ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο"

Transcript

1 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής του DΝΑ χαρακτηρίζεται από µεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύµων και συµπλοκών ενζύµων. Α.Ι. Ποια από τα παρακάτω συµµετέχουν στην αντιγραφή του DΝΑ: DΝΑ πολυµεράσες, DΝΑ ελικάσες, περιοριστικές ενδονουκλεάσες, πριµόσωµα, επιδιορθωτικά ένζυµα, DΝΑ δεσµάση; () Α.2. Να γράψετε ονοµαστικά τα ένζυµα που παίρνουν µέρος στην επιδιόρθωση του DΝΑ. () Β.2. Τι είναι το πολύσωµα; () Β.3. Ποια κωδικόνια ονοµάζονται συνώνυµα; () Ζήτηµα 4ο Γ. Έστω ένα τµήµα µεταγραφόµενου κλώνου DΝΑ µε την ακόλουθη αλληλουχία βάσεων: 5 ' TCACGGAATTTCTAGCAT-3 '. 1. Με δεδοµένο ότι δε µεσολαβεί στάδιο ωρίµανσης, να γράψετε το m-rνα που θα προκύψει από τη µεταγραφή του παραπάνω τµήµατος DΝΑ, σηµειώνοντας ταυτόχρονα τη θέση του 5' και 3 ' άκρου του m-rνα. (Μονάδες 3) 2. Να γραφούν τα αντικωδικόνια τωνt-rνα µε τη σειρά που συµµετέχουν στη µετάφραση του παραπάνω m-rνα. (Μονάδες 7) 2001 ΗΜΕΡΗΣΙΟ 2. Να αναφέρετε τις ειδικές θέσεις που έχει κάθε µόριο trna και να εξηγήσετε το ρόλο των trna στην πρωτεϊνοσύνθεση ΕΣΠΕΡΙΝΟ 1. Ποια είναι (ονοµαστικά) τα 4 είδη RNA; Β. Να γράψετε στο τετράδιό σας τα γράµµατα της στήλης Ι και δίπλα σε κάθε γράµµα τον αριθµό της στήλης ΙΙ που συσχετίζει σωστά τους όρους. Ι ΙΙ α. ζυµοµύκητες 1. βακτήριο β. πλασµίδιο 2. εσώνιο γ. κωδικόνιο 3. ιστόνες δ. νουκλεόσωµα 4. τριπλέτα 5. µικροέγχυση 6. ζύµωση 2. Οι περιοριστικές ενδονουκλεάσες συνδέουν κοµµάτια του DNA ενώ η DNA δεσµάση κόβει κάθε αλυσίδα του DNA σε συγκεκριµένες θέσεις. (Σ Λ) 1. Η αλληλουχία των στο µόριο ενός mrna καθορίζει την αλληλουχία των αµινοξέων της αντίστοιχης. 2. Ο γενετικός κώδικας είναι, δηλαδή το mrna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 1

2 ίνεται τυχαίο τµήµα ενός µορίου mrna: - AUU - UCA - CCU - CUU - CGA - CAA - 1. εδοµένου ότι το mrna αυτό δεν υπέστη διαδικασία ωρίµανσης, να γράψετε στο τετράδιό σας το δίκλωνο µόριο του DNA απ' το οποίο προήλθε. 2. Πόσα αµινοξέα κωδικοποιεί το τµήµα αυτό; 3. Στο αρχικό DNA ποιο ζευγάρι βάσεων συµµετέχει σε ποσοστό µεγαλύτερο του 50%; 2001 ΟΜΟΓΕΝΕΙΣ 2. Κάθε µεταφορικό RNA (trna): α. µεταφέρει ένα συγκεκριµένο αµινοξύ στο ριβόσωµα; β. µεταφέρει ενέργεια στα ριβοσώµατα; γ. µεταφέρει τη γενετική πληροφορία; Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 2. Να αναφέρετε τα βασικά χαρακτηριστικά του γενετικού κώδικα και να τα περιγράψετε. Μονάδες Να περιγράψετε τη διαδικασία σχηµατισµού "ώριµου" mrnα. Μονάδες ΕΣΠΕΡΙΝΟ 1. Οι DNA πολυµεράσες που συµµετέχουν στην αντιγραφή του DNA µπορούν να ξεκινήσουν τη διαδικασία της αντιγραφής, αν βοηθηθούν από α. τα ένζυµα που διορθώνουν τα λάθη της αντιγραφής. β. το πριµόσωµα. γ. τη DNA δεσµάση. δ. το κωδικόνιο. 1. Το πρόδροµο mrna µετατρέπεται σε mrna µε τη διαδικασία της..., κατά την οποία τα... κόβονται από µικρά ριβονουκλεοπρωτεϊνικά σωµατίδια και αποµακρύνονται. Μονάδες 9 2. Τι είναι το πολύσωµα; Μονάδες 4 3. Τι είναι το νουκλεόσωµα; Μονάδες 4 ίνεται τµήµα διπλής έλικας του DNA : ATG CGA CCT TCA CGA CTT TAA αλυσίδα Ι TAC GCT GGA AGT GCT GAA ATT αλυσίδαιι α) Ποια από τις δύο αλυσίδες έχει προσανατολισµό 3 5 και ποια 5 3 ; Ποια από τις δύο αλυσίδες είναι η µεταγραφόµενη και γιατί; β) Ποιο είναι το mrna που θα προκύψει από τη µεταγραφόµενη αλυσίδα; γ) Το mrna που προκύπτει από τη συγκεκριµένη µεταγραφόµενη αλυσίδα δεν υφίσταται διαδικασία ωρίµανσης. Να γράψετε στο τετράδιό σας τα trna που θα πάρουν µέρος στη µετάφραση. Μονάδες ΟΜΟΓΕΝΕΙΣ 2. Το πρόδροµο mrna στα ευκαρυωτικά κύτταρα είναι : α. ίσο σε µέγεθος µε το ώριµο mrna 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 2

3 β. µεγαλύτερο σε µέγεθος από το ώριµο mrna γ. µικρότερο σε µέγεθος από το ώριµο mrna. Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 3. Η DNA ελικάση : α. σπάει τους υδρογονικούς δεσµούς στο δίκλωνο µόριο του DNA β. τοποθετεί νουκλεοτίδια γ. επιδιορθώνει λάθη της αντιγραφής Μονάδες 2 Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 2. Να περιγράψετε πώς ρυθµίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα ΗΜΕΡΗΣΙΟ 1. Ο καταστολέας κωδικοποιείται από ένα ρυθµιστικό γονίδιο, που βρίσκεται µπροστά από τον υποκινητή. (Σ-Λ) Μονάδες 2 ίδεται το παρακάτω τµήµα DNA, το οποίο είναι υπεύθυνο για τη σύνθεση του πεπτιδίου: ισολευκίνη τυροσίνη ισολευκίνη τυροσίνη - ισολευκίνη και η διεύθυνση της µεταγραφής διεύθυνση της µεταγραφής 1. Να µεταφέρετε το παραπάνω σχήµα στο τετράδιό σας και να σηµειώσετε επάνω σ αυτό τα κωδικόνια του DNA, που κωδικοποιούν το τµήµα του πεπτιδίου αυτού (Μονάδες 3) και να δικαιολογήσετε την απάντησή σας (Μονάδες 9). Μονάδες Μετάλλαξη που έγινε σ ένα σηµείο στο παραπάνω DNA έδωσε το πεπτίδιο: τυροσίνη ισολευκίνη τυροσίνη ισολευκίνη - τυροσίνη Να εντοπίσετε το είδος της µετάλλαξης () και να αιτιολογήσετε την απάντησή σας (Μονάδες 7). Μονάδες 13 ίδονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων. Τυροσίνη UAU Ισολευκίνη AUA 2003 ΕΣΠΕΡΙΝΟ 3. Ο γενετικός κώδικας είναι α. ο αριθµός των γονιδίων του κυττάρου. β. η αντιστοίχιση τριπλετών βάσεων σε αµινοξέα. γ. το σύνολο των ενζύµων ενός κυττάρου. δ. ο τρόπος αντιστοίχισης των νουκλεοτιδίων µεταξύ τους. 5. Το είδος του RNA που µεταφέρει στα ριβοσώµατα την πληροφορία για τη σύνθεση µιας πολυπεπτιδικής αλυσίδας είναι το α. ριβοσωµικό RNA (rrna). β. µικρό πυρηνικό RNA (snrna). γ. αγγελιαφόρο RNA (mrna). 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 3

4 δ. µεταφορικό RNA (trna). 1. Κάθε µόριο trna έχει µια ειδική τριπλέτα νουκλεοτιδίων, το, µε την οποία προσδένεται, λόγω συµπληρωµατικότητας, µε το αντίστοιχο του mrna. 2. Τι είναι το κωδικόνιο έναρξης και τι τα συνώνυµα κωδικόνια; 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 4 ίνονται τα παρακάτω αµινοξέα και, δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αµινοξέα αυτά: τυροσίνη (tyr) UAU φαινυλαλανίνη (phe) UUU προλίνη (pro) CCC α) Αξιοποιώντας τις παραπάνω πληροφορίες να δώσετε το mrna που κωδικοποιεί το ακόλουθο τµήµα πολυπεπτιδικής αλυσίδας:... - phe phe pro tyr tyr pro -... β) Να γράψετε την κωδική αλυσίδα του DNA και τη συµπληρωµατική της, προσδιορίζοντας το 3 και 5 άκρο καθεµιάς απ αυτές. Μονάδες 15 γ) Πόσοι είναι οι δεσµοί υδρογόνου που σταθεροποιούν τις δύο πολυνουκλεοτιδικές αλυσίδες στο παραπάνω µόριο του DNA; 2003 ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ 2. Οι DNA πολυµεράσες είναι ένζυµα που συµµετέχουν στην αντιγραφή των µορίων DNA. Μονάδες 2 2. Η διαδικασία µεταγραφής οδηγεί στο σχηµατισµό µορίων : α. DNA β. c DNA γ. RNA δ. πρωτεϊνών. 3. Η RNA πολυµεράση προσδένεται : α. στον υποκινητή β. στην 3 αµετάφραστη περιοχή γ. στα εσώνια δ. στις αλληλουχίες λήξης ΟΜΟΓΕΝΕΙΣ Β. Τι ονοµάζεται πολύσωµα; ίδεται το παρακάτω τµήµα µορίου προκαρυωτικού DNA, στο οποίο κωδικοποιείται η γενετική πληροφορία για τη σύνθεση µικρής αλυσίδας αµινοξέων: (I)... TTTTACGTTATGAAAGATACTCGGCTC (II)... AAAATGCAATACTTTCTATGAGCCGAG... α. Σε ποια από τις αλυσίδες, (Ι) ή (ΙΙ), βρίσκεται η γενετική πληροφορία και γιατί; β. Να γράψετε το µόριο του m-rna το οποίο σχηµατίζεται κατά τη µεταγραφή του παραπάνω DNA και να ορίσετε το 3 και το 5 άκρο του µορίου αυτού. γ. Πόσα αµινοξέα έχει η αλυσίδα που σχηµατίζεται και γιατί; δ. Να γράψετε τα αντικωδικόνια των trna που συµµετέχουν στη µετάφραση του παραπάνω µορίου mrna.

5 2004 ΗΜΕΡΗΣΙΟ 1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. 5. Τα ένζυµα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι α. DNA ελικάσες και DNA δεσµάση. β. RNA πολυµεράσες και πριµόσωµα. γ. DNA δεσµάση και επιδιορθωτικά ένζυµα. δ. DNA πολυµεράσες και επιδιορθωτικά ένζυµα. ΘΕΜΑ 2ο 1. Ποια είδη RNA παράγονται κατά τη µεταγραφή του DNA προκαρυωτικού κυττάρου (µονάδες 3) και ποιος είναι ο ρόλος τους (µονάδες 6); Μονάδες ΕΣΠΕΡΙΝΟ 1. Το γεγονός ότι κάθε νουκλεοτίδιο του γενετικού κώδικα ανήκει σε ένα µόνο κωδικόνιο οδηγεί στο χαρακτηρισµό του κώδικα ως α. συνεχούς. β. µη επικαλυπτόµενου. γ. εκφυλισµένου. δ. σχεδόν καθολικού ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ 1. Ποιες λειτουργίες επιτελούν τα ένζυµα DNA πολυµεράσες κατά την αντιγραφή του DNA; 2004 ΟΜΟΓΕΝΕΙΣ 2. Η αντιγραφή του DNA αρχίζει µε το σπάσιµο των υδρογονικών δεσµών µεταξύ των δύο συµπληρωµατικών αλυσίδων µε τη βοήθεια ενζύµων που ονοµάζονται α. DNA πολυµεράσες. β. DNA ελικάσες. γ. DNA δεσµάσες. δ. RNA πολυµεράσες. ΘΕΜΑ 3ο Α. Σε µια θέση έναρξης αντιγραφής του DNA, η σύνθεση στη µια αλυσίδα είναι συνεχής, όπως φαίνεται στο παρακάτω σχήµα: α. Να µεταφέρετε στο τετράδιό σας το παραπάνω σχήµα, να σχεδιάσετε σ αυτό όλες τις νεοσυντιθέµενες αλυσίδες του DNA και να σηµειώσετε τον προσανατολισµό τους, γράφοντας τα 3 και 5 άκρα. β. Η σύνθεση των νέων αλυσίδων του DNA γίνεται είτε µε συνεχή είτε µε ασυνεχή τρόπο. Γιατί συµβαίνει αυτό; 2005 ΗΜΕΡΗΣΙΟ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 5

6 ίνεται τµήµα µορίου DNA ευκαρυωτικού κυττάρου που περιέχει ασυνεχές γονίδιο, το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου, που δεν έχει υποστεί καµιά τροποποίηση: εσώνιο G A A T T C A T G T T T CCCCAG G T T T A A G A A T T C C T T A A G T A C A A A GGGGTC C A A A T T C T T A A G εσώνιο H 2 N - Μεθειονίνη - φαινυλαλανίνη - βαλίνη - COOH Να γράψετε την κωδική και τη µη κωδική αλυσίδα του γονιδίου, το πρόδροµο m-rna και το ώριµο m- RNA (Μονάδες 4) και να ορίσετε τα 3 και 5 άκρα των παραπάνω νουκλεοτιδικών αλυσίδων αιτιολογώντας την απάντησή σας (). Να αναφέρετε τις διαδικασίες κατά την πορεία από το γονίδιο στο πεπτίδιο και τις περιοχές του κυττάρου στις οποίες πραγµατοποιούνται (). Πώς µπορούµε να δηµιουργήσουµε ένα ανασυνδυασµένο πλασµίδιο, που να περιέχει το συγκεκριµένο γονίδιο χρησιµοποιώντας την περιοριστική ενδονουκλεάση EcoRI; (Μονάδες 7). ίνονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων από το γενετικό κώδικα: Μεθειονίνη ΑUG Φαινυλαλανίνη UUU Βαλίνη GUU Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΑ ΗΜΕΡΗΣΙΟ ίνονται τρία κωδικόνια ενός τµήµατος γονιδίου από ένα µόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τµήµατος µιας πρωτεΐνης, και η διεύθυνση της µεταγραφής. Αλυσίδα 1. ACA AAG ATA.. ελεύθερο υδροξύλιο Αλυσίδα 2 TGT TTC TAT.. ιεύθυνση µεταγραφής Να ορίσετε τα άκρα 3 και 5 των παραπάνω αλυσίδων DNA και να αιτιολογήσετε την απάντησή σας (). Να γράψετε την αλληλουχία των βάσεων του τµήµατος του mrna που προκύπτει από τη µεταγραφή, σηµειώνοντας τα άκρα 3 και 5 και να αιτιολογήσετε την απάντησή σας (Μονάδες 7). Ποιο ένζυµο καταλύει το µηχανισµό της µεταγραφής και ποια είναι η δράση του µετά την πρόσδεσή του στον υποκινητή (Μονάδες 7); Τι επιπτώσεις µπορεί να έχει στη λειτουργικότητα της πρωτεΐνης, η οποία δεν τροποποιείται, η προσθήκη τριών διαδοχικών βάσεων που δεν κωδικοποιούν κωδικόνιο λήξης ή µιας βάσης, µεταξύ των παραπάνω κωδικονίων (); Μονάδες ΕΣΠΕΡΙΝΟ 1. Οι DNA πολυµεράσες, µεταξύ άλλων, α. καταλύουν την ωρίµανση του πρόδροµου mrνα. β. αρχίζουν την αντιγραφή του DNA. γ. επιδιορθώνουν λάθη που συµβαίνουν στην αντιγραφή του DNA. δ. συνδέουν τα κοµµάτια της ασυνεχούς αλυσίδας του DNA. Μονάδες 3 1. Ο γενετικός κώδικας είναι µη επικαλυπτόµενος, δηλαδή κάθε κωδικόνιο ανήκει σε ένα µόνο νουκλεοτίδιο. (Σ-Λ) Μονάδες 3 Η αλληλουχία των βάσεων ενός βακτηριακού mrna είναι: A U G A A A U U U C C C G G G G A U U G A U A A 1. Να γράψετε στο τετράδιό σας την αλληλουχία των βάσεων του δίκλωνου µορίου DNA από το οποίο προήλθε. 2. Πόσα αµινοξέα συγκροτούν την ολιγοπεπτιδική αλυσίδαπου θα προκύψει από την µετάφραση του παραπάνω µορίου mrna; Να δικαιολογήσετε την απάντησή σας. 3. Να γράψετε στο τετράδιό σας το µόριο του mrna επισηµαίνοντας το 5 και το 3 άκρο της αλυσίδας του. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 6

7 Μονάδες 2 4. Στο µόριο του mrna που σας δόθηκε υπάρχει µία τριπλέτα η οποία, σύµφωνα µε το γενετικό κώδικα, απαντάται σε κάθε µόριο mrna. Ποια είναι αυτή, πώς ονοµάζεται και ποιο αµινοξύ κωδικοποιεί; Μονάδες ΟΜΟΓΕΝΕΙΣ 5. Η µεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώµατα. β. στο κυτταρόπλασµα. γ. στον πυρήνα. δ. στο κεντροµερίδιο. 3. Ποια είναι τα είδη του RNA και ποιος είναι ο ρόλος κάθε είδους; 2006 ΕΣΠΕΡΙΝΟ 1. H µεταγραφή του DNA καταλύεται από την α. DNA πολυµεράση. β. RNA πολυµεράση. γ. DNA δεσµάση και DNA πολυµεράση. δ. DNA πολυµεράση και RNA πολυµεράση. B. Ποια είναι τα τέσσερα είδη µορίων RNA που παράγονται µε τη µεταγραφή και ποιος ο ρόλος του καθενός από αυτά; 4. Οι DNA ελικάσες σπάνε τους δεσµούς υδρογόνου µεταξύ δύο πολυνουκλεοτιδικών αλυσίδων RNA. (Σ-Λ) Μονάδες ΗΜΕΡΗΣΙΟ 2. Η ωρίµανση του RNA είναι µια διαδικασία η οποία α. οδηγεί στη δηµιουργία m-rna χωρίς εξώνια. β. καταλύεται από το ένζυµο DNA ελικάση. γ. συµβαίνει µόνο στους προκαρυωτικούς οργανισµούς. δ. συµβαίνει µόνο στους ευκαρυωτικούς οργανισµούς. ΘΕΜΑ 2ο 1. Τι είναι το πριµόσωµα και ποιος είναι ο ρόλος του στην αντιγραφή του DNA; Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ 1. Πολύσωµα είναι α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. οµάδα ριβοσωµάτων στο κυτταρόπλασµα. γ. το σύνολο των εξωνίων ενός ώριµου mrna. δ. το σύµπλεγµα πολλών ριβοσωµάτων µε το mrna. ίνεται το πεπτίδιο H 2 N Μεθειονίνη Αλανίνη Τυροσίνη Προλίνη Σερίνη COOH, που κωδικοποιείται από το παρακάτω τµήµα µορίου DNA ευκαρυωτικού κυττάρου: 5 C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 3 G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 Να γράψετε την αλληλουχία του πρόδροµου mrna, την αλληλουχία του ώριµου mrna που προκύπτει µετά τη µεταγραφή του παραπάνω τµήµατος DNA και να αιτιολογήσετε την απάντησή σας (µονάδες 9). 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 7

8 Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τµήµα του µορίου DNA (µονάδες 8). Να περιγράψετε τη διαδικασία ωρίµανσης του πρόδροµου mrna (µονάδες 8). ίνονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων από το γενετικό κώδικα: Αλανίνη GCC Σερίνη AGC Προλίνη CCC Μεθειονίνη AUG Τυροσίνη UAU Μονάδες ΟΜΟΓΕΝΕΙΣ 2. Πολύσωµα είναι α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. οµάδα ριβοσωµάτων στο κυτταρόπλασµα. γ. το σύνολο των εξωνίων του ώριµου mrna. δ. το σύµπλεγµα πολλών ριβοσωµάτων µε το mrna. Β. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αµινοξέων στις πρωτεΐνες µε βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mrna µε αµινοξέα πρωτεϊνών, ο οποίος ονοµάζεται γενετικός κώδικας. 1. Τι σηµαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός»; 2. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισµένος; 2007 ΗΜΕΡΗΣΙΟ 1. Τα πρωταρχικά τµήµατα κατά την αντιγραφή του DNA συντίθενται από α. την DNA πολυµεράση. β. την DNA δεσµάση. γ. το πριµόσωµα. δ. το πολύσωµα. 2. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται; Μονάδες ΕΣΠΕΡΙΝΟ 1. Το κωδικόνιο είναι α. µία τριάδα νουκλεοτιδίων. β. µία τριάδα αµινοξέων. γ. έξι νουκλεοτίδια συνδεδεµένα µε δεσµούς υδρογόνου. δ. το αµινοξύ µεθειονίνη. Μονάδες 3 2. Κάθε µεταφορικό RNA α. σχηµατίζει το ριβόσωµα. β. περιέχει θυµίνη. γ. καταλύει την ωρίµανση του mrna. δ. µεταφέρει ένα συγκεκριµένο αµινοξύ στο ριβόσωµα. Μονάδες 3 B. Να αναφέρετε ονοµαστικά τα ένζυµα της αντιγραφής του DNA. ίνονται πέντε αµινοξέα και δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αµινοξέα αυτά: τυροσίνη (tyr) UAU µεθειονίνη (met) AUG φαινυλαλανίνη (phe) UUU γλυκίνη (gly) GGG προλίνη (pro) CCC Τα πέντε παραπάνω αµινοξέα συγκροτούν ολιγοπεπτίδιο κάποιου βακτηριακού κυττάρου. α. Να γράψετε στο τετράδιό σας ποιο είναι το πρώτο (αρχικό) και ποιο το τέταρτο αµινοξύ του ολιγοπεπτιδίου. phe pro gly 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 8

9 Μονάδες 4 β. Να γράψετε µία αλληλουχία νουκλεοτιδίων του mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. γ. Να γράψετε την αλληλουχία των νουκλεοτιδίων της κωδικής αλυσίδας του DNA (µονάδες 6) και να σηµειώσετε το 5 και το 3 άκρο της (µονάδες 3). Μονάδες 9 δ. Πόσα άτοµα φωσφόρου υπάρχουν στη διπλή έλικα του DNA που κωδικοποιεί αυτό το ολιγοπεπτίδιο; ικαιολογείστε την απάντησή σας ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ 1. Από RNA αποτελούνται α. τα πρωταρχικά τµήµατα. β. οι υποκινητές. γ. οι µεταγραφικοί παράγοντες. δ. τα πριµοσώµατα. ΘΕΜΑ 3ο ίνεται το παρακάτω τµήµα µορίου βακτηριακού mrna. 5...Α G A U G A A A G C C A C G G A G C C C U G A G C A A... 3 Από τη µετάφραση αυτού του mrna προκύπτει µία πεπτιδική αλυσίδα. 1. Ποιος είναι ο αριθµός των αµινοξέων που αποτελούν αυτή την πεπτιδική αλυσίδα; (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 8) 2. Να περιγράψετε το στάδιο έναρξης της πρωτεϊνοσύνθεσης. 3. Να περιγράψετε το δεσµό µε τον οποίο ενώνονται µεταξύ τους δύο διαδοχικά νουκλεοτίδια σε ένα µόριο mrna. Μονάδες ΟΜΟΓΕΝΕΙΣ 1. Η DNA δεσµάση α. ενώνει τα κοµµάτια της αλυσίδας DNA που αντιγράφεται ασυνεχώς. β. είναι το ένζυµο µε το οποίο σχηµατίζονται τα πρωταρχικά τµήµατα. γ. είναι το κύριο ένζυµο της αντιγραφής. δ. επιδιορθώνει τα λάθη της αντιγραφής. ίνεται το παρακάτω τµήµα µορίου βακτηριακού DNA που κωδικοποιεί ένα πεπτίδιο µε έξι αµινοξέα: 5... CCGΑTGACCAAACCTCACGCCTAGACC GGCTACTGGTTTGGAGTGCGGATCTGG... 5 Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η µη κωδική; (µονάδες 4) Να αιτιολογήσετε την απάντησή σας. (µονάδες 9) Μονάδες 13 Να γράψετε την αλληλουχία του mrna που προκύπτει από τη µεταγραφή του παραπάνω τµήµατος DNA. Μονάδες 3 Να γράψετε την αλληλουχία των αµινοξέων του πεπτιδίου που προκύπτει από τη µετάφραση του παραπάνω mrna. Μονάδες 3 Να γράψετε τα αντικωδικόνια των trna µε τη σειρά που θα πάρουν µέρος στη µετάφραση του παραπάνω mrna. ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αµινοξέων από το γενετικό κώδικα: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 9

10 AUG Μεθειονίνη CCU Προλίνη AAA Λυσίνη ACC Θρεονίνη CAC Ιστιδίνη GCC Αλανίνη 2008 ΗΜΕΡΗΣΙΟ 3. Η µεταγραφή στα προκαρυωτικά κύτταρα πραγµατοποιείται: α. στον πυρήνα. β. στο κυτταρόπλασµα. γ. στα µιτοχόνδρια. δ. στο κυτταρικό τοίχωµα. ΘΕΜΑ 3ο Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία µε την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει µία πρωτεΐνη. 1. Πού αποσκοπεί κυρίως η ρύθµιση αυτή στην περίπτωση των βακτηρίων; 2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισµού, όπως τα νευρικά και τα µυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη µορφή και τη λειτουργία. Πώς ονοµάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ; 3. Ο µηχανισµός της µεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισµούς. Ποια είναι τα ρυθµιστικά στοιχεία της µεταγραφής του DNA, ποιο το ένζυµο που καταλύει τη µεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθµιση στο επίπεδο της µεταγραφής των ευκαρυωτικών οργανισµών; Μονάδες 12 Σε µια θέση τµήµατος µορίου DNA µε κλώνους Α και Β, έχει ξεκινήσει η αντιγραφή, όπως φαίνεται στο παρακάτω σχήµα. Η DNA-δεσµάση εκτός του ότι συνδέει όλα τα κοµµάτια που προκύπτουν από τις διάφορες θέσεις έναρξης αντιγραφής, δρα κατά την αντιγραφή του κλώνου Β. Σε κάθε κλώνο να συµπληρώσετε τον προσανατολισµό της αντιγραφής και να χαρακτηρίσετε τον τρόπο σύνθεσης των νέων αλυσίδων DNA (µονάδες 4). Ποιά ένζυµα τοποθετούν τα συµπληρωµατικά νουκλεοτίδια και ποιους άλλους ρόλους έχουν; (µονάδες 7). Στην κωδική αλυσίδα Α το γονίδιο, που είναι υπεύθυνο για την παραγωγή ενός πεπτιδίου, έχει την εξής αλληλουχία βάσεων: 5... ATG CCA TGC AAA CCG AAA TGA 3 Να γράψετε την αλληλουχία του mrna που προκύπτει (µονάδες 2). Κάποια αλλαγή που συνέβη στην παραπάνω κωδική αλυσίδα του DNA, έχει ως αποτέλεσµα το 4 ο κωδικόνιο στο µεταγραφόµενο mrna να έχει τις βάσεις UAA και ο αριθµός των κωδικονίων να παραµένει σταθερός. Αφού γράψετε το νέο mrna που προκύπτει, να εξηγήσετε ποια είναι η συγκεκριµένη αλλαγή που συνέβη και τι συνέπειες µπορεί να έχει για το πεπτίδιο; (µονάδες 8). 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 10

11 Γιατί η πρωτεϊνοσύνθεση στους ευκαρυωτικούς οργανισµούς είναι µια «οικονοµική διαδικασία»;(µονάδες 4). Μονάδες ΕΣΠΕΡΙΝΟ 5. Η ωρίµανση του mrna α. είναι µια διαδικασία που καταλύεται από DNA ελικάσες. β. συµβαίνει µόνο στους προκαρυωτικούς οργανισµούς. γ. συµβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων. δ. είναι µία διαδικασία στην οποία παραµένουν για µετάφραση τα εσώνια. 3. Γιατί ο µηχανισµός αυτοδιπλασιασµού του DNA ονοµάζεται ηµισυντηρητικός; ίνεται το παρακάτω τµήµα mrna που προκύπτει από τη µεταγραφή ενός γονιδίου βακτηριακού κυττάρου:... 5 AUG CCU CAU CGU UCU ACU UUU UAA 3... α. Να γράψετε στο τετράδιό σας τη µη κωδική αλυσίδα από την οποία προήλθε το παραπάνω mrna και να ορίσετε τον προσανατολισµό της. β. Αντικαθιστούµε µία τριπλέτα του παραπάνω mrna µε την τριπλέτα... 5 UGA 3... και το πεπτίδιο που κωδικοποιείται δεν υφίσταται την παραµικρή αλλαγή. Ποια είναι η τριπλέτα αυτή; (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 8) γ. Η τριπλέτα... 5 UCU 3... του παραπάνω mrna κωδικοποιεί το αµινοξύ σερίνη. Αν αντικαταστήσουµε αυτή την τριπλέτα µε την τριπλέτα... 5 UCC 3..., δεν προκύπτει η παραµικρή αλλαγή στο πεπτίδιο. Πώς ερµηνεύεται το γεγονός αυτό µε βάση τα χαρακτηριστικά του γενετικού κώδικα; 2008 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ 2. Πώς σχηµατίζεται το ώριµο mrna στα ευκαρυωτικά κύτταρα; 3. Ποιες ονοµάζονται θέσεις έναρξης της αντιγραφής του DNA (µονάδες 3), και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα; (µονάδες 4) Μονάδες ΟΜΟΓΕΝΕΙΣ 2. Το αντικωδικόνιο συνδέεται µε το κωδικόνιο κατά τη διαδικασία α. της αντιγραφής του DNA. β. της ωρίµανσης του πρόδροµου m-rna. γ. της µεταγραφής του DNA. δ. της µετάφρασης του m-rna. 2. Γιατί ο µηχανισµός αυτοδιπλασιασµού του DNA ονοµάστηκε ηµισυντηρητικός ΗΜΕΡΗΣΙΟ 1. Στο οπερόνιο της λακτόζης δεν περιλαµβάνεται α. χειριστής. β. υποκινητής. γ. snrna δ. δοµικά γονίδια. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 11

12 ίνεται δίκλωνο µόριο DNA το οποίο περιέχει τµήµα ασυνεχούς γονιδίου που µεταγράφεται σε mrna. α) Πού συναντάµε ασυνεχή γονίδια; (µονάδες 2) β) Να προσδιορίσετε τα 3 και 5 άκρα του παραπάνω µορίου DNA. (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) γ) Να γράψετε το τµήµα του πρόδροµου mrna και του ώριµου mrna που προκύπτουν από τη µεταγραφή του παραπάνω µορίου DNA, χωρίς αιτιολόγηση. (µονάδες 2) δ) Πώς προκύπτει το ώριµο mrna; (µονάδες 3) ε) Μπορεί η περιοριστική ενδονουκλεάση ΕcoRI να κόψει το παραπάνω τµήµα DNA; (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 3) στ) Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωµοσωµικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cdna βιβλιοθήκη; (µονάδες 8) Μονάδες ΕΣΠΕΡΙΝΟ 5. Το κωδικόνιο έναρξης της µετάφρασης του mrna σε όλους τους οργανισµούς είναι το α. ΑUG. β. UUU. γ. CAA. δ. UAA. ίνεται το παρακάτω τµήµα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής: 1. Στις θέσεις Α,Β,Γ,,Ε,Ζ να αντιστοιχίσετε τις ενδείξεις 3 ή 5 ώστε να φαίνεται ο προσανατολισµός των αρχικών και των νεοσυντιθέµενων αλυσίδων. 2. Τι είναι τα πρωταρχικά τµήµατα, πως δηµιουργούνται και πως επιµηκύνονται; Μονάδες 9 3. Εξηγήστε γιατί πρέπει, στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυµο DNA δεσµάση και πώς θα δράσει αυτό; 4. Ποια ένζυµα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής; Μονάδες ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 12

13 2. Η DNA δεσµάση α. επιδιορθώνει λάθη της αντιγραφής. β. συνδέει το αµινοξύ µε το trna. γ. συνδέει τµήµατα DNA. δ. µεταγράφει την πολυνουκλεοτιδική αλυσίδα. 3. Ποια γονίδια οργανώνονται σε οπερόνια; (µονάδες 3) Πώς επιτυγχάνεται η καταστολή στο οπερόνιο της λακτόζης; (µονάδες 6) ίνεται το παρακάτω τµήµα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αµινοξέα µιας πολυπεπτιδικής αλυσίδας. Η κατεύθυνση στην οποία κινείται η RNA πολυµεράση κατά τη µεταγραφή υποδεικνύεται από το βέλος. α. Ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η µη κωδική; (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 7) Μονάδες 9 β. Να γράψετε την αλληλουχία του mrna, που προκύπτει από τη µεταγραφή του παραπάνω DNA. Μονάδες 3 γ. Να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του trna, που µεταφέρει το 2 ο αµινοξύ της πολυπεπτιδικής αλυσίδας. δ. Τι είναι το σύµπλοκο έναρξης της πρωτεϊνοσύνθεσης (µονάδες 5) και ποια είναι η µετέπειτα πορεία του trna, που συµµετέχει σε αυτό; (µονάδες 3) 2009 ΟΜΟΓΕΝΕΙΣ 1. Πολύσωµα ονοµάζεται α. το σύµπλεγµα του DNA µε τις ιστόνες. β. η τρισωµία του 21 χρωµοσώµατος. γ. το σύµπλεγµα των ριβοσωµάτων µε το mrna. δ. το ειδικό σύµπλοκο που συνθέτει στις θέσεις έναρξης της αντιγραφής µικρά τµήµατα RNA. ΘΕΜΑ 3ο ίνεται το παρακάτω ολιγοπεπτίδιο έξι αµινοξέων το οποίο δεν έχει υποστεί καµία τροποποίηση µετά τη σύνθεσή του Η 2 Ν Μεθειονίνη Γλυκίνη Λυσίνη Τρυπτοφάνη Βαλίνη Αλανίνη - COOH Α. Με τη βοήθεια του τµήµατος του γενετικού κώδικα που παρατίθεται, γράψτε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισµό του τµήµατος mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. ικαιολογήστε την απάντησή σας. Μονάδες 13 Β. Γράψτε µε τον κατάλληλο προσανατολισµό την αλληλουχία νουκλεοτιδίων στο δίκλωνο µόριο DNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Ποια είναι η κωδική και ποια η µη κωδική αλυσίδα; Γ. Εάν η τριπλέτα 5 -UGG-3 στο mrna αντικατασταθεί από την τριπλέτα 5 -UGA-3, γράψτε την αλληλουχία των αµινοξέων στο νέο ολιγοπεπτίδιο που θα συντεθεί. ίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αµινοξέων από το γενετικό κώδικα: GUC Βαλίνη AUG Μεθειονίνη UGG Τρυπτοφάνη AAA Λυσίνη GGU Γλυκίνη GCC Αλανίνη 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 13

14 2010 ΗΜΕΡΗΣΙΟ Α3. Τα πρωταρχικά τµήµατα RNA συντίθενται από α. το πριµόσωµα β. το νουκλεόσωµα γ. την DΝΑ ελικάση δ. την DΝΑ δεσµάση Α5. Στο οπερόνιο της λακτόζης, όταν απουσιάζει η λακτόζη, η πρωτεΐνη καταστολέας συνδέεται µε α. τον υποκινητή β. το ρυθµιστικό γονίδιο γ. τον χειριστή δ. την RNA-πολυµεράση Β3. Τι είναι το πολύσωµα; 2010 ΕΣΠΕΡΙΝΟ Β3. Τι είναι το µικρό πυρηνικό RNΑ (snrnα) και ποιoς είναι ο ρόλος του; ίνεται τµήµα µορίου DNA ευκαρυωτικού κυττάρου που περιέχει το ασυνεχές γονίδιο το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου: H 2 N- µεθειονίνη αλανίνη λευκίνη ασπαραγίνη COOH 1. Να γράψετε την κωδική και τη µη κωδική αλυσίδα του γονιδίου. (µονάδες 4) Να αιτιολογήσετε την απάντησή σας. (µονάδες 6) 2.Να γράψετε το πρόδροµο mrna, το ώριµο mrna, το εσώνιο του γονιδίου (µονάδες 6) και να αιτιολογήσετε την απάντησή σας. (µονάδες 9) Μονάδες 15 ίνονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων: Aλανίνη = GCU Λευκίνη = UUG Ασπαραγίνη = AAU 2010 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α1. Τα ένζυµα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι α. η DNA δεσµάση και τα επιδιορθωτικά ένζυµα β. οι DNA πολυµεράσες και τα επιδιορθωτικά ένζυµα γ. οι DNA ελικάσες και η DNA δεσµάση δ. η RNA πολυµεράση και το πριµόσωµα ΘΕΜΑ Γ ίνεται το παρακάτω δίκλωνο µόριο DNA που κωδικοποιεί ένα πεπτίδιο, το οποίο λειτουργεί ως ένζυµο Γ1. Να γράψετε το mrna που θα προκύψει από τη µεταγραφή του παραπάνω τµήµατος DNA, ορίζοντας τα 5 και 3 άκρα του (µονάδες 2), και να δικαιολογήσετε την απάντησή σας (µονάδες 5). Μονάδες 7 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 14

15 Γ2. Να βρείτε τον αριθµό των αµινοξέων από τα οποία θα αποτελείται το ένζυµο µετά τη µετάφραση του παραπάνω mrna (µονάδες 2) και να δικαιολογήσετε την απάντησή σας µε βάση τις ιδιότητες του γενετικού κώδικα (µονάδες 8). Γ3. Να εξηγήσετε ποιο θα είναι το αποτέλεσµα στη λειτουργία του ενζύµου, αν συµβεί γονιδιακή µετάλλαξη, η οποία θα προκαλέσει έλλειψη του δεύτερου νουκλεοτιδίου στο δεύτερο κωδικόνιο του γονιδίου ΟΜΟΓΕΝΕΙΣ ίνεται το παρακάτω δίκλωνο τµήµα DNA το οποίο αντιγράφεται in vitro. Κατά τη διάρκεια της αντιγραφής οι DNA πολυµεράσες ενσωµατώνουν κατά λάθος στη θέση 12, απέναντι από το νουκλεοτίδιο Α (αδενίνη) το νουκλεοτίδιο C (κυτοσίνη), αντί του νουκλεοτιδίου T (θυµίνη). Το λάθος αυτό παραµένει και µετά το τέλος της αντιγραφής. 1. Να γράψετε τα δίκλωνα τµήµατα DNA που θα προκύψουν µετά το τέλος της αντιγραφής και να δικαιολογήσετε την απάντησή σας. Μονάδες ΗΜΕΡΗΣΙΟ Α4. Το γεγονός ότι κάθε νουκλεοτίδιο ανήκει σε ένα µόνο κωδικόνιο σηµαίνει ότι ο γενετικός κώδικας είναι α. συνεχής. β. µη επικαλυπτόµενος. γ. εκφυλισµένος. δ. σχεδόν καθολικός. Γ3. Μία πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από µία πολυπεπτιδική αλυσίδα 100 αµινοξέων. Το γονίδιο από το οποίο κωδικοποιήθηκε η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αµινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς. ίδεται το παραπάνω τµήµα DNA, το οποίο αντιγράφεται. Στον κλώνο ΖΗ η αντιγραφή γίνεται µε ασυνεχή τρόπο. Τα σηµεία και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. 1. Να µεταφέρετε στο τετράδιό σας το παραπάνω σχήµα, να σχεδιάσετε τα συνεχή και ασυνεχή τµήµατα των νέων κλώνων µε βέλη υποδεικνύοντας τους προσανατολισµούς των νέων και των µητρικών κλώνων (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 4). 2. Στον κλώνο που αντιγράφεται µε συνεχή τρόπο να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισµό του πρωταρχικού τµήµατος, το οποίο αποτελείται από 8 (οκτώ) νουκλεοτίδια (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 3). ίνεται το παρακάτω τµήµα µορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 15

16 3. Να γράψετε τα κωδικόνια του DNA που κωδικοποιούν το πεπτίδιο αυτό. Μονάδες ΕΣΠΕΡΙΝΟ Β2. Να ταξινοµήσετε τις παρακάτω µορφολογικές δοµές του γενετικού υλικού ενός ευκαρυωτικού κυττάρου αρχίζοντας από το µικρότερο προς το µεγαλύτερο βαθµό συσπείρωσης: 1. ινίδια χρωµατίνης 2. µεταφασικά χρωµοσώµατα 3. «χάντρες» νουκλεοσωµάτων 4. διπλή έλικα DNA 5. αδελφές χρωµατίδες Σ ένα µόριο DNA ευκαρυωτικού κυττάρου υπάρχουν δύο γονίδια Α και Β, όπως φαίνεται στο σχήµα: 1. Να µεταφέρετε το σχήµα στο τετράδιό σας και να ορίσετε τους προσανατολισµούς των αλυσίδων του DNA (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 4). 2. Τα γονίδια Α και Β µεταγράφονται σε RNA. Να ορίσετε τους προσανατολισµούς του RNA (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 4). 3. Ποια είναι η κωδική αλυσίδα για το γονίδιο Α και ποια για το Β (µονάδες 2); Να αιτιολογήσετε την απάντησή σας (µονάδες 5). Μονάδες 7 4. Τι είναι ο υποκινητής (µονάδες 2); Να ορίσετε τη θέση του υποκινητή για κάθε γονίδιο µε ένα βέλος (µονάδες 4) ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α3. Από RNA αποτελούνται α. οι υποκινητές. β. οι µεταγραφικοί παράγοντες. γ. τα πρωταρχικά τµήµατα. δ. οι RNA πολυµεράσες. Στο παρακάτω τµήµα δίκλωνου µορίου DNA, µεταξύ των σηµείων Κ και Λ περιέχεται ένα γονίδιο. Στο διάγραµµα υποδεικνύεται η θέση του υποκινητή του γονιδίου. Φωσφορική οµάδα Υποκινητής Κ Λ 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 16

17 Να µεταφέρετε το σχήµα στο τετράδιό σας. 1. Να σηµειώσετε στο σχήµα τους προσανατολισµούς των κλώνων του µορίου (µονάδες 2) και να αιτιολογήσετε την απάντησή σας. (µονάδες 4) 2. Να τοποθετήσετε στο σχήµα και στις κατάλληλες θέσεις το κωδικόνιο έναρξης του γονιδίου και ένα από τα κωδικόνια λήξης (της επιλογής σας). (µονάδες 4) Να αιτιολογήσετε την απάντησή σας. (µονάδες 9) Μονάδες Να εξηγήσετε τι γίνεται κατά την έναρξη της µεταγραφής ενός γονιδίου ΕΣΠΕΡΙΝΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Γ3. Ποιος είναι ο ρόλος του πριµοσώµατος στην αντιγραφή του DNA; 2011 ΟΜΟΓΕΝΕΙΣ A5. Κατά την αντιγραφή του DNΑ, στην κατασκευή των πρωταρχικών τµηµάτων συµµετέχει το α. ριβόσωµα. β. πολύσωµα. γ. νουκλεόσωµα. δ. πριµόσωµα. ίνεται το παρακάτω τµήµα δίκλωνου µορίου DNA που κωδικοποιεί το πεπτίδιο H 2 N-Μεθειονίνη-Τυροσίνη-Φαινυλαλανίνη-Φαινυλαλανίνη-Τυροσίνη-COOH. 1. Να εξηγήσετε ποια από τις δύο αλυσίδες του παραπάνω τµήµατος DNA είναι η κωδική και ποια είναι η µη κωδική αλυσίδα. (µονάδες 4) Να γράψετε τον προσανατολισµό των αλυσίδων (µονάδες 2) και να αιτιολογήσετε την απάντησή σας. (µονάδες 2) 2. Να γράψετε την αλληλουχία του πρόδροµου mrna που προκύπτει µετά τη µεταγραφή του παραπάνω τµήµατος DNA (µονάδες 2) καθώς και την αλληλουχία του ώριµου mrna (µονάδες 2). Να αιτιολογήσετε πού οφείλεται η διαφορά µεταξύ των δύο αυτών µορίων. (µονάδες 3) Μονάδες 7 ίνονται οι παρακάτω αντιστοιχίσεις αµινοξέων και κωδικονίων από το γενετικό κώδικα: Μεθειονίνη: AUG Τυροσίνη: UAC, UAU Φαινυλαλανίνη: UUU, UUC 2012 ΗΜΕΡΗΣΙΟ Α1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη µεταγραφή από το ένζυµο α. RNA πολυµεράση β. DNA πολυµεράση γ. DNA ελικάση δ. DNA δεσµάση. Α4. Σύνδεση κωδικονίου µε αντικωδικόνιο πραγµατοποιείται κατά την α. αντιγραφή β. µετάφραση γ. µεταγραφή δ. αντίστροφη µεταγραφή. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 17

18 ίνεται το παρακάτω τµήµα βακτηριακού DNA, το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. 1. Να προσδιορίσετε την κωδική και τη µη κωδική αλυσίδα του παραπάνω τµήµατος DNA, επισηµαίνοντας τα 5 και 3 άκρα των αλυσίδων του (µονάδες 1). Να αιτιολογήσετε την απάντησή σας (µονάδες 5). 2. Το παραπάνω τµήµα DNA αντιγράφεται, και κατά τη διαδικασία της αντιγραφής δηµιουργούνται τα παρακάτω πρωταρχικά τµήµατα: i) 5 -GAGAAUUC-3 ii) 5 -UUAAGCUA-3 iii) 5 -GUUGAAUU-3 Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, µε συνεχή και ποια µε ασυνεχή τρόπο (µονάδες 1). Να αιτιολογήσετε την απάντησή σας (µονάδες 5) ΕΣΠΕΡΙΝΟ Β3. Να εξηγήσετε γιατί η αντιγραφή του DNA έχει προσανατολισµό 5 προς 3. ίνεται το παρακάτω πεπτίδιο που παράγεται από ένα βακτήριο: HOOC µεθειονίνη αλανίνη σερίνη ασπαραγίνη µεθειονίνη NH 2 1. Να γράψετε το τµήµα του δίκλωνου DNA που κωδικοποιεί το παραπάνω πεπτίδιο (µονάδες 2). Να ορίσετε το 5 και 3 άκρο κάθε αλυσίδας (µονάδες 2) και να αιτιολογήσετε την απάντησή σας (µονάδες 4). Να καθορίσετε την κωδική και τη µη κωδική αλυσίδα (µονάδες 2) και να αιτιολογήσετε την απάντησή σας (µονάδες 5). ίνονται τα κωδικόνια : αλανίνη GCU, ασπαραγίνη AAU, µεθειονίνη AUG, σερίνη UCU. Το κωδικόνιο λήξης είναι το: UGA. Μονάδες Μπορεί η παραπάνω αλυσίδα να κοπεί από την περιοριστική ενδονουκλεάση EcoRI (µονάδες 1); Να αιτιολογήσετε την απάντησή σας (µονάδες 4). 3. Πώς σχηµατίζεται το σύµπλοκο έναρξης της πρωτεϊνοσύνθεσης (µονάδες 3); Από τι αποτελείται το πολύσωµα (µονάδες 2); 2012 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Β3. Με ποιους τρόπους περιορίζεται ο αριθµός των λαθών κατά την αντιγραφή του DNA στους ευκαρυωτικούς οργανισµούς; 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 18

19 2012 ΟΜΟΓΕΝΕΙΣ ίνεται το παρακάτω τµήµα DNA το οποίο αντιγράφεται. Τα σηµεία Α και Γ υποδεικνύουν τη θέση έναρξης της αντιγραφής. 1. Να µεταφέρετε στο τετράδιό σας το παραπάνω σχήµα και να σηµειώσετε πάνω σ αυτό τους προσανατολισµούς των µητρικών αλυσίδων (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). 2. Να σχεδιάσετε στο ίδιο σχήµα τα ασυνεχή και τα συνεχή τµήµατα των δύο νέων αλυσίδων µε βέλη και να σηµειώσετε πάνω σ αυτά τους προσανατολισµούς τους (Μονάδες 3). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Μονάδες 7 3. Η µητρική αλυσίδα του DNA που αντιγράφεται µε συνεχή τρόπο, αµέσως µετά µεταγράφεται. Να γράψετε το τµήµα του RNA που σχηµατίζεται κατά τη µεταγραφή και να σηµειώσετε τον προσανατολισµό του (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). 4. Ποια είναι η δράση της RNA πολυµεράσης µετά την πρόσδεσή της στον υποκινητή ενός γονιδίου; 2013 ΗΜΕΡΗΣΙΟ Α2. Επιδιορθωτικά ένζυµα χρησιµοποιούνται από το κύτταρο κατά α. τη µεταγραφή β. την αντιγραφή γ. την ωρίµανση δ. τη µετάφραση Α3. Το ένζυµο που προκαλεί τη διάσπαση των δεσµών υδρογόνου στη θέση έναρξης της αντιγραφής είναι α. η DNA ελικάση β. η RNA πολυµεράση γ. η DNA δεσµάση δ. το πριµόσωµα Β4. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισµένος; 3. Το πεπτίδιο που προκύπτει από τη µετάφραση του παραπάνω mrna είναι: H2N Μεθειονίνη Λυσίνη Προλίνη Γλυκίνη COOH Ποιο είναι το αντικωδικόνιο του trna που θα τοποθετηθεί στο ριβόσωµα µετά την αποσύνδεση του trna, το οποίο µεταφέρει το αµινοξύ λυσίνη (µονάδες 2); Να αιτιολογήσετε την απάντησή σας (µονάδες 6). 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 19

20 2013 ΕΣΠΕΡΙΝΟ Α5. Το µόριο που θα µεταφέρει την γενετική πληροφορία από τον πυρήνα στα ριβοσώµατα είναι το α. αγγελιοφόρο RNA (mrna) β. µεταφορικό RNA (trna) γ. ριβοσωµικό RNA (rrna) δ. µικρό πυρηνικό RNA (snrna) ίνεται µια αλυσίδα DNA ενός γονιδίου ευκαρυωτικού κυττάρου: 3 -TATACTCAACGTTCTAGTGAACTTTT-5 1. Να γράψετε τη συµπληρωµατική της αλυσίδα, σηµειώνοντας τον προσανατολισµό της. Μονάδες 2 2. Να γράψετε το πρόδροµο mrna που θα προκύψει από τη µεταγραφή του γονιδίου (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 5). Μονάδες 7 3. Το γονίδιο αυτό κωδικοποιεί το παρακάτω ολιγοπεπτίδιο: H 2 N Μεθειονίνη Σερίνη Ισολευκίνη Θρεονίνη COOH Να γράψετε το ώριµο mrna, η µετάφραση του οποίου δίνει το παραπάνω ολιγοπεπτίδιο (µονάδες 5). Να αναφέρετε ονοµαστικά τα χαρακτηριστικά του γενετικού κώδικα που εφαρµόστηκαν στην παραπάνω διαδικασία (µονάδες 5); 4. Να περιγράψετε την διαδικασία της ωρίµανσης του πρόδροµου mrna. ίνονται τα κωδικόνια: AUG : Μεθειονίνη AGU : Σερίνη AUC : Ισολευκίνη ACU : Θρεονίνη 2013 ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α1. Κατά την πρωτεϊνοσύνθεση το σύµπλεγµα των ριβοσωµάτων µε το mrna αποτελεί το α. σύµπλοκο έναρξης της πρωτεϊνοσύνθεσης β. σύµπλοκο λήξης της πρωτεϊνοσύνθεσης γ. πριµόσωµα δ. πολύσωµα. Β2. Να ονοµάσετε τα ρυθµιστικά στοιχεία της µεταγραφής (µονάδες 2) και να εξηγήσετε ποιος είναι ο ρόλος τους στη µεταγραφή των γονιδίων στα ευκαρυωτικά κύτταρα (µονάδες 6). ίνεται το παρακάτω τµήµα δίκλωνου µορίου DNA, το οποίο περιέχει ένα συνεχές γονίδιο. ίνεται, επίσης, ο υποκινητής του παραπάνω γονιδίου. 5 -TATAA-3 3 -ATATT-5 1. Να γράψετε το παραπάνω τµήµα δίκλωνου µορίου DNA, σηµειώνοντας τον προσανατολισµό των αλυσίδων. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 20

21 Μονάδες 2 2. Να γράψετε το mrna που προκύπτει από τη µεταγραφή του παραπάνω γονιδίου, σηµειώνοντας τον προσανατολισµό του (µονάδες 2). Να αιτιολογήσετε την απάντησή σας (µονάδες 6) ΟΜΟΓΕΝΕΙΣ A2. Στα γονίδια των ευκαρυωτικών οργανισµών οι αλληλουχίες που µεταφράζονται σε αµινοξέα ονοµάζονται α. εσώνια. β. εξώνια. γ. υποκινητές. δ. 5 αµετάφραστες περιοχές. B1. Τι ονοµάζεται οπερόνιο; Μονάδες 4 ΘΕΜΑ Γ ίνεται το παρακάτω τµήµα DNA, το οποίο περιέχει ένα συνεχές γονίδιο: Γ1. Να προσδιορίσετε την κωδική και τη µη κωδική αλυσίδα του παραπάνω τµήµατος DNA, επισηµαίνοντας τα 5 και 3 άκρα των αλυσίδων του. (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 6) Γ2. Να γράψετε την αλληλουχία του mrna που προκύπτει από την µεταγραφή του παραπάνω τµήµατος DNA. Μονάδες 3 Γ3. Να προσδιορίσετε αν ο υποκινητής του γονιδίου αυτού βρίσκεται στη θέση Α ή στη θέση Β. (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 3) Μονάδες ΗΜΕΡΗΣΙΟ Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna. Β2. Να αναφέρετε ονοµαστικά τα ένζυµα ή τα σύµπλοκα ενζύµων τα οποία καταλύουν τις παρακάτω διαδικασίες α. Επιµήκυνση πρωταρχικού τµήµατος κατά την αντιγραφή. β. Σύνθεση πρωταρχικών τµηµάτων. γ. Σύνδεση των κοµµατιών της ασυνεχούς αλυσίδας µεταξύ τους κατά την αντιγραφή. δ. Ξετύλιγµα της διπλής έλικας του DNA κατά την αντιγραφή. ε. Σύνδεση ριβονουκλεοτιδίων κατά τη µεταγραφή. ίνεται τµήµα DNA το οποίο κωδικοποιεί τα οκτώ πρώτα αµινοξέα του πρώτου δοµικού γονιδίου του οπερονίου της λακτόζης. 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 21

22 1. Να εντοπίσετε την κωδική αλυσίδα. (µονάδα 1) Να σηµειώσετε τον προσανατολισµό των αλυσίδων. (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) 2. Να γράψετε το τµήµα του mrna που θα προκύψει από τη µεταγραφή του παραπάνω τµήµατος του γονιδίου και να ορίσετε τα 5 και 3 άκρα του. (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 3) 3. Να γράψετε το τµήµα του mrna στο οποίο θα συνδεθεί η µικρή ριβοσωµική υποµονάδα κατά την έναρξη της µετάφρασης. Μονάδες ΕΣΠΕΡΙΝΟ Β3. Γιατί ο γενετικός κώδικας χαρακτηρίζεται σχεδόν καθολικός; Γ2. Στο παρακάτω σχήµα απεικονίζεται µια θηλιά αντιγραφής. Ποια από τα τµήµατα Α, Β, Γ και αντιγράφονται συνεχώς και ποια αντιγράφονται ασυνεχώς; (µονάδες 4) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) Γ3. Το γενετικό υλικό των ευκαρυωτικών κυττάρων αν και είναι πολύ µεγαλύτερο από το γενετικό υλικό των προκαρυωτικών κυττάρων, αντιγράφεται πολύ γρήγορα. Για ποιο λόγο συµβαίνει αυτό; Γ4. Γιατί ο τρόπος αντιγραφής του DNA ονοµάζεται ηµισυντηρητικός; (µονάδες 4) Ποια είναι η σηµασία της συµπληρωµατικότητας των αλυσίδων της διπλής έλικας του DNA; (µονάδες 3) Μονάδες 7 ίνεται το παρακάτω τµήµα DNA προκαρυωτικού κυττάρου το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. 1. Να εντοπίσετε την κωδική αλυσίδα. (µονάδα 1) Να σηµειώσετε τον προσανατολισµό των αλυσίδων. (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) 2. Να γράψετε το mrna που προκύπτει από τη µεταγραφή του παραπάνω τµήµατος DNA και να ορίσετε τα 5 και 3 άκρα του. (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 22

23 3. Από πόσα αµινοξέα θα αποτελείται το ολιγοπεπτίδιο το οποίο παράγεται; (µονάδες 2) Να αιτιολογήσετε την απάντησή σας. (µονάδες 6) 4. Να γράψετε τα αντικωδικόνια, µε τον προσανατολισµό τους, τα οποία θα χρησιµοποιηθούν κατά τη µετάφραση του mrna ΗΜΕΡΗΣΙΟ ΕΠΑΝΑΛΗΠΤΙΚΑ Α 2. Ο υποκινητής είναι α. αλληλουχία λήξης της µεταγραφής β. ειδική περιοχή πρόσδεσης της RNA πολυµεράσης στο DNA γ. τµήµα εσωνίου ενός γονιδίου δ. ρυθµιστικό γονίδιο. Β1. Τι ονοµάζεται γενετικός κώδικας; (µονάδες 3) Γιατί ο χαρακτηρίζεται ως σχεδόν καθολικός και ποια είναι η αυτής της ιδιότητάς του; (µονάδες 4) Στην Εικόνα 2 δίνεται τµήµα DNA το οποίο περιέχει το συνεχές ανθρώπινο γονίδιο που επιθυµούµε να εισαγάγουµε στο πλασµίδιο της Εικόνας Να εντοπίσετε την κωδική αλυσίδα του γονιδίου της Εικόνας 2. (µονάδα 1) Να γράψετε το mrna και να σηµειώσετε τον προσανατολισµό του. (µονάδες 2) Nα αιτιολογήσετε την απάντησή σας. (µονάδες 4) Μονάδες ΟΜΟΓΕΝΕΙΣ A1. Η DNA δεσµάση α. διασπά τµήµατα DNA β. συνδέει τµήµατα DNA γ. διασπά δεσµούς υδρογόνου δ. συνθέτει πρωταρχικά τµήµατα RNA. B1. Nα βάλετε στη σωστή σειρά τα παρακάτω στάδια που οδηγούν στην παραγωγή µιας λειτουργικής πρωτεΐνης σε ένα ευκαρυωτικό κύτταρο. Να γράψετε στο τετράδιό σας µόνο τους αριθµούς που αντιστοιχούν στα στάδια αυτά. 1) Μετάφραση του mrna. 2) Μεταφορά του mrna στο κυτταρόπλασµα. 3) Τροποποίηση πρωτεΐνης. 4) Ωρίµανση του mrna. 5) Μεταγραφή του γονιδίου. B2. Να γράψετε µε τη σωστή σειρά τα δοµικά µέρη του οπερονίου της λακτόζης (µονάδες 4) και να εξηγήσετε το ρόλο της πρωτεΐνης-καταστολέα. (µονάδες 4) Στην Εικόνα 1 δίνεται τµήµα DNA, το οποίο περιέχει ένα συνεχές γονίδιο: 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 23

24 1. Να προσδιορίσετε την κωδική αλυσίδα του τµήµατος DNA στην Εικόνα 1 (µονάδα 1), επισηµαίνοντας τα 5 και 3 άκρα των αλυσίδων του. (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 4) 2. Να γράψετε την αλληλουχία του mrna που προκύπτει από την µεταγραφή του γονιδίου στην Εικόνα 1 (µονάδα 1) και να ορίσετε τα 5 και 3 άκρα του. (µονάδα 1) Να αιτιολογήσετε την απάντησή σας. (µονάδες 3) 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ 24

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ)

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2013 2 0 1 3 ΛΥΚΕΙΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ 5 Γ Ε Λ Χ Α Λ Α Ν Δ Ρ Ι Ο Υ Περιεχόμενα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2015 2 0 1 5 ΗΜΕΡΗΣΙΑ ΛΥΚΕΙΑ ΕΣΠΕΡΙΝΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2011 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 2000 ΗΜΕΡΗΣΙΟ 5. Οι περιοριστικές ενδονουκλεάσες: α. συµµετέχουν στην ωρίµανση του RΝΑ β. είναι

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ

ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΤΕΤΡΑΚΤΥΣ ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙ ΕΥΣΗΣ Αµυραδάκη 20, Νίκαια (210-4903576) ΤΑΞΗ... Γ ΛΥΚΕΙΟΥ... ΜΑΘΗΜΑ...ΒΙΟΛΟΓΙΑ ΚΑΤ/ΣΗΣ... ΝΟΕΜΒΡΙΟΣ 2012 ΑΞΙΟΛΟΓΗΣΗ ΚΕΦΑΛΑΙΑ 1 ο -2 ο ΘΕΜΑ 1ο Α. Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ

ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ ΕΡΩΤΗΣΕΙΣ Π Ο Λ Λ Α Π Λ Η Σ Ε Π Ι Λ Ο Γ Η Σ ΝΑ ΣΗΜΕΙΩΣΕΙΣ ΤΗ ΣΩΣΤΗ ΑΠΑΝΤΗΣΗ 1. Η ποσότητα του DNΑ α. είναι ίδια σε όλους τους απλοειδείς οργανισµούς β. είναι σταθερή σε όλους τους διπλοειδείς οργανισµούς

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5

Α2. Οι ιστόνες είναι α. DNA β. RNA γ. πρωτεΐνες δ. υδατάνθρακες. Μονάδες 5 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ - ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 3 ΜΑΪΟΥ 212 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία:

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 21/09/2015 ΕΠΙΜΕΛΕΙΑ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Τ: 2221-300524 & 6937016375 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα