5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5"

Transcript

1 1 ( ) : : (5) 1 5, DNA.. mrna.. mrna.. DNA. 3. Ti

2 2 5. T DNA. : 1. Griffith : ). ) cdna DNA : ( ) 28% (G) 28% ,. 2 5

3 3., ( 4). ( 7) Turner DNA,

4 4 1., ( 2). ( 4). 6 2., 8 ( ) ( 2). ( 3). DNA. 5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 3. DNA DNA. DNA DNA,. DNA ( 4). ( 4). DNA. ( 2)

5 : : (4) ,, , VIII RNA RNA. 4. DNA

6 2 5. Bt. Bacillus thuringiensis.. Ti.... Agrobacterium tumefaciens. : 1. ; ( 3), ( 3) ; ( 3) 9 3. ( 3) ; ( 3) 6 DNA,. (3) (5 -GAT-3 ). 2 4

7 3 T TGTTGTCCAGATCAGAACCTGAGTTCCAATAGCCAG TATACAACAGGTCTAGTCTTGGACTCAAGGTTATCGGTC 1., : (). ( 2) 7 2.,. (). ; ( 2) N. ( 2) 9 3. Klinefelter DNA. DNA. DNA DNA,...

8 4 K 1. ( 2). ( 4) 6 2. ( ). ( 4). ( 9) ( ) 1. (, ) , : (3). 8. : K

9 1 - ( ) : : (5) 1 5, DNA.. mrna.. mrna.. DNA. 3. Ti

10 T DNA. 1.,,... in vivo DNA 4. RNA. Ti 5. DNA Agrobacterium tumefaciens

11 3-2. : DNA DNA : ( ) 28% (G) 28%

12 4-3. ; 12 DNA, : 1. DNA ( 2). ( 4) RNA. RNA ( 2). ( 4) ( 2); () ( 2); ( 4)

13 : : (4) ,, , VIII RNA RNA. 4. DNA

14 2-5. Bt. Bacillus thuringiensis.. Ti.... Agrobacterium tumefaciens. : 1. ; 10 2., ( 3) ( 3) ; ( 3) 9 3. EcoRI DNA; DNA;

15 3 - DNA,... K 1. ( 2). ( 4) 6 2. ( ). ( 4). ( 9) ( ) 1. (, )

16 : : (4) A A1 5. A1., DNA ,. A2.. RNA.. DNA.... DNA. A3. Ti. Bacillus thuringiensis A4. o. Turner.. Klinefelter.. Down

17 2 A5. DN, B B1. N. 8 B2. DN. 6 B3.. 6 B4. (PCR);.,.. 1. ( 8). ( 10)

18 3 2. ;. 7 DNA ( ) GACTAATAAAAGAAGTAGTTAGGATCATAGG ( ) CTGATTATTTTCTTCATCAATCCTAGTATCC H 2 N COOH. 1. DNA. ( 4) ( 2). ( 2) 8 2. mrna DNA ( 2) mrna ( 2).. ( 3) 7 3.,. 4.,. 3 4

19 4 : : : : AUG UAC, UAU UUU, UUC 1. (, ) , : (3). 7. : (1) 17:

20 1 ( ) : : (4) 1 5,. 1.. DNA.. mrna. 2. DNA RNA... D. D 4. DNA

21 2 5.,,.... RNA- : 1. ; ; 8 4. ; 6 1., ( 2)., ( 6)

22 3 3. DNA R. ( 2), DNA ( 4) DNA ( 4). 10,

23 : : (4) 1 5,. 1. DNA. DNA. DNA. DNA DNA. RNA (cri-du-chat). 3. in vitro Mendel (Pisum sativum)

24 : ; (ADA) ; ; 6 DNA, CTTAACTAATAGGGTGGACCTAACATAGAT GAATTGATTATCCCACCTGGATTGTATCTA 1. mrna DNA, 5 3 ( 2), ()

25 3 2. mrna ( 2) ( 8) ,, , 2, 3, 4, 5, 6, :. 3 4

26 1 ( ) : : (4) 1 1 5, snrna DNA.... DNA in vitro

27 DNA : 1. ; 4 2. ; () ; ( 2) 7 3. ; ; 6 4. ; I I II II

28 3 1 2, 2, 3 ( ) 2 2, 3 ( )., ( ). ( 8). () 13. Turner. ( 6) Turner,. ( 6) 4 12 DNA mrna...gaaggaggttgcttaaggggccctaccaat... OH.. CTTCCTCCAACGAATTCCCCGGGATGGTTA... - ) ; ( 2) 3 4

29 4 ) 3 5 DNA. ( 2). ( 4) ) mrna mrna DNA,. ( 2) ) mrna; ( 3) ) cori DNA; ( 1). ( 3) ) DNA cdna ; ( 8) (, ).. 2., : (3). 8. :

30 : : (4) 1 5,, DNA. 2. DNA... trna.. DNA DNA.. DNA.. DNA.. DNA Down. 1 4

31 2 5. Ti. Escherichia coli DNA ; ( 3) ; ( 6) 9 4. «Dolly». 3 6.,,..,

32 3., DNA (5). RNA.. DNA ; ( 2). ( 7) 9. mrna, DNA. 3. trna, 2.. () trna, ; ( 3) 8 3 4

33 : : (4) 1 5,. 1., Griffith, : :., : :... RNA.. DNA.. DNA. 1 4

34 2 5., : : 1. ;. 2., 21 ; 8 3. ; 7 4., ; ; 2 4

35 3 2.,,,. ; DNA, ; 4 12 DNA,,. A 3 5 B DNA-,. DNA ( 4). ; ( 7). 3 4

36 4,, : 5... ATG CCA TGC AAA CCG AAA TGA 3 mrna ( 2). DNA, 4 mrna UAA. mrna, ; ( 8). ; ( 4). 25 ( ) 1. (,, ).. 2., : (3). 7. : K 4 4

37 : : (4) 1 5,,. 1.. DNA.. DNA.. RNA.. RNA , DNA

38 : 1. endel; 6 2. mrna ; 8 3. DNA ( 3), DNA ; ( 4) 7 4. ; 3 4, ( ba). 2 4

39 3 DNA GAG GTG.. (HbA) ; ( 12). F (HbF); ( 7). 2 (HbA 2 ) ; 4 ( 6) 25,,... endel., ( 15), ( 10) (,, ).. 3 4

40 : : (5) 1 5,. 1. DNA. DNA.. DNA Turner

41 2 4.. DNA.. DNA.. RNA.. RNA : 1. ( 2) ; () 7 2. ; , ; 6 2

42 3 3 DNA, PCR,,. 1. (PCR); ( 4) ( 3) ,, DNA Bacillus thuringiensis. 10 3

43 4 4 ( ) ( ). (). (). ( 1, 2). ( 6). ()., 11 ( 4). 25 4

44 : : (4) 1 1 5,. 1. RNA DNA. DNA.. DNA.... RNA

45 2 4. Ti. Bacillus thuringiensis.. Escherichia coli : 1. DNA ; Mendel; 3. ; ( 2) 1993; ( 6) 8 4. Roselin ; 6 2

46 3 3 mrna G A U G A A A G C C A C G G A G C C C U G A G C A A... 3 mrna. 1. ; ( 2) -. ( 8) mrna III

47 4 ( 3). ( 6) ; ( 4) II 2, II 3 Klinefelter... ( 6) DNA Klinefelter; ( 2). ( 4) ( ) (,, ) : (3). 7. : K 4

48 : : (4) 1 5, DNA RNA. m-rna.. DNA PCR... DNA,

49 2 4. (cri-du-chat) : 1. DNA; 4 2. Hershey Chase DNA ; 6 3. ; 7 4. ; 8 2

50 CTG AAG CGA GAA CCC :. 5...CTG AAG CGA TAA CCC CTG CCG AAG CGA GAA CCC ; 9 4,. -,. ( 6) ( 6). E,, - ( 6). -., 3

51 4 - ( 7); 25 ( ) 1. (,, )... 2., : (3). 6. : K 4

52 : : (4) 1 1 5, mrna.. mrna

53 2 4. ex vivo DNA DNA,.. DNA.. DNA.. RNA.. DNA. 2 : 1. ; 4 2. cdna ; 8 3. ; 4. ;. 8 2

54 ,, ; 4 H 2 N COOH, DNA : 5 C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 3 G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 mrna, mrna DNA ( 9). DNA ( 8). mrna ( 8). 3

55 4 : GCC AUG CCC AGC UAU 25 ( ) 1. (,, )... 2., : (3). 6. : K 4

56 : : (5) 1 5, ,, Ex vivo

57 2 4.,... I : 1. ; 7 2. DNA Watson Crick; 9 3., ; 9 2

58 ( 2). ( 12) ; 3. ; 6 3

59 4 4 DNA,, : H 2 N COOH, m RNA m RNA ( 4) 3 5 ( 8). ( 6)., EcoRI; ( 7). : UG UUU GUU 25 4

60 : : (5) 1 1 5,. 1. Avery, Mac-Leod McCarty o. DNA.. RNA

61 : 1. ( 4) (); 9 2. (PCR) ; 8 3., ; 8 2

62 3 3,. 1. ( 6) ( 2); 8 2. ( 8) ( 3); ; 6 4 DNA,. 3

63 4 3 5 DNA (). mrna, 3 5 ( 7). ( 7);,,, ( 6); (,, ).. 2.,..,

64 : : (4) µ µ µ 1 5 µµ µ µ. 1. µ DNA. µ DNA.. µ µ DNA.. RNA.. µ RNA. 2. cdna. DNA µ.. mrna µ.. mrna µ.. µµ µ µ DNA. 3. µ. µ.. µ.. µ... 1

65 2 4. µ µ µ..... µ µ DNA. DNA DNA µ.. RNA µ µ µ.. DNA µ µ.. DNA µ µ. 2 : 1. RNA µ DNA (µ 3) (µ 6); 9 2. µ µ µ ; 9 3. µ µ ; 7 2

66 3 3, µ µ µ µ, µ µ Turner ( ). 1. µ µ µ µ µ Turner; 6 3. µ Turner µ µ µ µ µ µ µ µ, µ µ. µ µ µ µ µ µ µ µ µ µ µ µ µ µ µ µ. 12 3

67 4. µ µ µ, µ µ µ µ µ (µ 2), (µ 5) µ ( µ µ,, µ µ µ ). µ µ. 2. µ µ µ, µ µ. µ µ. µ µ, µ. 3. µ. 4. µ µ µ. 5. : (3) µ µ. 6. : µ 10:30. K 4

68 : : (4) 1 µ µ µ 1 5 µµ µ µ. 1.. µµ µ DNA.. µ DNA.. µ RNA.. µ µ RNA. 2.. µµ µ mrna.. µµ µ DNA.. DNA.. µµ DNA. 3. µ µ... µ µ Ti µ. Lactobacillus.. acillus thuringiensis.. Agrobacterium tumefaciens.. Clostridium. 1

69 2 5. µ DNA µ. µ µ.. µ.... µ µ µ. 2 : 1. µ DNA µ DNA; 6 2. µ µ µ ; 4 3. µ µ µ ( 4) ( 4); 8 4. µ µ µ ; 7 3 µ, - µ µ µ µ µ. 2

70 3 1. µ ; 6 2. µ µ µ ; 6 3. µ - µ µ µ µ ; 8 4. µ µ ; 4 µ µ. µ 2, II 2 2 (µ µ ), µ 2 II 3 (µ µ ). 3

71 4 1. µ. ( µ µ ) µ µ µ µ 2 µ µ µ ( µ µ,, µ µ µ ). µ µ. 2. µ µ µ, µ µ. µ µ. µ µ. 3. µ. 4. µ µ. 5. : (3) µ µ. 6. : 10:00. K 4

72 : : (4). µ µ 1-5,,, µ. 1. µ, µ µ µ (PCR) µ DNA, µ µ µ µ HbA µ µ µ. 2 1

73 2. 1-3, µ µµ. 1. µ µ µ :.. ii. i. I A i. 2. µ µ :. µ µ. µ.. µ. 3. µ :. m-rna µ. DNA µ. µ µ µ. µ µ ; Roselin (Dolly). ; 10 2

74 3 3. µ µ µ, µ µ µ µ ; µ. ; µ µ DNA, : - µ µ 1. µ µ µ DNA, µ µ ( 3) ( 9). 12 3

75 4 2. µ DNA : - µ ( 6) ( 7). 13 µ. UAU AUA ( µ ) 1. µ ( µ µ,, µ µ µ ). µ µ. µ µ µ µ µ. 2. µ µ µ µ µ. µ µ. µ µ. 3. µ. 4. µ µ µ. 5. : (3) µ µ. 6. : K 4

76 : : (4). µ µ 1-5,,, µ. 1. µ µ µ µ µ DNA µ µ µµ µ DNA µ i µ µ µ µ µ Clostridium,. 2 1

77 2. 1-3, µ µµ. 1. µ 21 µ µ µ :. Kleinefelter. Turner. D wn. Cri du chat ( ). 2. µ µ µ µ :. DNA. c DNA. RNA.. 3. RNA µ :.. 3 µ µ ; 2. µ ; 10 2

78 3 3. µ µ µ µ µ. 1. µ µ ; 2. µ ; µ µ µ. µ (3), (6) (7) µ. 3

79 4 1. ; 2. µ (8) (9) µ ; ( 3). ( 8). 11 ( µ ) 1. µ ( µ µ, µ µ µ ). µ µ. 2. µ µ µ µ µ. µ µ. µ µ. 3. µ. 4. µ µ µ. 5. : (3) µ µ. 6. : µ 10:00. K 4

80 : : (4) , µ µµ. 1. µ DNA :. µ... µ. 2. µ :.. µ. µ. - µ.. :

81 µ, Bt µ µ µ µ DNA. 5 3 GAATTCTTAATGC AGATCATAAAGAATTCTAG CTTAAGAATTACG TCTAGTATTTCTTAAGATC 3 5 µ µ DNA µ EcoRI, µ µ µ µ, µ µ. µ µ µ

82 3 µ µ U U C A UUU UUC UUA UUG C CUU CUC CUA CUG UCU UCC UCA UCG CCU CCC CCA CCG UAU UAC UAA UAG CAU CAC CAA µ CAG µ U C A G U C A G µ µ G AUU AUC AUA AUG µ GUU GUC GUA GUG ACU ACC ACA ACG GCU GCC GCA GCG AAU AAC AAA AAG GAU GAC GAA µ GAG µ U C A G U C A G µ µ 2., µ µ Cri-du-chat ( µ ) µ µ µ ; 3 4, µ, : µ µ µ.. 3

83 4 µ µ µ, µ µ µ.. F 1 F µ F F 2, µ µ µ µ µ,. 12 ( µ ) 1. µ ( µ µ,, µ µ µ ). µ µ. 2. µ µ µ µ µ. µ µ. µ µ. 3. µ. 4. µ µ µ. 5. : (3) µ µ. 6. : µ (1 1/2 ) µ µ. K 4

84 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΛΥΚΕΙΟΥ ΙΟΥΛΙΟΣ 2002 Θέμα 1ο Α. Στις ερωτήσεις 1-2 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Εμβολιασμός θρεπτικού υλικού είναι η προσθήκη: α) κατάλληλων εμβολίων β) μικρής ποσότητας κυττάρων γ) νιτρικών αλάτων (Μονάδες 5) 2. Τη γονιδιακή έκφραση αποτελούν οι διαδικασίες: α) αντιγραφής και μετάφρασης β) αντιγραφής και μεταγραφής γ) μεταγραφής και μετάφρασης (Μονάδες 5) Β. Να οριστούν οι παρακάτω έννοιες: 1. Νουκλεόσωμα. (Μονάδες 5) 2. Καρυότυπος. (Μονάδες 5) 3. Διαγονιδιακά ζώα. (Μονάδες 5) Θέμα 2ο Α. 1. Τι είναι η γονιδιωματική βιβλιοθήκη; (Μονάδες5) 2. Ποια είναι η σκοπιμότητα της προσθήκης αντιβιοτικού στο θρεπτικό υλικό, κατά τη διαδικασία δημιουργίας μιας γονιδιωματικής βιβλιοθήκης; (Μονάδες 6) Β. Ποιοι είναι οι στόχοι της τεχνολογίας του ανασυνδυασμένου DNA που άρχισε να εφαρμόζεται πρόσφατα για την παραγωγή αντιβιοτικών; (Μονάδες 6) Γ. Ποια είναι η διαδικασία που ακολουθείται για τη γονιδιακή θεραπεία της ασθένειας που οφείλεται στην έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA); (Μονάδες 6) 1

85 Θέμα 3ο Α. Να περιγράψετε τις δομικές χρωμοσωμικές ανωμαλίες που έχουν ως αποτέλεσμα την αναδιάταξη της γενετικής πληροφορίας. (Μονάδες 6) Ποιες είναι οι πιθανές συνέπειες για τα άτομα που τις φέρουν και ποιες είναι για τους απογόνους τους; (Μονάδες 6) Β. Δίνεται το παρακάτω πολυπεπτίδιο που παράγεται σε βακτηριακό κύτταρο: HOOC - Μεθειονίνη - Λυσίνη - Θρεονίνη - Προλίνη - Λευκίνη-Σερίνη - Βαλίνη - Αλανίνη - Βαλίνη- Μεθειονίνη - ΝΗ 2 1. Να γράψετε τη μη κωδική αλυσίδα του γονιδίου που κωδικοποιεί αυτό το πολυπεπτίδιο. (Μονάδες 6) 2. Να ορίσετε τα άκρα 3'και 5'της παραπάνω αλυσίδας. (Μονάδες 2) Να αιτιολογήσετε την απάντηση σας. (Μονάδες 7) Δίνονται οι επόμενες αντιστοιχίσεις αμινοξέων και κωδικονίων: Αμινοξέα Αλανίνη Βαλίνη Θρεονίνη Λευκίνη Λυσίνη Μεθεινίνη Προλίνη Σερίνη Κωδικόνια GCU GUG ACU CUA AAG AUG CCG UCG 2

86 Θέμα 4ο Δίνεται το παρακάτω γενεαλογικό δέντρο στο οποίο απεικονίζεται ο τρόπος με τον οποίο κληρονομείται μια ασθένεια. Το άτομο Ι -1 (μαυρισμένο) πάσχει και έχει ομάδα αίματος Ο. Το άτομο 1-2 (μαυρισμένο) πάσχει και έχει ομάδα αίματος Β (ομόζυγο). Τα άτομα αυτά απέκτησαν τρία παιδιά, εκ των οποίων το II - 2 (μαυρισμένο) πάσχει, α) Με βάση το παραπάνω γενεαλογικό δέντρο, να εξηγήσετε τον τρόπο με τον οποίο κληρονομείται η ασθένεια. (Μονάδες5) β) Να γράψετε τους πιθανούς γονοτύπους και φαινοτύπους των ατόμων της Ι και ΙΙ γενιάς. (μονάδες 8) γ) Το άτομο ΙΙ-1 παντρεύεται γυναίκα που έχει ομάδα αίματος ΑΒ και πάσχει από την ίδια ασθένεια. Να προσδιορίσετε την πιθανότητα να αποκτήσουν παιδί που θα έχει ομάδα αίματος Α και θα πάσχει. (μονάδες 12) 3

87 : : (5) , µ µµ. 1. µ µ. µ : µ µ µ µ :. µ µ. µ µ. µ i µ µ µ µ µ µ :. µ. µ DNA.. 1

88 2 2. µ trna trna µ. coli. µ. µ µ cdna µ µ ; 3 1. %. C G 1: : , 2 µ ;

89 3 2. Zea mays ( µ ) µ µ µ. µ µ , µ µ µ µ µ (ADA) µ µ. µ mrna µ ADA µ µ. µ µ mrna : µ : AUG GAA UUU UGG GGG CGC ACG UCG... µ : AUG GAA UUU UAG GGG CGC ACG UCG.... ; 6. µ ; 2 4 : - -1, -2. 3

90 4 - µ -2, -3. ; ; -1-2 :. µ. 4.. µ µ ( µ ) 1. µ ( µ µ,, µ µ µ ). µ µ. 2. µ µ µ µ µ. µ µ. 4

91 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ - ΙΟΥΛΙΟΣ 2001 Θέμα 1ο Α. Στις ερωτήσεις 1-3 να γράψετε στο τετράδιο σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Ένα ελεύθερο μόριο trna μπορεί να συνδεθεί με: α) ένα μόνο ειδικό αμινοξύ β) οποιοδήποτε διαθέσιμο αμινοξύ γ) τρία διαφορετικά αμινοξέα (Μονάδες 2) Να αιτιολογήσετε την επιλογή σας. (Μονάδες 3) 2. Αν συγκρίνουμε τους καρυότυπους ενός φυσιολογικού άνδρα και ενός άνδρα με σύνδρομο Down, παρατηρούμε ότι στον καρυότυπο του δεύτερου άνδρα υπάρχει/ουν: α) ένα επιπλέον χρωμόσωμα β) δυο Υ χρωμοσώματα γ) ένα επιπλέον ζεύγος χρωμοσωμάτων (Μονάδες 2) Να αιτιολογήσετε την επιλογή σας. (Μονάδες 3) 3. Η σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά: α) την αντιγραφή β) τη μεταγραφή γ) τη μετάφραση (Μονάδες 2) Να αιτιολογήσετε την επιλογή σας. (Μονάδες 3) Β. 1. Ποιες μεταλλάξεις ονομάζονται σιωπηλές; (Μονάδες5) 2. Σε μια κλειστή καλλιέργεια παρατηρείται και η στατική φάση. Τι γνωρίζετε για τη φάση αυτή; (Μονάδες 5) Θέμα 2ο Α. Πώς ρυθμίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα; (Μονάδες 10) Β. Να περιγράψετε πώς συσχετίζεται η μετατροπή ενός φυσιολογικού ανθρώπινου κυττάρου σε καρκινικό, με ένα: 1. πρώτο - ογκογονίδιο, 2. ογκοκατασταλτικό γονίδιο. (Μονάδες 8) Γ. Πώς ένα μονοκλωνικό αντίσωμα μπορεί να χρησιμοποιηθεί: 1. στη θεραπεία του καρκίνου; 2. στην επιλογή οργάνου συμβατού για μεταμόσχευση; (Μονάδες 7)

92 Θέμα 3ο Α. Να εξηγήσετε τους λόγους για τους οποίους τα πλασμίδια χρησιμοποιούνται ως φορείς κλωνοποίησης. (Μονάδες 10) Β. Δύο υγιείς γονείς αποκτούν τρία παιδιά, ένα αγόρι και ένα κορίτσι, που πάσχουν από μια ασθένεια, και ένα κορίτσι υγιές. 1. Να κατασκευάσετε το γενεαλογικό δέντρο της παραπάνω οικογένειας. (Μονάδες 10) 2. Να εξηγήσετε τον πιθανό τρόπο κληρονόμησης της παραπάνω ασθένειας. (Μονάδες 10) Θέμα 4ο Θεωρούμε τρία φυτά που παράγουν κίτρινα και στρογγυλά μπιζέλια. Τα τρία φυτά τα συμβολίζουμε με Α, Β και Γ. Το καθένα από αυτά διασταυρώνεται με φυτό που παράγει πράσινα και ρυτιδωμένα μπιζέλια, που συμβολίζεται με Δ. Από κάθε διασταύρωση παράγονται 100 φυτά. - Η διασταύρωση Α x Δ έδωσε: 51 φυτά που παράγουν κίτρινα και στρογγυλά μπιζέλια και 49 φυτά που παράγουν πράσινα και στρογγυλά μπιζέλια. - Η διασταύρωση Β x Δ έδωσε: 100 φυτά που παράγουν κίτρινα και στρογγυλά μπιζέλια. - Η διασταύρωση Γ x Δ έδωσε: 24 φυτά που παράγουν κίτρινα και στρογγυλά μπιζέλια, 26 φυτά που παράγουν κίτρινα και ρυτιδωμένα μπιζέλια, 25 φυτά που παράγουν πράσινα και στρογγυλά μπιζέλια, 25 φυτά που παράγουν πράσινα και ρυτιδωμένα μπιζέλια. Θεωρούμε ότι τα γονίδια που ελέγχουν την έκφραση των γνωρισμάτων βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. 1. Να αιτιολογήσετε τον τρόπο με τον οποίο κληρονομούνται τα δύο γνωρίσματα. (Μονάδες 10) 2. Να αιτιολογήσετε τους γονότυπους των Α, Β και Γ φυτών. (Μονάδες 10)

93 % ΑΡΧΗ%1ΗΣ%ΣΕΛΙΔΑΣ% Γ #ΤΑΞΗ#!"#$%&'()*+ *,*&!+*)+ -. &!,'+ */)!)#% $%0*)#% "*1"&' 22 )#%/)#% 2000 *,*&!2#1*/# 1!3'1! 3*&)0'+ 0!&*%3%/+'+: 4)#$#-)! +%/#$# +*$)56/: "*/&* (5)!"#$ 1%!"#$ %&'"ή)%#$ 1-5, *+,&ά.%"% )"/ "%"&ά0#ό )+$ "/* +&#23ό "4$ %&ώ"4)4$ 6+# 0ί89+ "/,&ά33+ 8/: +*"#)"/#;%ί )"4 )')"ή +8ά*"4) : E :=άgh<ie HJ= ;7: :. A:=Qά=K<;: Rά;E M. Rά;E D. Rά;E O. Rά;E Q:=άHK<. 1K=άO7P 5 2. &K GA:;8ίO9K Ti >CE;98KGK97ίH:9 ;HE :. OE89K<CDί:P SώJ= M. OE89K<CDί:P R<Hώ= D. G:C:DJDήP 9=H7CR7Cό=EP O. G:C:DJDήP 9=;K<Aί=EP. 1K=άO7P 5 3. HK 7ί=:9: :. DNA M. DNA D. DNA O. DNA. 1K=άO7P HE >CE;98KGK9Kύ=H:9: :. M. 87H:;>E8:H9;8έ=: D. DK=98KGK9E8έ=: JάC9: SώJ= 1K=άO7P 5 5. #9 : :. ;<887Hέ>K<= ;HE= JCί8:=;E HK< RNA M. 7ί=:9 :G:C:ίHEH7P D9: HE= έ=:cie HEP :=H9DC:RήP D. ;<887Hέ>K<= ;HE 87H:DC:Rή HK< DNA HK DNA Qέ;79P. 1K=άO7P 5 % ΤΕΛΟΣ%1ΗΣ%ΣΕΛΙΔΑΣ%

94 % ΑΡΧΗ%2ΗΣ%ΣΕΛΙΔΑΣ% % ΤΕΛΟΣ%2ΗΣ%ΣΕΛΙΔΑΣ% Γ #ΤΑΞΗ#!"#$ 2% $. ' HEP :=H9DC:RήP HK< DNA :Gό 87DάAE GK< ;HE OCά;E 7=Sύ8J=. 1. "K9: :Gό H: ;<887Hέ>K<= ;HE= :=H9DC:Rή HK< DNA: DNA GKA<87Cά;7P, DNA GC98ό;J8:, έ=s<8:, DNA O7;8ά;E; 1K=άO7P 5 2. /: DCάV7H7 H: έ=s<8: GK< G:ίC=K<= 8έCKP ;HE= 7G9O9όCQJ;E HK< DNA. 1K=άO7P 5 &. 1. "όh7 έ=:p :7CόM9KP; 1K=άO7P 5 2. &9 7ί=:9 HK GKAύ;J8:; 1K=άO7P 5 3. "K9: K=K8άSK=H:9 ;<=ώ=<8:; 1K=άO7P 5!"#$ 3% ' 49KH7>=KAKDί: ;<8MάAA79 ;HE= O9άD=J;E, Q7C:G7ί: O9:RόCJ= :;Q7=79ώ=. $. /: G7C9DCάV7H7 HE G:C:DJDήP :=H9;J8άHJ= D9: έ=: 7G9A7D8έ=K :=H9Dό=K. 1K=άO7P 9 &. /: DCάV7H7 H: Mή8:H: GK< :G:9HKύ=H:9 D9: HE= G:C:DJDή 89:P GCJH7W=EP :=QCώG9=EP GCKέA7<;EP :Gό έ=: SώK. 1K=άO7P 9 '. /: G7C9DCάV7H7 HE G:C:DJDήP HJ= 78MKAίJ= <GK8K=άOJ=. 1K=άO7P 7!"#$ 4% Έ=: έ>79 46 >CJ8K;ώ8:H:. $. 1. "ό;: 8όC9: DNA <GάC>K<= ;H: >CJ8K;ώ8:H: ;HK ;HάO9K HEP 87HάR:;EP HEP 8ίHJ;EP;

95 % ΑΡΧΗ%3ΗΣ%ΣΕΛΙΔΑΣ% 2. /: HE= :Gά=HE;ή ;:P. Γ #ΤΑΞΗ# 1K=άO7P 2 1K=άO7P 4 &. /: G7C9DCάV7H7 H9P 8KCRέP, 87 H9P KGKί7P 78R:=ίS7H:9 HK :=άakd: 87 HK ;HάO9K HK< GK< MK=άO7P 9 '. Έ;HJ έ=: H8ή8: DNA 87 HE= :AAEAK<>ί: Mά;7J=: 5.- &C! CGG AAT TTC TAG CAT O7OK8έ=K όh9 O7 87;KA:M7ί ;HάO9K JCί8:=;EP, =: DCάV7H7 HK m-rna GK< Q: :Gό HE 87H:DC:Rή HK< G:C:Gά=J H8ή8:HKP DNA, ;E879ώ=K=H:P H:<Hό>CK=: HE Qέ;E HK< 3. HK< m-rna. 1K=άO7P 3 2. /: DC:RKύ= H: HJ= t-rna 87 HE ;79Cά GK< ;<887Hέ>K<= ;HE 87HάRC:;E HK< G:C:Gά=J m-rna. MK=άO7P 7 % ΤΕΛΟΣ%3ΗΣ%ΣΕΛΙΔΑΣ%

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. Γουανίνη Κυτοσίνη. 4α. Λειτουργία γενετικού υλικού. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. Γουανίνη Κυτοσίνη. 4α. Λειτουργία γενετικού υλικού. Φωσφοδιεστερικός δεσμός εύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 4α. Λειτουργία γενετικού υλικού 1 ΛΕΙΤΟΥΡΓΙΑ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ Αντιγραφή (διπλασιασμός) DNA: DNA DNA Έκφραση γενετικής πληροφορίας:

Διαβάστε περισσότερα

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2,

Διαβάστε περισσότερα

Να αιτιολογήσετε την επιλογή σας. Μονάδες 3

Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Σάββατο, 22 Μαΐου 2010 07:30-10:30

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2007

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2007 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2007 ΜΑΘΗΜΑ : ΒΙΟΛΟΓΙΑ Ημερομηνία και Ωρα εξέτασης: Πέμπτη, 7 ΙΟΥΝΙΟΥ 2007 07:30 10:30

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

4 ο ΚΕΦΑΛΑΙΟ. Γ ε ν ε τ ι κ ή

4 ο ΚΕΦΑΛΑΙΟ. Γ ε ν ε τ ι κ ή 4 ο ΚΕΦΑΛΑΙΟ Γ ε ν ε τ ι κ ή 1. Κύκλος της ζωής του κυττάρου 3ο Γελ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης 2 2. Μοριακή Γενετική i). Ροή της γενετικής πληροφορίας DNA RNA πρωτεΐνες νουκλεΐκά οξέα ή πρωτεΐνες

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4 ΜΕΤΑΛΛΑΞΕΙΣ, Σύνδρομο Down

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΘΕΟΔΟΛΙΝΤΑ ΤΕΣΤΑ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΘΕΟΔΟΛΙΝΤΑ ΤΕΣΤΑ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΘΕΟΔΟΛΙΝΤΑ ΤΕΣΤΑ e-mail: info@iliaskos.gr www.iliaskos.gr 1 DNA Griffith (1928) : DNA 2 (Diplococcus

Διαβάστε περισσότερα

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και Ώρα εξέτασης: Τρίτη, 26 Μαΐου 2009 07:30 10:30

Διαβάστε περισσότερα

3.Σε μία καλλιέργεια μικροοργανισμών κατά τη λανθάνουσα φάση ο πληθυσμός των μικροοργανισμών: α. μειώνεται β. παραμένει σχεδόν σταθερός

3.Σε μία καλλιέργεια μικροοργανισμών κατά τη λανθάνουσα φάση ο πληθυσμός των μικροοργανισμών: α. μειώνεται β. παραμένει σχεδόν σταθερός ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 6 - ΜΕΤΑΛΛΑΞΕΙΣ ΑΣΚΗΣΕΙΣ 1. σε σωματικό κύτταρο οργανισμού που βρίσκεται στη φάση κυτταρικής διαφοροποίησης συνέβη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 Ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες

Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Σάββατο 22 Απριλίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1 Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α A1. α Α2. β Α3. α Α4. β Α5. α ΘΕΜΑ Β Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ Β1. Καρυότυπος είναι η απεικόνιση

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ

ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΜΑΔΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ Γ ΛΥΚΕΙΟΥ Επιμέλεια: Βουδούρη Καλλιρρόη Ριζηνίας 69 & Λασαίας 21 τηλ.2810313170 www.kmathisi.com ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΟΝΟΜΑ:..

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας Κεφάλαιο 2ο Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας 1. Το DNA αυτοδιπλασιάζεται 3ο ε.λ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης 3 Ο μηχανισμός της αντιγραφής του DNA Ο μηχανισμός αυτοδιπλασιασμού

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. ίκλωνο

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 6 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Επιμέλεια: Κιτσαντάς Λευτέρης, Βιολόγος 1

Επιμέλεια: Κιτσαντάς Λευτέρης, Βιολόγος 1 ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ 2000 ΘΕΜΑ 3 ο ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α

Σ Υ Σ Τ Η Μ Α ) ΘΕΜΑ Α ΘΕΜΑ Α ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

Διαβάστε περισσότερα

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα& Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 1. 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990 50.20.990 2. 25ης Μαρτίου 74 Π. ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 3. Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ 2000-2015 ΘΕΜΑ 1 Ο 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (2000-2012) «Ανά Θέμα» 1. Από τη διασταύρωση ενός λευκού μ' ένα μαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώμα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2006 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΘΗΜ / ΤΞΗ: ΙΟΛΟΓΙ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝ) ΗΜΕΡΟΜΗΝΙ: 22/01/2017 ΕΠΙΜΕΛΕΙ ΔΙΓΩΝΙΣΜΤΟΣ: ΝΟΤ ΛΖΡΚΗ ΘΕΜ Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. πό τη διασταύρωση ελέγχου

Διαβάστε περισσότερα

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ

ÁÎÉÁ ÅÊÐÁÉÄÅÕÔÉÊÏÓ ÏÌÉËÏÓ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) 27 ΜΑΪΟΥ 2016 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΕΚΦΩΝΗΣΕΙΣ Ένα από τα trna που µεταφέρουν το αµινοξύ Λευκίνη έχει ως αντικωδικόνιο την αλληλουχία 3 CUU5. Αλυσίδα Ι: GCG GGA CTG TTA CTT AGA GCG CGA CCC Αλυσίδα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Β.2 Σελίδα 24 σχ. βιβλίο. «Κάθε φυσιολογικό μεταφασικό καρυότυπο.» και «Ο αριθμός και η μορφολογία ζεύγος ΧΧ.»

ΑΠΑΝΤΗΣΕΙΣ. Β.2 Σελίδα 24 σχ. βιβλίο. «Κάθε φυσιολογικό μεταφασικό καρυότυπο.» και «Ο αριθμός και η μορφολογία ζεύγος ΧΧ.» ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) ΑΠΑΝΤΗΣΕΙΣ

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 30 ΜΑΪΟΥ 2006 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ)

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 4 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) Να γράψετε στο τετράδιό σας

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orionidef.gr ΘΕΜΑ A Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ_ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ_ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ - ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ

Διαβάστε περισσότερα

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2

2. Οι περιοριστικές ενδονουκλεάσες παράγονται από ευκαρυωτικά κύτταρα. Μονάδες 2 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 3 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Α. Να γράψετε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα