1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:"


1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3 Να βρείτε την πρωτοταγή δομή της πολυπεπτιδικής αλυσίδας. Δίνεται ο γενετικός κώδικας. 2. Ένα γονίδιο κωδικοποιεί μια πρωτεΐνη που αποτελείται από 50 αμινοξέα. Εξαιτία λάθους που συνέβη κατά την ωρίμανση του πρόδρομου mrna, δεν απομακρύνθηκε ένα εσώνιο μήκους 7 βάσεων το οποίο παρεμβάλλεται μεταξύ του δεύτερου κωδικονίου UGG και του τρίτου κωδικονίου UUU. Η αλληλουχία του εσωνίου είναι 5 -UGGAUGG-3. Τι επίπτωση θα έχει αυτό το λάθος στην αλληλουχία των αμινοξέων και στο μέγεθος της πρωτεΐνης; Να αιτιολογήσετε την απάντησή σας. (Δίνεται ο γενετικός κώδικας). 3. Από ένα πρόδρομο mrna που έχει 4999 φωσφοδιεστερικούς δεσμούς και αμετάφραστες περιοχές 200 νουκλεοτιδίων, συντίθεται μια πολυπεπτιδική αλυσίδα 1000 αμινοξέων. Να βρεθεί: α. ο αριθμός των νουκλεοτιδίων του ώριμου mrna β. ο αριθμός των νουκλεοτιδίων του εσωνίου του γ. ο αριθμός των νουκλεοτιδίων του γονιδίου 4. Δίδεται η παρακάτω αλληλουχία νουκλεοτιδίων ενός κλώνου DNA γονιδίου προκαρυωτικού οργανισμού: 5 ΑTATTCATGCTTATCGGGAGATTTTTCCACATGTAATAAAAAA 3 Να βρείτε: i. Tην αλληλουχία των βάσεων του συμπληρωματικού κλώνου. ii. Ποιος κλώνος είναι η κωδική αλυσίδα του γονιδίου ποια η αλληλουχία των κωδικονίων καθώς και ποιες οι αμετάφραστες περιοχές; iii. Ποια είναι η αλληλουχία των αμινοξέων στο πεπτίδιο που θα σχηματιστεί κατά την μετάφραση του παραπάνω γονιδίου; Δίνεται ο γενετικός κώδικας. iv. Στο πεπτίδιο που παράγεται κατά την μετάφραση γίνεται μεταμεταφραστική τροποποίηση και απομακρύνεται η μεθειονίνη. Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που θα προκύψει. 5. Ένα γονίδιο περιλαμβάνει εσώνια που έχουν συνολικό μήκος 279 ζεύγη βάσεων και κωδικοποιεί μια πολυπεπτιδική αλυσίδα που αποτελείται από 141 αμινοξέα. Πόσα νουκλεοτίδια θα έχει το πρόδρομο mrna που θα προκύψει και πόσα το ώριμο mrna, χωρίς να υπολογιστούν οι 3 και 5 αμετάφραστες περιοχές; 6. Ένα πρόδρομο mrna περιέχει δύο εσώνια Α και Β με μήκος 150 και 350 νουκλεοτίδια αντίστοιχα. Τα εσώνια αυτά αντιστοιχούν στο 50% του μήκους του. Επίσης, 100 κωδικόνιά του αντιστοιχούν σε αμινοξέα μιας πολυπεπτιδικής αλυσίδας. 1

2 α. Από πόσα νουκλεοτίδια αποτελείται το τμήμα του mrna που κωδικοποιεί τη πολυπεπτιδική αλυσίδα; β. Από πόσα νουκλεοτίδια αποτελούνται οι 5 και 3 αμετάφραστες περιοχές του ώριμου mrna; γ. Από τι είδους οργανισμό μπορεί να προέρχεται το παραπάνω μόριο mrna; Δικαιολογήστε. δ. Έστω ότι μετά από μετάλλαξη που συνέβη στο γονίδιο που είναι υπεύθυνο για τη παραγωγή του παραπάνω μορίου mrna είχε ως αποτέλεσμα να μη δεσμεύεται στο ριβόσωμα. Ποια περιοχή του γονιδίου μεταλλάχτηκε κατά τη γνώμη σας; 7. Ένα λειτουργικό τριπεπτίδιο έχει πρωτοταγή δομή: Τρυπτοφάνη-Ιστιδίνη-Λυσίνη. Να βρείτε την αλληλουχία των κωδικονίων στην κωδική αλυσίδα του γονιδίου που το κωδικοποιεί. 8. Ένα ένζυμο, στη λειτουργική του μορφή, έχει 450 αμινοξέα και αποτελείται από 2 διαφορετικές πολυπεπτιδικές αλυσίδες, την Α και τη Β που έχει 250 αμινοξέα. Το γονίδιο που κωδικοποιεί την Α πολυπεπτιδική αλυσίδα έχει 2400 νουκλεοτίδια συνολικά. Κατά τη μετάφραση του αντίστοιχου mrna υπάρχουν σε αυτό 400 νουκλεοτίδια που δε μεταφράζονται. Να θεωρήσετε ότι μετά τη σύνθεση των πολυπεπτιδικών αλυσιδών δεν αφαιρέθηκαν αμινοξέα από το αμινοτελικό τους άκρο και να βρείτε αν το ένζυμο αυτό προέρχεται από προκαρυωτικό ή από ευκαρυωτικό κύτταρο. Να αιτιολογήσετε την απάντησή σας. 9. Στο παρακάτω σχήµα, αφού το µεταφέρετε στο τετράδιό σας, να σηµειώσετε την κατεύθυνση της αντιγραφής και στις δύο αλυσίδες. Να αιτιολογήσετε την απάντησή σας. Κατά την αντιγραφή του µορίου το πριµόσωµα τοποθετεί 20 πρωταρχικά τµήµατα. Πόσα είναι τα συνεχή και πόσα τα ασυνεχή τµήµατα σε κάθε νέα αλυσίδα; 10. Δίνεται η παρακάτω αλυσίδα DNA γονιδίου προκαρυωτικού κυττάρου, το οποίο είναι υπεύθυνο για τη σύνθεση ενός ολιγοπεπτιδίου: CGAAATATGCGCGGGAGAAAATGACGCCC A. i)να βρείτε τη µη κωδική αλυσίδα και να αιτιολογήσετε την απάντησή σας. ii) Να γράψετε το m-rna που προκύπτει από τη µεταγραφή του τµήµατος αυτού και τα αντίστοιχα αντικωδικόνια. iii) Πόσοι δεσµοί υδρογόνου αναπτύσσονται ανάµεσα στα κωδικόνια και τα αντικωδικόνια και πόσοι πεπτιδικοί δεσµοί ανάµεσα στα αµινοξέα; B. Να εξετάσετε τις µεταβολές στη σύνθεση του παραπάνω πεπτιδίου, εάν από το αριστερό άκρο της αλυσίδας που σας δίνεται: i) το 8ο νουκλεοτίδιο αντικατασταθεί από G 2

3 iii) το 16ο νουκλεοτίδιο που είναι Α αντικαθίσταται από Τ iii) το 23ο νουκλεοτίδιο από Α 11. Δίνεται μικρό τμήμα της μητρικής αλυσίδας καθώς και η νεοσυντιθέμενη θυγατρική αλυσίδα που σχηματίζεται κατά την αντιγραφή του μορίου. Μητρική αλυσίδα A C G A A C A A G G G T T T C A A Θυγατρική αλυσίδα U G C U U G U T C C C A A A G T T Να βρείτε το μήκος του πρωταρχικού τμήματος καθώς και πόσοι δεσμοί υδρογόνου θα διασπασθούν κατά την απομάκρυνσή του, αιτιολογώντας την απάντησή σας. 12. Mια αλυσίδα DNA γονιδίου που κωδικοποιεί πεπτίδιο που απομονώθηκε από το βακτήριο E. coli περιέχει την ακόλουθη αλληλουχία: CCGGTTAAGGCTCATACAGCATGAGCCGAT A. Να γράψετε τη συμπληρωματική αλυσίδα και να εξηγήσετε ποια είναι η κωδική και ποια η μεταγραφόμενη αλυσίδα. Β. Να γράψετε το mrna καθώς και το πεπτίδιο που προκύπτει από τη μετάφραση αυτού. Γ. Ποια θα είναι τα αντικωδικόνια των trna, που θα συνδεθούν με τα αντίστοιχα κωδικόνια του mrna; Δ. Κατά τη διάρκεια της μετάφρασης, όταν η αμινομάδα της λευκίνης σχηματίζει πεπτιδικό δεσμό, να βρεθούν πόσοι και ποιοι δεσμοί σπάζουν. Όταν το trna που μεταφέρει τη λευκίνη αφήνει το ριβόσωμα, ποιο trna θα συνδεθεί στη συνέχεια; 13. Από βακτηριακό κύτταρο απομονώθηκε το ολιγοπεπτίδιο, Η2Ν-σερίνη-λευκίνηπρολίνη-ιστιδίνη-μεθειονίνη-COOH και το mrna που το κωδικοποιεί. Από την ανάλυση του mrna διαπιστώθηκε ότι τα αντίστοιχα κωδικόνια σε αυτό είναι: Σερίνη->UCU, Λευκίνη->CUC, Προλίνη->CCU, Ιστιδίνη->CAA, Μεθειονίνη->AUG Με δεδομένα αυτά να βρείτε: Α) Το τμήμα του mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο (μον. 10), να σημειώσετε τα άκρα 5 και 3 αυτού (μον. 10) και να αιτιολογήσετε την απάντησή σας Β) Το τμήμα του αντίστοιχο γονιδίου Γ) Να προσδιορίσετε την κωδική και την μη κωδική αλυσίδα αυτού και να αιτιολογήσετε την απάντησή σας Δ). Να σημειώσετε τα άκρα 5 και 3 στο παραπάνω τμήμα DNA(μον. 10) και να αιτιολογήσετε την απάντησή σας 14. Στον πυρήνα κυττάρου εντοπίζουμε γονίδιο που αποτελείται από 1000 ζεύγη βάσεων. Το πρόδρομο mrna που προκύπτει από την μεταγραφή του γονιδίου περιέχει τέσσερα εσώνια συνολικού μήκους 200 αζωτούχων βάσεων. Το 90% του μήκους του ώριμου mrna αντιστοιχεί σε αμινοξέα. i. Ποια τμήματα αντιστοιχούν στο 10% του μήκους του ώριμου mrna που δεν μεταφράζεται και από πόσες βάσεις συνολικά αποτελούνται; (3 μον.) ii. Δεδομένου ότι κατά την τροποποίηση της πολυπεπτιδικής αλυσίδας μετά την σύνθεσή της απομακρύνονται εννέα (9) αμινοξέα, ποιος είναι ο αριθμός των 3

4 αμινοξέων στο μόριο της λειτουργικής πρωτεϊνης που προκύπτει από το γονίδιο; (3 μον.) 15. Ένα πολυριβονουκλεοτίδιο παράγεται από ένα μίγμα που περιέχει U και G σε αναλογία 4:1. Αν υποθέσουμε ότι τα ριβονουκλετίδια σχηματίζονται με τυχαία γραμμική διάταξη, να προβλεφθούν οι σχετικές συχνότητες με τις οποίες αναμένεται να σχηματιστούν οι διάφορες τριάδες. 16. Το πεπτίδιο μεθειονίνη λυσίνη προλίνη - ασπαρτικό οξύ- σερίνη παράγεται από το γονίδιο: Κωδική: 5 -ACGGATGAAACCCACCGUUGATAGTTGAAAACA-3 Μη κωδική: 3 -TGCC TACTTTGGGCGGCAACTATCAACTTTTGT-5 a. Να γραφτεί το mrna που προκύπτει, τις 5 και 3 αμετάφραστες περιοχές και το εσώνιο. b. Σε ποια κατηγορία οργανισμών ανήκει το παραπάνω γονίδιο; c. Με ποιες διαδικασίες καταλήξαμε από το γονίδιο στο πεπτίδιο και σε ποιες περιοχές κυττάρου πραγματοποιούνται αυτές; (μεθειονίνη->αug, λυσίνη->aaa, προλίνη->ccc, ασπαρτικό οξύ->gau, σερίνη- >AGU, λήξη->uga) 17. Από ένα πολύσωμα παρήχθησαν συνολικά 10 πρωτεΐνες, 1000 συνολικών αμινοξέων. Ποιο είναι το ελάχιστο μήκος του mrna που μεταγράφεται από αυτό το πολύσωμα; 18. Δίνεται το παρακάτω δίκλωνο τμήμα πυρηνικού DNA που περιέχει πλήρες γονίδιο (Ι) GATCTATGCC TGCATTGC TAGCTΤCA TTTT GACCGA (ΙΙ) CTAGTTACGGACGAAACGATCGAΑGTAAAACTGGCT καθώς και η αμινοξική αλληλουχία που προκύπτει από την έκφραση του γονιδίου: met pro ala ser-phe Να εντοπίσετε τα 5 και 3 άκρα των δυο αλυσίδων, ποια είναι η κωδική και μη κωδική αλυσίδα και ποιο είναι το mrna που θα προκύψει. Δίδονται οι αντιστοιχίες αμινοξέων κωδικονίων: met >AUG, pro >CCU, ala >GCA, ser >UCA, phe->uuu 19. Το ώριμο mrna που προκύπτει από την μεταγραφή γονιδίου ευκαρυωτικού κυττάρου αποτελείται από 852 νουκλεοτίδια και κωδικοποιεί πρωτεΐνη, η οποία στην τελική και λειτουργική της μορφή αποτελείται από 153 αμινοξέα. Αν γνωρίζετε ότι οι 5 και 3 αμετάφραστες περιοχές του μορίου αυτού αποτελούνται συνολικά από 30 νουκλεοτίδια, να υπολογίσετε τον αριθμό των αμινοξέων που απομακρύνονται από την πρωτεΐνη κατά τις μετα-μεταφραστικές τροποποιήσεις 20. Ένα γονίδιο ευκαρυωτικού κυττάρου έχει μήκος 2500 ζευγών βάσεων. Το πρόδρομο mrna που προέκυψε από τη μεταγραφή αυτού του γονιδίου περιλαμβάνει 54 νουκλεοτίδια στην 5 αμετάφραστη περιοχή του, 33 νουκλεοτίδια στην 3 αμετάφραστη περιοχή του καθώς και δύο εσώνια μήκους 460 και 1350 νουκλεοτιδίων 4

5 αντίστοιχα. Αν η πολυπεπτιδική αλυσίδα (μη λειτουργική πρωτεΐνη) που προέκυψε από τη μετάφραση υφίσταται μια τροποποίηση για να καταστεί βιολογικά ενεργή κατά την οποία της αφαιρούνται 20 αμινοξέα, να βρείτε τον αριθμό των αμινοξέων της τελικής λειτουργικής πρωτεΐνης που παράγεται από το παραπάνω γονίδιο. 21. Σας δίνεται η αλληλουχία της κωδικής αλυσίδας του DNA ενός γονιδίου που καθορίζει τη σύνθεση ενός ολιγοπεπτιδίου. 5 CATTCAGACCATGCTAATGGCACACCGACAGGCGTAGTTT 3 Ποιο θα είναι το αποτέλεσμα στην έκφραση αυτού του γονιδίου αν: α. Η 14η βάση από C αλλάξει σε Τ. β. Η 26η βάση από C αλλάξει σε Τ. γ. Η 12η βάση από Τ αντικατασταθεί με Α. δ. Μετά την 6η Α γίνει προσθήκη Τ. (Σας δίνεται ο γενετικός κώδικας) 22. Δίνεται το γονίδιο: Κωδική αλ. 5 ACCGATGCTTACCGTTGTGTCATGAAACA 3 Μη κωδική αλ. 3 TGGCTACGAATGGCAACACAGTACTTTGT 5 το οποίο κωδικοποιεί το τριπεπτίδιο Λευκίνη-Βαλίνη-Σερίνη α. Εντοπίστε, αφού γράψετε το mrna που προκύπτει, τις 5 και 3 αμετάφραστες περιοχές, τα εσώνια και τα εξώνια. β. Σε τι είδους οργανισμό ανήκει το γονίδιο αυτό; γ. Με ποιες διαδικασίες καταλήξαμε από το γονίδιο στο πεπτίδιο; Σε ποιες περιοχές του κυττάρου γίνονται; δ. Ποιο είναι το σταθερότερο: το γονίδιο που δόθηκε ή κάποιο άλλο με τον ίδιο αριθμό νουκλεοτιδίων αλλά με ποσοστιαία σύσταση 35% Α-Τ; (δίνεται ο γενετικός κώδικας). Λευκίνη (UUA, UUG, CUU, CUA, CUG, CUC), Βαλίνη (GUU, GUA, GUG, GUC), Σερίνη (UCU, UCG, UCA, UCC, AGU, AGC) 23. Ένα γονίδιο έχει μήκος 8414 ζεύγη βάσεων και είναι υπεύθυνο για δημιουργία πρωτεΐνης 1686 αμινοξέων. Το πρόδρομο mrna περιλαμβάνει τις 5 και 3 αμετάφραστες περιοχές με μήκος 746 και 499 νουκλεοτίδια αντίστοιχα και ένα εσώνιο μήκους 1212 βάσεων. Να βρείτε αν στο γονίδιο υπάρχει και δεύτερο εσώνιο. 5

6 ΛΥΣΕΙΣ ΤΩΝ ΑΣΚΗΣΕΩΝ 1 Είναι γνωστό ότι τα γονίδια στους προκαρυωτικούς οργανισμούς είναι συνεχή. Επομένως το mrna που παράγεται μετά την μεταγραφή είναι έτοιμο να μεταφραστεί. Η μετάφραση γίνεται από το 5 άκρο του mrna με κατεύθυνση προς το 3 άκρο του, ξεκινάει από το πρώτο κωδικόνιο έναρξης (5 AUG 3 ) που σχηματίζεται στο μόριο και ολοκληρώνεται στο πρώτο κωδικόνιο λήξης που σχηματίζεται (5 UGA 3 ή 5 UAG 3 ή 5 UAA 3 ). Ωστόσο στο συγκεκριμένο μόριο mrna παρατηρούμε ότι δεν μας δίνεται ολόκληρη η αλληλουχία των βάσεων. Εφόσον δεν γνωρίζουμε το συνολικό αριθμό των νουκλεοτιδίων που αποτελούν το πλαίσιο ανάγνωσης, δεν μπορούμε να ξέρουμε την ακριβή ακολουθία των κωδικονίων που υπάρχουν στο τέλος του. Αυτό σημαίνει ότι πρέπει να λάβουμε υπόψη μας τρείς τρόπους ανάγνωσης της αλληλουχίας που ακολουθεί μετά από τα αποσιωποιητικά όπως φαίνεται παρακάτω: 1ος τρόπος ανάγνωσης 5 ΑΑΑGG AUG GCG UAU CCC AUG... UGC GCG UGA UUUAAAA 3 2oς τρόπος ανάγνωσης 5 ΑΑΑGG AUG GCG UAU CCC AUG... U GCG CGU GAU UUA AAA 3 : στην περίπτωση αυτή δεν εντοπίστηκε κωδικόνιο λήξης οπότε απορρίπτεται. 3ος τρόπος ανάγνωσης 5 ΑΑΑGG AUG GCG UAU CCC AUG... UG CGC GUG AUU UAA AA 3 Η πρωτοταγής δομή μιας πολυπεπτιδικής αλυσίδας είναι η αλληλουχία των αμινοξέων που την αποτελούν. Σύμφωνα με τα παραπάνω υπάρχουν δύο δυνατές περιπτώσεις ανάλογα με το πλαίσιο ανάγνωσης που ισχύει: 1ος τρόπος ανάγνωσης Μεθειονίνη αλανίνη τυροσίνη προλίνη μεθειονίνη. κυστεΐνηαλανίνη 3ος τρόπος ανάγνωσης Μεθειονίνη αλανίνη τυροσίνη προλίνη μεθειονίνη... X αργινίνη βαλίνη ισολευκίνη Το Χ παριστάνει το αμινοξύ που κωδικοποιείται από το πρώτο μη ολοκληρωμένο κωδικόνιο μετά τα αποσιωποιητικά, το οποίο μπορεί να είναι ΑUG (μεθειονίνη) ή UUG (λευκίνη) ή CUG (λευκίνη) ή GUG (βαλίνη). Σημείωση: υποθέτουμε ότι το κωδικόνιο λήξης βρίσκεται οπωσδήποτε στο κομμάτι της αλληλουχίας που ακολουθεί μετά από τα αποσιωποιητικά. 2, Το εσώνιο (7 νουκλεοτίδια) δεν είναι πολλαπλάσιο του 3, οπότε η προσθήκη του μεταξύ 2ου και 3ου κωδικονίου (τα οποία κωδικοποιούν, μετά την 1η μεθειονίνη, αντίστοιχα την 2η τρυπτοφάνη και 3η φαινυλαλανίνη) έχει σαν αποτέλεσμα την προσθήκη των αμινοξέων τρυπτοφάνη και μεθειονίνη στην 3 4η θέση της νέας πολυπεπτιδικής αλυσίδας τα οποία κωδικοποιήθηκαν από τα 6 πρώτα νουκλεοτίδια του εσωνίου, αλλά και την προσθήκη στην 5η θέση της αλυσίδας της βαλίνης που κωδικοποιείται από το κωδικόνιο GUU το οποίο προέκυψε από το 7ο νουκλεοτίδιο G του εσωνίου και τα 2 πρώτα νουκλεοτίδια UU του 6

7 αρχικού 3ου κωδικονίου, ενώ το 3ο νουκλεοτίδιο U του συγκεκριμένου αρχικού 3ου κωδικονίου αλλάζει τον βηματισμό της ανάγνωσης (όλα τα υπόλοιπα, μετά το αρχικό 3ο, κωδικόνια). Μπορεί να δημιουργείται νέο κωδικόνιο λήξης από το 6ο κιόλας κωδικόνιο του mrna ή και αργότερα από το αρχικό Κ.Λ., επομένως προκύπτει αγνώστου μήκους πρωτεΐνη (αφού αγνοούμε την παρακάτω αλληλουχία), μικρότερη ή μεγαλύτερη με διαφορετική πρωτοταγή δομή, επομένως διαφορετικής ενεργότητας σε σχέση με την αρχική και προφανώς νέος φαινότυπος. Φυσιολογικό (ώριμο) mrna : 5 AUG UGG UUU + 47 κωδικόνια + κωδικόνιο λήξης 3 Φυσιολογική πρωτεΐνη: μεθειονίνη τρυπτοφάνηφαινυλαλανίνη + 47 αμινοξέα Μεταλλαγμένο (πρόδρομο) mrna: 5 AUG UGG UGG AUG GUU U + 47 κωδικόνια + κωδικόνιο λήξης 3 Μεταλλαγμένη πρωτεΐνη: μεθειονίνητρυπτοφάνη τρυπτοφάνη μεθειονίνη βαλίνη + Χ αμινοξέα. 3. (Πρόδρομο και ώριμο mrna => ευκαρυωτικό κύτταρο => γραμμικό δίκλωνο DNA) α. Πολυπεπτιδική αλυσίδα=1000 αμινοξέα => 1000 κωδικόνια + 1 κωδικόνιο λήξης=1001 κωδικόνια => 1001 Χ 3 =3003 νουκλεοτίδια (πλαίσιο ανάγνωσης) => ώριμο mrna = νουκλεοτίδια (5 και 3 αμετάφραστες περιοχές)= 3203 νουκλεοτίδια β φωσφοδιεστερικοί δεσμοί στο πρόδρομο => 5000 νουκλεοτίδια => εσώνιο= νουκλεοτίδια= 1797 νουκλεοτίδια γ. πρόδρομο mrna = 5000 νουκλεοτίδια => αντίστοιχο DNA =2 Χ 5000 = νουκλεοτίδια 4. i. Oι δύο αλυσίδες του δίκλωνου μορίου DNA είναι αντιπαράλληλες και συμπληρωματικές. Η αλληλουχία των βάσεων του συμπληρωματικού κλώνου είναι: 3 ΤΑΤΑΑGTACGAATAGCCCTCTAAAAAGGTGTACATTATTTTTT 5 ii. Ο όρος κωδικόνιο αναφέρεται τόσο στο mrna όσο και στην κωδική αλυσίδα του γονιδίου. Η μετάφραση γίνεται από το 5 άκρο του mrna με κατεύθυνση προς το 3 άκρο του, ξεκινάει από το πρώτο κωδικόνιο (έναρξης, 5 AUG 3 ) και ολοκληρώνεται στο κωδικόνιο λήξης (5 UGA 3 ή 5 UAG 3 ή 5 UAA 3 ). Αντίστοιχα στην κωδική αλυσίδα του γονιδίου το 5 ATG 3 είναι το κωδικόνιο έναρξης και 5 TGA 3 ή 5 TAG 3 ή 5 ΤΑΑ 3 τα κωδικόνια λήξης. Η 5 αμετάφραστη περιοχή βρίσκεται πριν το κωδικόνιο έναρξης ενώ η 3 αμετάφραστη περιοχή βρίσκεται μετά το κωδικόνιο λήξης. Η αλυσίδα που πληρεί αυτά τα δεδομένα και επομένως είναι η κωδική είναι: 5 ΑTATTC ATG CTT ATC GGG AGA TTT TTC CAC ATG TAA TAAAAAA 3 iii. Με βάση το γενετικό κώδικα η αλληλουχία των αμινοξέων στο πεπτίδιο που θα σχηματιστεί κατά την μετάφραση του παραπάνω γονιδίου είναι: N Μεθειονίνη λευκίνη ισολευκίνη γλυκίνη αργινίνη φαινυλαλανίνη φαινυλαλανίνηιστιδίνη μεθειονίνη C. iv. Κατά την μεταμεταφραστική τροποποίηση σε πολλές πρωτεΐνες απομακρύνονται ορισμένα αμινοξέα από το αμινικό άκρο τους που είναι το άκρο που βρίσκεται πάντα από 7

8 την πλευρά του πρώτου αμινοξέος που μεταφράζεται. Στην προκειμένη περίπτωση θα απομακρυνθεί η μεθειονίνη του αμινικού άκρου και επομένως η αλληλουχία των αμινοξέων του πεπτιδίου που θα προκύψει είναι: N Λευκίνη ισολευκίνη γλυκίνη αργινίνη φαινυλαλανίνη φαινυλαλανίνη ιστιδίνημεθειονίνη C. 5. Το πρόδρομο mrna αποτελείται εκτός από τις 5 και 3 αμετάφραστες περιοχές που δεν τις λαμβάνουμε υπόψη και από τα εξώνια και τα εσώνια. Το μήκος των εσωνίων σε αυτό είναι 279 βάσεις αφού το πρόδρομο mrna είναι μονόκλωνο. Αφού κάθε κωδικόνιο κωδικοποιεί ένα αμινοξύ, υπάρχουν 141 κωδικόνια που κωδικοποιούν τα 141 αμινοξέα της πολυπεπτιδικής αλυσίδας συν το κωδικόνιο λήξης που δεν αντιστοιχεί σε αμινοξύ. Άρα συνολικά τα εξώνια αποτελούνται από 142 κωδικόνια ή 142x3 = 426 νουκλεοτίδια αφού κάθε κωδικόνιο είναι μία τριπλέτα αζωτούχων βάσεων. Επομένως το πρόδρομο mrna έχει μήκος =705 νουκλεοτίδια (χωρίς τις 5 και 3 αμετάφραστες περιοχές που βρίσκονται στα άκρα του). Το ώριμο mrna προκύπτει από το πρόδρομο mrna μετά από την αφαίρεση των εσωνίων κατά την διαδικασία της ωρίμανσης. Άρα έχει μήκος 426 νουκλεοτίδια (και εδώ δεν έχουν υπολογιστεί οι 5 και 3 αμετάφραστες περιοχές που βρίσκονται στα άκρα του μορίου.) 6 α. Από τη θεωρία γνωρίζουμε πως ένα κωδικόνιο τριπλέτα νουκλεοτιδίων κωδικοποιεί ένα αμινοξύ. Επομένως, 100 κωδικόνια x 3 νουκλεοτίδια/κωδικόνιο= 300 νουκλεοτίδια συν τρία νουκλεοτίδια που αντιστοιχούν στο κωδικόνιο λήξης (UAG, UGA ή UAA) το οποίο δε κωδικοποιεί κάποιο αμινοξύ, δηλαδή το τμήμα του mrna που κωδικοποιεί τη πολυπεπτιδική αλυσίδα αποτελείται από 303 νουκλεοτίδια. β. Τα εσώνια αποτελούν το 50% του μήκους του, δηλαδή: = 500 νουκλεοτίδια. Επομένως, το μήκος του πρόδρομου mrna είναι 1000 νουκλεοτίδια. Οι 5 και 3 αμετάφραστες περιοχές θα έχουν μήκος: 1000 νουκλεοτίδια ( )= 197 νουκλεοτίδια. Το mrna διατηρεί τις περιοχές αυτές και μετά την ωριμανση. γ. Εφόσον το μόριο αυτό περιέχει εσώνια, προέρχεται από ασυνεχές ή διακεκομμένο γονίδιο. Αυτό το είδος γονιδίων συναντάμε σε ευκαρυωτικούς οργανισμούς ή σε ιούς που τους προσβάλλουν. Οι περιοχές που μεταφράζονται σε αμινοξέα (εξώνια) διακόπτονται από ενδιάμεσες αλληλουχίες που δε μεταφράζονται σε αμινοξέα (εσώνια). δ. Κατά την έναρξη της μετάφρασης το mrna προσδένεται μέσω μιας αλληλουχίας που υπάρχει στη 5 αμετάφραστη περιοχή του, με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων. Εφόσον το συγκεκριμένο mrna δε μπορεί να προσδεθεί σωστά, η μετάλλαξη εντοπίζεται στη 5 αμετάφραστη περιοχή του. 8

9 7. Κατά μετάφραση το πρώτο αμινοξύ που εισάγεται είναι η μεθειονίνη, η οποία κωδικοποιείται από το κωδικόνιο έναρξης (5 AUG3 /5 ATG3 ). Συμπεραίνουμε ότι η μεθειονίνη έχει αφαιρεθεί από το συγκεκριμένο πεπτίδιο πράγμα που συμβαίνει συνήθως στις πρωτεΐνες μετά τη μετάφραση. Επίσης παρατηρούμε στο γενετικό κώδικα ότι τα αμινοξέα ιστιδίνη και λυσίνη κωδικοποιούνται από δύο συνώνυμα κωδικόνια το καθένα, ενώ το κωδικόνιο έναρξης μπορεί να είναι ένα εκ των 5 ΤΑΑ3, 5 ΤΑG3 ή 5 TGA3. Σύμφωνα με τα παραπάνω υπάρχουν περισσότερoι από ένας πιθανοί συνδυασμοί αλληλουχιών κωδικονίων στην κωδική αλυσίδα του γονιδίου που κωδικοποιεί το συγκεκριμένο τριπεπτίδιο: 5 ATG TGG CAT AAA TAA3, 5 ATG TGG CAT AAA TAG3 5 ATG TGG CAT AAA TGA3, 5 ATG TGG CAT AAG TAA3 5 ATG TGG CAT AAG TAG3, 5 ATG TGG CAT AAG TGA3 5 ATG TGG CAC AAA TAA3, 5 ATG TGG CAC AAA TAG3 5 ATG TGG CAC AAA TGA3, 5 ATG TGG CAC AAG TAA3 5 ATG TGG CAC AAG TAG3, 5 ATG TGG CAC AAG TGA3 8. Η Α πολυπεπτιδική αλυσίδα έχει =200 αμινοξέα. Επειδή κάθε αμινοξύ κωδικοποιείται από μια τριάδα νουκλεοτιδίων στο mrna, στο αντίστοιχο mrna υπάρχουν 200 Χ 3 = 600 νουκλεοτίδια που κωδικοποιούν αυτά τα αμινοξέα. Στα προκαρυωτικά κύτταρα το mrna που μεταφράζεται είναι ίδιο με αυτό που προκύπτει με μεταγραφή. Σε αυτό θα υπάρχουν 400 νουκλεοτίδια στις 5 και 3 αμετάφραστες περιοχές και το κωδικόνιο λήξης που δε μεταφράζονται σε αμινοξέα και άλλα 600 νουκλεοτίδια που μεταφράζονται σε αμινοξέα. Δηλαδή 1000 νουκλεοτίδια συνολικά. Στο αντίστοιχο γονίδιο, επειδή είναι δίκλωνο, θα έπρεπε να υπάρχουν 1000 Χ 2 = 2000 νουκλεοτίδια και όχι 2400 νουκλεοτίδια. Άρα δεν μπορεί να προέρχεται από προκαρυωτικό κύτταρο αλλά από ευκαρυωτικό. Τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών έχουν εσώνια ενώ των προκαρυωτικών όχι. Το mrna που μεταγράφεται ονομάζεται πρόδρομο mrna και έχει 1200 νουκλεοτίδια (όσα τα μισά νουκλεοτίδια του γονιδίου). Όμως το mrna που μεταφράζεται (ώριμο) έχει τόσα νουκλεοτίδια όσα υπολογίσαμε προηγουμένως, δηλαδή Αυτή η διαφορά τους κατά 200 νουκλεοτίδια οφείλεται στα εσώνια που αφαιρέθηκαν από το πρόδρομο mrna. 9. Οι DNA πολυµεράσες... ασυνεχής στην άλλη» (Σχολικό Βιβλίο σελ. 30) Πάνω αλυσίδα : Συνεχής Ασυνεχής (όπου η θέση έναρξης της αντιγραφής) Κάτω αλυσίδα : Ασυνεχής Συνεχής 1 συνεχές και 9 ασυνεχή πρωταρχικά τµήµατα για κάθε νέα αλυσίδα 9

10 10. Α.i) Το κωδικόνιο έναρξης της µετάφρασης στο mrna 5 AUG 3. Το αντίστοιχο κωδικόνιο στη µη κωδική αλυσίδα θα είναι 3 TAC 5, αφού οι αλυσίδες είναι αντιπαράλληλες. Τα κωδικόνια λήξης του mrna είναι 5 UAG 3, ή 5 UGA 3, ή 5 UAA 3, τα αντίστοιχα στη µεταγραφόµενη αλυσίδα του DNA θα είναι τα 3 ATC 5, ή 3 ACT 5, ή 3 ATT 5. Τέλος οι βάσεις ανάµεσα στο κωδικόνιο έναρξης και το κωδικόνιο λήξης θα πρέπει να είναι ανά τριάδες. Σύµφωνα µε τα παραπάνω έχουµε: 5 CGAAATATGCGCGGGAGAAAATGACGCCC 3 κωδική 3 GCTT TATACGCGCCCT CTT TTACTGCGGG 5 µη κωδική ii) mrna : 5 CGAAAUAUGCGCGGGAGAAAAUGACGCCC 3 trna : 3 UAC 5, 3 GCG 5, 3 CCC 5, 3 UCU 5, 3 UUU 5 Το κωδικόνιο λήξης δεν κωδικοποιεί κανένα αµινοξύ (δεν έχει αντίστοιχο αντικωδικόνιο) iii) Ανάµεσα σε Α και U υπάρχουν δύο δεσµοί υδρογόνου και ανάµεσα σε C και G τρεις δεσµοί υδρογόνου. Εποµένως θα έχουµε = 38 δεσµούς υδρογόνου, όπου 7 τα ζεύγη Α U και όπου 8 τα ζεύγη G C Από τη µετάφραση του παραπάνω τµήµατος θα σχηµατιστούν 5 αµινοξέα, ανάµεσα στα οποία θα αναπτυχθούν 4 πεπτιδικοί δεσµοί. Β. i) Μετάλλαξη στο κωδικόνιο έναρξης της µετάφρασης δε θα γίνει φυσιολογική έναρξη και κατ επέκταση και σύνθεση της πρωτεΐνης ii) Πρόωρος τερµατισµός στη σύνθεση της πρωτεΐνης µετατροπή κωδικονίου αµινοξέος σε κωδικόνιο λήξης iii) Καµία µεταβολή. Το νέο κωδικόνιο είναι και πάλι κωδικόνιο λήξης. 11. Οι DNA πολυμεράσες, που είναι τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA, δεν έχουν την ικανότητα να αρχίσουν τη διαδικασία αυτή. Για το λόγο αυτό, το πριμόσωμα, ένα σύμπλοκο ενζύμων, συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. Επομένως, εφόσον τα πρωταρχικά τμήματα είναι RNA τμήματα, στη συγκεκριμένη περίπτωση το πρωταρχικό τμήμα αποτελείται από 7 βάσεις ή από 7 ριβονουκλεοτίδια. Αυτό γιατί μετά το 7ο ριβονουκλεοτίδιο, ακολουθεί δεοξυριβονουκλεοτίδιο, εφόσον φέρει ως αζωτούχο βάση τη Τ. Ανάμεσα στην Α και την U αναπτύσσονται 2 δεσμοί υδρογόνου και ανάμεσα στην C και την G 3 δεσμοί υδρογόνου. Επομένως έχουμε: Δ.Η = (2 x 4) + (3 x 3) = Α. 5 C C G G T T A A G G C T C A T A C A G C A T G A G C C G A T 3 3 G G C C A A T T C C G A G T A T G T C G T A C T C G G C T A 5 Σελ "Κατά την έναρξη της μεταγραφής ενός γονιδίου... προσανατολισμό 5 >3 " Το πρώτο κωδικόνιο του mrna είναι το AUG (κωδικόνιο έναρξης που κωδικοποιεί τη μεθειονίνη). Επομένως πριν από αυτό υπάρχει η 5 αμετάφραστη περιοχή, ενώ στη συνέχεια με βήματα τριπλέτας (συνεχής μη επικαλυπτόμενος γενετικός κώδικας) συναντάμε το κωδικόνιο λήξης (UAA ή UGA ή UAG) και ακολουθεί η 3 αμετάφραστη περιοχή. Ο όρος κωδικόνιο δεν αναφέρεται μόνο στο mrna από το οποίο παράχθηκε. Η 10

11 αλληλουχία των βάσεων είναι η ίδια μόνο που στη θέση της ουρακίλης έχουμε θυμίνη. Λόγω συμπληρωματικότητας και αντιπαραλληλίας, η μη κωδική αλυσίδα έχει την εξής σειρά αλληλουχιών: αλληλουχία αζωτούχων βάσεων που με τη μεταγραφή δίνει την 5 αμετάφραστη περιοχή, το κωδικόνιο έναρξης (ΤΑC), τις υπόλοιπες τριπλέτες εξονίων και το κωδικόνιο λήξης (ΑΤΤ, ATG, AGT) και τέλος την 3 αμετάφεραστη περιοχή. Η μη κωδική αλυσίδα του γονιδίου αρχίζει να μεταγράζεται από το 3 άκρο προς το 5 άκρο, αφού προκύπτει mrna με προσανατολισμό 5 >3. Β. mrna: 3 GGCCAAU UCC GAG UAU GUC GUACTCGGCUA 5 η πολυπεπτιδική αλυσίδα που δημιουργείται είναι η εξής: ΝH2 met leu tyr glu pro COOH Με βάση το γενετικό κώδικα, σε κάθε κωδικόνιο του mrna αντιστοιχεί και ένα αμινοξύ. Εξαίρεση αποτελεί το κωδικόνιο λήξης. Η πολυπεπτιδική αλυσίδα που δημιουργείται έχει ως πρώτο αμινοξύ την μεθειονίνη, με ελεύθερη την αμινομάδα ( H2N), ενώ το τελευταίο αμινοξύ έχει ελεύθερη την καρβοξυλική ομάδα ( COOH). Γ. Τα αντικωδικόνια είναι συμπληρωματικά και αντιπαράλληλα με τα κωδικόνια. Στο αντικωδικόνιο λήξης δεν αντιστοιχεί αντικωδικόνιο, αφού αυτό δεν κωδικοποιεί αμινοξύ. Επειδή κάθε αντικωδικόνιο ανήκει και σε διαφορετικό trna, τα αντικωδικόνια δεν ενώνονται μεταξύ τους, οπότε τα καθένα ξεχωριστά έχει μπροστά ελεύθερο το 3 άκρο ενώ στο τέλος το 5 άκρο. Έτσι έχουμε: 3 UAC 5, 3 GAC 5, 3 AUA 5, 3 CUC 5, 3 GGA Γνωρίζουμε τα εξής: 1) Ο γενετικός κώδικας είναι κώδικας τριπλέτας, συνεχής και μη επικαλυπτόμενος. 2) Το βακτηριακό κύτταρο είναι προκαρυωτικό, άρα δεν γίνεται ωρίμανση του mrna. 3) Κατά την έναρξη της μετάφρασης η μικρή ριβοσωμική υπομονάδα συνδέεται με μια αλληλουχία που υπάρχει στην 5 αμετάφραστη περιοχή του mrna, δίπλα στην οποία βρίσκεται το κωδικόνιο έναρξης AUG που αντιστοιχεί στο αμινοξύ μεθειονίνη. Δηλαδή το πρώτο αμινοξύ κάθε νεοσυντιθέμενης πολυπεπτιδικής αλυσίδας είναι η μεθειονίνη η οποία έχει ελεύθερο το αμινικό της άκρο. Επομένως το τελευταίο αμινοξύ θα έχει ελεύθερο το καρβοξυλικό άκρο. Κατά την επιμήκυνση της πολυπεπτιδικής αλυσίδας το ριβόσωμα κινείται πάνω στο mrna με κατεύθυνση 5 3 «διαβάζοντας» όλα τα διαδοχικά κωδικόνια που συναντά. Η επιμήκυνση τελειώνει όταν το ριβόσωμα συναντήσει ένα από τα κωδικόνια λήξης. Δηλαδή στο mrna το κωδικόνιο έναρξης βρίσκεται κοντά στο άκρο 5 και το κωδικόνιο λήξης κοντά στο άκρο 3. 4) Όλες οι πρωτεΐνες (πολυπεπτιδικές αλυσίδες) ενός οργανισμού δεν έχουν ως πρώτο αμινοξύ την μεθειονίνη. Αυτό συμβαίνει γιατί μετά τη σύνθεσή τους απομακρύνονται ορισμένα αμινοξέα από το αμινικό άκρο. Από τα παραπάνω συμπεραίνουμε ότι από το δοσμένο ολιγοπεπτίδιο έχουν απομακρυνθεί ορισμένα αμινοξέα από το αμινικό του άκρο και γι αυτό ξεκινά με το αμινοξύ σερίνη. Επομένως το αντίστοιχο τμήμα mrna θα έχει στο άκρο του 5 το κωδικόνιο της σερίνης και στο άκρο 3 το κωδικόνιο της μεθειονίνης, δηλαδή: Ολιγοπεπτίδιο Η2Ν σερίνη λευκίνη προλίνη ιστιδίνη μεθειονίνη COOH mrna 5 U C U C U C C C U C A A A U G 3 11

12 Κατά τη μεταγραφή το mrna συντίθεται με χημικό καλούπι την μη κωδική αλυσίδα του DNA σύμφωνα με τον κανόνα της συμπληρωματικότητας και είναι αντιπαράλληλο προς αυτή. Δηλαδή απέναντι από το άκρο 5 mrna βρίσκεται το άκρο 3 της μη κωδικής του DNA και αντίστροφα. Επειδή η κωδική αλυσίδα είναι και αυτή συμπληρωματική και αντιπαράλληλη με την μη κωδική συμπεραίνουμε ότι το mrna και η κωδική αλυσίδα έχουν την ίδια αλληλουχία βάσεων στην κατεύθυνση 5 3 με τη διαφορά ότι στη θέση της θυμίνης του DNA, υπάρχει η βάση ουρακίλη στο mrna. Επίσης τα κωδικόνια υπάρχουν στο mrna και στην κωδική του DNA, για παράδειγμα στο κωδικόνιο έναρξης 5..AUG..3 του mrna αντιστοιχεί το κωδικόνιο έναρξης της κωδικής 5..ATG..3. Επομένως: mrna 5 UCU CUC CCU CAA AUG 3 Κωδική 5 TCT CTC CCT CAA ATG 3 Μη κωδική 3. AGA GAG GGA GTT TAG 5 14 Το πρόδρομο mrna έχει μήκος 1000 βάσεις (τις μισές από όσες έχει το γονίδιο), επομένως το ώριμο mrna θα έχει μήκος = 800 βάσεις. Το 90% των βάσεων αυτών (δηλαδή οι 720 βάσεις) κωδικοποιούν αμινοξέα, συγκεκριμένα κωδικοποιούν 720:3=240 αμινοξέα. Δεδομένου ότι κατά την τροποποίηση της πολυπεπτιδικής αλυσίδας μετά την σύνθεσή της απομακρύνονται 9 αμινοξέα, η λειτουργική πρωτεϊνη αποτελείται από = 231 αμινοξέα. Το 10% των βάσεων του ώριμου mrna (δηλαδή 80 βάσεις) αντιστοιχούν στις 3 και 5 αμετάφραστες περιοχές, αλλά και στο κωδικόνιο λήξης. 15 Θα έχουμε 23 τριάδες φτιάχνουμε όλες τις τριάδες και στην συνέχεια κάθε τριάδα πολλαπλασιάζουμε για κάθε U της τριάδες με 4/5 και για κάθε G με 1/5. 16 a. mrna: 3 AUG AAA CCC GAU AGU UGA 5 Met Lys Pro Asp Ser λήξη b. 5 και 3 αμετάφραστες περιοχές: 5 ACGG... AAACA 5 c. το εσώνιο 5 ACCGUU 3 d. Ανήκει σε ευκαρυωτικό οργανισμό (λόγω εσωνίων). 17 Το σύμπλεγμα των ριβοσωμάτων με το mrna ονομάζεται πολύσωμα (Σχολικό Βιβλίο σελ. 38). Αφού παρήχθησαν συνολικά 10 πρωτεΐνες η καθεμία θα έχει μήκος 100 αμινοξέων και αφού προέρχονται από τη μεταγραφή του ιδίου mrna είναι φυσικά όλες ίδιες μεταξύ τους. Κατά συνέπεια το ώριμο mrna θα έχει συνολικά 100Χ3+3=303 ριβονουκλεοτίδια. Πολλαπλασιάσαμε με 3 επειδή γνωρίζουμε ότι ο γενετικός κώδικας είναι τριαδικός δηλαδή 12

13 τρία νουκλεοτίδια κωδικοποιούν ένα αμινοξύ και η προσθήκη των τριών νουκλεοτιδίων (βάσεων) αντιστοιχεί στο κωδικόνιο λήξης. 18 Εφόσον η εκφώνηση αναφέρει ότι το DNA είναι πυρηνικό, σημαίνει ότι προέρχεται από ευκαρυωτικό οργανισμό άρα ενδέχεται να είναι ασυνεχές. Παρατηρώντας και τις δυο αλυσίδες που μας δίδονται και προς τις δυο κατευθύνσεις εντοπίζουμε την τριπλέτα ATG στην αλυσίδα Ι. Γνωρίζουμε ότι το mrna είναι κινητό αντίγραφο της κωδικής αλυσίδας με μόνη διαφορά ότι αντί της ουρακίλης έχουμε θυμίνη. Άρα το ATG πιθανώς αντιστοιχεί στο AUG, κωδικόνιο έναρξης στο mrna: (Ι) GATCTATGCCTGCATTGCTAGCTΤCATTTTGACCGA Για να επιβεβαιώσουμε ότι όντως αυτό είναι το κωδικόνιο έναρξης θα πρέπει να ελέγξουμε αν και τα υπόλοιπα κωδικόνια αντιστοιχούν στα αμινοξέα της πρωτεΐνης. Διαβάζουμε τα νουκλεοτίδια μετά το ATG ανά τρία χωρίς να παραλείψουμε κανένα και χωρίς να συμπεριλάβουμε κάποιο σε δυο κωδικόνια εφόσον ο γενετικός κώδικας είναι κωδικός τριπλέτας, συνεχής και μη επικαλυπτόμενος. Διαπιστώνουμε ότι το ATG ακολουθούν τα κωδικόνια CCT και GCA που αντιστοιχούν στα αμινοξέα pro και ala αντίστοιχα. Αντιθέτως παρατηρούμε ότι ανάμεσα στα νουκλεοτίδια Τ και C του κωδικονίου TCA που αντιστοιχεί στο αμινοξύ σερίνη παρεμβάλλεται αλληλουχία που αντιστοιχεί σε εσώνιο, και δεν μεταφράζεται. Συνεχίζοντας εντοπίζουμε το κωδικόνιο ΤΤΤ που αντιστοιχεί στην phe και το κωδικόνιο λήξης TGA: (Ι) GATCT ATG CCT GCA T TGCTAGCTΤ CA TTT TGA CCGA Εφόσον το mrna είναι κινητό αντίγραφο της κωδικής αλυσίδας με μόνη διαφορά ότι αντί της ουρακίλης έχουμε θυμίνη, η αλυσίδα (Ι) αποτελεί την κωδική με άκρα (Ι) 5 GATCT ATG CCT GCA T TGCTAGCTΤ CA TTT TGA CCGA 3 Η απέναντι αλυσίδα, που είναι συμπληρωματική και αντιπαράλληλη, αποτελεί την μη κωδική. Το πρόδρομο mrna που θα προκύψει μαζί με τις 5 και 3 αμετάφραστες περιοχές είναι: 5 GAUCUAUGCCUGCAUUGCUAGCUUCAUUUUGACCGA 3 ενώ το ώριμο mrna είναι: 5 GAUCUAUGCCUGCAUCAUUUUGACCGA =822 => 822/3=274 κωδικόνια => 274 1=273 αμινοξέα => =120 αμινοξέα απομακρύνθηκαν 20 Το πρόδρομο mrna που προκύπτει από τη μεταγραφή είναι συμπληρωματικό της μιας (μεταγραφόμενης) αλυσίδας του δίκλωνου μορίου DNA. Επομένως θα αποτελείται από 2500 νουκλεοτίδια. Ο αριθμός των νουκλεοτιδίων του mrna που κωδικοποιεί αμινοξέα μπορεί να υπολογιστεί αν από το πρόδρομο mrna αφαιρεθούν οι περιοχές που δεν μεταφράζονται δηλαδή τα 13

14 νουκλεοτίδια που αντιστοιχούν στα δύο εσώνια, στις 5 και 3 αμετάφραστες περιοχές και στο κωδικόνιο λήξης: 2500 ( ) = 600 νουκλεοτίδια Γνωρίζουμε ότι ο γενετικός κώδικας είναι κώδικας τριπλέτας, συνεχής και μη επικαλυπτόμενος. Επομένως τα 600 νουκλεοτίδια αντιστοιχούν σε 600 : 3 = 200 κωδικόνια ή 200 αμινοξέα στην παραγόμενη μη λειτουργική πολυπεπτιδική αλυσίδα. Από την αλυσίδα αυτή αφαιρέθηκαν 20 αμινοξέα, οπότε η λειτουργική πρωτεΐνη αποτελείται από: = 180 αμινοξέα. 21 α. Προκύπτει συνώνυμο κωδικόνιο (Λευκίνη) β. Προκύπτει κωδικόνιο λήξης πιο νωρίς, με αποτέλεσμα να δημιουργηθεί μικρότερη πρωτεΐνη. γ. Αλλάζει το κωδικόνιο έναρξης σε Λυσίνη και η μετάφραση θα ξεκινήσει όταν το ριβόσωμα συναντήσει το επόμενο κωδικόνιο έναρξης. δ. Δημιουργείται κωδικόνιο έναρξης πιο νωρίς άρα θα σχηματιστεί μεγαλύτερη πρωτεΐνη. 22 Η μεταγραφή έχει προσανατολισμό 5 3. Δηλαδή, το κωδικόνιο έναρξης του mrna θα είναι κοντά στο 5 άκρο του ενώ το κωδικόνιο λήξης κοντά στο 3 άκρο του. Επομένως, το ίδιο θα ισχύει και για την κωδική αλυσίδα του γονιδίου, ενώ στη μη κωδική θα υπάρχει στο 3 άκρο της τριπλέτα TAC (συμπληρωματική του κωδικονίου έναρξης AUG του mrna) και στο 5 άκρο της μία τριπλέτα συμπληρωματική ενός από τα τρία κωδικόνια λήξης του mrna (UAG, UGA και UAA). α. Αν η φορά μεταγραφής είναι από αριστερά προς τα δεξιά, η κάτω αλυσίδα με προσανατολισμό 3 5 είναι η μη κωδική και μεταγράφεται στο ακόλουθο mrna: 5 ACCGAUGCUUACCGUUGUGUCAUGAAACA 3 Το m RNA αυτό πρέπει να μεταφράζεται στο τριπεπτίδιο Λευκίνη Βαλίνη Σερίνη για να είναι σωστή η υπόθεσή μας ως προς τη φορά μεταγραφής. Από το γενετικό κώδικα βρίσκουμε την αντιστοίχιση των 3 αμινοξέων του πεπτιδίου(το οποίο τη στιγμή της σύνθεσής του είχε πρώτο αμινοξύ τη μεθειονίνη που κωδικοποιείται από το κωδικόνιο έναρξης AUG) με τις τριπλέτες του m RNA που τις κωδικοποιούν. Παρατηρούμε ότι στο παραπάνω mrnaυπάρχει το εσώνιο ACCGUU που όταν αφαιρείται, κατά τη διαδικασία της ωρίμανσης, από τα ριβονουκλεοπρωτεϊνικά σωματίδια, προκύπτει το ώριμο m RNA: 5 ACCGAUGCUUGUGUCAUGA AACA 3 που δίνει το εν λόγω πεπτίδιο. Άρα το εσώνιο είναι 5 ACCGUU 3, ενώ τα εξώνια είναι 2: 5 AUGCUU 3 και 5 GUGUCAUGA 3. Οι 5 και 3 αμετάφραστες περιοχές του m RNA είναι ACCG και AACA αντίστοιχα. Πρέπει να σημειωθεί ότι αν η φορά μεταγραφής είναι από δεξιά προς τα αριστερά επίσης παράγεται mrna με την πάνω αλυσίδα να λειτουργεί ως μη κωδική. Το mrna στην περίπτωση αυτή είναι το 5 UGUUUCAUGACACAACGGUAAGCAUCGGU 3 το οποίο είναι προφανές ότι δεν κωδικοποιεί το πεπτίδιο. Άρα απορρίπτεται. β. Αφού εντοπίστηκε εσώνιο στο mrna, (άρα και στο γονίδιο), το γονίδιο αυτό ανήκει σε 14

15 ευκαρυωτικό οργανισμό ή σε ιό ευκαρυωτικού κυττάρου. γ. Αρχικά, το γονίδιο μεταγράφεται, δηλαδή συντίθεται πρόδρομο m RNA, με προσανατολισμό 5 3, συμπληρωματικό της μη κωδικής αλυσίδας του γονιδίου. Η διαδικασία αυτή καταλύεται από την RNA πολυμεράση και πραγματοποιείται στον πυρήνα του ευκαρυωτικού κυττάρου. Στον πυρήνα, επίσης, γίνεται και η ωρίμανση του πρόδρομου mrna με τη δράση των ριβονουκλεοπρωτεϊνικών σωματιδίων (αποτελούνται από snrna και πρωτεϊνες), τα οποία αφαιρούν το εσώνιο και συρράπτουν μεταξύ τους τα 2 εξώνια. Έτσι προκύπτει το ώριμο m RNA, το οποίο βγαίνει από τον πυρήνα και πηγαίνει στα ριβοσώματα, όπου και μεταφράζεται στο τριπεπτίδιο. δ. Το γονίδιο που δόθηκε έχει 29 ζεύγη βάσεων. Από αυτά τα 13 ζεύγη βάσεων είναι ζεύγη G C και αποτελούν το 44,8% του γονιδίου. Το δεύτερο γονίδιο δίνεται ότι έχει 65% G C. Επομένως, το 2ο τμήμα DNA είναι πιο σταθερό αφού έχει μεγαλύτερο ποσοστό G C ( αζωτούχων βάσεων που σχηματίζουν τριπλό δεσμό υδρογόνου) από το 1ο, ενώ έχουν το ίδιο μήκος. 23 Το γονίδιο είναι υπεύθυνο για 1686 αμινοξέα που δημιουργούνται από τα αντίστοιχα κωδικόνια. Επειδή είναι κώδικας τριπλέτας ο γενετικός κώδικας τα 1686 κωδικόνια είναι 1686 x 3= 5058 βάσεις στο mrna. Αν σε αυτές προστεθούν 3 βάσεις από το κωδικόνιο λήξης που δεν αντιστοιχούν σε αμινοξύ, οι 5 και 3 αμετάφραστες περιοχές και το εσώνιο, προκύπτει πρόδρομο mrna μήκους 7518 βάσεων. Επειδή από το γονίδιο μέσω μεταγραφής προκύπτει mrna 8414 βάσεων, αντιλαμβανόμαστε ότι υπάρχει και άλλο εσώνιο που αποτελείται από 896 βάσεις στο mrna. 15


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η

Κεφάλαιο 2 Α Ν Τ Ι Γ Ρ Α Φ Η ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαιο 2 Μεθοδολογία Ασκήσεων Α Ν Τ Ι Γ Ρ Α Φ Η 1 η Κατηγορία: Ασκήσεις στην Αντιγραφή (υπολογιστικές) Αφού αναφέρουμε τον ημισυντηρητικό τρόπο αντιγραφής φτιάχνουμε ένα απλό σχήμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2,

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18


Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις

Βιολογία ομάδας προσανατολισμού θετικών σπουδών. Πανελλαδικές εξετάσεις Βιολογία ομάδας προσανατολισμού θετικών σπουδών Πανελλαδικές εξετάσεις 2015-2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος ονομάζεται η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα


5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής


Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα


5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Κατεύθυνσης 24 Μαΐου 2013 ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τροποποιούνται έξω

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ Εκφωνήσεις ΘΕΜΑ 1 ο Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Πόσα µόρια DNA απεικονίζονται στον καρυότυπο ενός σωµατικού κυττάρου, ενός

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και Ώρα εξέτασης: Τρίτη, 26 Μαΐου 2009 07:30 10:30

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα