ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο"

Transcript

1 ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφονται τρεις φορές. α. Πόσες αλυσίδες και πόσα νουκλεοτίδια με ραδιενεργό 15 Ν θα υπάρχουν στα μόρια DΝΑ που θα προκύψουν; β. Ένα από τα μόρια που προέκυψαν από τον πρώτο διπλασιασμό μεταφέρεται σε περιβάλλον με ραδιενεργό 35 S, όπου και διπλασιάζεται δύο φορές. Πόσες αλυσίδες και πόσα νουκλεοτίδια με ραδιενεργό 35 S θα υπάρχουν στα μόρια που θα προκύψουν; α. Από κάθε μόριο DΝΑ μετά από κ αντιγραφές προκύπτουν 2 κ+1 πολυπεπτιδικές αλυσίδες. Κατά συνέπεια στην προκειμένη περίπτωση θα προκύψουν 2 2 κ+1 =2 2 4 =32 πολυπεπτιδικές αλυσίδες (η καθεμιά θα αποτελείται από αζωτούχες βάσεις), από τις οποίες όμως οι 32-4=28 πολυπεπτιδικές αλυσίδες θα έχουν ενσωματώσει στα νουκλεοτίδια τους το 15 Ν (οι 4 αρχικές πολυπεπτιδικές αλυσίδες θα έχουν 14 Ν). Ο αριθμός των νουκλεοτιδίων μετά και την τρίτη αντιγραφή θα είναι: = β. Όπως είναι γνωστό το ραδιενεργό 35 S δεν ενσωματώνεται στο DΝΑ. Κατά συνέπεια μετά τη μεταφορά και την αντιγραφή της πολυπεπτιδικής αλυσίδας σε περιβάλλον με ραδιενεργό 35 S καμιά νέα πολυπεπτιδική αλυσίδα και νουκλεοτίδιο δεν θα έχουν ενσωματώσει το ραδιενεργό αυτό στοιχείο. 2. Μία αλυσίδα DΝΑ γονιδίου, που κωδικοποιεί πεπτίδιο περιέχει την ακόλουθη αλληλουχία: 5 GGAGATGGTATGCGGCATTTAAAGAGC 3 α. Να γράψετε τη συμπληρωματική της και να βρεθεί ποια από τις δύο αλυσίδες είναι η μη κωδική. β. Να γράψετε το mrνα και το ανοιχτό πλαίσιο ανάγνωσης. γ. Να γράψετε τα αντικωδικόνια του trna. δ. Να γράψετε το πεπτίδιο και να σημειώσετε το αμινικό και το καρβοξυλικό άκρο του. α. Η συμπληρωματική της αλυσίδα είναι η εξής: 3 CCTCTACCATACGCCGTAAATTTCTCG 5 Η μη κωδική αλυσίδα όπως είναι γνωστό έχει κατεύθυνση 3 5. Κατά συνέπεια αρχίζουμε να διαβάζουμε και τις δύο αλυσίδες με κατεύθυνση 3 5 αναζητώντας κωδικόνιο έναρξης και λήξης. 1 η αλυσίδα (διαβάζουμε από δεξιά προς αριστερά): 3 CGAGAAATT TAC GGC GTA TGG TAG AGG 5 Βρέθηκε μόνο κωδικόνιο έναρξης. 2 η αλυσίδα (διαβάζουμε από αριστερά προς τα δεξιά): 3 CCTC TAC CAT ACG CCG TAA ATT TCTCG 5 Κατά συνέπεια η 2 η αλυσίδα είναι η μη κωδική. β. Το mrνα που προκύπτει είναι το εξής: 5 GGAG AUG GUA UGC GGC AUU UAA AGAGC 3 Το ανοιχτό πλαίσιο ανάγνωσης αρχίζει με το κωδικόνιο έναρξης και σταματά στο κωδικόνιο πριν από το κωδικόνιο λήξης. Οπότε: 5 AUG GUA UGC GGC AUU 3 γ. Τα αντικωδικόνια του trna είναι συμπληρωματικά ως προς τα κωδικόνια του Οπότε: 3 UAC 5, 3 CAU 5, 3 ACG 5, 3 CCG 5, 3 UAA 5 δ. Με βάση το γενετικό κώδικα το πεπτίδιο που προκύπτει είναι το εξής: ΝΗ 2 -met-val-cys-gly-ile-cooh. 3. Μία αλυσίδα DΝΑ γονιδίου, που κωδικοποιεί πεπτίδιο περιέχει την ακόλουθη αλληλουχία: AATTATACAGAAATTTTGAGACTTTTGAGC Κωστανίκος Δημήτρης 1 Βιολόγος

2 α. Να γράψετε τη συμπληρωματική της. β. Ποια από τις δύο αλυσίδες θα είναι η μη κωδική; Να τοποθετήσετε τα 5' και 3' άκρα των αλυσίδων αυτών. γ. Να γράψετε το mrνα που προκύπτει από τη μεταγραφή του τμήματος αυτού. δ. Να γράψετε τα αντικωδικόνια του trna. ε. Να γράψετε το πεπτίδιο που προκύπτει από τη μετάφραση του mrνα αυτού και να σημειώσετε το αμινικό και το καρβοξυλικό άκρο. α. Η συμπληρωματική της αλυσίδα είναι: TTAATATGTCTTTAAAACTCTGAAAACTCG β. Θα αναζητήσουμε τη μη κωδική αλυσίδα. Αρχίζουμε να «διαβάζουμε» την 1 η αλυσίδα από τα αριστερά προς τα δεξιά αναζητώντας κωδικόνιο έναρξης (3 TAC 5 ) και ένα από τα κωδικόνια λήξης (3 ATC 5, 3 ACT 5, 3 ATT 5 ) : AATTA TAC AGA AAT TTT GAG ACT TTTGAGC Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. CGAGTTTTCAGAGTTTTAAAGACATATTAA Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. TTAATATGTCTTTAAAACTCTGAAAACTCG Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα δεξιά προς τα αριστερά. GCTCAAAAGTCTCAAAATTTCTGTATAATT Κατά συνέπεια μη κωδική είναι η 1 η αλυσίδα από τα αριστερά προς τα δεξιά, οπότε τα άκρα του γονιδίου έχουν ως εξής: 3 AATTA TAC AGA AAT TTT GAG ACT TTTGAGC 5 5 TTAAT ATG TCT TTA AAA CTC TGA AAACTCG 3 γ. Το mrνα που προκύπτει είναι το εξής: 5 UUAAU AUG UCU UUA AAA CUC UGA AAACUCG 3 δ. Τα αντικωδικόνια του trna είναι συμπληρωματικά ως προς τα κωδικόνια του Οπότε: 3 UAC 5, 3 AGA 5, 3 AAU 5, 3 UUU 5, 3 GAG 5 ε. Με βάση το γενετικό κώδικα το πεπτίδιο που προκύπτει είναι το εξής: ΝΗ 2 -met-ser-leu-lys-leu-cooh. 4. Δίνεται το παρακάτω τμήμα μορίου DNA βακτηριακού κυττάρου: 5 AATTATGTCCAGCATGTGGTAGTAAGGATGCAGCAATGAAA3 3'TTAATACAGGTCGTACACCATCATTC CTACGTCGTT ACTTT 5 α. Να εντοπιστούν τα γονίδια που περιέχει χωρίς να ληφθούν υπόψη οι 5 και 3 αμετάφραστες περιοχές. β. Να γραφούν τα mrna που θα προκύψουν από το παραπάνω τμήμα DNA (να μην ληφθούν υπόψη οι 5 και 3 αμετάφραστες περιοχές). γ. Πόσα κωδικόνια περιέχει κάθε μόριο mrna και πόσα διαφορετικά μόρια trna απαιτούνται για τη μετάφρασή του; δ. Να γραφούν οι αλληλουχίες των αμινοξέων των πεπτιδίων που συντίθενται από τη μετάφραση κάθε μορίου ε. Πόσοι πεπτιδικοί δεσμοί δημιουργούνται σε κάθε πεπτίδιο; α. Προκειμένου να βρούμε τα γονίδια που περιέχονται στο παραπάνω τμήμα DNA, αναζητούμε τη μη κωδική αλυσίδα κατά τη φορά 3 5. Κωστανίκος Δημήτρης 2 Βιολόγος

3 Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. 3 AAAGTAACGACGTAGGAATGATGGTG TAC GAC CTG TAT TAA 5 Βρέθηκε μόνο κωδικόνιο έναρξης. Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. 3 TTAA TAC AGG TCG TAC ACC ATC ATTCC TAC GTC GTT ACT TT 5 Υπάρχουν 2 κωδικόνια έναρξης και 2 κωδικόνια λήξης. Κατά συνέπεια θα υπάρχουν και 2 γονίδια τα οποία θα είναι τα εξής: Γονίδιο 1: 5 ATG TCC AGC ATG TGG TAG 3 κωδική 3 TAG AGG TCG TAG ACC ATC 5 μη κωδική Γονίδιο 2: 5 ATG CAG CAA TGA 3 κωδική 3 TAC GTC GTT ACT 5 μη κωδική β. mrna (Για γονίδιο 1): 5 AUG UCC AGC AUG UGG UAG 3 mrna (Για γονίδιο 2): 5 AUG CAG CAA UGA 3 γ. Το πρώτο mrna περιέχει έξι κωδικόνια: πέντε κωδικόνια που κωδικοποιούν αμινοξέα και ένα κωδικόνιο λήξης της μετάφρασης για το οποίο δεν υπάρχει trna με αντικωδικόνιο. Το κωδικόνιο AUG υπάρχει και σε άλλη θέση εκτός από την έναρξη. Απαιτούνται λοιπόν τέσσερα διαφορετικά μόρια trna με αντικωδικόνια συμπληρωματικά των αντίστοιχων κωδικονίων (Τα UCC και AGC κωδικοποιούν το ίδιο αμινοξύ (ser), συνδέονται όμως με δ.η με μόρια trna που ενώ μεταφέρουν το ίδιο αμινοξύ (ser) έχουν διαφορετικά αντικωδικόνια). Το δεύτερο mrna περιέχει τέσσερα κωδικόνια: τρία κωδικόνια που κωδικοποιούν αμινοξέα και ένα κωδικόνιο λήξης. Για τη μετάφραση του δεύτερου μορίου mrna απαιτούνται τρία διαφορετικά μόρια trna με αντικωδικόνια συμπληρωματικά των αντίστοιχων κωδικονίων (Τα CAG και CAA κωδικοποιούν το ίδιο αμινοξύ (gln), συνδέονται όμως με δ.η με μόρια trna που ενώ μεταφέρουν το ίδιο αμινοξύ (gln) έχουν διαφορετικά αντικωδικόνια). δ. πεπτίδιο (1) : H 2 N - met - ser - ser - met - trp - COOH πεπτίδιο (2): H 2 N - met - gln - gln - COOH ε. Ο πεπτιδικός δεσμός δημιουργείται μεταξύ της καρβοξυλομάδας (-COOH) του πρώτου αμινοξέος και της αμινομάδας (-NH 2 ) του δευτέρου αμινοξέος. Στη μετάφραση του πρώτου mrna δημιουργούνται τέσσερις πεπτιδικοί δεσμοί και παράγεται ένα πενταπεπτίδιο, ενώ στη μετάφραση του δεύτερου mrna δημιουργούνται δύο πεπτιδικοί δεσμοί και παράγεται ένα τριπεπτίδιο. 5. Δίνεται η αλληλουχία βακτηριακού τμήματος DNA: TTAGAGATGGCGGAGCATCAGCAGTGATAG AATCTCTACCGCCTCGTAGTCGTCACTATC α. Να γράψετε τα mrνα, τα αντικωδικόνια και τα πεπτίδια που προκύπτουν. β. Όταν η αμινομάδα του 4 ου αμινοξέος σχηματίζει πεπτιδικό δεσμό, να βρείτε πόσοι και ποιοι δεσμοί σπάνε. α. Θα αναζητήσουμε τη μη κωδική αλυσίδα. Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα αριστερά προς τα δεξιά. TTAGAGATGGCGGAGCATCAGCAGTGATAG Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. GATAGTGACGAC TAC GAG GCG GTA GAG ATT Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. AATCTC TAC CGC CTC GTA GTC GTC ACT ATC Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα δεξιά προς τα αριστερά. CTATCACTGCTGATGCTCCGCCATCTCTAA Κωστανίκος Δημήτρης 3 Βιολόγος

4 Διακρίνουμε δύο περιπτώσεις: 1 η περίπτωση: Η μη κωδική αλυσίδα είναι η 1 η με το 5 άκρο αριστερά και το 3 δεξιά. Βακτηριακό DNA: 5 TTA GAG ATG GCG GAG CAT CAGCAGTGATAG 3 3 AAT CTC TAC CGC CTC GTA GTCGTCACTATC 5 Μη κωδική αλυσίδα: 3 GATAGTGACGAC TAC GAG GCG GTA GAG ATT 5 mrna: 5 CUAUCACUGCUG AUG CUC CGC CAU CUC UAA 3 Αντικωδικόνια: 3 UAC 5, 3 GAG 5, 3 GCG 5, 3 GUA 5, 3 GAG 5 Πεπτίδιο: ΝΗ 2 -met-leu-arg-his-leu-cooh (5 αμινοξέα). 2 η περίπτωση: Η μη κωδική αλυσίδα είναι η 2 η με το 5 άκρο δεξιά και το 3 αριστερά. Βακτηριακό DNA: 5 TTAGAG ATG GCG GAG CAT CAG CAG TGA TAG 3 3 AATCTC TAC CGC CTC GTA GTC GTC ACT ATC 5 Μη κωδική αλυσίδα: 3 AATCTC TAC CGC CTC GTA GTC GTC ACT ATC 5 mrna: 5 UUAGAG AUG GCG GAG CAU CAG CAG UGA UAG 3 Αντικωδικόνια: 3 UAC 5, 3 CGC 5, 3 CUC 5, 3 GUA 5, 3 GUC 5, 3 GUC 5 Πεπτίδιο: ΝΗ 2 -met-ala-glu-his-gln-gln-cooh (6 αμινοξέα). β. Όταν η αμινομάδα του 4 ου αμινοξέος σχηματίζει πεπτιδικό δεσμό τότε απομακρύνεται το trna του 3 ου αμινοξέος. Τα δύο διαφορετικά πεπτίδια που σχηματίζονται έχουν ως 3 ο αμινοξύ το ένα την arg και το άλλο το glu. Κατά συνέπεια και πάλι διακρίνουμε δύο περιπτώσεις: 1 η περίπτωση: Στην περίπτωση που το 3 ο αμινοξύ είναι η arg τότε κατά την απομάκρυνση του trna σπάει ο δεσμός μεταξύ του trna και της arg καθώς και οι δεσμοί που σχηματίζονται μεταξύ του κωδικονίου του mrna και του αντικωδικονίου του trna, δηλαδή οι εννιά (9) δεσμοί υδρογόνου μεταξύ του κωδικονίου CGC και του αντικωδικονίου GCG. 2 η περίπτωση Στην περίπτωση που το 3 ο αμινοξύ είναι το glu τότε κατά την απομάκρυνση του trna σπάει ο δεσμός μεταξύ του trna και του glu καθώς και οι δεσμοί που σχηματίζονται μεταξύ του κωδικονίου του mrna και του αντικωδικονίου του trna, δηλαδή οι οχτώ (8) δεσμοί υδρογόνου μεταξύ του κωδικονίου GAG και του αντικωδικονίου CUC. 6. Ένα γονίδιο ευκαρυωτικού κυττάρου αποτελείται από 2000 ζεύγη βάσεων. Το μήκος του ώριμου mrνα, που προκύπτει από τη μεταγραφή του γονιδίου, είναι 480 νουκλεοτίδια και το πολυπεπτίδιο που κωδικοποιεί αποτελείται από 146 αμινοξέα. Να υπολογίσετε: α. Το ποσοστό των αζωτούχων βάσεων του γονιδίου που αποτελούν εσώνια. β. Το ποσοστό των βάσεων του γονιδίου που δεν μεταφράζονται σε αμινοξέα. α. Όπως είναι γνωστό για το πρόδρομο mrna ισχύει: Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=4.000/2=2.000 βάσεις. Το ώριμο mrna (480 νουκλεοτίδια) αποτελείται από εξώνια κατά συνέπεια η διαφορά μεταξύ πρόδρομου και ώριμου mrna αντιπροσωπεύει τις βάσεις των εσωνίων. Οπότε τα εσώνια θα αποτελούνται από =1520 βάσεις στο πρόδρομο mrna οι οποίες θα αντιστοιχούν σε 1520 ζεύγη βάσεων στο γονίδιο και το ποσοστό τους θα είναι (1520/2000) 100%= 76%. Κωστανίκος Δημήτρης 4 Βιολόγος

5 β. Η πολυπεπτιδική αλυσίδα που σχηματίζεται αποτελείται από 146 αμινοξέα τα οποία αντιστοιχούν σε 146 3=438 βάσεις στο ώριμο Η διαφορά =42 δείχνει τις βάσεις στις 5 και 3 αμετάφραστες περιοχές του ώριμου mrna οι οποίες δεν εκφράζονται σε αμινοξέα. Άρα οι συνολικές βάσεις του πρόδρομου mrna που δε μεταφράζονται σε αμινοξέα είναι =1562 βάσεις που αντιστοιχούν σε 1562 ζεύγη βάσεων στο γονίδιο και το ποσοστό τους θα είναι (1562/2000) 100%= 78%. 7. Ένα γονίδιο περιέχει 8300 αζωτούχες βάσεις, το 32% των οποίων αντιστοιχεί σε εσώνια. Ποσοστό ίσο με το 14% των βάσεων του πρόδρομου mrνα που προκύπτει από το γονίδιο αντιστοιχεί σε 5 και 3 αμετάφραστες περιοχές. Να βρείτε τον αριθμό των αμινοξέων της πρωτεΐνης που κωδικοποιείται από το γονίδιο. Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=8300/2=4.150 βάσεις. Τα εσώνια θα αντιστοιχούν σε %= 1328 βάσεις και η 5 και 3 αμετάφραστη περιοχή σε %=581 βάσεις. Το ώριμο mrna θα αποτελείται από =2241 βάσεις από τις οποίες προκύπτουν 2241/3=747 αμινοξέα. 8. Γονίδιο αποτελείται από 4800 ζεύγη βάσεων και περιέχει 32 εσώνια. Το mrνα που μεταφέρεται στο κυτταρόπλασμα περιέχει το 20% των βάσεων του mrνα που προκύπτει από τη μεταγραφή του γονιδίου και κωδικοποιεί πρωτεΐνη που αποτελείται από 301 αμινοξέα. Να υπολογίσετε: α. Τον αριθμό των βάσεων που αποτελούν τα εσώνια στο γονίδιο. β. Τον αριθμό των εξωνίων στο γονίδιο. γ. Πόσοι φωσφοδιεστερικοί δεσμοί σπάνε και πόσοι δημιουργούνται κατά τη διαδικασία της ωρίμανσης. δ. Τον αριθμό των βάσεων στις 5 και 3 αμετάφραστες περιοχές του mrνα, δεδομένου ότι μετά τη σύνθεση της πρωτεΐνης αφαιρούνται 4 αμινοξέα. α. Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=9.600/2= Βάσεις ώριμου mrna= %=960 Το ώριμο mrna αποτελείται από εξώνια κατά συνέπεια η διαφορά μεταξύ πρόδρομου και ώριμου mrna αντιπροσωπεύει τις βάσεις των εσωνίων, δηλαδή = βάσεις οι οποίες θα αντιστοιχούν σε ζεύγη βάσεων στο γονίδιο δηλαδή = β. Τα εσώνια είναι ενδιάμεσες αλληλουχίες των γονιδίων και ως εκ τούτου ενδιάμεσες αλληλουχίες στο πρόδρομο mrνα. Αν ένα γονίδιο έχει x εσώνια, τότε έχει x + 1 εξώνια. Στη συγκεκριμένη περίπτωση το γονίδιο έχει 33 εξώνια. γ. Για την απομάκρυνση των x εσωνίων σπάνε 2x φωσφοδιεστερικοί δεσμοί, ενώ για τη συρραφή x εξωνίων δημιουργούνται x-1 φωσφοδιεστερικοί δεσμοί. Κατά συνέπεια για την απομάκρυνση 32 εσωνίων σπάνε 32 2=64 φωσφοδιεστερικοί δεσμοί, ενώ για τη συρραφή 33 εξωνίων απαιτούνται 32 φωσφοδιεστερικοί δεσμοί. δ. Πριν τη μετα-μεταφραστική τροποποίηση της η πρωτεΐνη αποτελούνταν από 301+4=305 αμινοξέα τα οποία αντιστοιχούν σε 305 3=915 βάσεις στο ώριμο Άρα οι βάσεις της 5 και 3 αμετάφραστης περιοχής θα είναι =45 βάσεις. 9. Μια λειτουργική πρωτεΐνη αποτελείται από 157 αμινοξέα ενώ η αρχική πολυπεπτιδική αλυσίδα πριν την μετα-μεταφραστική της τροποποίηση είχε επιπλέον 12 αμινοξέα στο αμινικό της άκρο. Με δεδομένο ότι το ώριμο mrna περιέχει 25 επιπλέον βάσεις από το ελάχιστο αριθμό που απαιτείται για την κωδικοποίηση της συγκεκριμένης πρωτεΐνης και ότι το γονίδιο είναι ασυνεχές και περιέχει 4 εσώνια με 50 ζεύγη βάσεων το καθένα, να βρεθεί το μήκος του γονιδίου που κωδικοποιεί τη συγκεκριμένη πρωτεΐνη. Η αρχική πρωτεΐνη είχε =169 αμινοξέα τα οποία κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=170 κωδικονίων, δηλαδή από 170 3=510 βάσεις. Ο αριθμός των βάσεων στο ώριμο mrna θα είναι: =535 βάσεις. Τα εσώνια στο γονίδιο θα είναι συνολικά 200 ζεύγη βάσεων δηλαδή 400 βάσεις, ενώ στο πρόδρομο mrna θα είναι 200 βάσεις. Κωστανίκος Δημήτρης 5 Βιολόγος

6 Άρα ο αριθμός των βάσεων στο πρόδρομο mrna θα είναι: =735 βάσεις. Οι βάσεις αυτές αντιστοιχούν σε 735 βάσεις της μη κωδικής αλυσίδας του γονιδίου και σε 735 ζεύγη βάσεων ή 1470 βάσεις στο γονίδιο. 10. Ένα πολυριβονουκλεοτίδιο παράγεται στο εργαστήριο από μείγμα που περιέχει G και C σε μοριακή αναλογία 4:1 αντίστοιχα. Δεδομένου ότι τα ριβονουκλεοτίδια συνδυάζονται τυχαία προς το σχηματισμό νουκλεϊκού οξέος, να βρείτε τα κωδικόνια που θα παρατηρηθούν σε αυτό το νουκλεϊκό οξύ και την αναμενόμενη συχνότητα του καθενός. Οι δύο αυτές βάσεις θα πρέπει να συνδυαστούν για να σχηματίσουν τριπλέτες (κωδικόνια) βάσεων. Ο πιθανός αριθμός των κωδικονίων είναι 2 3 =8 κωδικόνια. Εφόσον στο μείγμα η αναλογία G:C είναι 4:1 αυτό συνεπάγεται ότι η πιθανότητα εμφάνισης της G είναι 4/5, ενώ η πιθανότητα εμφάνισης της C είναι 1/5. Τα κωδικόνια που θα μπορούσαν να προκύψουν και η πιθανότητα εμφάνισής τους φαίνονται στο παρακάτω πίνακα. Κωδικόνια Αναμενόμενη συχνότητα GGG 4/5 4/5 4/5=64/125 GCG 4/5 1/5 4/5=16/125 GGC 4/5 4/5 1/5=16/125 GCC 4/5 1/5 1/5=4/125 CCC 1/5 1/5 1/5=1/125 CGC 1/5 4/5 1/5=4/125 CCG 1/5 1/5 4/5=4/125 CGG 1/5 4/5 4/5=16/ Από τη μετάφραση ενός μορίου mrna προκύπτουν 4 διαφορετικά πολυπεπτίδια: Το Α με 73 αμινοξέα, το Β με 65 αμινοξέα, το Γ με 125 αμινοξέα και το Δ με 101 αμινοξέα. Ποιο είναι το ελάχιστο μήκος αυτού του μορίου του mrna; Επειδή από ένα μόριο mrna προκύπτουν 4 διαφορετικά πολυπεπτίδια αυτό σημαίνει ότι το mrna αυτό προέρχεται από τη μεταγραφή τεσσάρων δομικών γονιδίων ενός οπερονίου που χαρακτηρίζει το γονιδίωμα ενός προκαρυωτικού οργανισμού. Κατά συνέπεια θα υπάρχουν και 4 κωδικόνια έναρξης και 4 κωδικόνια λήξης. Το ελάχιστο μήκος του συγκεκριμένου μορίου mrna υπολογίζεται ως εξής: Πολυπεπτίδιο Α: Τα 73 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των 73+1 (κωδικόνιο λήξης)=74 κωδικονίων τα οποία αντιστοιχούν σε 74 3=222 βάσεις στο μόριο του Πολυπεπτίδιο Β: Τα 65 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των 65+1 (κωδικόνιο λήξης)=66 κωδικονίων τα οποία αντιστοιχούν σε 66 3=198 βάσεις στο μόριο του Πολυπεπτίδιο Γ: Τα 125 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=126 κωδικονίων τα οποία αντιστοιχούν σε 126 3=378 βάσεις στο μόριο του Πολυπεπτίδιο Δ: Τα 101 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=102 κωδικονίων τα οποία αντιστοιχούν σε 102 3=306 βάσεις στο μόριο του Ο ελάχιστος αριθμός βάσεων που θα πρέπει να υπάρχουν σε αυτό το μόριο mrna για να προκύψουν τα 4 αυτά πολυνουκλεοτίδια είναι: =1.104 βάσεις Κωστανίκος Δημήτρης 6 Βιολόγος

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ

Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ Ι. ΘΕΩΡΙΑ ΠΙΝΑΚΑΣ 2.1: ΣΥΓΚΡΙΤΙΚΟΣ ΠΙΝΑΚΑΣ ΑΝΤΙΓΡΑΦΗΣ-ΜΕΤΑΓΡΑΦΗΣ ΣΤΟΝ ΠΥΡΗΝΑ ΤΩΝ ΕΥΚΑΡΥΩΤΙΚΩΝ ΚΥΤΤΑΡΩΝ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ Γίνεται σύνθεση DNA. Γίνεται σύνθεση RNA. Εξασφαλίζεται η διαιώνιση της γενετικής

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. Γουανίνη Κυτοσίνη. 4α. Λειτουργία γενετικού υλικού. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ. Γουανίνη Κυτοσίνη. 4α. Λειτουργία γενετικού υλικού. Φωσφοδιεστερικός δεσμός εύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 4α. Λειτουργία γενετικού υλικού 1 ΛΕΙΤΟΥΡΓΙΑ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ Αντιγραφή (διπλασιασμός) DNA: DNA DNA Έκφραση γενετικής πληροφορίας:

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι :

Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι : ΑΠΑΝΤΗΣΕΙΣ ΑΣΚΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ 2 ΟΥ ΚΕΦΑΛΑΙΟΥ ΑΠΟ ΤΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΞΕΤΑΣΕΙΣ 2000 Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων : 5 -TCA-CGG-AAT-TTC-TAG-CAT-3. Α)

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

Υποδειγματική Απάντηση

Υποδειγματική Απάντηση Θέμα 3ο ( Μονάδες 40) Δίνεται η παρακάτω ακολουθία των βάσεων σε ένα τμήμα μίας πολυνουκλεοτιδικής αλυσίδας βακτηριακού DNA. 3 ΑΤG TAC CGC AGC GAG TCG CAC TAA ATT CTT TAT 5 α. Να μεταφέρετε την αλυσίδα

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

4 ο ΚΕΦΑΛΑΙΟ. Γ ε ν ε τ ι κ ή

4 ο ΚΕΦΑΛΑΙΟ. Γ ε ν ε τ ι κ ή 4 ο ΚΕΦΑΛΑΙΟ Γ ε ν ε τ ι κ ή 1. Κύκλος της ζωής του κυττάρου 3ο Γελ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης 2 2. Μοριακή Γενετική i). Ροή της γενετικής πληροφορίας DNA RNA πρωτεΐνες νουκλεΐκά οξέα ή πρωτεΐνες

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΣΚΗΣΕΙΣ ΣΤΟ ΔΕΥΤΕΡΟ ΚΕΦΑΛΑΙΟ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1) Τμήμα μορίου βακτηριακού DNA έχει την ακόλουθη αλληλουχία βάσεων: 3 TACTGGAATGGTCGCCCCTGCATT 5 a. Ποια είναι η αλληλουχία του συμπληρωματικού κλώνου και ποιος είναι ο προσανατολισμός της. b. Ποιο είναι

Διαβάστε περισσότερα

4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G

4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 ο - ΑΣΚΗΣΕΙΣ ΑΝΤΙΓΡΑΦΗ Γράφουμε τον ημισυντηρητικό τρόπο αντιγραφής του DNA. Αν χρειαστεί και τον κανόνα συμπληρωματικότητας

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ)

ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ) ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (Β ΛΥΚΕΙΟΥ) ΘΕΜΑ Α Να γράψετε στο τετράδιο σας τον αριθμό κάθε μιας από τις παρακάτω ημιτελείς προτάσεις 1-5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΑ 1 & 2 ΑΠΑΝΤΗΣΕΙΣ Θέμα Α: Α1.β, Α2.δ, Α3.γ, Α4.γ, Α5.γ Θέμα Β: Β1. Ο 1 ος ιός παρατηρούμε ότι περιέχει Τ, άρα το γενετικό του υλικό είναι DNA, στο οποίο παρατηρούμε ότι δεν

Διαβάστε περισσότερα

Το πλεονέκτημα της χρήσης του DNA των φάγων λ, ως φορέα κλωνοποίησης είναι ότι μπορούμε να ενσωματώσουμε σε αυτόν μεγαλύτερα κομμάτια DNA.

Το πλεονέκτημα της χρήσης του DNA των φάγων λ, ως φορέα κλωνοποίησης είναι ότι μπορούμε να ενσωματώσουμε σε αυτόν μεγαλύτερα κομμάτια DNA. ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ 2 ο,4 ο ΚΕΦ. ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α: Α1.β, Α2.δ, Α3.β, Α4.γ, Α5.γ Θέμα Β: Β1. Οι υποκινητές και οι μεταγραφικοί παράγοντες αποτελούν τα ρυθμιστικά στοιχεία της μεταγραφής

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4 ΜΕΤΑΛΛΑΞΕΙΣ, Σύνδρομο Down

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ημερομηνία: Κυριακή 29 Οκτωβρίου 2017 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες

ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ. Πώς από το DNA φτάνουμε στις πρωτεΐνες ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ Πώς από το DNA φτάνουμε στις πρωτεΐνες Αντιγραφή του DNA o Ο μηχανισμός αντιγραφής του DNA ονομάζεται ημισυντηρητικός διότι κατά την αντιγραφή του

Διαβάστε περισσότερα

ΧΡΗΣΤΟΣ ΚΑΚΑΒΑΣ 1 ΚΑΘΗΓΗΤΗΣ ΒΙΟΛΟΓΟΣ Μ.Δ.Ε

ΧΡΗΣΤΟΣ ΚΑΚΑΒΑΣ 1 ΚΑΘΗΓΗΤΗΣ ΒΙΟΛΟΓΟΣ Μ.Δ.Ε ΚΕΦΑΛΑΙΟ 2 ον. ΑΝΤΙΓΡΑΦΗ ΚΑΙ ΕΚΦΡΑΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ ΤΙ ΠΡΕΠΕΙ ΝΑ ΞΕΡΩ. 1. Τη δομή της δίκλωνης έλικας πάρα πολύ καλά. 2. Τους δεσμούς υδρογόνου μεταξύ των συμπληρωματικών βάσεων και την επίπτωσή

Διαβάστε περισσότερα

ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ /12/2017

ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ /12/2017 ΘΕΜΑΤΑ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΗ ΥΛΗ: ΚΕΦ 1-2-4 03/12/2017 ΘΕΜΑ A Α. Να επιλέξετε την ορθή πρόταση στα παρακάτω: Α1. Βασική μονάδα οργάνωσης της χρωματίνης αποτελεί το α. νουκλεοτίδιο

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου Διαγώνισμα στο Κεφάλαιο 4 ο

Βιολογία Κατεύθυνσης Γ Λυκείου Διαγώνισμα στο Κεφάλαιο 4 ο Βιολογία Κατεύθυνσης Γ Λυκείου Διαγώνισμα στο Κεφάλαιο 4 ο ΘΕΜΑ Α Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

Απαντήσεις διαγωνίσματος Κεφ. 6 ο : Μεταλλάξεις

Απαντήσεις διαγωνίσματος Κεφ. 6 ο : Μεταλλάξεις Απαντήσεις διαγωνίσματος Κεφ. 6 ο : Μεταλλάξεις ΘΕΜΑ Α Α1. γ Α2. β Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Τα ερυθρά αιμοσφαίρια του ανθρώπου περιέχουν κυρίως μια πρωτεΐνη, την αιμοσφαιρίνη. Κάθε μόριο αιμοσφαιρίνης

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΒΙΟΛΟΓΙΑΣ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 04/11/2018 Νότα Λαζαράκη Αλέξανδρος Παπαγιαννακόπουλος ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

Διαβάστε περισσότερα

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ

ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ 1 ΕΝΟΤΗΤΑ 14: Ο ΦΟΡΕΑΣ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ (DNA) 14.1 ΕΙΣΑΓΩΓΗ Οι δύο πολυνουκλεοτιδικές αλυσίδες του DNA αποτελούνται από νουκλεοτίδια τα οποία ενώνονται με φωσφοδιεστερικούς δεσμούς. Πιο συγκεκριμένα

Διαβάστε περισσότερα

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας Κεφάλαιο 2ο Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας 1. Το DNA αυτοδιπλασιάζεται 3ο ε.λ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης 3 Ο μηχανισμός της αντιγραφής του DNA Ο μηχανισμός αυτοδιπλασιασμού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 19/06/2018 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 19/06/2018 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 19/06/2018 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4. α Α5. β ΘΕΜΑ Β Β1 1-γ 2-β 3-γ 4-α 5-γ 6-γ 7-β Β2 Μικροοργανισμός Β σχολικό βιβλίο σελ. 112 "Το PH επηρεάζει...σε

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 22/10/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΛΑΖΑΡΑΚΗ ΝΟΤΑ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η εκατοστιαία

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. Σελ. 13: Το 1928 ο Griffith χρησιμοποίησε δύο στελέχη του βακτηρίου πνευμονιόκοκκος δεν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ)

ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ. ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1 ΒΙΟΛΟΓΙΑ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ - Γ Λ ΚΑΤΕΥΘΥΝΣΗ (ανάκληση γνώσεων από Β Λ) 1. Κατά τον σχηματισμό ενός μορίου RNA αποβάλλονται 2008 μόρια νερού. Να βρεθεί το μήκος του. [2009b (βάσεις)]

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 19 Ιουνίου 2018 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α.1 δ Α.2 β Α.3 α Α.4 γ Α.5 α ΘΕΜΑ B B.1 1. γ 2. β 3. γ 4. α 5.

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: ΘΕΜΑ Α A1. α Α2. β Α3. α Α4. β Α5. α ΘΕΜΑ Β Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ Β1. Καρυότυπος είναι η απεικόνιση

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6)

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ' ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6) ΡΧΗ lησ ΣΕΛΙΔΣ - Δ' ΠΝΕΛΛΔΙΚΕΣ ΕΞΕΤΣΕΙΣ Δ' ΤΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 19 ΙΟΥΝΙΟΥ 2018 ΕΞΕΤΖΟΜΕΝΟ ΜΘΗΜ: ΒΙΟΛΟΓΙ ΠΡΟΣΝΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6) ΘΕΜ Να γράψετε στο τετράδιό σας τον αριθμό

Διαβάστε περισσότερα

Προγνωστικές μέθοδοι με βάση αλληλουχίες DNA

Προγνωστικές μέθοδοι με βάση αλληλουχίες DNA Προγνωστικές μέθοδοι με βάση αλληλουχίες DNA Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus ΣΥΝΟΨΗ Εισαγωγή Αλυσίδες Markov και αλληλουχίες

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α: Α1.γ, Α2.δ, Α3.β, Α4.δ, Α5.α. Θέμα Β: Β1. Στα βακτήρια δεν συμβαίνει η διαδικασία της ωρίμανσης διότι δεν έχουν τις κατάλληλες πρωτεΐνες

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. γ 5. β ΘΕΜΑ Α ΘΕΜΑ B B1. Περιγραφή του πολυσώματος όπως αυτό περιγράφεται στις σελίδες 41-42. B2. Σελίδες 37-38 Στους προκαρυωτικούς οργανισμούς... σχηματίζεται

Διαβάστε περισσότερα

Σελίδες 372 Αντιγραφή Μεταγραφή Ρύθμιση της Γενετική πληροφορίας

Σελίδες 372 Αντιγραφή Μεταγραφή Ρύθμιση της Γενετική πληροφορίας Σελίδες 372 Αντιγραφή Μεταγραφή Ρύθμιση της Γενετική πληροφορίας Ερωτήσεις «Θεωρίας και Επισημάνσεις» Ερωτήσεις «πολλαπλής επιλογής» Ερωτήσεις τύπου «Σωστό Λάθος» Ερωτήσεις «Κρίσεως-Συνδυαστικές» Αναλυτική

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

Supplemental file 3. All 306 mapped IDs collected by IPA program. Supplemental file 6. The functions and main focused genes in each network.

Supplemental file 3. All 306 mapped IDs collected by IPA program. Supplemental file 6. The functions and main focused genes in each network. LIST OF SUPPLEMENTAL FILES Supplemental file 1. Primer sets used for qrt-pcr. Supplemental file 2. All 1305 differentially expressed genes. Supplemental file 3. All 306 mapped IDs collected by IPA program.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ

ΟΜΟΣΠΟΝΔΙΑ ΕΚΠΑΙΔΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑΔΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2018 A ΦΑΣΗ ΒΙΟΛΟΓΙΑ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ημερομηνία: Σάββατο 13 Ιανουαρίου 2018 Διάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 δ, Α4 δ, Α5 α ΘΕΜΑ Β B1. α. Γονίδια,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 19 Ιουνίου 2018 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 δ Α.2 β Α.3 α Α.4 α Α.5 β ΘΕΜΑ B B.1 1. γ 2. β 3. γ 4. α 5.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5

5 GTG CAC CTG ACT CCT GAG GAG 3 3 CAC GTG GAC TGA GGA CTC CTC 5 Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις διαγωνίσματος στο Κεφάλαιο 4 ο ΘΕΜΑ Α Α1. β Α2. β Α3. γ Α4. β Α5. β ΘΕΜΑ B B1. Ο κλώνος είναι μια ομάδα πανομοιότυπων μορίων, κυττάρων, ή οργανισμών. B2. Η υβριδοποίηση

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ÌÅÈÏÄÉÊÏ ÊÏÌÏÔÇÍÇ Ε_3.Βλ3Θ(ε) ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις

Ενδεικτικές απαντήσεις ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΠΟΥ ΥΠΗΡΕΤΟΥΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΠΑΡΑΣΚΕΥΗ 8 ΣΕΠΤΕΜΒΡΙΟΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Ενδεικτικές απαντήσεις

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ Θέμα

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΚΕΦΑΛΑΙΑ 1 & 2 Θέμα Α: Να γράψετε στο τετράδιό σας τον αριθμό της καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5

5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ. Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Το

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2018 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2018 ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 208 ΘΕΜΑ Α Α. δ Α2. β Α3. α Α. α Α5. β ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Β Β. -γ, 2-β, 3-γ, -α, 5-γ, 6-γ, 7-β ΑΠΑΝΤΗΣΕΙΣ Β2. Στο γένος Lactobacillus μπορεί

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2016 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Πέµπτη 7 Ιανουαρίου 2016 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 γ, Α2 β, Α3 γ, Α4 δ, Α5 - β ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. α. Το

Διαβάστε περισσότερα

Βιολογία Προσανατολισμού

Βιολογία Προσανατολισμού Γ ΓΕΛ 12 / 04 / 2018 Βιολογία Προσανατολισμού ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: Α1. Ένας ανιχνευτής υβριδοποιεί την κωδική αλυσίδα του ανθρώπινου

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

Α1. α. Α2. δ. Α3. γ. Α4. β. Α5. β.

Α1. α. Α2. δ. Α3. γ. Α4. β. Α5. β. ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α. Α2. δ. Α3. γ. Α4. β. Α5. β. ΘΕΜΑ Β Β1. Σελ. 13 σχ. βιβλίου: «Το 1928, ο Griffith

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

Bιολογία προσανατολισμού

Bιολογία προσανατολισμού Bιολογία προσανατολισμού Α. 1. γ 2. β 3. γ 4. β 5. γ ΘΕΜΑ Α ΘΕΜΑ Β Β1. α: Σ, β: Λ, γ: Σ, δ: Λ, ε: Σ, ζ: Σ, η: Λ Β2. α. Τα γονίδια, ανάλογα με το προϊόν της μεταγραφής τους, διακρίνονται σε 2 μεγάλες κατηγορίες,

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα