ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010"

Transcript

1 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2010 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Σάββατο, 22 Μαΐου :30-10:30 ΤΟ ΕΞΕΤΑΣΤΙΚΟ ΔΟΚΙΜΙΟ ΑΠΟΤΕΛΕΙΤΑΙ ΑΠΟ ΕΝΤΕΚΑ (11) ΣΕΛΙΔΕΣ ΝΑ ΑΠΑΝΤΗΣΕΤΕ ΣΕ ΟΛΕΣ ΤΙΣ ΕΡΩΤΗΣΕΙΣ ΜΕΡΟΣ Α : Αποτελείται από έξι (6) ερωτήσεις των πέντε (5) μονάδων η καθεμιά. 1. Το πιο κάτω σχεδιάγραμμα παρουσιάζει τη δομή του μορίου δύο λιπαρών ουσιών σε απλοποιημένη μορφή. (α) Να ονομάσετε την κατηγορία λιπαρών ουσιών στην οποία ανήκουν τα μόρια Α και Β. (β) Να αναφέρετε δύο φυσικοχημικές ιδιότητες των ουδέτερων λιπών και να εξηγήσετε τη βιολογική σημασία της κάθε μιας. (μον.4) -1 -

2 2. Διενεργήθηκε πείραμα για τη διερεύνηση της επίδρασης της θερμοκρασίας στην ταχύτητα της ενζυμικής αντίδρασης. Τα αποτελέσματα του φαίνονται στη πιο κάτω γραφική παράσταση, με τη βοήθεια της οποίας να απαντήσετε στα πιο κάτω: (α) Ποια είναι η άριστη τιμή της θερμοκρασίας του ενζύμου στο συγκεκριμένο πείραμα; Να αιτιολογήσετε την απάντησή σας. (β) Να ονομάσετε δυο παράγοντες που θα πρέπει να παραμείνουν σταθεροί κατά την διάρκεια του πιο πάνω πειράματος. (γ) Να εξηγήσετε τι είναι η μετουσίωση ενός πρωτεϊνικής φύσεως ενζύμου. 3. Το πιο κάτω σχήμα δείχνει τρεις διαδοχικές φάσεις από μια κυτταρική διαίρεση. -2 -

3 (α) Τι είδος κυτταρικής διαίρεσης παρουσιάζει το σχήμα; Να δικαιολογήσετε την απάντησή σας. (β) Ποια φάση της κυτταρικής διαίρεσης παρουσιάζει η εικόνα Β; (γ) Δώστε δυο διαφορές μεταξύ της μίτωσης και της μείωσης. 4. Το πιο κάτω σχεδιάγραμμα αφορά στη δομή του DNA. (α) Τι αντιπροσωπεύουν τα γράμματα Α μέχρι Δ. (β) Ένα τμήμα DNA έχει συνολικά 20 βάσεις. Από αυτές οι έξι είναι βάσεις Θυμίνης (Τ). Πόσους δεσμούς υδρογόνου περιέχει αυτό το τμήμα DNA;( μον.1) (γ) Να γράψετε δύο διαφορές στη χημική σύσταση μεταξύ του ριβονουκλεοτιδίου και του δεσοξυριβονουκλεοτιδίου. 5. (α) Να αναφέρετε μια (1) φυσικοχημική ιδιότητα του νερού και να εξηγήσετε τη βιολογική σημασία της. -3 -

4 (β)το πιο κάτω σχήμα παρουσιάζει τη δομή ενός αμινοξέος. Να ονομάσετε το μέρος Α του πιο πάνω μορίου. (γ) Να γράψετε ένα είδος πρωτεΐνης και να εξηγήσετε το ρόλο που επιτελεί. 6. Το σχεδιάγραμμα παρουσιάζει ανθρώπινο σπερματοζωάριο. (α) Να γράψετε τι παριστάνουν τα γράμματα Α και Β. (β) Σε ποιο μέρος του γεννητικού συστήματος της γυναίκας γίνεται η εναπόθεση των σπερματοζωαρίων και σε ποιο η ανάπτυξη του εμβρύου; (γ) Πως επιτυγχάνεται η αναγνώριση του σπερματοζωαρίου από το ωοκύτταρο Β τάξης, κατά τη διαδικασία της γονιμοποίησης; ΜΕΡΟΣ Β : Αποτελείται από τέσσερις (4) ερωτήσεις των δέκα (10) μονάδων η καθεμιά. 7. (α) Από διασταύρωση άντρα με ομάδα αίματος Α και ρέζους Rh, με γυναίκα με ομάδα αίματος Ο και Rh +, γεννιέται παιδί με ομάδα Ο και ρέζους Rh. Να κάνετε την κατάλληλη διασταύρωση δείχνοντας: i. τους γονότυπους του άντρα και της γυναίκας. ii. τους γαμέτες του άντρα και της γυναίκας. iii.όλους τους πιθανούς γονότυπους των απογόνων. iv.όλους τους πιθανούς φαινότυπους των απογόνων. (β) Να εξηγήσετε γιατί ένα άτομο με ομάδα αίματος Α δε μπορεί να είναι δότης για άτομο με ομάδα αίματος Β. -4 -

5 8. Τα άτομα με αλφισμό δεν παράγουν μελανίνη σε εξειδικευμένα κύτταρα λόγω της απουσίας του ενζύμου τυροσινάση. (α) Ας υποθέσουμε ότι ένα τμήμα του mrna, που είναι υπεύθυνο για παραγωγή της τυροσινάσης έχει κατά σειρά τις πιο κάτω βάσεις: A A U U G U U G C C C G Χρησιμοποιώντας τον πιο κάτω γενετικό κώδικα να γράψετε με τη σωστή σειρά τα αμινοξέα του τμήματος της πρωτεΐνης που παράγεται. 1 η 2 η Βάση 3 η Βάση U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη U U UUC φαινυλανανίνη UCC σερίνη UAC τυροσίνη UGC κυστεΐνη UUA λευκίνη UCA σερίνη UAA STOP UGA STOP UUG λευκίνη UCG σερίνη UAG STOP UGG τρυπτοφάνη C A G CUU λευκίνη CCU προλίνη CAU ιστιδίνη CGU αργινίνη U C CUC λευκίνη CCC προλίνη CAC ιστιδίνη CGC αργινίνη CUA λευκίνη CCA προλίνη CAA γλουταμίνη CGA αργινίνη CUG λευκίνη CCG προλίνη CAG γλουταμίνη CGG αργινίνη C A G AUU ισολευκίνη ACU θρεονίνη AAU ασπαραγγίνη AGU σερίνη U A AUC ισολευκίνη ACC θρεονίνη AAC ασπαραγγίνη AGC σερίνη AUA ισολευκίνη ACA θρεονίνη AAA λυσίνη AGA αργινίνη AUG μεθιονίνη STR ACG θρεονίνη AAG λυσίνη AGG αργινίνη C A G GUU βαλίνη GCU αλανίνη GAU ασπαρτικό οξύ GGU γλυκίνη U GUC βαλίνη GCC αλανίνη GAC ασπαρτικό οξύ GGC γλυκίνη C G GUA βαλίνη GCA αλανίνη GAA γλουταμινικό οξύ GUG βαλίνη GCG αλανίνη GAG γλουταμινικό οξύ GGA GGG γλυκίνη γλυκίνη A G (β) Nα περιγράψετε το ρόλο των μορίων trna κατά τη διαδικασία της παραγωγής του ενζύμου (πρωτεΐνη) τυροσινάση. (μον.4) -5 -

6 (γ) Να ονομάσετε ένα ένζυμο το οποίο συμμετέχει στη διαδικασία της μεταγραφής του DΝA και να εξηγήσετε το ρόλο του. (δ) Να γράψετε 2 χαρακτηριστικά των ενζύμων 9. Στο πιο κάτω σχεδιάγραμμα φαίνεται περιληπτικά η διαδικασία της γλυκόλυσης που γίνεται σε ένα ανθρώπινο μυϊκό κύτταρο. (α) Να ονομάσετε το προϊόν Α. (β) Να γράψετε σε ποιο στάδιο καταναλώνεταιι η ΑΤΡ. (γ) Να εξηγήσετε γιατί ο κύκλος του Krebs σταματά όταν δεν υπάρχει διαθέσιμο οξυγόνο. (δ) Να αναφέρετε σε ποιο ακριβώς μέρος του μιτοχονδρίου γίνεται ο κύκλος του Krebs. (ε) Να γράψετε: i. ποια ουσία είναι ο τελικός αποδέκτης των ηλεκτρονίων κατά το στάδιο της τελικής οξείδωσης ii. δύο από τα προϊόντα της τελικής οξείδωσης iii. πόσα μόρια ΑΤΡ παράγονται από τον κύκλο του Krebs ανά μόριο γλυκόζης. -6 -

7 10. Στο πιο κάτω σχεδιάγραμμα φαίνεται τμήμα του πεπτικού συστήματος του ανθρώπου. (α) Να ονομάσετε τα όργανα 1, 2, 3, 4, 5, 6. (β) Μετά την κατάποση το άμυλο φτάνει στο στομάχι. Με αναφορά στο πιο πάνω σχεδιάγραμμα να περιγράψετε τη διαδικασία πέψης του αμύλου σε μόρια γλυκόζης αναφέροντας τα σχετικά ένζυμα, το μέρος παραγωγής τους και τη δράση τους. (μον.4) (γ) Να περιγράψετε την απορρόφηση των λιπαρών ουσιών από το έντερο μέχρι τα λεμφαγγεία. -7 -

8 ΜΕΡΟΣ Γ : καθεμιά. Αποτελείται από δύο (2) ερωτήσεις των δεκαπέντε (15) μονάδων η 11. Το πιο κάτω σχεδιάγραμμα παρουσιάζει τομή καρδίας. (α) Να ονομάσετε τα αγγεία 1 μέχρι 4. (μον. 2) -8 - Πηγή: Life the science of biology, 7 th edition (2004)

9 (β) Όπως φαίνεται στο πιο πάνω σχήμα μετρήθηκε η αρτηριακή πίεση ενός ατόμου και βρέθηκε 120 mm Hg (σχήμα Α) και 70 mm Hg (σχήμα Β). Να εξηγήσετε τι σημαίνουν οι αριθμοί αυτοί. (γ) Ένα άτομο κάνει υπερβολική χρήση χλωριούχου νατρίου (αλατιού) στο φαγητό του. Να εξηγήσετε πως η συνήθειά του αυτή θα επηρεάσει την αρτηριακή του πίεση και γιατί; (δ) i. Τι ονομάζουμε έμφραγμα του μυοκαρδίου και εξηγήστε πως μπορεί να επιφέρει το θάνατο; ii. Να αναφέρετε δύο παράγοντες που ευθύνονται για το έμφραγμα του μυοκαρδίου. (ε) Να εξηγήσετε πως περιορίζονται οι τριβές λόγω της κίνησης της καρδίας; (στ) Τι είναι ο φλεβόκομβος και ποιος ο ρόλος του; (ζ) Στο πιο κάτω σχεδιάγραμμα παρουσιάζονται έμμορφα συστατικά του αίματος. i. Να ονομάσετε τα κύτταρα 1 και 2 και να αναφέρετε ένα ρόλο που επιτελούν. ii. Οι µυελοβλάστες ποια κύτταρα του αίματος παράγουν; -9 -

10 12. Στο πιο κάτω διάγραμμα φαίνεται συμβολικά ένα τμήμα χλωροπλάστη. Με τη βοήθεια του διαγράμματος και των γνώσεών σας γύρω από το θέμα αυτό (α) Να ονομάσετε τι αντιπροσωπεύουν τα Α μέχρι Γ. (β) Να δώσετε σύντομη περιγραφή των πιο κάτω φαινομένων. i.ιονισμός και αποϊονισμός των χλωροφυλλών αρ680 και αρ700 των φωτοσυστημάτων I (PSI) και II (PSII). ii.φωτόλυση του νερού αναγωγή του NADP + (γ) Να γράψετε τρεις διαφορές μεταξύ κυκλικής και μη κυκλικής φωτοσυνθετικής φωσφορυλίωσης

11 (δ) Στο πιο κάτω σχήμα φαίνεται ο κύκλος του Calvin. Τι είδους αντίδραση γίνεται κατά τη μετατροπή: i.του Φωσφορογλυκερινού οξέος σε Διφωσφορογλυκερινικό οξύ ii. του Διφωσφορογλυκερινικού οξέος σε Φωσφορογλυκεριναλδεϋδη; (ε) Ποιο από τα φωτοσυστήματα Ι και ΙΙ θεωρείται πιο εξελιγμένο; Να δικαιολογήσετε την απάντησή σας. --- ΤΕΛΟΣ

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση

07:30 10:30. παιδιά ορρός αντι-α ορρός αντι-β ορρός αντι-d (αντι- Rhesus) 2 εν έγινε συγκόλληση Έγινε συγκόλληση Έγινε συγκόλληση ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και Ώρα εξέτασης: Τρίτη, 26 Μαΐου 2009 07:30 10:30

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Πέμπτη, 12 ΙΟΥΝΙΟΥ 2008 07:30 10:30

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2006 Μάθηµα: ΒΙΟΛΟΓΙΑ Ηµεροµηνία και ώρα εξέτασης: ευτέρα, 5 Ιουνίου 2006 7.30 π.µ.

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: Δευτέρα, 20 Μαΐου 2013 07:30-10:30

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2015 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ Contents ΕΝΟΤΗΤΑ 2: ΧΗΜΕΙΑ ΤΗΣ ΖΩΗΣ... 3 ΕΝΟΤΗΤΑ 3: ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΝΖΥΜΑ... 16 ΕΝΟΤΗΤΑ

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2002 Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. ίκλωνο

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 6 ΚΕΦΑΛΑΙΟ 1 Να εξηγήσετε τη γέννηση ενός κοριτσιού με αιμορροφιλία από φυσιολογικούς γονείς 2 Δίνεται το γενεαλογικό δένδρο μιας οικογένειας στην οποία εμφανίζεται μια ασθένεια που

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R;

ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ. 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ 1. (α) Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; (β) Ποια είναι η απλούστερη μορφή του R; (γ) Ποιο μέρος του μορίου προσδίδει σε αυτό όξινες ιδιότητες; (δ) Ποιο μέρος του μορίου προσδίδει

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ (1). Τι είναι η φωτοσυνθετική φωσφορυλίωση και σε τι διακρίνεται; (2). Εξηγήστε το ρόλο των ουσιών (α) καρβοξυδισμουτάση (β) NADPH στη σκοτεινή φάση της

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια που κωδικοποιούν.

Διαβάστε περισσότερα

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4

Τράπεζα Θεμάτων Βιολογίας Β' Λυκείου 2014-2015 Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΓΗ_Β_ΒΙΟ_0_14364 Β5 (ΚΕΦ. 2, 4) ΘΕΜΑ Β: ΚΕΦΑΛΑΙΟ 4 ΙΙ. Τα μιτοχόνδρια ανήκουν σε μια ευρύτερη κατηγορία οργανιδίων που μετατρέπουν την ενέργεια που προσλαμβάνουν τα κύτταρα σε αξιοποιήσιμη μορφή. α) Να

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 30 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑΣ 2010 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ

ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑΣ 2010 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑΣ 2010 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΜΕΡΟΣ Α : 1. (α) Α: Ανήκει στα: ουδέτερα λίπη (τριγλυκερίδια) Β: Ανήκει στα: φωσφορολιπίδια (β) Δύο από τα πιο κάτω. Τα λίπη: Είναι κακοί αγωγοί

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ)

ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ (ΠΕΡΙΕΧΟΝΤΑΙ ΚΑΙ ΟΙ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ) ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ

ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΑΣΚΗΣΕΙΣ ΓΙΑ ΤΗ ΦΩΤΟΣΥΝΘΕΣΗ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ (1). Τι είναι η φωτοσυνθετική φωσφορυλίωση και σε τι διακρίνεται; Είναι η διαδικασία κατά την οποία παράγεται ATP (στο χλωροπλάστη), με δέσμευση φωτεινής

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012-2013

ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2012-2013 ΔΙΔΑΚΤΕΑ ΥΛΗ ΒΙΟΛΟΓΙΑΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 0-03. ΕΝΟΤΗΤΑ : Χαρακτηριστικά των ζωντανών οργανισμών (απλή αναφορά). ΕΝΟΤΗΤΑ : Η Χημεία της ζωής. ΒΑΣΙΚΕΣ ΧΗΜΙΚΕΣ ΕΝΝΟΙΕΣ, 5 9 (απλή αναφορά). ΤΟ ΝΕΡΟ ΚΑΙ Η ΒΙΟΛΟΓΙΚΗ

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011

ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία και Ώρα εξέτασης: ευτέρα, 23 Μαΐου 2011 07:30-10:30

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015

ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015 ΓΥΜΝΑΣΙΟ ΑΡΧ. ΜΑΚΑΡΙΟΥ Γ - ΠΛΑΤΥ ΣΧΟΛΙΚΟ ΕΤΟΣ 2014-2015 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2015 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ-ΧΗΜΕΙΑ ΗΜΕΡΟΜΗΝΙΑ: 12/6/2015 ΒΑΘΜΟΣ ΒΑΘΜΟΣ:... ΤΑΞΗ: Γ Αριθμητικά.. ΧΡΟΝΟΣ: 2 ώρες Ολογράφως:...

Διαβάστε περισσότερα

3. Το σχεδιάγραμμα παρουσιάζει τομή ανθρώπινου πεπτικού συστήματος.

3. Το σχεδιάγραμμα παρουσιάζει τομή ανθρώπινου πεπτικού συστήματος. ΠΕΠΤΙΚΟ 1. Α. Να γράψετε τα είδη των δοντιών Α, Β, Γ, Δ και τα μέρη του δοντιού Ε Μ. Β. Πόσα δόντια έχει ένα παιδί 3 χρόνων; Γ. Ποιοι αδένες αφήνουν το έκκριμά τους στη στοματική κοιλότητα και ποιο το

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος

ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ. Καρβουντζή Ηλιάνα Βιολόγος ΚΥΤΤΑΡΙΚΗ ΑΝΑΠΝΟΗ Η τροφή αποτελείται και από ουσίες μεγάλου μοριακού βάρους (πρωτεΐνες, υδατάνθρακες, λιπίδια, νουκλεϊνικά οξέα). Οι ουσίες αυτές διασπώνται (πέψη) σε απλούστερες (αμινοξέα, απλά σάκχαρα,

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΠΑΓΚΥΠΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2008 Μάθημα: ΒΙΟΛΟΓΙΑ Ημερομηνία και ώρα εξέτασης: Πέμπτη, 12 Ιουνίου 2008 7.30 10.30

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση

ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ. 3. Πώς ονομάζεται η βιοχημική αντίδραση της συνένωσης των δύο μορίων; Συμπύκνωση ΑΣΚΗΣΕΙΣ ΣΤΙΣ ΟΡΓΑΝΙΚΕΣ ΟΥΣΙΕΣ ΓΙΑ ΤΗ ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ Α ΖΗΤΗΜΑ: 1. Ποιο μόριο απεικονίζεται στο σχεδιάγραμμα; Γλυκόζη 2. Εάν δύο τέτοια μόρια ενωθούν μαζί τι θα προκύψει; Μαλτόζη 3. Πώς ονομάζεται η

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ(40 μονάδες) ΗΜΕΡΟΜΗΝΙΑ: / / 2009 ΤΑΞΗ: Γ ΓΥΜΝΑΣΙΟΥ ΔΙΑΡΚΕΙΑ: 2 ώρες(βιολογία-χημεία) Όνομα μαθητή /

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ

ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΜΕΡΟΣ Α' ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΠΟΛΙΤΙΣΜΟΥ ΔΙΕΥΘΥΝΣΗ ΑΝΩΤΕΡΗΣ ΚΑΙ ΑΝΩΤΑΤΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΥΠΗΡΕΣΙΑ ΕΞΕΤΑΣΕΩΝ ΕΞΕΤΑΣΕΙΣ ΓΙΑ ΤΑ ΑΝΩΤΕΡΑ ΚΑΙ ΑΝΩΤΑΤΑ ΕΚΠΑΙΔΕΥΤΙΚΑ ΙΔΡΥΜΑΤΑ Μάθημα: ΒΙΟΛΟΓΙΑ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα).

Β. ΚΑΜΙΝΕΛΛΗΣ ΒΙΟΛΟΓΙΑ. Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). ΒΙΟΛΟΓΙΑ Είναι η επιστήμη που μελετά τους ζωντανούς οργανισμούς. (Αποτελούνται από ένα ή περισσότερα κύτταρα). Είδη οργανισμών Υπάρχουν δύο είδη οργανισμών: 1. Οι μονοκύτταροι, που ονομάζονται μικροοργανισμοί

Διαβάστε περισσότερα

Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-3, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ

MAΘΗΜΑ 4 ο AMINOΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ MAΘΗΜΑ 4 ο AMIΞΕΑ-ΠΕΠΤΙ ΙΑ-ΠΡΩΤΕΪΝΕΣ Αλανίνη (Αla) Αλανυλοσερίνη (Αla-Ser) Αλβουµίνη ρα. Κουκουλίτσα Αικατερίνη Χηµικός Εργαστηριακός Συνεργάτης Τ.Ε.Ι Αθήνας ckoukoul@teiath.gr AMIΞΕΑ 2 λειτουργικές οµάδες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3

ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 ΒΙΟΛΟΓΙΑ Β ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΠΕΡΙΛΗΨΗ ΚΕΦΑΛΑΙΟΥ 3 Το θέμα που απασχολεί το κεφάλαιο σε όλη του την έκταση είναι ο μεταβολισμός και χωρίζεται σε τέσσερις υποκατηγορίες: 3.1)Ενέργεια και οργανισμοί,

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΑΓ.ΑΘΑΝΑΣΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2013-2014 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2014

ΓΥΜΝΑΣΙΟ ΑΓ.ΑΘΑΝΑΣΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2013-2014 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2014 ΓΥΜΝΑΣΙΟ ΑΓ.ΑΘΑΝΑΣΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2013-2014 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2014 ΜΑΘΗΜΑ:ΒΙΟΛΟΓΙΑ ΗΜΕΡΟΜΗΝΙΑ:3.6.2014 ΤΑΞΗ: Γ ΧΡΟΝΟΣ:1.30 ΑΡΙΘΜΟΣ ΣΕΛΙΔΩΝ:10 ΟΝΟΜΑΤΕΠΩΝΥΜΟ:. ΤΜΗΜΑ:. ΑΡ:... ΒΑΘΜΟΣ:...

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση:

1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: ΘΕΜΑ 1o 1.1. Να γράψετε στο τετράδιό σας το γράµµα που αντιστοιχεί στη σωστή απάντηση: Η σταθερά Κ w στους 25 ο C έχει τιµή 10-14 : α. µόνο στο καθαρό νερό β. σε οποιοδήποτε υδατικό διάλυµα γ. µόνο σε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o

ÈÅÌÁÔÁ 2011 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ. ΘΕΜΑ 1 o 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία

Θέματα πριν τις εξετάσεις. Καλό διάβασμα Καλή επιτυχία Θέματα πριν τις εξετάσεις Καλό διάβασμα Καλή επιτυχία 2013-2014 Θέματα πολλαπλής επιλογής Μετουσίωση είναι το φαινόμενο α. κατά το οποίο συνδέονται δύο αμινοξέα για τον σχηματισμό μιας πρωτεΐνης β. κατά

Διαβάστε περισσότερα

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση:

ΘΕΜΑ 1 ο 1.1. Να γράψετε στο τετράδιό σας το γράμμα που αντιστοιχεί στη σωστή απάντηση: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αµνιο-PCR Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αγγελική Χατζάκη, PhD Γεωργία Χριστοπούλου, MSc Τµήµα Γενετικής και Μοριακής Βιολογίας Μαιευτήριο «ΜΗΤΕΡΑ»

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ

ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ ΜΕΤΑΒΟΛΙΣΜΟΣ ΑΝΘΡΑΚΙΚΟΥ ΣΚΕΛΕΤΟΥ ΑΜΙΝΟΞΕΩΝ Ανασκόπηση μεταβολισμού πρωτεϊνών & αμινοξέων Ιστοί ΤΡΟΦΗ Αλανίνη & Γλουταμίνη Αμινοξέα Κυκλοφορία Πρωτεΐνες Αμινοξέα Αποκαρβοξυλίωση Βιογενείς αμίνες (νευροδιαβιβαστές,

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ

ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΡΓΑΣΙΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΕΠΙΜΕΛΕΙΑ: Κ. ΔΗΜΗΤΡΙΟΣ ΤΜΗΜΑ:Β 1 ΚΕΦΑΛΑΙΟ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Είναι γνωστό πως οποιοσδήποτε οργανισμός, για να λειτουργήσει χρειάζεται ενέργεια. Η ενέργεια αυτή βρίσκεται

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα