Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφονται τρεις φορές. α. Πόσες αλυσίδες και πόσα νουκλεοτίδια με ραδιενεργό 15 Ν θα υπάρχουν στα μόρια DΝΑ που θα προκύψουν; β. Ένα από τα μόρια που προέκυψαν από τον πρώτο διπλασιασμό μεταφέρεται σε περιβάλλον με ραδιενεργό 35 S, όπου και διπλασιάζεται δύο φορές. Πόσες αλυσίδες και πόσα νουκλεοτίδια με ραδιενεργό 35 S θα υπάρχουν στα μόρια που θα προκύψουν; α. Από κάθε μόριο DΝΑ μετά από κ αντιγραφές προκύπτουν 2 κ+1 πολυπεπτιδικές αλυσίδες. Κατά συνέπεια στην προκειμένη περίπτωση θα προκύψουν 2 2 κ+1 =2 2 4 =32 πολυπεπτιδικές αλυσίδες (η καθεμιά θα αποτελείται από αζωτούχες βάσεις), από τις οποίες όμως οι 32-4=28 πολυπεπτιδικές αλυσίδες θα έχουν ενσωματώσει στα νουκλεοτίδια τους το 15 Ν (οι 4 αρχικές πολυπεπτιδικές αλυσίδες θα έχουν 14 Ν). Ο αριθμός των νουκλεοτιδίων μετά και την τρίτη αντιγραφή θα είναι: = β. Όπως είναι γνωστό το ραδιενεργό 35 S δεν ενσωματώνεται στο DΝΑ. Κατά συνέπεια μετά τη μεταφορά και την αντιγραφή της πολυπεπτιδικής αλυσίδας σε περιβάλλον με ραδιενεργό 35 S καμιά νέα πολυπεπτιδική αλυσίδα και νουκλεοτίδιο δεν θα έχουν ενσωματώσει το ραδιενεργό αυτό στοιχείο. 2. Μία αλυσίδα DΝΑ γονιδίου, που κωδικοποιεί πεπτίδιο περιέχει την ακόλουθη αλληλουχία: 5 GGAGATGGTATGCGGCATTTAAAGAGC 3 α. Να γράψετε τη συμπληρωματική της και να βρεθεί ποια από τις δύο αλυσίδες είναι η μη κωδική. β. Να γράψετε το mrνα και το ανοιχτό πλαίσιο ανάγνωσης. γ. Να γράψετε τα αντικωδικόνια του trna. δ. Να γράψετε το πεπτίδιο και να σημειώσετε το αμινικό και το καρβοξυλικό άκρο του. α. Η συμπληρωματική της αλυσίδα είναι η εξής: 3 CCTCTACCATACGCCGTAAATTTCTCG 5 Η μη κωδική αλυσίδα όπως είναι γνωστό έχει κατεύθυνση 3 5. Κατά συνέπεια αρχίζουμε να διαβάζουμε και τις δύο αλυσίδες με κατεύθυνση 3 5 αναζητώντας κωδικόνιο έναρξης και λήξης. 1 η αλυσίδα (διαβάζουμε από δεξιά προς αριστερά): 3 CGAGAAATT TAC GGC GTA TGG TAG AGG 5 Βρέθηκε μόνο κωδικόνιο έναρξης. 2 η αλυσίδα (διαβάζουμε από αριστερά προς τα δεξιά): 3 CCTC TAC CAT ACG CCG TAA ATT TCTCG 5 Κατά συνέπεια η 2 η αλυσίδα είναι η μη κωδική. β. Το mrνα που προκύπτει είναι το εξής: 5 GGAG AUG GUA UGC GGC AUU UAA AGAGC 3 Το ανοιχτό πλαίσιο ανάγνωσης αρχίζει με το κωδικόνιο έναρξης και σταματά στο κωδικόνιο πριν από το κωδικόνιο λήξης. Οπότε: 5 AUG GUA UGC GGC AUU 3 γ. Τα αντικωδικόνια του trna είναι συμπληρωματικά ως προς τα κωδικόνια του Οπότε: 3 UAC 5, 3 CAU 5, 3 ACG 5, 3 CCG 5, 3 UAA 5 δ. Με βάση το γενετικό κώδικα το πεπτίδιο που προκύπτει είναι το εξής: ΝΗ 2 -met-val-cys-gly-ile-cooh. 3. Μία αλυσίδα DΝΑ γονιδίου, που κωδικοποιεί πεπτίδιο περιέχει την ακόλουθη αλληλουχία: AATTATACAGAAATTTTGAGACTTTTGAGC Κωστανίκος Δημήτρης 1 Βιολόγος

2 α. Να γράψετε τη συμπληρωματική της. β. Ποια από τις δύο αλυσίδες θα είναι η μη κωδική; Να τοποθετήσετε τα 5' και 3' άκρα των αλυσίδων αυτών. γ. Να γράψετε το mrνα που προκύπτει από τη μεταγραφή του τμήματος αυτού. δ. Να γράψετε τα αντικωδικόνια του trna. ε. Να γράψετε το πεπτίδιο που προκύπτει από τη μετάφραση του mrνα αυτού και να σημειώσετε το αμινικό και το καρβοξυλικό άκρο. α. Η συμπληρωματική της αλυσίδα είναι: TTAATATGTCTTTAAAACTCTGAAAACTCG β. Θα αναζητήσουμε τη μη κωδική αλυσίδα. Αρχίζουμε να «διαβάζουμε» την 1 η αλυσίδα από τα αριστερά προς τα δεξιά αναζητώντας κωδικόνιο έναρξης (3 TAC 5 ) και ένα από τα κωδικόνια λήξης (3 ATC 5, 3 ACT 5, 3 ATT 5 ) : AATTA TAC AGA AAT TTT GAG ACT TTTGAGC Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. CGAGTTTTCAGAGTTTTAAAGACATATTAA Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. TTAATATGTCTTTAAAACTCTGAAAACTCG Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα δεξιά προς τα αριστερά. GCTCAAAAGTCTCAAAATTTCTGTATAATT Κατά συνέπεια μη κωδική είναι η 1 η αλυσίδα από τα αριστερά προς τα δεξιά, οπότε τα άκρα του γονιδίου έχουν ως εξής: 3 AATTA TAC AGA AAT TTT GAG ACT TTTGAGC 5 5 TTAAT ATG TCT TTA AAA CTC TGA AAACTCG 3 γ. Το mrνα που προκύπτει είναι το εξής: 5 UUAAU AUG UCU UUA AAA CUC UGA AAACUCG 3 δ. Τα αντικωδικόνια του trna είναι συμπληρωματικά ως προς τα κωδικόνια του Οπότε: 3 UAC 5, 3 AGA 5, 3 AAU 5, 3 UUU 5, 3 GAG 5 ε. Με βάση το γενετικό κώδικα το πεπτίδιο που προκύπτει είναι το εξής: ΝΗ 2 -met-ser-leu-lys-leu-cooh. 4. Δίνεται το παρακάτω τμήμα μορίου DNA βακτηριακού κυττάρου: 5 AATTATGTCCAGCATGTGGTAGTAAGGATGCAGCAATGAAA3 3'TTAATACAGGTCGTACACCATCATTC CTACGTCGTT ACTTT 5 α. Να εντοπιστούν τα γονίδια που περιέχει χωρίς να ληφθούν υπόψη οι 5 και 3 αμετάφραστες περιοχές. β. Να γραφούν τα mrna που θα προκύψουν από το παραπάνω τμήμα DNA (να μην ληφθούν υπόψη οι 5 και 3 αμετάφραστες περιοχές). γ. Πόσα κωδικόνια περιέχει κάθε μόριο mrna και πόσα διαφορετικά μόρια trna απαιτούνται για τη μετάφρασή του; δ. Να γραφούν οι αλληλουχίες των αμινοξέων των πεπτιδίων που συντίθενται από τη μετάφραση κάθε μορίου ε. Πόσοι πεπτιδικοί δεσμοί δημιουργούνται σε κάθε πεπτίδιο; α. Προκειμένου να βρούμε τα γονίδια που περιέχονται στο παραπάνω τμήμα DNA, αναζητούμε τη μη κωδική αλυσίδα κατά τη φορά 3 5. Κωστανίκος Δημήτρης 2 Βιολόγος

3 Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. 3 AAAGTAACGACGTAGGAATGATGGTG TAC GAC CTG TAT TAA 5 Βρέθηκε μόνο κωδικόνιο έναρξης. Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. 3 TTAA TAC AGG TCG TAC ACC ATC ATTCC TAC GTC GTT ACT TT 5 Υπάρχουν 2 κωδικόνια έναρξης και 2 κωδικόνια λήξης. Κατά συνέπεια θα υπάρχουν και 2 γονίδια τα οποία θα είναι τα εξής: Γονίδιο 1: 5 ATG TCC AGC ATG TGG TAG 3 κωδική 3 TAG AGG TCG TAG ACC ATC 5 μη κωδική Γονίδιο 2: 5 ATG CAG CAA TGA 3 κωδική 3 TAC GTC GTT ACT 5 μη κωδική β. mrna (Για γονίδιο 1): 5 AUG UCC AGC AUG UGG UAG 3 mrna (Για γονίδιο 2): 5 AUG CAG CAA UGA 3 γ. Το πρώτο mrna περιέχει έξι κωδικόνια: πέντε κωδικόνια που κωδικοποιούν αμινοξέα και ένα κωδικόνιο λήξης της μετάφρασης για το οποίο δεν υπάρχει trna με αντικωδικόνιο. Το κωδικόνιο AUG υπάρχει και σε άλλη θέση εκτός από την έναρξη. Απαιτούνται λοιπόν τέσσερα διαφορετικά μόρια trna με αντικωδικόνια συμπληρωματικά των αντίστοιχων κωδικονίων (Τα UCC και AGC κωδικοποιούν το ίδιο αμινοξύ (ser), συνδέονται όμως με δ.η με μόρια trna που ενώ μεταφέρουν το ίδιο αμινοξύ (ser) έχουν διαφορετικά αντικωδικόνια). Το δεύτερο mrna περιέχει τέσσερα κωδικόνια: τρία κωδικόνια που κωδικοποιούν αμινοξέα και ένα κωδικόνιο λήξης. Για τη μετάφραση του δεύτερου μορίου mrna απαιτούνται τρία διαφορετικά μόρια trna με αντικωδικόνια συμπληρωματικά των αντίστοιχων κωδικονίων (Τα CAG και CAA κωδικοποιούν το ίδιο αμινοξύ (gln), συνδέονται όμως με δ.η με μόρια trna που ενώ μεταφέρουν το ίδιο αμινοξύ (gln) έχουν διαφορετικά αντικωδικόνια). δ. πεπτίδιο (1) : H 2 N - met - ser - ser - met - trp - COOH πεπτίδιο (2): H 2 N - met - gln - gln - COOH ε. Ο πεπτιδικός δεσμός δημιουργείται μεταξύ της καρβοξυλομάδας (-COOH) του πρώτου αμινοξέος και της αμινομάδας (-NH 2 ) του δευτέρου αμινοξέος. Στη μετάφραση του πρώτου mrna δημιουργούνται τέσσερις πεπτιδικοί δεσμοί και παράγεται ένα πενταπεπτίδιο, ενώ στη μετάφραση του δεύτερου mrna δημιουργούνται δύο πεπτιδικοί δεσμοί και παράγεται ένα τριπεπτίδιο. 5. Δίνεται η αλληλουχία βακτηριακού τμήματος DNA: TTAGAGATGGCGGAGCATCAGCAGTGATAG AATCTCTACCGCCTCGTAGTCGTCACTATC α. Να γράψετε τα mrνα, τα αντικωδικόνια και τα πεπτίδια που προκύπτουν. β. Όταν η αμινομάδα του 4 ου αμινοξέος σχηματίζει πεπτιδικό δεσμό, να βρείτε πόσοι και ποιοι δεσμοί σπάνε. α. Θα αναζητήσουμε τη μη κωδική αλυσίδα. Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα αριστερά προς τα δεξιά. TTAGAGATGGCGGAGCATCAGCAGTGATAG Αρχίζουμε να διαβάζουμε την 1 η αλυσίδα από τα δεξιά προς τα αριστερά. GATAGTGACGAC TAC GAG GCG GTA GAG ATT Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα αριστερά προς τα δεξιά. AATCTC TAC CGC CTC GTA GTC GTC ACT ATC Αρχίζουμε να διαβάζουμε τη 2 η αλυσίδα από τα δεξιά προς τα αριστερά. CTATCACTGCTGATGCTCCGCCATCTCTAA Κωστανίκος Δημήτρης 3 Βιολόγος

4 Διακρίνουμε δύο περιπτώσεις: 1 η περίπτωση: Η μη κωδική αλυσίδα είναι η 1 η με το 5 άκρο αριστερά και το 3 δεξιά. Βακτηριακό DNA: 5 TTA GAG ATG GCG GAG CAT CAGCAGTGATAG 3 3 AAT CTC TAC CGC CTC GTA GTCGTCACTATC 5 Μη κωδική αλυσίδα: 3 GATAGTGACGAC TAC GAG GCG GTA GAG ATT 5 mrna: 5 CUAUCACUGCUG AUG CUC CGC CAU CUC UAA 3 Αντικωδικόνια: 3 UAC 5, 3 GAG 5, 3 GCG 5, 3 GUA 5, 3 GAG 5 Πεπτίδιο: ΝΗ 2 -met-leu-arg-his-leu-cooh (5 αμινοξέα). 2 η περίπτωση: Η μη κωδική αλυσίδα είναι η 2 η με το 5 άκρο δεξιά και το 3 αριστερά. Βακτηριακό DNA: 5 TTAGAG ATG GCG GAG CAT CAG CAG TGA TAG 3 3 AATCTC TAC CGC CTC GTA GTC GTC ACT ATC 5 Μη κωδική αλυσίδα: 3 AATCTC TAC CGC CTC GTA GTC GTC ACT ATC 5 mrna: 5 UUAGAG AUG GCG GAG CAU CAG CAG UGA UAG 3 Αντικωδικόνια: 3 UAC 5, 3 CGC 5, 3 CUC 5, 3 GUA 5, 3 GUC 5, 3 GUC 5 Πεπτίδιο: ΝΗ 2 -met-ala-glu-his-gln-gln-cooh (6 αμινοξέα). β. Όταν η αμινομάδα του 4 ου αμινοξέος σχηματίζει πεπτιδικό δεσμό τότε απομακρύνεται το trna του 3 ου αμινοξέος. Τα δύο διαφορετικά πεπτίδια που σχηματίζονται έχουν ως 3 ο αμινοξύ το ένα την arg και το άλλο το glu. Κατά συνέπεια και πάλι διακρίνουμε δύο περιπτώσεις: 1 η περίπτωση: Στην περίπτωση που το 3 ο αμινοξύ είναι η arg τότε κατά την απομάκρυνση του trna σπάει ο δεσμός μεταξύ του trna και της arg καθώς και οι δεσμοί που σχηματίζονται μεταξύ του κωδικονίου του mrna και του αντικωδικονίου του trna, δηλαδή οι εννιά (9) δεσμοί υδρογόνου μεταξύ του κωδικονίου CGC και του αντικωδικονίου GCG. 2 η περίπτωση Στην περίπτωση που το 3 ο αμινοξύ είναι το glu τότε κατά την απομάκρυνση του trna σπάει ο δεσμός μεταξύ του trna και του glu καθώς και οι δεσμοί που σχηματίζονται μεταξύ του κωδικονίου του mrna και του αντικωδικονίου του trna, δηλαδή οι οχτώ (8) δεσμοί υδρογόνου μεταξύ του κωδικονίου GAG και του αντικωδικονίου CUC. 6. Ένα γονίδιο ευκαρυωτικού κυττάρου αποτελείται από 2000 ζεύγη βάσεων. Το μήκος του ώριμου mrνα, που προκύπτει από τη μεταγραφή του γονιδίου, είναι 480 νουκλεοτίδια και το πολυπεπτίδιο που κωδικοποιεί αποτελείται από 146 αμινοξέα. Να υπολογίσετε: α. Το ποσοστό των αζωτούχων βάσεων του γονιδίου που αποτελούν εσώνια. β. Το ποσοστό των βάσεων του γονιδίου που δεν μεταφράζονται σε αμινοξέα. α. Όπως είναι γνωστό για το πρόδρομο mrna ισχύει: Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=4.000/2=2.000 βάσεις. Το ώριμο mrna (480 νουκλεοτίδια) αποτελείται από εξώνια κατά συνέπεια η διαφορά μεταξύ πρόδρομου και ώριμου mrna αντιπροσωπεύει τις βάσεις των εσωνίων. Οπότε τα εσώνια θα αποτελούνται από =1520 βάσεις στο πρόδρομο mrna οι οποίες θα αντιστοιχούν σε 1520 ζεύγη βάσεων στο γονίδιο και το ποσοστό τους θα είναι (1520/2000) 100%= 76%. Κωστανίκος Δημήτρης 4 Βιολόγος

5 β. Η πολυπεπτιδική αλυσίδα που σχηματίζεται αποτελείται από 146 αμινοξέα τα οποία αντιστοιχούν σε 146 3=438 βάσεις στο ώριμο Η διαφορά =42 δείχνει τις βάσεις στις 5 και 3 αμετάφραστες περιοχές του ώριμου mrna οι οποίες δεν εκφράζονται σε αμινοξέα. Άρα οι συνολικές βάσεις του πρόδρομου mrna που δε μεταφράζονται σε αμινοξέα είναι =1562 βάσεις που αντιστοιχούν σε 1562 ζεύγη βάσεων στο γονίδιο και το ποσοστό τους θα είναι (1562/2000) 100%= 78%. 7. Ένα γονίδιο περιέχει 8300 αζωτούχες βάσεις, το 32% των οποίων αντιστοιχεί σε εσώνια. Ποσοστό ίσο με το 14% των βάσεων του πρόδρομου mrνα που προκύπτει από το γονίδιο αντιστοιχεί σε 5 και 3 αμετάφραστες περιοχές. Να βρείτε τον αριθμό των αμινοξέων της πρωτεΐνης που κωδικοποιείται από το γονίδιο. Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=8300/2=4.150 βάσεις. Τα εσώνια θα αντιστοιχούν σε %= 1328 βάσεις και η 5 και 3 αμετάφραστη περιοχή σε %=581 βάσεις. Το ώριμο mrna θα αποτελείται από =2241 βάσεις από τις οποίες προκύπτουν 2241/3=747 αμινοξέα. 8. Γονίδιο αποτελείται από 4800 ζεύγη βάσεων και περιέχει 32 εσώνια. Το mrνα που μεταφέρεται στο κυτταρόπλασμα περιέχει το 20% των βάσεων του mrνα που προκύπτει από τη μεταγραφή του γονιδίου και κωδικοποιεί πρωτεΐνη που αποτελείται από 301 αμινοξέα. Να υπολογίσετε: α. Τον αριθμό των βάσεων που αποτελούν τα εσώνια στο γονίδιο. β. Τον αριθμό των εξωνίων στο γονίδιο. γ. Πόσοι φωσφοδιεστερικοί δεσμοί σπάνε και πόσοι δημιουργούνται κατά τη διαδικασία της ωρίμανσης. δ. Τον αριθμό των βάσεων στις 5 και 3 αμετάφραστες περιοχές του mrνα, δεδομένου ότι μετά τη σύνθεση της πρωτεΐνης αφαιρούνται 4 αμινοξέα. α. Βάσεις πρόδρομου mrna= βάσεις μη κωδικής αλυσίδας DNA= βάσεις γονιδίου/2=9.600/2= Βάσεις ώριμου mrna= %=960 Το ώριμο mrna αποτελείται από εξώνια κατά συνέπεια η διαφορά μεταξύ πρόδρομου και ώριμου mrna αντιπροσωπεύει τις βάσεις των εσωνίων, δηλαδή = βάσεις οι οποίες θα αντιστοιχούν σε ζεύγη βάσεων στο γονίδιο δηλαδή = β. Τα εσώνια είναι ενδιάμεσες αλληλουχίες των γονιδίων και ως εκ τούτου ενδιάμεσες αλληλουχίες στο πρόδρομο mrνα. Αν ένα γονίδιο έχει x εσώνια, τότε έχει x + 1 εξώνια. Στη συγκεκριμένη περίπτωση το γονίδιο έχει 33 εξώνια. γ. Για την απομάκρυνση των x εσωνίων σπάνε 2x φωσφοδιεστερικοί δεσμοί, ενώ για τη συρραφή x εξωνίων δημιουργούνται x-1 φωσφοδιεστερικοί δεσμοί. Κατά συνέπεια για την απομάκρυνση 32 εσωνίων σπάνε 32 2=64 φωσφοδιεστερικοί δεσμοί, ενώ για τη συρραφή 33 εξωνίων απαιτούνται 32 φωσφοδιεστερικοί δεσμοί. δ. Πριν τη μετα-μεταφραστική τροποποίηση της η πρωτεΐνη αποτελούνταν από 301+4=305 αμινοξέα τα οποία αντιστοιχούν σε 305 3=915 βάσεις στο ώριμο Άρα οι βάσεις της 5 και 3 αμετάφραστης περιοχής θα είναι =45 βάσεις. 9. Μια λειτουργική πρωτεΐνη αποτελείται από 157 αμινοξέα ενώ η αρχική πολυπεπτιδική αλυσίδα πριν την μετα-μεταφραστική της τροποποίηση είχε επιπλέον 12 αμινοξέα στο αμινικό της άκρο. Με δεδομένο ότι το ώριμο mrna περιέχει 25 επιπλέον βάσεις από το ελάχιστο αριθμό που απαιτείται για την κωδικοποίηση της συγκεκριμένης πρωτεΐνης και ότι το γονίδιο είναι ασυνεχές και περιέχει 4 εσώνια με 50 ζεύγη βάσεων το καθένα, να βρεθεί το μήκος του γονιδίου που κωδικοποιεί τη συγκεκριμένη πρωτεΐνη. Η αρχική πρωτεΐνη είχε =169 αμινοξέα τα οποία κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=170 κωδικονίων, δηλαδή από 170 3=510 βάσεις. Ο αριθμός των βάσεων στο ώριμο mrna θα είναι: =535 βάσεις. Τα εσώνια στο γονίδιο θα είναι συνολικά 200 ζεύγη βάσεων δηλαδή 400 βάσεις, ενώ στο πρόδρομο mrna θα είναι 200 βάσεις. Κωστανίκος Δημήτρης 5 Βιολόγος

6 Άρα ο αριθμός των βάσεων στο πρόδρομο mrna θα είναι: =735 βάσεις. Οι βάσεις αυτές αντιστοιχούν σε 735 βάσεις της μη κωδικής αλυσίδας του γονιδίου και σε 735 ζεύγη βάσεων ή 1470 βάσεις στο γονίδιο. 10. Ένα πολυριβονουκλεοτίδιο παράγεται στο εργαστήριο από μείγμα που περιέχει G και C σε μοριακή αναλογία 4:1 αντίστοιχα. Δεδομένου ότι τα ριβονουκλεοτίδια συνδυάζονται τυχαία προς το σχηματισμό νουκλεϊκού οξέος, να βρείτε τα κωδικόνια που θα παρατηρηθούν σε αυτό το νουκλεϊκό οξύ και την αναμενόμενη συχνότητα του καθενός. Οι δύο αυτές βάσεις θα πρέπει να συνδυαστούν για να σχηματίσουν τριπλέτες (κωδικόνια) βάσεων. Ο πιθανός αριθμός των κωδικονίων είναι 2 3 =8 κωδικόνια. Εφόσον στο μείγμα η αναλογία G:C είναι 4:1 αυτό συνεπάγεται ότι η πιθανότητα εμφάνισης της G είναι 4/5, ενώ η πιθανότητα εμφάνισης της C είναι 1/5. Τα κωδικόνια που θα μπορούσαν να προκύψουν και η πιθανότητα εμφάνισής τους φαίνονται στο παρακάτω πίνακα. Κωδικόνια Αναμενόμενη συχνότητα GGG 4/5 4/5 4/5=64/125 GCG 4/5 1/5 4/5=16/125 GGC 4/5 4/5 1/5=16/125 GCC 4/5 1/5 1/5=4/125 CCC 1/5 1/5 1/5=1/125 CGC 1/5 4/5 1/5=4/125 CCG 1/5 1/5 4/5=4/125 CGG 1/5 4/5 4/5=16/ Από τη μετάφραση ενός μορίου mrna προκύπτουν 4 διαφορετικά πολυπεπτίδια: Το Α με 73 αμινοξέα, το Β με 65 αμινοξέα, το Γ με 125 αμινοξέα και το Δ με 101 αμινοξέα. Ποιο είναι το ελάχιστο μήκος αυτού του μορίου του mrna; Επειδή από ένα μόριο mrna προκύπτουν 4 διαφορετικά πολυπεπτίδια αυτό σημαίνει ότι το mrna αυτό προέρχεται από τη μεταγραφή τεσσάρων δομικών γονιδίων ενός οπερονίου που χαρακτηρίζει το γονιδίωμα ενός προκαρυωτικού οργανισμού. Κατά συνέπεια θα υπάρχουν και 4 κωδικόνια έναρξης και 4 κωδικόνια λήξης. Το ελάχιστο μήκος του συγκεκριμένου μορίου mrna υπολογίζεται ως εξής: Πολυπεπτίδιο Α: Τα 73 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των 73+1 (κωδικόνιο λήξης)=74 κωδικονίων τα οποία αντιστοιχούν σε 74 3=222 βάσεις στο μόριο του Πολυπεπτίδιο Β: Τα 65 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των 65+1 (κωδικόνιο λήξης)=66 κωδικονίων τα οποία αντιστοιχούν σε 66 3=198 βάσεις στο μόριο του Πολυπεπτίδιο Γ: Τα 125 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=126 κωδικονίων τα οποία αντιστοιχούν σε 126 3=378 βάσεις στο μόριο του Πολυπεπτίδιο Δ: Τα 101 αμινοξέα κωδικοποιούνται από τον ελάχιστο αριθμό των (κωδικόνιο λήξης)=102 κωδικονίων τα οποία αντιστοιχούν σε 102 3=306 βάσεις στο μόριο του Ο ελάχιστος αριθμός βάσεων που θα πρέπει να υπάρχουν σε αυτό το μόριο mrna για να προκύψουν τα 4 αυτά πολυνουκλεοτίδια είναι: =1.104 βάσεις Κωστανίκος Δημήτρης 6 Βιολόγος

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα



Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα


ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα


BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο Α. Να σηµειώσετε τη σωστή απάντηση: 1. Ο γονότυπος των φυσιολογικών γονιών ενός ατόµου που έχει σύνδροµο Kleinefelter και πάσχει από αιµορροφιλία είναι :

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1- α Α2- δ Α3- γ Α4- β Α5- β ΘΕΜΑ Β. Β1. Βλέπε σελ. 13 σχολικού βιβλίου: από «Το 1928 ο Griffith» μέχρι «αλλά δεν μπόρεσε να

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα


ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα


ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr 1 TO 1. µ, : i µ µ DNA ii µ DNA iii

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία προσανατολισμού

Βιολογία προσανατολισμού Βιολογία προσανατολισμού Α. 1. β. 2. γ. 3. γ. 4. α. 5. δ. ΘΕΜΑ Α ΘΕΜΑ Β Β1. Σχολικό βιβλίο σελ. 131 «Το βακτήριο... στο σώμα των φυτών.» Β2.1 Ε, 2 Δ, 3 Α, 4 Β Β3. Σχολικό βιβλίο σελ. 108 «Η θερμοκρασία..

Διαβάστε περισσότερα


ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα


5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα


Διαβάστε περισσότερα


5 -TACATGTCGCGATGCAAGTTCTAATCTCAATA CTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTAT GAA-5 1 ( ) 18 2011 : : (5) 1 5,. 1......... 2.. DNA.. mrna.. mrna.. DNA. 3. Ti........ 4......... 1 5 2 5. T....... DNA. : 1. Griffith. 8 2.. 3. : ). ) cdna. 7 6 4. DNA : ( ) 28% (G) 28%.. 4 1.,. 2 5 3., (

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2015 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ (ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ) ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και, δίπλα, το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΕΠΑΝΑΛΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 γ Α3 γ Α4 α Α5 δ ΘΕΜΑ Β Β1. Το βακτήριο Agrobacterium tumefaciens, το οποίο ζει στο έδαφος,

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΙΑΤΡ ΓΘΕΤ 2 ΗΜΕΡΟΜΗΝΙΑ: 20/03/2016 ΘΕΜΑ Α 1. α 2. δ 3. γ 4. δ 5. γ. ΘΕΜΑ Β 1. Τα αντισώματα αποτελούν το πιο αποτελεσματικό φυσικό φάρμακο για την αντιμετώπιση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΤΕΤΑΡΤΗ 18/5/2011 Θέμα 1 Α1. α Α2. δ Α3. γ Α4. β Α5. β Θέμα 2 Β1. Σελ. σχολικού βιβλίου 13 «Το 1928. για το πώς γίνεται αυτό» Β2. Σελ. σχολικού βιβλίου 101 «Τέλος, βλάβες στους

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4ο Γενετική

ΚΕΦΑΛΑΙΟ 4ο Γενετική ΚΕΦΑΛΑΙΟ 4ο Γενετική Ενότητα 4.1: Κύκλος ζωής του κυττάρου Ενότητα 4.2: Μοριακή γενετική. (Το κεντρικό δόγμα της βιολογίας - Αντιγραφή - Μεταγραφή - Μετάφραση του DNA - Η χρωματίνη και το χρωμόσωμα) Ενότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Θέμα A A1: β A2: β A3: γ A4: β A5: α. Θέμα Β Β1. ΠΝΤΗΣΕΙΣ ΜΘΗΜ: ΙΟΛΟΓΙ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Θέμα A A1: β A2: β A3: γ A4: β A5: α Θέμα 1. Για να εκφράζονται και τα δυο αλληλόμορφα σε ετερόζυγα άτομα, τα γονίδια αυτά θα πρέπει να έχουν μεταξύ τους σχέση ατελών

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα


Διαβάστε περισσότερα

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών

Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς Βιολογία Γ λυκείου Θ ε τ ι κ ών σπο υ δ ών Φ ρ ο ν τ ι σ τ ή ρ ι α δ υ α δ ι κ ό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Θ Ε Μ Α Α Γ ε ν ι κ έ ς εξ ε τ ά σ ε ι ς 2 0 1 6 Βιολογία Γ λυκείου

Διαβάστε περισσότερα

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28

Τ 28 G 22 C 22 2 η καλλιέργεια βακτηρίων Λόγω συμπληρωματικότητας βάσεων (Μοντέλο διπλής έλικας) και ότι A+T+G+C= 100 Έχω G = C = 28 ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 8 ΜΑΪΟΥ 2 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ Α Α. α Α2. δ Α3 γ Α4 β Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου

Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αµνιο-PCR Η νέα προσέγγιση στην ταχεία προγεννητική διάγνωση των χρωµοσωµατικών ανωµαλιών του εµβρύου Αγγελική Χατζάκη, PhD Γεωργία Χριστοπούλου, MSc Τµήµα Γενετικής και Μοριακής Βιολογίας Μαιευτήριο «ΜΗΤΕΡΑ»

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 Πανελλήνιες 2016 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΘΕΜΑ Α Α1- β Α2- β Α3- δ Α4- γ Α- γ ΘΕΜΑ Β Β1. 1- Α 2- Γ 3- Α 4- Β - Α 6- Α 7- Γ Β2. Ορισμός καρυότυπου (σελ. 24):

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 4ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 4ο ΟΜΑΔΑ Α 1. Τμήμα DΝΑ που έχει κοπεί στα άκρα του με την περιοριστική ενδονουκλεάση ΕcoRΙ περιέχει 316 νουκλεοτίδια με αζωτούχο βάση την Τ και 1614 δεσμούς υδρογόνου. Να υπολογίσετε

Διαβάστε περισσότερα

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών.

Δύο συμπεράσματα που μπορούν να εξαχθούν είναι το φύλο του οργανισμού και η ύπαρξη δομικών ή αριθμητικών χρωμοσωμικών ανωμαλιών. ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1-Α 2-Γ 3-Α 4-Β 5-Α 6-Α 7-Γ Β2. (σελ. 24) Κάθε φυσιολογικό μεταφασικό... τον καρυότυπο. Δύο συμπεράσματα που μπορούν να

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014. Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΑΠΑΝΤΗΣΕΙΣ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α A1. α Α2. γ Α3. α Α4. α Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. α. Τα πολυπεπτίδια

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Κατεύθυνσης Γ Λυκείου ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Θέµα 1 ο κ ΙΑΓΩΝΙΣΜΑ Α Α. Να σηµειώσεις την σωστή απάντηση και να αιτιολογήσεις. I 1. Το διπλανό γενεαλογικό δένδρο αναπαριστά την κληρονόµηση:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα