίνης 15. Ιστόνες 16. Ιχνηθέτηση 17. Καλλιέργια 18. Καρυότυπος 19. Μεσόφαση 20. Μετασχηματισμός 21. Μεταφασικό χρωμόσωμα 22. Μη ιστόνες 23. Μιτωγόνος ουσία 24. Μίτωση 25. Νουκλεόσωμα 26. Νουκλεοτίδιο 27. Ομόλογα χρωμοσώματα 28. Πλασμίδια 29. Ριβονουκλεοτίδιο 30. Στέλεχος 31. Φάγος ή βακτηριοφάγος 32. Φυλετικά χρωμοσώματα 33. Φωσφοδιεστερικός δεσμός

2 ΟΡΟΛΟΓΙΑ 2 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. Αγγελιοφόρο RNA 2. DNA πολυμεράσες 3. DNA δεσμάση 4. DNA ελικάσες 5. RNA πολυμεράση 6. Αλληλουχίες λήξης της μεταγραφής 7. Αμετάφραστες περιοχές 8. Ανοιχτό πλαίσιο ανάγνωσης 9. Αντιγραφή 10. Αντικωδικόνιο 11. Αντίστροφη μεταγραφάση 12. Αντίστροφη μεταγραφή 13. Ασυνεχής αντιγραφή 14. Γενετικός κώδικας 15. Γενετικός κώδικας 16. Γονιδιακή έκφραση 17. Γονιδιακή ρύθμιση 18. Γονίδιο 19. Εκφυλισμένος γενετικός κώδικας 20. Έναρξη 21. Εξώνια 22. Επαγωγέας 23. Επιδιορθωτικά ένζυμα 24. Επιμήκυνση 25. Εσώνια 26. Ημισυντηρητικός μηχανισμός 27. Θέσεις έναρξης αντιγραφής 28. Καταστολέας 29. Κεντρικό δόγμα της βιολογίας 30. Κυτταρική διαφοροποίηση

3 31. Κωδική αλυσίδα 32. Κωδικόνιο 33. Κωδικόνιο έναρξης 34. Κωδικόνιο λήξης 35. Λήξη 36. Μεταγραφή 37. Μεταγραφικοί παράγοντες 38. Μεταγραφόμενη ή μη κωδική αλυσίδα 39. Μεταφορικό RNA 40. Μετάφραση 41. Μη επικαλυπτόμενος γενετικός κώδικας 42. Μικρό πυρηνικό RNA 43. Οπερόνιο 44. Πλαίσιο ανάγνωσης 45. Πολύσωμα 46. Πριμόσωμα 47. Πρόδρομο mrna 48. Πρωταρχικά τμήματα 49. Ριβοσώματα 50. Ριβοσωμικό RNΑ 51. Ρυθμιστικό γονίδιο 52. Σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης 53. Συνεχής αντιγραφή 54. Συνεχής γενετικός κώδικας 55. Συνώνυμα κωδικόνια 56. Σχεδόν καθολικός γενετικός κώδικας 57. Τριαδικός γενετικός κώδικας 58. Υποκινητής 59. Χειριστής 60. Ωρίμανση mrna 61. Ώριμο mrna

4 ΟΡΟΛΟΓΙΑ 4 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. cdna βιβλιοθήκη 2. Ecoli 3. EcoRI 4. Αλυσιδωτή αντίδραση πολυμεράσης 5. Ανασυνδυασμένο DNA 6. Ανιχνευτής 7. Αποδιάταξη DNA 8. Γενετική μηχανική 9. Γονιδιωματική βιβλιοθήκη 10. Κλωνοποίηση 11. Κλώνος 12. Κύτταρο ξενιστής 13. Μετασχηματισμός 14. Περιοριστικές ενδονουκλεάσες 15. Τεχνητά ανασυνδυασμένο DNA 16. Υβρίδιο 17. Υβριδοποίηση 18. Φορέας κλωνοποίησης ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ Στο δίκλωνο DNA η αζωτούχος βάση Α είναι συμπληρωματική της Τ και η αζωτούχος βάση G είναι συμπληρωματική της C. Μεταξύ Α-Τ σχηματίζονται δύο δεσμοί υδρογόνου ενώ μεταξύ G C σχηματίζονται τρεις δεσμοί υδρογόνου. Ο δεσμός που συνδέει Τα νουκλεοτίδια στα νουκλεϊκά οξέα είναι ο 3-5 φωσφοδιεστερικός δεσμός. Ο δεσμός που συνδέει τα αμινοξέα μιας πρωτεΐνης είναι ο πεπτιδικός δεσμός. Για να διαπιστώσουμε αν δύο οργανισμοί ανήκουν στο ίδιο είδος συγκρίνουμε τους λόγους (Α+Τ)/(G+C).

5 Το νουκλεόσωμα αποτελείται από DNA μήκους 146 ζευγών βάσεων και από οκτώ μόρια πρωτεϊνών που ονομάζονται ιστόνες. Το μήκος του τμήματος που συνδέει τα νουκλεοσώματα δίνεται (34 ζεύγη βάσεων στον άνθρωπο). Όταν μια άσκηση αναφέρεται σε τμήμα DNA κυττάρου π.χ. γονίδιο τότε λύνουμε την άσκηση λαμβάνοντας υπόψη ότι το τμήμα του DNA είναι δίκλωνο και γραμμικό ενώ αν δεν αναφέρεται σε κύτταρο παίρνουμε και δεύτερη περίπτωση που ισχύει σε ορισμένους ιούς, το DNA να είναι μονόκλωνο και γραμμικό. Όταν μια άσκηση αναφέρεται σε μόριο DNA κυττάρου τότε λύνουμε την άσκηση διακρίνοντας δύο περιπτώσεις : α) το μόριο να είναι δίκλωνο και γραμμικό β) το μόριο να είναι δίκλωνο και κυκλικό Γραμμικό μόριο DNA υπάρχει στον πυρήνα ευκαρυωτικών κυττάρων,στα μιτοχόνδρια κατώτερων πρωτόζωων και σε ορισμένους ιούς. Κυκλικό μόριο DNA υπάρχει στα μιτοχόνδρια και τους χλωροπλάστες ευκαρυωτικών κυττάρων, στα προκαρυωτικά κύτταρα και σε ορισμένους ιούς. Αν η άσκηση δεν αναφέρεται σε κύτταρο τότε παίρνουμε 4 περιπτώσεις: α) το μόριο να είναι δίκλωνο και γραμμικό. β) το μόριο να είναι δίκλωνο και κυκλικό. γ) το μόριο να είναι μονόκλωνο και γραμμικό. δ) το μόριο να είναι μονόκλωνο και κυκλικό. Όταν μια άσκηση μας δίνει αριθμό φωσφοδιεστερικών δεσμών και δεσμών υδρογόνου, τμήματος ή μορίου DNA, λύνουμε την άσκηση με σύστημα υποθέτοντας ότι είναι x τα ζεύγη Α-Τ και ψ τα ζεύγη G-C. Ο σχηματισμός ενός φωσφοδιεστερικού ή ενός πεπτιδικού δεσμού συνοδεύεται από αποβολή ενός μορίου νερού και αντίστροφα. Τα απλοειδή κύτταρα έχουν γενετικό υλικό μήκους ζεύγη βάσεων. Τα διπλοειδή κύτταρα έχουν γενετικό υλικό μήκους ζεύγη βάσεων. Ο αριθμός των ατόμων φωσφόρου είναι ίσος με τον αριθμό των νουκλεοτιδίων Ο αριθμός των ριβοζών ή των δεοξυριβοζών είναι ίσος με τον αριθμό των νουκλεοτιδίων Κάθε ριβόζη ή δεοξυριβοζή είναι πεντόζη έχει δηλαδή 5 άτομα άνθρακα.

6 ΑΣΚΗΣΕΙΣ 1. Σε δύο κύτταρα έγινε ανάλυση γενετικού υλικού και βρέθηκε η ακόλουθη επί τις εκατό σύσταση σε αζωτούχες βάσεις : Α Τ G C Κύτταρο Κύτταρο Να αιτιολογήσετε αν τα κύτταρα ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών. 2. Αν στην μία αλυσίδα ενός τμήματος DNA ο λόγος (Α+Τ)/(G+C) =0,125, να υπολογιστεί ο αντίστοιχος λόγος στη συμπληρωματική αλυσίδα. 3. Ένα ινίδιο χρωματίνης έχει στην αρχή της μεσόφασης του κυττάρου 400 νουκλεοσώματα. Να βρείτε : i. Πόσα νουκλεοσώματα, ii. Πόσες αζωτούχες βάσεις και iii. Πόσα μόρια ιστονών Θα υπάρχουν μετά την αντιγραφή του DNA κατά την μεσόφαση. 4. Ένα τμήμα DNA έχει 10 φωσφοδιεστερικούς και 15 δεσμούς υδρογόνου. Πόσες Α, Τ, G και C περιέχει; 5. Ένα πλασμίδιο έχει νουκλεοτίδια. Πόσοι είναι οι φωσφοδιεστερικοί δεσμοί του μορίου; 6. Ένα μόριο DNA έχει φωσφοδιεστερικούς δεσμούς. Ποίος είναι ο αριθμός των νουκλεοτιδίων του μορίου; 7. Ο λόγος (Α+Τ)/(G+C) σε ένα μόριο DNA είναι ¾ και το σύνολο των δεσμών υδρογόνου είναι Να βρείτε τον αριθμό των νουκλεοτιδίων για κάθε μια αζωτούχο βάση. 8. Ένα μόριο DNA κυττάρου υπολογίστηκε ότι περιέχει αζωτούχες βάσεις. Το 30% των βάσεων είναι G. Βρείτε : i. το ποσοστό των υπολοίπων βάσεων ii. τον αριθμό των δεσμών υδρογόνου που υπάρχουν στο μόριο 9. Ένα μόριο DNA κυττάρου περιέχει ζεύγη νουκλεοτιδίων. Αν τα 500 νουκλεοτίδια περιέχουν Α, να βρείτε:

7 i. Τον αριθμό των υπολοίπων βάσεων ii. Τον αριθμό των φωσφοδιεστερικών δεσμών iii. Τον αριθμό των δεσμών υδρογόνου. 10. Ένα μόριο DNA έχει μήκος nm. Αν σε κάθε βήμα της διπλής έλικας του υπάρχουν 10 ζεύγη βάσεων με μήκος 3,4 nm και το 15% των αζωτούχων βάσεων είναι Α,να βρείτε : i. τον αριθμό των νουκλεοτιδίων του μορίου ii. τον αριθμό των δεσμών υδρογόνου που υπάρχουν σε αυτό 11. Ένα μόριο DNA ευκαρυωτικού κυττάρου έχει φωσφοδιεστερικούς δεσμούς και δεσμούς υδρογόνου. Ποιος είναι ο αριθμός των νουκλεοτιδίων για κάθε μια αζωτούχο βάση; 12. Ποιο είναι το μέσο μήκος, σε ζεύγη αζωτούχων βάσεων, ενός χρωμοσώματος στο γαμέτη του ανθρώπου; 13. Δύο μόρια DNA έχουν 30% G. i. θα έχουν το ίδιο μήκος; ii. θα έχουν τον ίδιο αριθμό δεσμών υδρογόνου; 14. Έστω ένα κύτταρο με 10 χρωμοσώματα. Πόσα χρωμοσώματα και πόσα μόρια DNA θα έχει ένα θυγατρικό του κύτταρο μετά από την κυτταρική διαίρεση (αρχή της μεσόφασης); 15. Κατά τον σχηματισμό ενός πλασμιδίου αφαιρούνται μόρια νερού και σχηματίζονται δεσμοί υδρογόνου. Να βρεθεί ο αριθμός των διαφορετικών νουκλεοτιδίων που περιέχει. 16. Μιτοχονδριακό DNA του ανθρώπου περιέχει ζεύγη βάσεων. Αν ισχύει A/C = 1/3, να βρεθεί: α) ο ακριβής αριθμός των αζωτούχων βάσεων και β) τα μόρια του νερού που αποσπάστηκαν κατά την δημιουργία του μορίου. 17. Μεσοφασικό ανθρώπινο χρωμόσωμα έχει ζεύγη βάσεων. Αν το κομμάτι του DNA μεταξύ δύο διαδοχικών νουκλεοσωμάτων έχει μήκος 34 ζεύγη βάσεών να βρεθεί ο αριθμός των μορίων των ιστονών που υπάρχουν στο παραπάνω χρωμόσωμα. Να θεωρήσετε ότι στα άκρα του χρωμοσώματος βρίσκονται νουκλεοσώματα και ότι κάθε νουκλεόσωμα αποτελείται από 146 ζεύγη βάσεών. 18. Κυκλικό δίκλωνο μόριο DNA περιέχει φωσφοδιεστερικούς δεσμούς και δεσμούς υδρογόνου.

8 Ποιο είναι το ποσοστό (%) καθεμιάς από τις τέσσερις αζωτούχες βάσεις στο μόριο; 19. Ένα τμήμα μορίου DNA έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Ποιος είναι ο ακριβής αριθμός κάθε αζωτούχου βάσης; 20. Αν ο λόγος A+G/T+C στην μια αλυσίδα του DNA είναι 7/10 πόσος είναι ο ίδιος λόγος α) στην συμπληρωματική της και β) στο μόριο; 21. Αν ο λόγος A+τ/G+C στην μια αλυσίδα του DNA είναι 7/10 πόσος είναι ο ίδιος λόγος α) στην συμπληρωματική της και β) στο μόριο; 22. Τμήμα DNA αποτελούμενο από 200 ζεύγη βάσεων περιέχει 110 βάσεις Τ. Ποιος ο αριθμός και το ποσοστό (%) των υπολοίπων βάσεων; 23. Στο DNA ενός νουκλεοσώματος η διαφορά αδενίνης και κυτοσίνης είναι 80. Ποιος ο αριθμός των υπολοίπων βάσεων; 24. Μόριο DNA αποτελείται από νουκλεοτίδια. Το ποσοστό των αζωτούχων βάσεων στην μία αλυσίδα είναι Α:15%, Τ:25%, G:40% και C:20%. Να βρεθεί ο αριθμός των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών που υπάρχουν στο μόριο. 25. Τμήμα DNA περιέχει 80 ζεύγη βάσεων και ο αριθμός των δεσμών υδρογόνου στο μόριο είναι 190. Να βρεθούν: α) τα ποσοστά(%) των αζωτούχων βάσεων του τμήματος, β)ο αριθμός των φωσφοδιεστερικών δεσμών, γ)το πλήθος των μορίων του νερού που απαιτούνται για την υδρόλυση του παραπάνω τμήματος; 26. Μια πλήρης στροφή της έλικας του DNA έχει μήκος 3,4nm και περιέχει 10 ζεύγη βάσεων. Αν ένα τμήμα DNA έχει μήκος 13600nm και το 30% των βασεών του είναι αδενίνη, να βρεθεί ο αριθμός α) όλων των βάσεων, β) των δεσμών υδρογόνου και γ) των φωσφοδιεστερικών δεσμών. 27. Το συνολικό DNA μιας μύγας έχει 1, ζεύγη βάσεων. Από πόσα περίπου νουκλεοσώματα αποτελείται και με πόσα περίπου μόρια ιστονών πακετάρονται αυτά αν είναι γνωστό ότι: α) το DNA είναι ενιαίο μόριο, β)στα άκρα του βρίσκονται

9 νουκλεοσώμτα, γ)κάθε νουκλεόσωμα αποταλείται από 146 ζεύγη βάσεων και δ) το DNA που ενώνει δύο διαδοχικά νουκλεοσώματα έχει μήκος 54 ζεύγη βάσεων. 28. Βακτηριακό DNA αποτελείται από 800 ζεύγη νουκλεοτιδίων,περιέχει θυμίνη σε ποσοστό 12% του συνόλου των βάσεων και η απόσταση μεταξύ δύο διαδοχικών νουκλεοτιδίων είναι 0,4`nm.Να βρεθούν : α) το ποσοστό και ο αριθμός των υπολοίπων βάσεων, β) το πλήθος των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών, γ)ο αριθμός των ατόμων φωσφόρου, δ) ο αριθμός των δεσοξυριβοζών και ο αριθμός των ατόμων άνθρακα, ε)το μήκος του μορίου και στ) το μήκος της διπλής έλικας αν το βήμα της είναι 3,4nm και αποτελείται από 16 ζεύγη νουκλεοτιδίων. 29. Το μοριακό βάρος του DNA ενός διπλοειδούς κυττάρου είναι ,το μέσο μοριακό βάρος των νουκλεοτιδίων του είναι 300 και η απόσταση δύο διαδοχικών νουκλεοτιδίων 0,34nm.Να βρεθούν : α) ο αριθμός των δεοξυριβονουκλεοτιδίων και β)το συνολικό μήκος του μορίου. 30. Σε ένα δίκλωνο μόριο DNA βρέθηκε ότι η κυτοσίνη αποτελείτο 17% των αζωτούχων βάσεων του. Ποιο είναι το ποσοστό των υπολοίπων βάσεων στο μόριο του DNA; Πόσοι δεσμοί υδρογόνου αναπτύσσονται στο μόριο του δίκλωνου DNA, αν αποτελείται από νουκλεοτίδια; 31. Σε ένα δίκλωνο μόριο DNA βρέθηκε ότι η γουανίνη (G) αποτελείτο 21% των αζωτούχων βάσεων του. Σε ποιες αναλογίες (%) θα βρίσκεται η καθεμιά από τις υπόλοιπες αζωτούχες βάσεις του; Πόσα μόρια νερού χρειάζονται για την υδρόλυση ενός δίκλωνου μορίου DNA, αν αποτελείται από 7000 νουκλεοτίδια; Πόσες διαφορετικές πολυνουκλεοτιδικές αλυσίδες είναι δυνατόν να προκύψουν από τη μια αλυσίδα του παραπάνω μορίου του DNA; 32. Ένα δίκλωνο μόριο DNA περιέχει φωσφοδιεστερικούς δεσμούς. Αν είναι γνωστό ότι το ποσοστό των νουκλεοτιδίων

10 που έχουν ως βάση τη θυμίνη είναι 15%, να υπολογίσετε το ποσοστό των υπολοίπων βάσεων, καθώς και τον αριθμό τους στο μόριο του DNA. 33. H μία αλυσίδα ενός τμήματος δίκλωνου μορίου DNA έχει την παρακάτω αλληλουχία: GGCGTTAAGATCAGTACCTGCTAATGCATCGATAATTCCGATCGTAC TGA Να βρείτε τη συμπληρωματική της, καθώς και τον αριθμό των υδρογονοδεσμών που αναπτύσσονται ανάμεσα στις δύο αυτές συμπληρωματικές αλυσίδες. 34. Στο δίκλωνο μόριο του DNA να συμπληρώσετε τα κενά και να υπολογισθούν οι δεσμοί υδρογόνου, καθώς και οι φωσφοδιεστερικοί δεσμοί που αναπτύσσονται. GTAGCTACGTTGTGATAATCT ATGCAG GCC ΤΑΑ ΑΤΑGΤΑGΑΤΑΑ ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ a) Κεντρικό δόγμα της Βιολογίας: ΜΕΤΑΓΡΑΦΗ DNA RNA ΠΡΩΤΕΪΝΕΣ ΑΝΤΙΓΡΑΦΗ ΑΝΤΙΣΤΡΟΦΗ ΜΕΤΑΓΡΑΦΗ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ b) Τα γονίδια των ευκαρυωτικών κυττάρων περιέχουν εσώνια και εξώνια, οπότε μετά την μεταγραφή προκύπτει το πρόδρομο mrna. Αντίθετα, τα γονίδια των προκαρυωτικών κυττάρων έχουν μόνο εξώνια.

11 c) Το mrna είναι συμπληρωματικό της μη κωδικής (μεταγραφόμενης) αλυσίδας του γονιδίου (του DNA). d) Κατά την μεταγραφή απέναντι από το νουκλεοτίδιο με Α τοποθετείται νουκλεοτίδιο με U, απέναντι από το νουκλεοτίδιο με T τοποθετείται νουκλεοτίδιο με A, απέναντι από το νουκλεοτίδιο με G τοποθετείται νουκλεοτίδιο με C και απέναντι από το νουκλεοτίδιο με C τοποθετείται νουκλεοτίδιο με G. e) Το ώριμο mrna εκτός από το ανοιχτό πλαίσιο ανάγνωσης, περιέχει τις 3 και 5 αμετάφραστες περιοχές και το κωδικόνιο λήξης. f) Τα αντικωδικόνια των trna είναι συμπληρωματικά των κωδικονίων του mrna. g) Κάθε αντικωδικόνιο αντιστοιχεί και σε ένα ξεχωριστό μόριο trna. h) Κωδικόνιο έναρξης της πρωτεϊνοσύνθεσης είναι το AUG που κωδικοποιεί ταυτόχρονα το αμινοξύ μεθειονίνη. i) Κωδικόνια λήξης της πρωτεϊνοσύνθεσης είναι τα : UAA, UAG και UGA, και δεν κωδικοποιούν κανένα αμινοξύ και δεν έχουν αντικωδικόνια. j) Σε πολλές πρωτεϊνες,αμέσως μετά την ολοκλήρωση της σύνθεσής τους απομακρύνονται ορισμένα αμινοξέα, επομένως και η μεθειονίνη από το αρχικό αμινικό άκρο. k) Αν α είναι τα νουκλεοτίδια ενός γονιδίου τότε τα νουκλεοτίδια της κωδικής αλυσίδας του είναι α/2 και της μη κωδικής (μεταγραφόμενης ) α/2 και τα νουκλεοτίδια του mrna θα είναι α/2. l) Όταν μας δίνονται τα νουκλεοτίδια του mrna (έστω α) και δεν υπάρχουν 3, 5 αμετάφραστες περιοχές τα κωδικόνια είναι α/3 και τα αμινοξέα (α/3 1) αφού στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ. m) Όταν μας δίνονται τα νουκλεοτίδια του mrna και πρέπει να ληφθούν υπόψη οι 3, 5 αμετάφραστες περιοχές αφαιρούμε τον ελάχιστο αριθμό που απαιτείται ώστε ο αριθμός νουκλεοτιδίων να γίνει πολλαπλάσιος του 3 και να μένουν σε κάθε άκρο 1 ή 2 αμετάφραστα νουκλεοτίδια και ακολουθούμε την διαδικασία της παραγράφου (l).

12 n) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν τα εξώνια ή τα εσώνια βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna και εργαζόμαστε σε μια από τις προηγούμενες παραγράφους (Ι) ή (m) ανάλογα με την περίπτωση. o) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν το πλαίσιο ανάγνωσης βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna (έστω α) τα κωδικόνια είναι α/3 και τα αμινοξέα (α/3 1) αφού στο κωδικόνιο λήξης δεν αντιστοιχεί αμινοξύ p) Όταν δίνεται το ποσοστό των νουκλεοτιδίων που αποτελούν το ανοιχτό πλαίσιο ανάγνωσης βρίσκουμε από αυτό τον ακριβή αριθμό των νουκλεοτιδίων του ώριμου mrna (έστω α) τα κωδικόνια είναι α/3 και τα αμινοξέα α/3. q) Όταν μας δίνεται η αλληλουχία ενός τμήματος DNA ψάχνουμε σε κάθε αλυσίδα του και προς τις δύο κατευθύνσεις να εντοπίσουμε τα κωδικόνια έναρξης και λήξης (με Τ αντί της U),η αλυσίδα που τα περιέχει είναι η κωδική και η συμπληρωματική της η μεταγραφόμενη. r) Από τα τέσσερα είδη RNA τα τρία βρισκονται τόσο στους προκαρυωτικούς όσο και στους ευκαρυωτικούς οργανισμούς σε κατά μέσο όρο ποσοστά 5% mrna, 15% trna και 80% rrna, το τέταρτο (snrna) υπάρχει μόνο στους ευκαρυωτικούς οργανισμούς. s) Η ποσοστιαία αναλογία βάσεων στο RNA είναι ίδια με αυτή της κωδικής αλυσίδας του DNA από το οποίο προκύπτει. t) Από ένα μόριο mrna μπορούν να προκύψουν πολλά όμοια πεπτίδια. u) Τα οπερόνια των προκαρυωτικών οργανισμών είναι ομάδες γονιδίων. v) Κατά τον σχηματισμό ενός πεπτιδικού δεσμού αφαιρείται ένα μόριο νερού εκτός και αν αναφέρεται στο πρόβλημα ότι αυτό δεν λαμβάνεται υπόψη. w) Στα μόρια DNA προκαρυωτικών κυττάρων υπάρχουν οι υποκινητές και οι χειριστές τους οποίους αγνοούμε αν δεν

13 έχουμε στοιχεία για αυτούς ή αν αναφέρεται στο πρόβλημα. x) Πίνακας επίλυσης προβλημάτων μεταγραφής μετάφρασης: DNA Κωδική Μεταγραφόμενη (μη κωδική) mrna trna Πεπτίδιο Περιέχει το κωδικόνιο έναρξης (ATG) και ένα από τα κωδικόνια λήξης (TAA, TAG και TGA) Συμπληρωματική και αντιπαράλληλη της κωδικής Συμπληρωματικό και αντιπαράλληλο της μεταγραφόμενης με U αντί Τ. Συμπληρωματικό και αντιπαράλληλο του mrna (ένα μόριο για κάθε κωδικόνιο εκτός από το κωδικόνιο λήξης) Συνδυασμός mrna και γενετικού κώδικα ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ 1. Μόριο DNA με ραδιενεργό Ρ 32 αφήνεται να διπλασιαστεί σε περιβάλλον με κανονικό Ρ 30. Αν ακολουθήσουν δύο διαδοχικές διαιρέσεις, πόσοι κλώνοι DNA θα αποτελούνται από κανονικό Ρ 30 ; 2. Ένα μόριο DNA περιέχει νουκλεοτίδια που στις αζωτούχες βάσεις του έχουν Ν 14. Μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που έχουν μόνο Ν 15 και αυτοδιπλασιάζονται. Πόσες αλυσίδες με Ν 14 και πόσες με Ν 15 θα υπάρχουν μετά τον δεύτερο αυτοδιπλασιασμό;

14 3. Σε ένα μόριο DNA υπάρχουν νουκλεοτίδια που έχουν Ρ 30. Μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που έχουν Ρ 32 και αυτοδιπλασιάζεται. Πόσα νουκλεοτίδια με Ρ 32 θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο αυτοδιπλασιασμό; 4. Ένα μόριο DNA περιέχει στον ένα κλώνο Ν 15 και στον άλλο Ν 14. Το μόριο αυτοδιπλασιάζεται σε περιβάλλον στο οποίο περιέχονται νουκλεοτίδια με Ν 14. Το αρχικό μόριο αποτελείται από 7200 νουκλεοτίδια. Πόσα νουκλεοτίδια με Ν 14 και πόσα με Ν 15 θα υπάρχουν στα μόρια του DNA μετά από δύο συνεχείς αυτοδιπλασιασμούς; 5. Σε ένα μόριο DNA υπάρχουν άτομα φωσφόρου. Το μόριο αυτό μεταφέρεται και διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου. Πόσα άτομα ραδιενεργού φωσφόρου θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο διπλασιασμό; Αιτιολογήστε πλήρως την απάντηση σας. 6. Μόριο DNA διπλασιάζεται σε περιβάλλον ραδιενεργού αζώτου. Πόσες αλυσίδες DNA με ραδιενεργό άζωτο θα υπάρχουν μετά τον πρώτο και πόσες μετά τον τέταρτο διπλασιασμό; 7. Μόριο DNA διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου, τα θυγατρικά του μόρια διπλασιάζονται σε περιβάλλον ραδιενεργού θείου. Τι σύσταση θα έχουν οι πολυνουκλεοτιδικές αλυσίδες που θα προκύψουν από την παραπάνω διαδικασία; 8. Το παρακάτω τμήμα DNA αυτοδιπλασιάζεται σε περιβάλλον που ATATG TATAC υπάρχουν μόνο σημασμένα νουκλεοτίδια Α *,T *, G *,C *. Να γράψετε τα μόρια του DNA που προκύπτουν μετά τον πρώτο και μετά τον δεύτερο διπλασιασμό(αιτιολογήστε την απάντηση σας).

15 9. Μόριο DNA που περιέχει Ν 14 υφίσταται δύο διπλασιασμούς σε περιβάλλον με Ν 15 και ακολούθως άλλους δύο σε περιβάλλον με Ν 14.Ποια θα είναι η σύσταση των μορίων του DNA μετά το πέρας της παραπάνω διεργασίας; 10. Μόριο mrna που προέρχεται από τη μεταγραφή βακτηριακού DNA αποτελείται κατά 30% από αδενίνη, 30% G, 20% C. Ποια θα είναι η αναλογία των βάσεων στο μόριο από το οποίο προήλθε; 11. Μία από τις δύο αλυσίδες του DNA που έχει σύνθεση βάσεων Α:12%, G :29% και C : 20%, αντιγράφεται για να δώσει την συμπληρωματική της αλυσίδα. Στη συνέχεια, η συμπληρωματική αυτή αλυσίδα μεταγράφεται σε mrna. Να βρεθεί η σύνθεση των βάσεων του mrna. Αιτιολογήστε την απάντηση σας. 12. Πως δικαιολογείται η διαφορά(αριθμητική) μεταξύ των νουκλεοτιδίων που υπάρχουν σε ένα γονίδιο ευκαρυωτικού κυττάρου και των αμινοξέων της λειτουργικής πρωτεΐνης που προκύπτει από αυτό; 13. Ένα τμήμα DNA του βακτηρίου E-coli αποτελείται από νουκλεοτίδια. Πόσα αμινοξέα μπορούν να κωδικοποιηθούν από αυτό το τμήμα (θεωρήστε ότι το παραπάνω τμήμα ταυτίζεται με το πλαίσιο ανάγνωσης); 14. Ένα μόριο DNA του βακτηρίου E-coli αποτελείται από νουκλεοτίδια. Αν το μέσο μοριακό βάρος των αμινοξέων είναι 100, πόσες διαφορετικές πρωτεΐνες με ΜΒ μπορεί να κωδικοποιήσει το μόριο DNA (να αγνοηθούν οι υποκινητές και οι χειριστές); 15. Ένα μόριο DNA έχει νουκλεοτίδια. Πόσες περίπου πρωτεΐνες με ΜΒ μπορούν να κωδικοποιηθούν από το παραπάνω DNA, αν το μέσο ΜΒ κάθε αμινοξέος είναι 100 (να αγνοηθούν τα μόρια νερού). 16. Ένα ώριμο μόριο mrna αποτελείται από 100 νουκλεοτίδια. Ποιος είναι ο μέγιστος αριθμός των αμινοξέων της πολυπεπτιδικής αλυσίδας που αυτό κωδικοποιεί;

16 17. Πρωτεΐνη προκαρυωτικού οργανισμού έχει ΜΒ ενώ το μέσο ΜΒ των αμινοξέων της είναι 100. Να βρεθεί ο αριθμός των κωδικονίων και ο ελάχιστος αριθμός των νουκλεοτιδίων που κωδικοποιεί αυτή την πρωτεΐνη. 18. Η α-αλυσίδα της αιμοσφαιρίνης αποτελείται από 141 αμινοξέα με πρώτο την μεθειονίνη. Υπολογίστε από πόσα νουκλεοτίδια αποτελείται το γονίδιο που την κωδικοποιεί αν είναι γνωστό ότι στο πρόδρομο mrna το 40% των νουκλεοτιδίων του είναι εσώνια; 19. Το μόριο της αιμοσφαιρίνης Α του ανθρώπου αποτελείται από τέσσερις πολυπεπτιδικές αλυσίδες, δύο α, όμοιες μεταξύ τους με 141 αμινοξέα έκαστη και δύο β, όμοιες μεταξύ τους με 146 αμινοξέα η καθεμία. Θεωρώντας ότι όλες οι αλυσίδες έχουν πρώτο αμινοξύ την μεθειονίνη βρείτε: i. Πόσα είδη mrna είναι υπεύθυνα για την σύνθεση των τεσσάρων πολύπεπτιδικών αλυσίδων; ii. Από πόσες αζωτούχες βάσεις αποτελείται το ώριμο μόριο κάθε είδους mrnaτου ερωτήματος (i); 20. Το ώριμο mrna που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 630 νουκλεοτίδια. Οι 3,5 αμετάφραστες περιοχές αποτελούνται από συνολικά 12 νουκλεοτίδια. Αν η λειτουργική πρωτεΐνη που προκύπτει έχει 185 αμινοξέα να βρείτε πόσα αμινοξέα απομακρύνθηκαν από την πολυπεπτιδική αλυσίδα που σχηματίστηκε στα οργανίδια τροποποίησης των πρωτεϊνών; 21. Το 80% των νουκλεοτιδίων ενός πρόδρομου mrna είναι εσώνια. Το μόριο αυτό έχει συνολικά 560 νουκλεοτίδια, ενώ οι 3,5 αμετάφραστες περιοχές του έχουν 16 νουκλεοτίδια. Ποιος είναι ο μέγιστος αριθμός των αμινοξέων που θα έχει το πρωτεϊνικό μόριο που θα προκύψει από την μετάφραση του παραπάνω μορίου; 22. Το πρόδρομο mrna που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 730 νουκλεοτίδια. Οι 3,5 αμετάφραστες περιοχές αποτελούνται από συνολικά 12 νουκλεοτίδια. Αν η πολυπεπτιδική αλυσίδα (μη λειτουργική πρωτεΐνη) που προκύπτει έχει 205 αμινοξέα να βρείτε τον

17 αριθμό των νουκλεοτιδίων που ανήκουν στα εσώνια του γονιδίου; 23. Ένα μόριο πρόδρομου mrna έχει 522 νουκλεοτίδια ενώ η πρωτεΐνη που προέκυψε από την μετάφραση του έχει 138 αμινοξέα. Αν οι 3,5 αμετάφραστες περιοχές αποτελούνται από 6 νουκλεοτίδια καθεμία,ποιο το ποσοστό των εσωνίων του παραπάνω μορίου; 24. Μόριο mrna βακτηρίου αποτελείται από 640 νουκλεοτίδια και μεταφράζεται σε μία πολυπεπτιδική αλυσίδα. Πόσοι πεπτιδικοί δεσμοί σχηματίζονται και πόσα μόρια νερού απελευθερώνονται; 25. Ένα τμήμα DNA (γονίδιο) αποτελείται από 3600 νουκλεοτίδια. Να βρεθούν: i. Ο αριθμός των κωδικονίων του mrna που δημιουργείται από την μεταγραφή του γονιδίου αν το ανοιχτό πλαίσιο ανάγνωσης αποτελεί το 50% του συνολικού mrna που προκύπτει από την μεταγραφή. ii. Ο αριθμός των trna που θα χρησιμοποιηθούν κατά την μετάφραση του mrna. iii. Ο αριθμός των αμινοξέων που θα περιέχονται στην πολυπεπτιδική αλυσίδα. 26. Το τμήμα DNA που κωδικοποιεί την α-αλυσίδα της αιμοσφαιρίνης αποτελείται από 1128 νουκλεοτίδια. Αν το ανοιχτό πλαίσιο ανάγνωσης αποτελεί το 75% του συνολικού mrna,βρείτε πόσα αμινοξέα περιέχει η α-αλυσίδα. 27. Τμήμα αλυσίδας βακτηριακού DNA μεταγράφεται σε mrna το οποίο μεταφράζεται σε πρωτεΐνη. Έστω ότι κάποια αμινοξέα αυτής της πρωτεΐνης που μεταφέρονται από τα αντίστοιχα trna και συνδέονται στην πολυπεπτιδική αλυσίδα είναι: βαλίνη - βαλίνη - σερίνη, ιστιδίνη, και κωδικοποιούνται αντίστοιχα από τα εξής κωδικόνια: GUU, GUC,UCG, CAU. Ποια η ακολουθία των αζωτούχων βάσεων στο αντίστοιχο τμήμα της αλυσίδας του DNA; 28. Από μία πολυπεπτιδική αλυσίδα ενός βακτηρίου απομακρύνθηκαν 2 αμινοξέα από το αμινικό της άκρο,ώστε τελικά να έχει 100 αμινοξέα.πόσα νουκλεοτίδιαθα έχει το

18 τμήμα DNA που καθόρισε την αλληλουχία των αμινοξέων στην αρχική πολυπεπτιδική αλυσίδα; 29. Ένα μόριοβακτηριακού DNA αποτελείται από νουκλεοτίδια: i. Πόσα δεσόξυριβονουκλεοτίδια θα χρειαστούν για την αντιγραφή του; ii. Να ονομάσετε τα ένζυμα που θα πάρουν μέρος στην αντιγραφή του. iii. Αν το 5% του μήκους του κωδικοποιεί 50 όμοιες πολυπεπτιδικές αλυσίδες ποιος είναι ο αριθμός των αμινοξέων που απαιτούνται για την έκφραση των πληροφοριών του παραπάνω μορίου DNA; 30. Το κύριο κυκλικό μόριο DNA του βακτηρίου Ε-coli αποτελείται από ζεύγη βάσεων. Ένα βακτήριο Ε-coli αναπτύσεται σε περιβάλλον ραδιενεργού φωσφόρου (Ρ 32 ). Αν ο χρόνος διπλασιασμού είναι 20min,να εξηγήσετε μετά από 40min: i. Πόσα μόρια DNA σχηματίστηκαν; ii. Πόσα κανονικά και πόσα ραδιενεργά άτομα φωσφόρου περιέχονται στα μόρια DNA που σχηματίστηκαν; 31. Δίνεται ένας κλώνος DNA με την ακόλουθη αλληλουχία βάσεων: -ACC-CCA-TAC-CGT-TTT-TTT-TTT-ACT-CCG-AGT-CAT- Βρείτε το πλαίσιο ανάγνωσης του mrna που θα προκύψει από την μεταγραφή του παραπάνω τμήματος DNA. 32. Αν ένα τμήμα της κωδικής αλυσίδας ενός μορίου DNA περιέχει την ακόλουθη διαδοχή αζωτούχων βάσεων, να απαντήσετε στις ακόλουθες ερωτήσεις: -ATG-CCT-TTA-AAA-CGA-TCC-GTA-CAC-TCG-TGAi. Ποια είναι η κωδική αλυσίδα του DNA; ii. Ποιο είναι το τμήμα mrna που συντίθεται; iii. Ποια είναι τα αντικωδικόνια των trna που παίρνουν μέρος στη μετάφραση; iv. Το πρωτεϊνικό τμήμα που παράγεται από πόσα και ποια αμινοξέα αποτελείται; v. Ποιο είναι το σύνολο των δεσμών υδρογόνου και των φωσφοδιεστερικών δεσμών σε αυτό το τμήμα DNA.

19 33. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων: 5 -TCA-CGG-AAT-TTC-TAG-CAT-3 i. Με δεδομένο ότι δεν μεσολαβεί στάδιο ωρίμανσης, να γράψετε το mrna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA σημειώνοντας ταυτόχρονα την θέση του 5 και 3 άκρου του mrna. ii. Να γραφούν τα αντικωδικόνια των trna με την σειρά με την οποία συμμετέχουν στην μετάφραση του παραπάνω mrna σημειώνοντας ταυτόχρονα την θέση του 5 και 3 άκρου κάθε trna. 34. Η αλληλουχία των αζωτούχων βάσεων ενός τμήματος γονιδίου είναι: 5 -AAATTTCTAATGCCTGCGCGACGGCATGAAAAATTT-3 Να βρείτε: i. Την αλληλουχία των βάσεων στην 2 η αλυσίδα DNA ii. Τα κωδικόνια του mrna iii. Τα αντικωδικόνια των trna με την σειρά που συμμετέχουν στην μετάφραση. iv. Τον αριθμό και το είδος των αμινοξέων του πεπτιδίου που προκύπτει από την μετάφραση. 35. Δίνεται η ακόλουθη αλληλουχία του 3 ου άκρου ενός μορίου mrna : UGGAUUCUCCCUACAAGGUAAGCGGAAU-3 Πόσα αμινοξέα κωδικοποιούνται από αυτό το τμήμα του mrna; Ποια είναι η ακολουθία των νουκλεοτιδίων στο γονίδιο που κωδικοποιεί αυτό το mrna; (θεωρήστε ότι δεν υπάρχουν εσώνια). 36. Δίνεται η ακόλουθη αλληλουχία του τμήματος ενός μορίου mrna : UUUCAGUUUACGUCCUCCUCGAACU i. Ποιο είναι το 3 και ποιο το 5 άκρο αυτού του τμήματος; ii. Το τμήμα αυτό αντιστοιχεί στην αρχή ή στο τέλος του μορίου; iii. Πόσα και ποια αμινοξέα θα προκύψουν από αυτό το τμήμα;

20 iv. Ποια είναι τα αντικωδικόνια αυτού του τμήματος; 37. Έστω ότι γνωρίζετε τον αριθμό των αμινοξέων ενός μορίου μιας ανθρώπινης πρωτεΐνης. Μπορείτε να βρείτε το μήκος του DNA που περιέχει τις πληροφορίες για την σύνθεση της; Αιτιολογήστε την απάντηση σας. 38. Υπολογίστε το πλήθος των πεντοζών και των αζωτούχων βάσεων στο μόριο του mrna που κατά την μετάφραση του δίνει πολυπεπτιδική αλυσίδα, η οποία στην πρόδρομη μορφή της έχει 155 αμινοξέα και στη λειτουργική μορφή της έχει 150 αμινοξέα. Πόσα μόρια mrna πήραν μέρος στην σύνθεση της αλυσίδας και πόσα μόρια νερού κέρδισε τελικά το κύτταρο; 39. Βακτηριακή πρωτεΐνη έχει 98 αμινοξέα. Αν το τμήμα DNA από το οποίο προέκυψε έχει 20% Α, βρείτε: i. τον αριθμό των νουκλεοτιδίων του τμήματος του DNA ii. τον αριθμό των φωσφοδιεστερικών δεσμών που υπάρχουν σ αυτό. iii. Τον αριθμό των δεσμών υδρογόνου αυτού του τμήματος. 40. Δίνεται η παρακάτω αλληλουχία βάσεων σε ένα κλώνο DNA: -AAG-TAG-GGC-TAC-GGC-AGC-GCG-TCC-CAC-ATC-TTTi. Να γραφεί ο συμπληρωματικός κλώνος και να υπολογιστεί ο αριθμός των δεσμών υδρογόνου. ii. Αφού εντοπιστεί η κωδική και η μεταγραφόμενη αλυσίδα να γραφεί η ακολουθία των βάσεων του mrna που προκύπτει κατά την μεταγραφή. iii. Αν δεν υπάρχουν εσώνια να γραφεί το πεπτίδιο που θα προκύψει από την μετάφραση του παραπάνω mrna. 41. Δίνονται οι αλληλουχίες βάσεων ενός μορίου DNA και ενός μορίου RNA: Τι παρατηρείτε; DNA : TATGTTGG ATACTACC RNA : UAUGAUGG 42. Αν υποθέσουμε ότι ένας αρχέγονος οργανισμός που ανακαλύπτεται στον Άρη, βρέθηκε να έχει ένα παρόμοιο γενετικό σύστημα με το δικό μας, δηλαδή το γενετικό του υλικό είναι δίκλωνο DNA, αποτελείται από 5 διαφορετικά

21 είδη νουκλεοτιδίων και οι πρωτεΐνες του δομούνται από 19 διαφορετικά αμινοξέα, να βρείτε: i. Την φύση του γενετικού του κώδικα (είδος και αριθμό κωδικονίων) ii. Αν υπάρχει ένα κωδικόνιο έναρξης και ένα κωδικόνιο λήξης τα οποία δεν κωδικοποιούν αμινοξέα πόσο εκφυλισμένος είναι αυτός; iii. Αν ο οργανισμός παράγει 100 διαφορετικές πρωτεΐνες,που καθεμία περιέχει 10 αμινοξέα, ποιος θα πρέπει να είναι ο μικρότερος αριθμός νουκλεοτιδίων που βρίσκονται στο γενετικό του υλικό; 43. Σε ένα ώριμο μόριο mrna η περιοχή του που καθορίζει την αλληλουχία των αμινοξέων στην πολυπεπτιδική αλυσίδα περιλαμβάνει 2999 φωσφοδιεστερικούς δεσμούς. i. Από πόσα κωδικόνια αποτελείται η παραπάνω περιοχή του mrna; ii. Πόσα αμινοξέα θα έχει η πολυπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του παραπάνω μορίου; 44. Μόρια νουκλεϊνικών οξέων έχουν απομονωθεί από επτά τύπους ιών. Η σύσταση των βάσεων των μορίων αυτών δίνεται από τον πίνακα : ΒΑΣΕΙΣ ΙΟΣ 1 ΙΟΣ2 ΙΟΣ3 ΙΟΣ4 ΙΟΣ5 ΙΟΣ6 ΙΟΣ7 Α Τ G C U Να αναγνωρίσετε τον τύπο του νουκλεϊνικού οξέος σε καθένα από τους 7 τύπους ιών και να αποφανθείτε κατά πόσο μπορούμε να γνωρίζουμε αν αυτό είναι μονόκλωνο ή δίκλωνο. 45. Δίνεται το παρακάτω τμήμα ώριμου mrna : 5 - AUGGUGCACCAGAGUCCUGAGGAGAAGUAA-3 Να βρείτε:

22 i. Την αλληλουχία των βάσεων του δίκλωνου DNA από το οποίο μεταγράφηκε. ii. Τα αντικωδικόνια που αντιστοιχούν στα παραπάνω κωδικόνια. iii. Τα ποσοστά των βάσεων της μεταγραφόμενης αλυσίδας του DNA. iv. Ποσοστά των βάσεων στο κάθε θυγατρικό μόριο που θα προκύψει από την αντιγραφή του παραπάνω μορίου DNA. 46. Αν το μέσο μήκος ενός γονιδίου είναι 2000 ζεύγη βάσεων βρείτε το σύνολο των γονιδίων που υπάρχουν σε ένα ανθρώπινο σωματικό κύτταρο. 47. Το γονίδιο του κολλαγόνου του ανθρώπου έχει 50 εσώνια. Κατά την διαδικασία ωρίμανσης του πρόδρομου mrna το κύτταρο κέρδισε ή έχασε μόρια νερού και πόσα; 48. Βακτηριακό mrna που έχει 2999 φωσφοδιεστερικούς δεσμούς κατευθύνει την σύνθεση πολυπεπτιδικής αλυσίδας που αποτελείται από 989 αμινοξέα. Ποιος είναι ο αριθμός των νουκλεοτιδίων που αντιστοιχούν στις 3,5 αμετάφραστες περιοχές του παραπάνω μορίου; 49. Η αλληλουχία των αμινοξέων μιας πρωτεΐνης δύο διαφορετικών οργανισμών που επιτελεί την ίδια λειτουργία και στους δύο οργανισμούς βρέθηκε όμοια κατά 80%. Όμως τα αντίστοιχα γονίδια των οργανισμών βρέθηκε να έχουν ομοιότητα κατά 40%. Πώς μπορεί να εξηγηθεί αυτή η διαφορά; 50. Το DNA ενός πλασμιδίου έχει 1, φωσφοδιεστερικούς δεσμούς. Πόσες πρωτεΐνες με μέσο μοριακό βάρος θα μπορούσαν να κωδικοποιηθούν από αυτό αν το μέσο μοριακό βάρος των αμινοξέων είναι 100; 51. Το μοριακό βάρος του DNA του βακτηρίου Ε-coli είναι Ποιος είναι ο συνολικός αριθμός των γονιδίων στο μόριο. Δίνεται ότι το μέσο μοριακό βάρος ενός ζεύγους νουκλεοτιδίων είναι 660 και ότι κάθε γονίδιο φέρει την πληροφορία για τον σχηματισμό της ίδιας πρωτεΐνης και ότι όλες οι πρωτεΐνες αποτελούνται από 400 αμινοξέα. 52. Δίνεται η κωδική αλυσίδα του DNA ενός γονιδίου:

23 ATGCCTCATCGTTGT AGTGGTGATGCTGTTTGA i. Να γράψετε την αλληλουχία των βάσεων του πρόδρομου mrna. ii. Αν το λειτουργικό πεπτίδιο που σχηματίστηκε από την μετάφραση του ώριμου mrna ήταν:προλίνη-ιστιδίνηαργινίνη-ασπαρτικό οξύ-αλανίνη-βαλίνη, να βρείτε την αλληλουχία των βάσεων του εσωνίου που βρίσκεται στο γονίδιο. iii. Να γράψετε την αλληλουχία των βάσεων του ώριμου mrna. iv. Πόσοι φωσφοδιεστερικοί δεσμοί δημιουργούνται κατά την συρραφή των εξωνίων; v. Ποια μακρομόρια παίρνουν μέρος στην ωρίμανση του πρόδρομου mrna; ΜΕΘΟΔΟΛΟΓΙΑ ΓΙΑ ΤΗΝ ΕΠΙΛΥΣΗ ΑΣΚΗΣΕΩΝ A. Οι περιοριστικές ενδονουκλεάσες είναι ένζυμα που αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA, μήκους 4-8 νουκλεοτιδίων. B. Η περιοριστική ενδονουκλεάση EcoRI, η οποία όποτε συναντά την αλληλουχία : G AATTC CTTAA G στο γονιδίωμα,κόβει κάθε αλυσίδα μεταξύ G και Α, οπότε κάθε φορά σπάζουν 2 φωσφοδιεστερικοί δεσμοί και 8 δεσμοί υδρογόνου. C. Η παραπάνω αλληλουχία που αναγνωρίζεται από την EcoRI συναντάται μια φορά στα πλασμίδια.

24 D. Με την μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης (PCR) μπορούμε να αντιγράψουμε επιλεκτικά,εκατομμύρια φορές ειδικές αλληλουχίες DNA από ένα σύνθετο μείγμα μορίων DNA,χωρίς την μεσολάβηση ζωντανού κυττάρου δηλαδή χωρίς κλωνοποίηση. E. Η παραγωγή των αντιγράφων τμήματος DNA στο εργαστήριο με την μέθοδο PCR πραγματοποιείται με ρυθμό γεωμετρικής προόδου. F. Η τεχνολογία του ανασυνδυασμένου DNA βασίζεται στο ότι:! Ο γενετικός κώδικας είναι καθολικός, οπότε τα γονίδια από άλλους οργανισμούς μπορούν να εκφράζονται σε βακτήρια.! Τα βακτήρια μπορούν να αναπαράγονται πολύ γρήγορα, επομένως τα γονίδια που περιέχουν αντιγράφονται πολλές φορές σε μικρό χρονικό διάστημα.

25 ΑΣΚΗΣΕΙΣ ΠΡΟΒΛΗΜΑΤΑ 1. Σε ένα κύτταρο Ecoli συμβαίνει μια γονιδιακή μετάλλαξη. Στα δύο θυγατρικά κύτταρα δεν εμφανίζεται καμία φαινοτυπική αλλαγή. Από τα τέσσερα θυγατρικά κύτταρα που αναπτύσσονται σε διαφορετικό περιβάλλον, ένα εμφανίζει νέο φαινοτυπικό γνώρισμα. Εξηγήστε τι μπορεί να συνέβη. 2. Το ένζυμο EcoRI κόβει μικρό γραμμικό δίκλωνο DNA σε δύο τμήματα το Α και το Β. Το Α αποτελείται από 212 νουκλεοτίδια, 40 από τα οποία περιέχουν την αζωτούχο βάση αδενίνη. i. Ποιος είναι ο αριθμός των άλλων αζωτούχων βάσεων του τμήματος Α; ii. Ποιος είναι ο αριθμός των φωσφοδιεστερικών δεσμών που υπάρχουν στο τμήμα Α; iii. Πόσοι δεσμοί υδρογόνου συγκρατούν μεταξύ τους τις συμπληρωματικές αλυσίδες του Α; iv. Ποιος είναι ο αριθμός των αζωτούχων βάσεων κάθε είδους του τμήματος Β, αν το αρχικό μόριο DNA περιέχει 400 φωσφοδιεστερικούς δεσμούς και 85 αδενίνες; 3. Έστω ότι σε ένα γραμμικό μόριο DNA που έχει μήκος 16Kb (1Kb = 1000 βάσεις) επιδρούμε με την περιοριστική ενδονουκλεάση Α και δημιουργούνται δύο τμήματα μήκους 10 και 6Kb αντίστοιχα. Εάν επιδράσουμε με την ενδονουκλεάση Β, τα τμήματα που δημιουργούνται είναι τρία 9,4 και 3Kb. Σε πόσα τμήματα θα χωριστεί το DNA αν επιδράσουμε και με τις δύο ενδονουκλεάσες μαζί; 4. Ένα πλασμίδιο περιέχει γονίδια που το καθιστούν ανθεκτικό στα αντιβιοτικά αμπικιλλίνη και τετρακυκλίνη. Επιδρούμε με την περιοριστική ενδονουκλεάση EcoRI στη θέση του γονιδίου ανθεκτικότητας της αμπικιλλίνης και στο τμήμα αυτό εισάγουμε DNA δροσόφιλας. Το ανασυνδυασμένο DNA μετασχηματίζει κύτταρα Ecoli. Ποιο αντιβιοτικό θα πρέπει να προσθέσουμε στην καλλιέργεια ώστε να επιλέξουμε κύτταρα που έχουν ενσωματώσει το ανασυνδυασμένο πλασμίδιο; Δικαιολογήστε την απάντηση σας. 5. Με την δράση της EcoRI ένα μόριο DNA από ευκαρυωτικό κύτταρο κόπηκε σε 5 κομμάτια. i. Σε πόσα σημεία κόπηκε το μόριο; ii. Πόσων δεσμών την διάσπαση προκάλεσε η EcoRI; iii. Πόσα κατάλληλα πλασμίδια χρειάζονται για την κατασκευή <<βιβλιοθήκης >> του συγκεκριμένου μορίου DNA; iv. Πόσων δεσμών την διάσπαση θα προκαλέσει η EcoRI στα πλασμίδια αυτά; 6. Σε ένα πείραμα PCR επιχειρείται η κατασκευή τουλάχιστον 30 αντιγράφων ενός αρχικού κομματιού από DNA. Το κομμάτι αυτό αποτελείται από νουκλεοτίδια και η αντιγραφή του διαρκεί 2 ώρες. i. Μετά από πόσο χρόνο θα έχουμε τον επιθυμητό αριθμό αντιγράφων;

26 ii. Πόσα νουκλεοτίδια θα υπάρχουν τελικά στα αντίγραφα και πόσα χρειάστηκαν; iii. Πόσοι κλώνοι συντέθηκαν;

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό

Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης. Κεφάλαιο 1α Το Γενετικό Υλικό Βιολογία Γ Γενικού Λυκείου Θετικής κατεύθυνσης Κεφάλαιο 1α Το Γενετικό Υλικό Το DNA είναι το γενετικό υλικό Αρχικά οι επιστήμονες θεωρούσαν ότι οι πρωτεΐνες αποτελούσαν το γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα.

Η ζητούμενη σειρά έχει ως εξής: αδενίνη < νουκλεοτίδιο < νουκλεόσωμα < γονίδιο < χρωματίδα < χρωμόσωμα < γονιδίωμα. ΚΕΦ. 1 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Να κατατάξετε σε σειρά αυξανόμενου μεγέθους τις παρακάτω έννοιες που σχετίζονται με το γενετικό υλικό των οργανισμών: νουκλεόσωμα, χρωμόσωμα, αδενίνη, νουκλεοτίδιο, γονίδιο

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια

(αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά ποντίκια νεκρά ποντίκια Το DNA είναι το γενετικό υλικό 1. Πείραμα Griffith (1928) Βακτήριο πνευμονιόκοκκου (Diplococcus pneumoniae) Χωρίς κάλυμμα Με κάλυμμα (αδρές αποικίες) Θέρμανση (λείες αποικίες) ζωντανά ποντίκια ζωντανά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ( ΣΥΓΓΡΑΦΗ): ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (Θα περιέχει ερωτήσεις θεωρίας µε απαντήσεις, ασκήσεις ανοικτούκλειστού τύπου µε

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό

igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό igenetics ΜΑΘΗΜΑ 3 Το γενετικό υλικό ΛΕΙΤΟΥΡΓΙΕΣ ΤΟΥ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ ΑΠΟΘΗΚΕΥΣΗ Στο DNA (RNA ιών) οι πληροφορίες για τα χαρακτηριστικά ενός οργανισμού (γονίδια) ΔΙΑΤΗΡΗΣΗ Από κύτταρο σε κύτταρο και από

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό

1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1 ο κεφάλαιο-το γενετικό υλικό 1.1. Το DNA είναι το γενετικό υλικό 1.1.1.Με βάση την εικόνα που σας δίνεται (πείραμα Griffith) να απαντήσετε στις ερωτήσεις που ακολουθούν. Α. Το συστατικό των βακτηρίων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049

Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 ΝΙΚΟΠΟΥΛΟΣ ΚΩΝ/ΝΟΣ 5 η ΕΚΔΟΣΗ Η ΣΥΓΧΡΟΝΗ ΔΥΝΑΜΗ ΣΤΗΝ ΕΚΠΑΙΔΕΥΣΗ ΜΕ ΟΡΓΑΝΩΣΗ ΜΕΘΟΔΟ ΣΥΣΤΗΜΑ & ΠΡΟΓΡΑΜΜΑΤΙΣΜΟ www.2001.gr Ν.ΓΡΗΓΟΡΑ & ΦΡΟΥΡΙΟΥ 9 ΤΗΛ. 2531024049 1 2 3 ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ DNA και RNA DNA Δίκλωνο

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει:

Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Ο µαθητής που έχει µελετήσει το κεφάλαιο γενετικό υλικό πρέπει να γνωρίζει: Με ποια πειράµατα οι επιστήµονες κατέληξαν στο συµπέρασµα ότι το DNA είναι το γενετικό υλικό του κυττάρου. Ποιες οι διαφορές

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β.

ÏÑÏÓÇÌÏ ÅËÁÓÓÏÍÁ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β. 1 Απάντηση στο 1 ο Θέµα 1. α 2. γ 3. δ 4. β 5. β Απάντηση στο 2 ο Θέµα Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1. Σχολικό σελ. 17 από «Το DNA τον έλεγχο της σύνθεσης των πρωτεϊνών». 2. Α. Τα χρωµοσώµατα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο ΙΑΓΩΝΙΣΜΑ Α/ Ποιες οι λειτουργίες του γενετικού υλικού ; (Μονάδες 6) Β/ Που βρίσκεται το γενετικό υλικό στα ευκαρυωτικά και στα προκαρυωτικά ; (Μονάδες 6)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Μαυροματάκης Γιώργος Βιολόγος

Μαυροματάκης Γιώργος Βιολόγος Βιολογία Γ'Λυκείου Κατεύθυνσης Εικονογραφημένη Επανάληψη Μαυροματάκης Γιώργος Βιολόγος (gmavromat@gmail.com) Χανιά 2009-2010 1 Κεφάλαιο 1ο Το γενετικό υλικό 2 3 Με τη βοήθεια της φωτογραφίας που ακολουθεί

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ)

ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) ΣΧΕΔΙΟ ΜΑΘΗΜΑΤΟΣ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA (ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ) Ι) ΠΡΟΑΠΑΙΤΟΥΜΕΝΕΣ ΓΝΩΣΕΙΣ ΚΑΙ ΔΕΞΙΟΤΗΤΕΣ Οι μαθητές θα πρέπει : Να γνωρίζουν ποιο μόριο είναι ο φορέας της γενετικής

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Stylianos Kalaitzis A1-1

Stylianos Kalaitzis A1-1 A1-το γενετικό υλικό Stylianos Kalaitzis A1-1 Περιεχόμενα Σημειώσεις Θεωρίας Το γενετικό υλικό Μεθοδολογία ασκήσεων έκφρασης Μεταλλάξεις και οι σχέση τους με τη μενδελική κληρονομικότητα Μενδελική κληρονομικότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 1ο ΚΕΦΑΛΑΙΟ 1. Αρχικά οι επιστήμονες πίστευαν ότι τα βιολογικά μακρομόρια που μεταφέρουν τη γενετική πληροφορία ήταν οι πρωτεΐνες. Ποια ήταν η λογική τους;

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ

ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ ΒΙΟΛΟΓΙΑ - ΓΕΝΕΤΙΚΗ ρ ΑΝ ΡΟΝΙΚΗ Σ. ΠΑΠΟΥΤΣΗ Επικ. Καθηγήτρια Βιολογίας-Γενετικής Α.Τ.Ε.Ι.Θ. Τμήμα Νοσηλευτικής Σ.Ε.Υ.Π. Α.Τ.Ε.Ι. Θεσσαλονίκης ΘΕΣΣΑΛΟΝΙΚΗ 2010 «Αν δώσουμε τη δυνατότητα στους αδύνατους

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ:

ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΑΞΗ: Γ ΛΥΚΕΙΟΥ ΥΠΕΥΘΥΝΗ ΚΑΘΗΓΗΤΡΙΑ: Συροπούλου Ελεάνα ΟΝΟΜΑΤΕΠΩΝΥΜΟ: / /2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η ποσότητα του DNA είναι α. διπλάσια στα νευρικά κύτταρα σε σχέση

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÔÑÉÐÔÕ Ï Í. ÓÌÕÑÍÇ ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Ενότητα 10: Κυτταρική Διαίρεση

Ενότητα 10: Κυτταρική Διαίρεση Ενότητα 10: Κυτταρική Διαίρεση Κυτταρική διαίρεση: παραγωγή γενετικά πανομοιότυπων θυγατρικών κυττάρων Κυτταρική διαίρεση Μονοκύτταροι οργανισμοί: η διαίρεση του κυττάρου συνεπάγεται αναπαραγωγή ολόκληρου

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ. Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας

ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ. Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας ΣΤΟΙΧΕΙΑ ΓΕΝΕΤΙΚΗΣ Κωνσταντίνος Ε. Κεραμάρης Βιολόγος Εκπαιδευτικός Κλινικός Βιοχημικός Διδάκτορας Βιολογικών Επιστημών Πανεπιστημίου Αθήνας 2001 1 ΠΕΡΙΕΧΟΜΕΝΑ 1. Δομή του γενετικού υλικού 3 2. Κληρονομικότητα..

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΕΡΩΤΗΣΕΙΣ ΘΕΩΡΙΑΣ 1.Ποια χηµικά στοιχεία συµµετέχουν στην σύνθεση των µορίων των οργανισµών σε σηµαντικό βαθµό; (σελ.18) 2. Γιατί είναι σηµαντικά τα ιχνοστοιχεία;(σελ.18)

Διαβάστε περισσότερα

DNA, οργάνωση και δομή του γενετικού υλικού

DNA, οργάνωση και δομή του γενετικού υλικού DNA, οργάνωση και δομή του γενετικού υλικού Κιούπη Βασιλική, εκπαιδευτικός κλ.πε04.04 Μια εκπαιδευτική δραστηριότητα βασισμένη σε εκθέματα του ιδρύματος Ευγενίδου Εισαγωγικός τομέας και προκαταρτική φάση

Διαβάστε περισσότερα

DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ;

DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ; DNA ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ ΠΩΣ ΚΑΤΑΛΗΞΑΜΕ ΣΤΟ ΣΥΜΠΕΡΑΣΜΑ ΟΤΙ ΤΟ DNA ΕΙΝΑΙ ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ; ΠΕΙΡΑΜΑ GRIFFITH 1928 ΕΠΑΝΑΛΗΨΗ ΠΕΙΡΑΜΑΤΟΣ GRIFFITH IN VITRO ΑΠO ΤΟΥΣ AVERY MAC-CLEOD MC-CARTHY- 1944 ΒΙΟΧΗΜΙΚΑ Ε

Διαβάστε περισσότερα

ΦΥΕ 43. Θέματα 3 ης γραπτής εργασίας

ΦΥΕ 43. Θέματα 3 ης γραπτής εργασίας ΦΥΕ 43 Θέματα 3 ης γραπτής εργασίας Θέμα 1. Ανάμεσα στα χημικά μεταλλαξιγόνα περιλαμβάνονται οι παράγοντες αλκυλίωσης και οι παράγοντες απαμίνωσης των βάσεων του DNA. Βρείτε από το διαδίκτυο και περιγράψτε

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ

ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ ΓΕΝΕΤΙΚΗ Λουκάς Νικολάου ΚΕΦΑΛΑΙΟ ΕΝΝΑΤΟ 2014 2 Γενετική είναι ο κλάδος της Βιολογίας που ασχολείται με την μελέτη της κληρονομικότητας. Κληρονομικότητα είναι η προγόνους στους απογόνους. μεταβίβαση χαρακτήρων

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ 2 ΑΝΑΖΗΤΗΣΗ ΠΛΗΡΟΦΟΡΙΑΣ ΣΕ ΒΙΟΛΟΓΙΚΕΣ ΒΑΣΕΙΣ ΔΕΔΟΜΕΝΩΝ Α. Εισαγωγικά Στοιχεία Βιολογίας 1. DNA (Δεοξυριβονουκλεϊκό Οξύ) Φορέας γενετικής πληροφορίας Το DNA είναι ένα επίμηκες μόριο

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

Από το γονίδιο στην πρωτεΐνη

Από το γονίδιο στην πρωτεΐνη Κεφάλαιο 17 Από το γονίδιο στην πρωτεΐνη Original Slides by Erin Barley Kathleen Fitzpatrick Γρηγόρης Παπαγρηγορίου 1 Η ροή της γενετικής πληροφορίας Η πληροφορία που περιέχεται στα γονίδια έχει την μορφή

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων

Πανεπιστημιο Κυπρου. Τμημα Βιολογικων Επιστημων Πανεπιστημιο Κυπρου Τμημα Βιολογικων Επιστημων Σημειωσεις μαθηματος ΒΙΟ101 Ιωάννης Κυρμιτζόγλου Αν. Καθ. Λεόντιος Κωστρίκης Λευκωσια, 2007-2008 Ε Ι Σ Α Γ Ω Γ Η Σ Τ Ι Σ Σ Υ Γ Χ Ρ Ο Ν Ε Σ Β Ι Ο Λ Ο Γ Ι Κ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου;

ΒΙΟΛΟΓΙΑ. 3. Τι γνωρίζετε για τον πυρήνα του ευκαρυωτικού κυττάρου; ΒΙΟΛΟΓΙΑ 1,Να αντιστοιχίσετε της όρους της αριστερής στήλης με τις προτάσεις της δεξιάς στήλης: α. κυτταρική μεμβράνη 1. πολλαπλασιάζονται με εκβλάστηση β. αμοιβάδα 2.κέντρα παραγωγής ενέργειας γ. μιτοχόνδρια

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών

Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής έκφρασης cdna μικροσυστοιχιών ΕΘΝΙΚΟ ΜΕΤΣΟΒΙΟ ΠΟΛΥΤΕΧΝΕΙΟ ΣΧΟΛΗ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΣΥΣΤΗΜΑΤΩΝ ΜΕΤΑΔΟΣΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΥΛΙΚΩΝ Αξιολόγηση μεθόδων κατηγοριοποίησης δεδομένων γονιδιακής

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: ευτέρα, 23 Μαΐου 2011 07:30-10:30

Διαβάστε περισσότερα