Θέματα Πανελλαδικών

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Θέματα Πανελλαδικών"

Transcript

1 Θέματα Πανελλαδικών ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 2

2 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα 3 ο 12 Θέμα 4 ο 13 Κεφάλαιο 2 ο Αντιγραφή, Έκφραση & Ρύθμιση γενετικής πληροφορίας Θέμα 1 ο 14 Θέμα 2 ο 22 Θέμα 3 ο 26 Θέμα 4 ο 29 Πανελλαδικές Β. Πιτσιλαδής

3 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα που συμπληρώνει σωστά ΕΣΠΕΡΙΝΑ ( ) 2. Το είδος του RNA που μεταφέρει την πληροφορία για τη σύνθεση της πρωτεΐνης στο ριβόσωμα είναι: Μονάδες 3 α) το ριβοσωμικό RNA (rrna) β) το μικρό πυρηνικό RNA (snrna) γ) το αγγελιαφόρο RNA (mrna) δ) το μεταφορικό RNA (trna) 5. Ο γενετικός κώδικας είναι : Μονάδες 3 α) το σύνολο των χρωμοσωμάτων του κυττάρου β) η αντιστοίχιση τριπλετών βάσεων σε αμινοξέα γ) μια συνεχής αλληλουχία αμινοξέων δ) ο τρόπος ελέγχου της ενζυμικής δράσης στο κύτταρο 2001 ΕΣΠΕΡΙΝΑ ( ) Α. Σωστές απαντήσεις : Μονάδες 5 1. Ποια είναι (ονομαστικά) τα 4 είδη RNA; ΗΜΕΡΗΣΙΑ ( ) Β. 2. Να αναφέρετε τις ειδικές θέσεις που έχει κάθε μόριο trna και να εξηγήσετε το ρόλο των trna στην πρωτεϊνοσύνθεση. Μονάδες 5 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Α. 1. Ένα ελεύθερο μόριο trna μπορεί να συνδεθεί με: Μονάδες 2 α. ένα μόνο ειδικό αμινοξύ β. οποιοδήποτε διαθέσιμο αμινοξύ γ. τρία διαφορετικά αμινοξέα. Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 Α. 3. Η σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την: Μονάδες 2 α. αντιγραφή β. μεταγραφή γ. μετάφραση. Να αιτιολογήσετε την επιλογή σας. Μονάδες 3 ΟΜΟΓΕΝΩΝ ( ) Α. Γράψτε τον αριθμό της ερώτησης και δίπλα το σωστό γράμμα. 2. Κάθε μεταφορικό RNA (trna): Μονάδες 2 α. μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα; β. μεταφέρει ενέργεια στα ριβοσώματα; γ. μεταφέρει τη γενετική πληροφορία; Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 Πανελλαδικές Β. Πιτσιλαδής

4 2002 ΗΜΕΡΗΣΙΑ ( ) Β. Να οριστούν οι παρακάτω έννοιες: 1. Ανοικτό πλαίσιο ανάγνωσης. Μονάδες 7 ΕΣΠΕΡΙΝΑ ( ) Α.1. Οι DNA πολυμεράσες που συμμετέχουν στην αντιγραφή του DNA μπορούν να ξεκινήσουν τη διαδικασία της αντιγραφής, αν βοηθηθούν από Μονάδες 5 α. τα ένζυμα που διορθώνουν τα λάθη της αντιγραφής. β. το πριμόσωμα. γ. τη DNA δεσμάση. δ. το κωδικόνιο. ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 2. Τη γονιδιακή έκφραση αποτελούν οι διαδικασίες: Μονάδες 5 α. αντιγραφής και μετάφρασης β. αντιγραφής και μεταγραφής γ. μεταγραφής και μετάφρασης. ΟΜΟΓΕΝΩΝ ( ) Α. Γράψτε τον αριθμό της πρότασης και δίπλα το σωστό γράμμα. 2. Το πρόδρομο mrna στα ευκαρυωτικά κύτταρα είναι : Μονάδες 2 α. ίσο σε μέγεθος με το ώριμο mrna β. μεγαλύτερο σε μέγεθος από το ώριμο mrna γ. μικρότερο σε μέγεθος από το ώριμο mrna. Να δικαιολογήσετε την απάντησή σας. Μονάδες 3 3. Η DNA ελικάση : Μονάδες 2 α. σπάει τους υδρογονικούς δεσμούς στο δίκλωνο μόριο του DNA β. τοποθετεί νουκλεοτίδια γ. επιδιορθώνει λάθη της αντιγραφής Να δικαιολογήσετε την απάντησή σας. Μονάδες ΗΜΕΡΗΣΙΑ ( ) Α. Σωστό ή Λάθος 1. Ο καταστολέας κωδικοποιείται από ένα ρυθμιστικό γονίδιο, που βρίσκεται μπροστά από τον υποκινητή. Μονάδες 2 ΕΣΠΕΡΙΝΑ ( ) 3. Ο γενετικός κώδικας είναι Μονάδες 5 α. ο αριθμός των γονιδίων του κυττάρου. β. η αντιστοίχιση τριπλετών βάσεων σε αμινοξέα. γ. το σύνολο των ενζύμων ενός κυττάρου. δ. ο τρόπος αντιστοίχισης των νουκλεοτιδίων μεταξύ τους. 5. Το είδος του RNA που μεταφέρει στα ριβοσώματα την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας είναι το Μονάδες 5 α. ριβοσωμικό RNA (rrna). β. μικρό πυρηνικό RNA (snrna). γ. αγγελιαφόρο RNA (mrna). δ. μεταφορικό RNA (trna). Πανελλαδικές Β. Πιτσιλαδής

5 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Α. Σωστό ή Λάθος Μονάδες 2 2. Οι DNA πολυμεράσες είναι ένζυμα που συμμετέχουν στην αντιγραφή των μορίων DNA. Β. 2. Η διαδικασία μεταγραφής οδηγεί στο σχηματισμό μορίων : Μονάδες 5 α. DNA β. c DNA γ. RNA δ. πρωτεϊνών. Β. 3. Η RNA πολυμεράση προσδένεται : Μονάδες 5 α. στον υποκινητή β. στην 3 αμετάφραστη περιοχή γ. στα εσώνια δ. στις αλληλουχίες λήξης ΗΜΕΡΗΣΙΑ ( ) 1. Κατά τη μεταγραφή του DNA συντίθεται ένα Μονάδες 5 α. δίκλωνο μόριο DNA. β. μονόκλωνο μόριο DNA. γ. δίκλωνο RNA. δ. μονόκλωνο RNA. 5. Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι Μονάδες 5 α. DNA ελικάσες και DNA δεσμάση. β. RNA πολυμεράσες και πριμόσωμα. γ. DNA δεσμάση και επιδιορθωτικά ένζυμα. δ. DNA πολυμεράσες και επιδιορθωτικά ένζυμα. ΕΣΠΕΡΙΝΑ ( ) 1. Το γεγονός ότι κάθε νουκλεοτίδιο του γενετικού κώδικα ανήκει σε ένα μόνο κωδικόνιο οδηγεί στο χαρακτηρισμό του κώδικα ως Μονάδες 5 α. συνεχούς. β. μη επικαλυπτόμενου. γ. εκφυλισμένου. δ. σχεδόν καθολικού. ΟΜΟΓΕΝΩΝ ( ) 2. Η αντιγραφή του DNA αρχίζει με το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων με τη βοήθεια ενζύμων που ονομάζονται Μονάδες 5 α. DNA πολυμεράσες. β. DNA ελικάσες. γ. DNA δεσμάσες. δ. RNA πολυμεράσες. Πανελλαδικές Β. Πιτσιλαδής

6 2005 ΕΣΠΕΡΙΝΑ ( ) 1. Οι DNA πολυμεράσες, μεταξύ άλλων, Μονάδες 3 α. καταλύουν την ωρίμανση του πρόδρομου mrna. β. αρχίζουν την αντιγραφή του DNA. γ. επιδιορθώνουν λάθη που συμβαίνουν στην αντιγραφή του DNA. δ. συνδέουν τα κομμάτια της ασυνεχούς αλυσίδας του DNA. ΟΜΟΓΕΝΩΝ ( ) 5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται Μονάδες 5 α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο ΗΜΕΡΗΣΙΑ ( ) 2. Η ωρίμανση του RNA είναι μια διαδικασία η οποία Μονάδες 5 α. οδηγεί στη δημιουργία m-rna χωρίς εξώνια. β. καταλύεται από το ένζυμο DNA ελικάση. γ. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. δ. συμβαίνει μόνο στους ευκαρυωτικούς οργανισμούς. ΕΣΠΕΡΙΝΑ ( ) Α.1. H μεταγραφή του DNA καταλύεται από την Μονάδες 3 α. DNA πολυμεράση. β. RNA πολυμεράση. γ. DNA δεσμάση και DNA πολυμεράση. δ. DNA πολυμεράση και RNA πολυμεράση. B. Ποια είναι τα τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή και ποιος ο ρόλος του καθενός από αυτά; Μονάδες 10 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 1. Πολύσωμα είναι Μονάδες 5 α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. το σύνολο των εξωνίων ενός ώριμου mrna. δ. το σύμπλεγμα πολλών ριβοσωμάτων με το mrna. ΟΜΟΓΕΝΩΝ ( ) 2. Πολύσωμα είναι Μονάδες 5 α. το οργανίδιο που γίνεται η πρωτεϊνοσύνθεση. β. ομάδα ριβοσωμάτων στο κυτταρόπλασμα. γ. το σύνολο των εξωνίων του ώριμου mrna. δ. το σύμπλεγμα πολλών ριβοσωμάτων με το mrna. Πανελλαδικές Β. Πιτσιλαδής

7 2007 ΗΜΕΡΗΣΙΑ ( ) 1. Τα πρωταρχικά τμήματα κατά την αντιγραφή του DNA συντίθενται από Μονάδες 5 α. την DNA πολυμεράση. β. την DNA δεσμάση. γ. το πριμόσωμα. δ. το πολύσωμα. ΕΣΠΕΡΙΝΑ ( ) Α. 1. Το κωδικόνιο είναι Μονάδες 3 α. μία τριάδα νουκλεοτιδίων. β. μία τριάδα αμινοξέων. γ. έξι νουκλεοτίδια συνδεδεμένα με δεσμούς υδρογόνου. δ. το αμινοξύ μεθειονίνη. Α. 2. Κάθε μεταφορικό RNA Μονάδες 3 α. σχηματίζει το ριβόσωμα. β. περιέχει θυμίνη. γ. καταλύει την ωρίμανση του mrna. δ. μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα. B. Να αναφέρετε ονομαστικά τα ένζυμα της αντιγραφής του DNA. Μονάδες 10 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 1. Από RNA αποτελούνται Μονάδες 5 α. τα πρωταρχικά τμήματα. β. οι υποκινητές. γ. οι μεταγραφικοί παράγοντες. δ. τα πριμοσώματα. ΟΜΟΓΕΝΩΝ ( ) 1. Η DNA δεσμάση Μονάδες 5 α. ενώνει τα κομμάτια της αλυσίδας DNA που αντιγράφεται ασυνεχώς. β. είναι το ένζυμο με το οποίο σχηματίζονται τα πρωταρχικά τμήματα. γ. είναι το κύριο ένζυμο της αντιγραφής. δ. επιδιορθώνει τα λάθη της αντιγραφής ΗΜΕΡΗΣΙΑ ( ) 3. Η μεταγραφή στα προκαρυωτικά κύτταρα πραγματοποιείται: Μονάδες 5 α. στον πυρήνα. β. στο κυτταρόπλασμα. γ. στα μιτοχόνδρια. δ. στο κυτταρικό τοίχωμα. ΕΣΠΕΡΙΝΑ ( ) 5. Η ωρίμανση του mrna Μονάδες 5 α. είναι μια διαδικασία που καταλύεται από DNA ελικάσες. β. συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. γ. συμβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων. δ. είναι μία διαδικασία στην οποία παραμένουν για μετάφραση τα εσώνια. Πανελλαδικές Β. Πιτσιλαδής

8 ΟΜΟΓΕΝΩΝ ( ) 2. Το αντικωδικόνιο συνδέεται με το κωδικόνιο κατά τη διαδικασία Μονάδες 5 α. της αντιγραφής του DNA. β. της ωρίμανσης του πρόδρομου m-rna. γ. της μεταγραφής του DNA. δ. της μετάφρασης του m-rna ΗΜΕΡΗΣΙΑ ( ) 1. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται Μονάδες 5 α. χειριστής β. υποκινητής γ. snrna δ. δομικά γονίδια ΕΣΠΕΡΙΝΑ ( ) 5. Το κωδικόνιο έναρξης της μετάφρασης του mrna σε όλους τους οργανισμούς είναι το α. ΑUG. Μονάδες 5 β. UUU. γ. CAA. δ. UAA. ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 2. Η DNA δεσμάση Μονάδες 5 α. επιδιορθώνει λάθη της αντιγραφής. β. συνδέει το αμινοξύ με το trna. γ. συνδέει τμήματα DNA. δ. μεταγράφει την πολυνουκλεοτιδική αλυσίδα. ΟΜΟΓΕΝΩΝ ( ) 1. Πολύσωμα ονομάζεται Μονάδες 5 α. το σύμπλεγμα του DNA με τις ιστόνες. β. η τρισωμία του 21 χρωμοσώματος. γ. το σύμπλεγμα των ριβοσωμάτων με το mrna. δ. το ειδικό σύμπλοκο που συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA ΗΜΕΡΗΣΙΑ ( ) Α3. Τα πρωταρχικά τμήματα RNA συντίθενται από Μονάδες 5 α. το πριμόσωμα β. το νουκλεόσωμα γ. την DΝΑ ελικάση δ. την DΝΑ δεσμάση Α5. Στο οπερόνιο της λακτόζης, όταν απουσιάζει η λακτόζη, η πρωτεΐνη καταστολέας συνδέεται με Μονάδες 5 α. τον υποκινητή β. το ρυθμιστικό γονίδιο γ. τον χειριστή δ. την RNA-πολυμεράση Πανελλαδικές Β. Πιτσιλαδής

9 ΕΣΠΕΡΙΝΑ ( ) Β2. Συμπληρώστε. Μονάδες Τα ένζυμα που διασπούν τους δεσμούς υδρογόνου μεταξύ των δύο αλυσίδων του DNA ονομάζονται ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Α1. Τα ένζυμα που διορθώνουν λάθη κατά την αντιγραφή του DNA είναι Μονάδες 5 α. η DNA δεσμάση και τα επιδιορθωτικά ένζυμα β. οι DNA πολυμεράσες και τα επιδιορθωτικά ένζυμα γ. οι DNA ελικάσες και η DNA δεσμάση δ. η RNA πολυμεράση και το πριμόσωμα 2011 ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Α4. Το γεγονός ότι κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο σημαίνει ότι ο γενετικός κώδικας είναι Μονάδες 5 α. συνεχής. β. μη επικαλυπτόμενος. γ. εκφυλισμένος. δ. σχεδόν καθολικός. ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ + ΕΣΠΕΡΙΝΩΝ ( ) Α3. Από RNA αποτελούνται Μονάδες 5 α. οι υποκινητές. β. οι μεταγραφικοί παράγοντες. γ. τα πρωταρχικά τμήματα. δ. οι RNA πολυμεράσες. ΟΜΟΓΕΝΩΝ ( ) A5. Κατά την αντιγραφή του DNΑ, στην κατασκευή των πρωταρχικών τμημάτων συμμετέχει το α. ριβόσωμα. Μονάδες 5 β. πολύσωμα. γ. νουκλεόσωμα. δ. πριμόσωμα ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Α1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη μεταγραφή από το ένζυμο Μονάδες 5 α. RNA πολυμεράση β. DNA πολυμεράση γ. DNA ελικάση δ. DNA δεσμάση. Α4. Σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται κατά την Μονάδες 5 α. αντιγραφή β. μετάφραση γ. μεταγραφή δ. αντίστροφη μεταγραφή. Πανελλαδικές Β. Πιτσιλαδής

10 2013 ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Α2. Επιδιορθωτικά ένζυμα χρησιμοποιούνται από το κύτταρο κατά Μονάδες 5 α. τη μεταγραφή β. την αντιγραφή γ. την ωρίμανση δ. τη μετάφραση Α3. Το ένζυμο που προκαλεί τη διάσπαση των δεσμών υδρογόνου στη θέση έναρξης της αντιγραφής είναι Μονάδες 5 α. η DNA ελικάση β. η RNA πολυμεράση γ. η DNA δεσμάση δ. το πριμόσωμα 2014 ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του Μονάδες 5 α. mrna β. snrna γ. trna δ. rrna ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Α2. Ο υποκινητής είναι Μονάδες 5 α. αλληλουχία λήξης της μεταγραφής β. ειδική περιοχή πρόσδεσης της RNA πολυμεράσης στο DNA γ. τμήμα εσωνίου ενός γονιδίου δ. ρυθμιστικό γονίδιο ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ ( ) Α3. Το μικρό πυρηνικό snrna Μονάδες 5 α. μεταφέρει αμινοξέα στα ριβοσώματα β. μεταφέρει τη γενετική πληροφορία από το DNA γ. συμμετέχει στην ωρίμανση του πρόδρομου mrna δ. είναι δομικό συστατικό των ριβοσωμάτων Α4. Οι γενετικές πληροφορίες που καθορίζουν τα χαρακτηριστικά ενός οργανισμού οργανώνονται σε λειτουργικές μονάδες που λέγονται Μονάδες 5 α. εσώνια β. πολυσώματα γ. πριμοσώματα δ. γονίδια ΟΜΟΓΕΝΩΝ ( ) Α1. Η DNA δεσμάση Μονάδες 5 α. διασπά τμήματα DNA β. συνδέει τμήματα DNA γ. διασπά δεσμούς υδρογόνου δ. συνθέτει πρωταρχικά τμήματα RNA Πανελλαδικές Β. Πιτσιλαδής

11 2015 ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται Μονάδες 5 α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές ΘΕΜΑ 2 ο 2000 ΕΣΠΕΡΙΝΑ ( ) Α. Σωστό ή Λάθος Μονάδες 4 1. Τα δύο θυγατρικά μόρια που προκύπτουν από το διπλασιασμό του DNA είναι πανομοιότυπα μεταξύ τους. 4. Κατά τη μετάφραση της γενετικής πληροφορίας παράγονται πρωτεΐνες, λίπη και σάκχαρα. Β. Συμπληρώστε τα κενά. Μονάδες 6 4. Ο Γενετικός Κώδικας είναι μη, δηλαδή κάθε νουκλεοτίδιο ανήκει σ ένα μόνο κωδικόνιο. 5. Το ένζυμο που υπάρχει σε ορισμένους ιούς χρησιμοποιεί ως καλούπι το RNA, για να συνθέσει DNA. ΗΜΕΡΗΣΙΑ ( ) Α. Η διαδικασία της αντιγραφής του DNA χαρακτηρίζεται από μεγάλη ταχύτητα και ακρίβεια, που οφείλεται κυρίως στη δράση ενζύμων και συμπλόκων ενζύμων. 1. Ποια από τα παρακάτω συμμετέχουν στην αντιγραφή του DNA: DNA πολυμεράσες, DNA ελικάσες, περιοριστικές ενδονουκλεάσες, πριμόσωμα, επιδιορθωτικά ένζυμα, DNA δεσμάση; Μονάδες 5 2. Να γράψετε ονομαστικά τα ένζυμα που παίρνουν μέρος στην επιδιόρθωση του DNA Μονάδες 5 Β. 2. Τι είναι το πολύσωμα; Μονάδες 5 Β. 3. Ποια κωδικόνια ονομάζονται συνώνυμα; Μονάδες ΕΣΠΕΡΙΝΑ ( ) Β. Συμπλήρωση κενών. Μονάδες 6 Β.1. Η αλληλουχία των στο μόριο ενός mrna καθορίζει την αλληλουχία των αμινοξέων της αντίστοιχης. Β.2. Ο γενετικός κώδικας είναι, δηλαδή το mrna διαβάζεται συνεχώς ανά τρία νουκλεοτίδια χωρίς να παραλείπεται κάποιο νουκλεοτίδιο. ΗΜΕΡΗΣΙΑ ( ) 1. Ένας πληθυσμός βακτηρίων Ε. coli αναπτύσσεται σε θρεπτικό υλικό που περιέχει τη λακτόζη ως πηγή άνθρακα. Όταν η λακτόζη εξαντληθεί προσθέτουμε γλυκόζη. Να περιγράψετε τον τρόπο λειτουργίας του οπερονίου της λακτόζης πριν και μετά την προσθήκη της γλυκόζης. Μονάδες 10 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 1. Πώς ρυθμίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα; Μονάδες 10 Πανελλαδικές Β. Πιτσιλαδής

12 2002 ΕΣΠΕΡΙΝΑ ( ) A. Συμπληρώσετε τα κενά. Μονάδες 3 A.2. Το πρόδρομο mrna μετατρέπεται σε mrna με τη διαδικασία της..., κατά την οποία τα... κόβονται από μικρά ριβονουκλεοπρωτεϊνικά σωματίδια και απομακρύνονται. Β.3. Τι είναι το πολύσωμα; Μονάδες ΕΣΠΕΡΙΝΑ ( ) Α. Συμπληρώσετε τα κενά. Μονάδες 5 Α.1. Κάθε μόριο trna έχει μια ειδική τριπλέτα νουκλεοτιδίων, το, με την οποία προσδένεται, λόγω συμπληρωματικότητας, με το αντίστοιχο του mrna. Β.2. Τι είναι το κωδικόνιο έναρξης και τι τα συνώνυμα κωδικόνια; Μονάδες 5 ΟΜΟΓΕΝΩΝ ( ) Β. Τι ονομάζεται πολύσωμα; Μονάδες ΗΜΕΡΗΣΙΑ ( ) 1. Ποια είδη RNA παράγονται κατά τη μεταγραφή του DNA προκαρυωτικού κυττάρου (μονάδες 3) και ποιος είναι ο ρόλος τους (μονάδες 6); ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 1. Ποιες λειτουργίες επιτελούν τα ένζυμα DNA πολυμεράσες κατά την αντιγραφή του DNA; Μονάδες ΕΣΠΕΡΙΝΑ ( ) Β. Σωστό ή λάθος. 1. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος, δηλαδή κάθε κωδικόνιο ανήκει σε ένα μόνο νουκλεοτίδιο. Μονάδες 3 ΟΜΟΓΕΝΩΝ ( ) 3. Ποια είναι τα είδη του RNA και ποιος είναι ο ρόλος κάθε είδους; Μονάδες ΗΜΕΡΗΣΙΑ ( ) 1. Τι είναι το πριμόσωμα και ποιος είναι ο ρόλος του στην αντιγραφή του DNA; Μονάδες 4 ΕΣΠΕΡΙΝΑ ( ) Β. Σωστό ή Λάθος. 4. Οι DNA ελικάσες σπάνε τους δεσμούς υδρογόνου μεταξύ δύο πολυνουκλεοτιδικών αλυσίδων RNA. Μονάδες ΗΜΕΡΗΣΙΑ ( ) 2. Ποια είναι τα βασικά χαρακτηριστικά του γενετικού κώδικα και πώς περιγράφονται; Μονάδες 12 Πανελλαδικές Β. Πιτσιλαδής

13 2008 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 2. Πώς σχηματίζεται το ώριμο mrna στα ευκαρυωτικά κύτταρα; Μονάδες 8 3. Ποιες ονομάζονται θέσεις έναρξης της αντιγραφής του DNA (μονάδες 3), και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα; (μονάδες 4) ΕΣΠΕΡΙΝΑ ( ) 3. Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάζεται ημισυντηρητικός; Μονάδες 8 ΟΜΟΓΕΝΩΝ ( ) 2. Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάστηκε ημισυντηρητικός. Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 3. Ποια γονίδια οργανώνονται σε οπερόνια; (μονάδες 3) Πώς επιτυγχάνεται η καταστολή στο οπερόνιο της λακτόζης; (μονάδες 6) 2010 ΗΜΕΡΗΣΙΑ ( ) Β3. Τι είναι το πολύσωμα; Μονάδες 5 ΕΣΠΕΡΙΝΑ ( ) Β3. Τι είναι το μικρό πυρηνικό RNΑ (snrnα) και ποιός είναι ο ρόλος του; Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Β3. Με ποιους τρόπους περιορίζεται ο αριθμός των λαθών κατά την αντιγραφή του DNA στους ευκαρυωτικούς οργανισμούς; Μονάδες 8 ΕΣΠΕΡΙΝΑ ( ) Β3. Να εξηγήσετε γιατί η αντιγραφή του DNA έχει προσανατολισμό 5 προς 3. Μονάδες ΗΜΕΡΗΣΙΑ ( ) Β4. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Μονάδες ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) B2. Να αναφέρετε ονομαστικά τα ένζυμα ή τα σύμπλοκα ενζύμων τα οποία καταλύουν τις παρακάτω διαδικασίες Μονάδες 5 α. Επιμήκυνση πρωταρχικού τμήματος κατά την αντιγραφή. β. Σύνθεση πρωταρχικών τμημάτων. γ. Σύνδεση των κομματιών της ασυνεχούς αλυσίδας μεταξύ τους κατά την αντιγραφή. δ. Ξετύλιγμα της διπλής έλικας του DNA κατά την αντιγραφή. ε. Σύνδεση ριβονουκλεοτιδίων κατά τη μεταγραφή ΕΣΠΕΡΙΝΑ ( ) B3. Γιατί ο γενετικός κώδικας χαρακτηρίζεται σχεδόν καθολικός; Μονάδες 6 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Β1. Τι ονομάζεται γενετικός κώδικας; (μονάδες 3) Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως σχεδόν καθολικός και ποια είναι η πρακτική σημασία αυτής της ιδιότητάς του; (μονάδες 4) Μονάδες 7 Πανελλαδικές Β. Πιτσιλαδής

14 ΟΜΟΓΕΝΩΝ ( ) B1. Να βάλετε στη σωστή σειρά τα παρακάτω στάδια που οδηγούν στην παραγωγή μιας λειτουργικής πρωτεΐνης σε ένα ευκαρυωτικό κύτταρο. Να γράψετε στο τετράδιό σας μόνο τους αριθμούς που αντιστοιχούν στα στάδια αυτά. Μονάδες 5 1) Μετάφραση του mrna. 2) Μεταφορά του mrna στο κυτταρόπλασμα. 3) Τροποποίηση πρωτεΐνης. 4) Ωρίμανση του mrna. 5) Μεταγραφή του γονιδίου. B2. Να γράψετε με τη σωστή σειρά τα δομικά μέρη του οπερονίου της λακτόζης (μονάδες 4) και να εξηγήσετε το ρόλο της πρωτεΐνης-καταστολέα. (μονάδες 4) Μονάδες ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) B2. Από τι αποτελείται το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης; Μονάδες 7 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) B1. Να συνδυάσετε τους όρους της στήλης Ι με τα βιομόρια της στήλης ΙΙ, αντιστοιχίζοντας κάθε φορά έναν αριθμό της στήλης Ι με ένα μόνο γράμμα, Α ή Β ή Γ, της στήλης ΙΙ. Μονάδες 8 Στήλη Ι Στήλη ΙΙ 1. DNA δεσμάση 2. Πρωταρχικό τμήμα Α: DNA 3. Υποκινητής 4. Μεταγραφικοί παράγοντες Β: Πρωτεΐνη 5. Χειριστής 6. RNA πολυμεράση 7. Πλασμίδιο Γ: RNA 8. Αντικωδικόνιο ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) B4. Να αναφέρετε πώς ρυθμίζεται η γονιδιακή έκφραση στους ευκαρυωτικούς οργανισμούς στο επίπεδο μετά τη μεταγραφή (μονάδες 2) και στο επίπεδο της μετάφρασης (μονάδες 2). Μονάδες 4 ΟΜΟΓΕΝΩΝ ( ) B1. Να αντιστοιχίσετε σωστά τον αριθμό καθεμιάς από τις φράσεις της στήλης Ι με ένα μόνο γράμμα, Α, Β ή Γ, της στήλης ΙΙ. Μονάδες 9 Στήλη Ι Στήλη ΙΙ 1. Πρωταρχικά τμήματα 2. Μεταγραφικοί παράγοντες Α: Αντιγραφή 3. Πολύσωμα 4. Αμινοξέα 5. RNA πολυμεράση 6. Πριμόσωμα 7. Σύμπλοκο έναρξης πρωτεϊνοσύνθεσης 8. Επιδιορθωτικά ένζυμα 9. snrna Β: Μεταγραφή Γ: Μετάφραση Πανελλαδικές Β. Πιτσιλαδής

15 ΘΕΜΑ 3 ο 2001 ΟΜΟΓΕΝΩΝ ( ) 2. Να αναφέρετε τα βασικά χαρακτηριστικά του γενετικού κώδικα και να τα περιγράψετε. Μονάδες Να περιγράψετε τη διαδικασία σχηματισμού "ώριμου" mrna. Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) 2. Δίνεται το παρακάτω πολυπεπτίδιο, που παράγεται σε βακτηριακό κύτταρο: ΗΟΟC-Μεθειονίνη -Λυσίνη -Θρεονίνη -Προλίνη - Λευκίνη -Σερίνη -Βαλίνη -Αλανίνη -Βαλίνη - Mεθειoνίνη- ΝΗ 2 α. Να γράψετε τη μη κωδική αλυσίδα του γονιδίου που κωδικοποιεί αυτό το πολυπεπτίδιο. Μονάδες 6 β. Να ορίσετε τα άκρα 3 και 5 της παραπάνω αλυσίδας. Μονάδες 2 Να αιτιολογήσετε την απάντησή σας. Μονάδες 7 Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων: ΑΜΙΝΟΞΕΑ ΚΩΔΙΚΟΝΙΑ ΑΜΙΝΟΞΕΑ ΚΩΔΙΚΟΝΙΑ Αλανίνη GCU Λυσίνη AAG Βαλίνη GUG Μεθειονίνη AUG Θρεονίνη ACU Προλίνη CCG Λευκίνη CUA Σερίνη UCG ΟΜΟΓΕΝΩΝ ( ) 2. Να περιγράψετε πώς ρυθμίζεται η γονιδιακή έκφραση στα ευκαρυωτικά κύτταρα. Μονάδες ΟΜΟΓΕΝΩΝ ( ) Α. Σε μια θέση έναρξης αντιγραφής του DNA, η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται στο παρακάτω σχήμα: α. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε σ αυτό όλες τις νεοσυντιθέμενες αλυσίδες του DNA και να σημειώσετε τον προσανατολισμό τους, γράφοντας τα 3 και 5 άκρα. Μονάδες 5 β. Η σύνθεση των νέων αλυσίδων του DNA γίνεται είτε με συνεχή είτε με ασυνεχή τρόπο. Γιατί συμβαίνει αυτό; Μονάδες ΟΜΟΓΕΝΩΝ ( ) Β. Η αλληλουχία των βάσεων του mrna καθορίζει την αλληλουχία των αμινοξέων στις πρωτεΐνες με βάση ένα κώδικα αντιστοίχισης νουκλεοτιδίων mrna με αμινοξέα πρωτεϊνών, ο οποίος ονομάζεται γενετικός κώδικας. 1. Τι σημαίνει η έκφραση «ο γενετικός κώδικας είναι συνεχής και σχεδόν καθολικός»; Μονάδες 5 2. Γιατί ο γενετικός κώδικας χαρακτηρίζεται ως εκφυλισμένος; Μονάδες 5 Πανελλαδικές Β. Πιτσιλαδής

16 2007 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Δίνεται το παρακάτω τμήμα μορίου βακτηριακού mrna. 5...Α G A U G A A A G C C A C G G A G C C C U G A G C A A...3 Από τη μετάφραση αυτού του mrna προκύπτει μία πεπτιδική αλυσίδα. 1. Ποιος είναι ο αριθμός των αμινοξέων που αποτελούν αυτή την πεπτιδική αλυσίδα; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 8) 2. Να περιγράψετε το στάδιο έναρξης της πρωτεϊνοσύνθεσης. Μονάδες 8 3. Να περιγράψετε το δεσμό με τον οποίο ενώνονται μεταξύ τους δύο διαδοχικά νουκλεοτίδια σε ένα μόριο mrna. Μονάδες ΗΜΕΡΗΣΙΑ ( ) Ο όρος γονιδιακή έκφραση αναφέρεται συνήθως σε όλη τη διαδικασία με την οποία ένα γονίδιο ενεργοποιείται για να παραγάγει μία πρωτεΐνη. 1. Πού αποσκοπεί κυρίως η ρύθμιση αυτή στην περίπτωση των βακτηρίων; Μονάδες 5 2. Τα κύτταρα ενός ευκαρυωτικού πολύπλοκου οργανισμού, όπως τα νευρικά και τα μυϊκά, αν και έχουν το ίδιο γενετικό υλικό, διαφέρουν στη μορφή και τη λειτουργία. Πώς ονομάζεται αυτή η διαδικασία εξειδίκευσης και τι κάνει τα κύτταρα να διαφέρουν τόσο πολύ; Μονάδες 8 3. Ο μηχανισμός της μεταγραφής είναι ο ίδιος στους προκαρυωτικούς και ευκαρυωτικούς οργανισμούς. Ποια είναι τα ρυθμιστικά στοιχεία της μεταγραφής του DNA, ποιο το ένζυμο που καταλύει τη μεταγραφή και πώς λειτουργεί αυτό κατά τη γονιδιακή ρύθμιση στο επίπεδο της μεταγραφής των ευκαρυωτικών οργανισμών; Μονάδες ΟΜΟΓΕΝΩΝ ( ) Δίνεται το παρακάτω ολιγοπεπτίδιο έξι αμινοξέων το οποίο δεν έχει υποστεί καμία τροποποίηση μετά τη σύνθεσή του Η 2 Ν - Μεθειονίνη - Γλυκίνη - Λυσίνη - Τρυπτοφάνη - Βαλίνη - Αλανίνη - COOH Α. Με τη βοήθεια του τμήματος του γενετικού κώδικα που παρατίθεται, γράψτε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του τμήματος mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Δικαιολογήστε την απάντησή σας. Μονάδες 13 Β. Γράψτε με τον κατάλληλο προσανατολισμό την αλληλουχία νουκλεοτιδίων στο δίκλωνο μόριο DNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Ποια είναι η κωδική και ποια η μη κωδική αλυσίδα; Μονάδες 6 Γ. Εάν η τριπλέτα 5 -UGG-3 στο mrna αντικατασταθεί από την τριπλέτα 5 -UGA-3, γράψτε την αλληλουχία των αμινοξέων στο νέο ολιγοπεπτίδιο που θα συντεθεί. Μονάδες 6 Δίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: GUC Βαλίνη UGG Τρυπτοφάνη GGU Γλυκίνη AUG Μεθειονίνη AAA Λυσίνη GCC Αλανίνη 2011 ΕΣΠΕΡΙΝΑ ( ) Γ1. Μια πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από μια πολυπεπτιδική αλυσίδα 100 αμινοξέων. Το γονίδιο από το οποίο κωδικοποιήθηκε η πρωτεΐνη αποτελείται από πολύ περισσότερα νουκλεοτίδια από αυτά που κωδικοποιούν τα 100 αμινοξέα. Να αναφέρετε τους λόγους αυτής της διαφοράς. Μονάδες 7 Πανελλαδικές Β. Πιτσιλαδής

17 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ ( ) Γ3. Ποιος είναι ο ρόλος του πριμοσώματος στην αντιγραφή του DNA; Μονάδες ΕΣΠΕΡΙΝΑ ( ) Γ2. Στο παρακάτω σχήμα απεικονίζεται μια θηλιά αντιγραφής. Ποια από τα τμήματα Α, Β, Γ και Δ αντιγράφονται συνεχώς και ποια αντιγράφονται ασυνεχώς; (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 8 Γ3. Το γενετικό υλικό των ευκαρυωτικών κυττάρων αν και είναι πολύ μεγαλύτερο από το γενετικό υλικό των προκαρυωτικών κυττάρων, αντιγράφεται πολύ γρήγορα. Για ποιο λόγο συμβαίνει αυτό; Μονάδες 6 Γ4. Γιατί ο τρόπος αντιγραφής του DNA ονομάζεται ημισυντηρητικός; (μονάδες 4) Ποια είναι η σημασία της συμπληρωματικότητας των αλυσίδων της διπλής έλικας του DNA; (μονάδες 3) Μονάδες ΗΜΕΡΗΣΙΑ + ΕΣΠΕΡΙΝΑ ( ) Στην εικόνα 1 φαίνεται ένα μέρος μίας βιολογικής διαδικασίας, η οποία βρίσκεται σε εξέλιξη. Εικόνα 1 CUCUUTCT GAGAAACATGCATACGA Γ1. Να ονομάσετε τη διαδικασία, που βρίσκεται σε εξέλιξη, στην εικόνα 1 και να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας (μονάδες 2). Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1 (μονάδες 3). Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού (μονάδα 1). Μονάδες 6 Γ2. Να ονομάσετε τα ένζυμα που είναι απαραίτητα για τη δημιουργία του τελικού δίκλωνου μορίου του ερωτήματος Γ1 και να αναφέρετε τη δράση του καθενός ενζύμου. Μονάδες 5 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Στην εικόνα 1 απεικονίζονται διαγραμματικά 3 μόρια DNA, στα οποία ο υποκινητής σημειώνεται με Υ. Γ1. Να μεταφέρετε στο τετράδιό σας τα τρία σχήματα της εικόνας 1 και να σημειώσετε με ένα βέλος την κατεύθυνση μεταγραφής σε καθένα από τα γονίδια Α, Β και Γ (μονάδες 3). Να γράψετε για το κάθε γονίδιο Α, Β και Γ ποια από τις δύο αλυσίδες Ι ή ΙΙ είναι η κωδική (μονάδες 3). Μονάδες 6 Πανελλαδικές Β. Πιτσιλαδής

18 ΘΕΜΑ 4 ο 2000 ΗΜΕΡΗΣΙΑ ( ) Γ. Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων: 5 - ΤCΑ CGG AAT TTC TAG CAT Με δεδομένο ότι δε μεσολαβεί στάδιο ωρίμανσης, να γράψετε το m-rna που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος DNA, σημειώνοντας ταυτόχρονα τη θέση του 5 και 3 άκρου του m-rna. Μονάδες 3 2. Να γραφούν τα αντικωδικόνια των t-rna με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω m-rna. Μονάδες 7 ΕΣΠΕΡΙΝΑ ( ) Δίνεται τμήμα διπλής έλικας DNA -TAC-AGT-GGA-GAA-GCT-ATT- (αλυσίδα 1) -ATG-TCA- CCT- CTT- CGA-TAA- (αλυσίδα 2) α) Ποια από τις δυο αλυσίδες είναι αυτή που μεταγράφεται και γιατί; Μονάδες 8 β) Ποιο είναι το mrna που προκύπτει από τη μεταγραφή της αλυσίδας αυτής; Μονάδες 8 γ) Δεδομένου ότι το mrna που προκύπτει από τη συγκεκριμένη μεταγραφή δεν υφίσταται διαδικασία ωρίμανσης, να δώσετε τον αριθμό των αμινοξέων που θα έχει το πεπτίδιο που θα συντεθεί κατά τη μετάφραση αυτού του mrna και να εξηγήσετε πώς προκύπτει ο αριθμός αυτός. Μονάδες ΕΣΠΕΡΙΝΑ ( ) Δίνεται τυχαίο τμήμα ενός μορίου mrna: - AUU - UCA - CCU - CUU - CGA - CAA - 1. Δεδομένου ότι το mrna αυτό δεν υπέστη διαδικασία ωρίμανσης, να γράψετε στο τετράδιό σας το δίκλωνο μόριο του DNA απ' το οποίο προήλθε. Μονάδες Πόσα αμινοξέα κωδικοποιεί το τμήμα αυτό; Μονάδες Στο αρχικό DNA ποιο ζευγάρι βάσεων συμμετέχει σε ποσοστό μεγαλύτερο του 50%; Μονάδες 5 ΕΣΠΕΡΙΝΑ ( ) Δίνεται τμήμα διπλής έλικας του DNA : 2002 α) Ποια από τις δύο αλυσίδες έχει προσανατολισμό 3 5 και ποια 5 3 ; Ποια από τις δύο αλυσίδες είναι η μεταγραφόμενη και γιατί; Μονάδες 8 β) Ποιο είναι το mrna που θα προκύψει από τη μεταγραφόμενη αλυσίδα; Μονάδες 8 γ) Το mrna που προκύπτει από τη συγκεκριμένη μεταγραφόμενη αλυσίδα δεν υφίσταται διαδικασία ωρίμανσης. Να γράψετε στο τετράδιό σας τα trna που θα πάρουν μέρος στη μετάφραση. Μονάδες ΕΣΠΕΡΙΝΑ ( ) #1 (Κεφάλαιο 1) Δίνονται τα παρακάτω αμινοξέα και, δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αμινοξέα αυτά: τυροσίνη (tyr) UAU, φαινυλαλανίνη (phe) UUU, προλίνη (pro) CCC Πανελλαδικές Β. Πιτσιλαδής

19 α) Αξιοποιώντας τις παραπάνω πληροφορίες να δώσετε το mrna που κωδικοποιεί το ακόλουθο τμήμα πολυπεπτιδικής αλυσίδας: Μονάδες phe phe pro tyr tyr pro -... β) Να γράψετε την κωδική αλυσίδα του DNA και τη συμπληρωματική της, προσδιορίζοντας το 3 και 5 άκρο καθεμιάς απ αυτές. Μονάδες 15 γ) Πόσοι είναι οι δεσμοί υδρογόνου που σταθεροποιούν τις δύο πολυνουκλεοτιδικές αλυσίδες #1 στο παραπάνω μόριο του DNA; Μονάδες 5 ΟΜΟΓΕΝΩΝ ( ) Δίδεται το παρακάτω τμήμα μορίου προκαρυωτικού DNA, στο οποίο κωδικοποιείται η γενετική πληροφορία για τη σύνθεση μικρής αλυσίδας αμινοξέων: α. Σε ποια από τις αλυσίδες, (Ι) ή (ΙΙ), βρίσκεται η γενετική πληροφορία και γιατί; Μονάδες 10 β. Να γράψετε το μόριο του m-rna το οποίο σχηματίζεται κατά τη μεταγραφή του παραπάνω DNA και να ορίσετε το 3 και το 5 άκρο του μορίου αυτού. Μονάδες 5 γ. Πόσα αμινοξέα έχει η αλυσίδα που σχηματίζεται και γιατί; Μονάδες 5 δ. Να γράψετε τα αντικωδικόνια των t-rna που συμμετέχουν στη μετάφραση του παραπάνω μορίου m-rna. Μονάδες ΕΣΠΕΡΙΝΑ ( ) Η αλληλουχία των βάσεων ενός βακτηριακού mrna είναι: A U G A A A U U U C C C G G G G A U U G A U A A 1. Να γράψετε στο τετράδιό σας την αλληλουχία των βάσεων του δίκλωνου μορίου DNA από το οποίο προήλθε. Μονάδες 8 2. Πόσα αμινοξέα συγκροτούν την ολιγοπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του παραπάνω μορίου mrna; Να δικαιολογήσετε την απάντησή σας. Μονάδες 6 3. Να γράψετε στο τετράδιό σας το μόριο του mrna επισημαίνοντας το 5 και το 3 άκρο της αλυσίδας του. Μονάδες 2 4. Στο μόριο του mrna που σας δόθηκε υπάρχει μία τριπλέτα η οποία, σύμφωνα με το γενετικό κώδικα, απαντάται σε κάθε μόριο mrna. Ποια είναι αυτή, πώς ονομάζεται και ποιο αμινοξύ κωδικοποιεί; Μονάδες ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Δίνεται το πεπτίδιο H 2 N - Μεθειονίνη - Αλανίνη - Τυροσίνη - Προλίνη - Σερίνη - COOH, που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαρυωτικού κυττάρου: 5 C A A A T G G C C T A T A A C T G G A C A C C C A G C T G A C G A 3 3 G T T T A C C G G A T A T T G A C C T G T G G G T C G A C T G C T 5 Να γράψετε την αλληλουχία του πρόδρομου mrna, την αλληλουχία του ώριμου mrna που προκύπτει μετά τη μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντησή σας (μονάδες 9). Να γράψετε την αλληλουχία του εσωνίου που βρίσκεται στο παραπάνω τμήμα του μορίου DNA (μονάδες 8). Να περιγράψετε τη διαδικασία ωρίμανσης του πρόδρομου mrna (μονάδες 8). Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων από το γενετικό κώδικα: Αλανίνη GCC Μεθειονίνη AUG Προλίνη CCC Σερίνη AGC Τυροσίνη UAU Πανελλαδικές Β. Πιτσιλαδής

20 2007 ΕΣΠΕΡΙΝΑ ( ) #1 (Κεφάλαιο 1) Δίνονται πέντε αμινοξέα και δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αμινοξέα αυτά: τυροσίνη (tyr) UAU φαινυλαλανίνη (phe) UUU προλίνη (pro) CCC μεθειονίνη (met) AUG γλυκίνη (gly) GGG Τα πέντε παραπάνω αμινοξέα συγκροτούν ολιγοπεπτίδιο κάποιου βακτηριακού κυττάρου. α. Να γράψετε στο τετράδιό σας ποιο είναι το πρώτο (αρχικό) και ποιο το τέταρτο αμινοξύ του ολιγοπεπτιδίου. Μονάδες 4 phe pro gly β. Να γράψετε μία αλληλουχία νουκλεοτιδίων του mrna που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο. Μονάδες 6 γ. Να γράψετε την αλληλουχία των νουκλεοτιδίων της κωδικής αλυσίδας του DNA (μονάδες 6) και να σημειώσετε το 5 και το 3 άκρο της (μονάδες 3). δ. Πόσα άτομα φωσφόρου υπάρχουν στη διπλή έλικα του DNA που κωδικοποιεί αυτό το ολιγοπεπτίδιο; Δικαιολογείστε την απάντησή σας. #1 Μονάδες 6 ΟΜΟΓΕΝΩΝ ( ) Δίνεται το παρακάτω τμήμα μορίου βακτηριακού DNA που κωδικοποιεί ένα πεπτίδιο με έξι αμινοξέα: 5... CCGΑTGACCAAACCTCACGCCTAGACC GGCTACTGGTTTGGAGTGCGGATCTGG... 5 Ποια από τις δύο αλυσίδες είναι η κωδική και ποια η μη κωδική; (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Να γράψετε την αλληλουχία του mrna που προκύπτει από τη μεταγραφή του παραπάνω τμήματος DNA. Μονάδες 3 Να γράψετε την αλληλουχία των αμινοξέων του πεπτιδίου που προκύπτει από τη μετάφραση του παραπάνω mrna. Μονάδες 3 Να γράψετε τα αντικωδικόνια των trna με τη σειρά που θα πάρουν μέρος στη μετάφραση του παραπάνω mrna. Μονάδες 6 Δίνονται οι παρακάτω αντιστοιχίσεις κωδικονίων και αμινοξέων από το γενετικό κώδικα: AUG Μεθειονίνη ACC Θρεονίνη AAA Λυσίνη CCU Προλίνη CAC Ιστιδίνη GCC Αλανίνη 2009 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ( ) Δίνεται το παρακάτω τμήμα βακτηριακού DNA που κωδικοποιεί τα πέντε (5) πρώτα αμινοξέα μιας πολυπεπτιδικής αλυσίδας. Η κατεύθυνση στην οποία κινείται η RNA πολυμεράση κατά τη μεταγραφή υποδεικνύεται από το βέλος. α. Ποια από τις δύο αλυσίδες του παραπάνω DNA είναι η κωδική και ποια είναι η μη κωδική; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 7) β. Να γράψετε την αλληλουχία του mrna, που προκύπτει από τη μεταγραφή του παραπάνω DNA. Μονάδες 3 γ. Να γράψετε και να αιτιολογήσετε το αντικωδικόνιο του trna, που μεταφέρει το 2 ο αμινοξύ της πολυπεπτιδικής αλυσίδας. Μονάδες 5 δ. Τι είναι το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης (μονάδες 5) και ποια είναι η μετέπειτα πορεία του trna, που συμμετέχει σε αυτό; (μονάδες 3) Πανελλαδικές Β. Πιτσιλαδής

21 ΕΣΠΕΡΙΝΑ ( ) Δίνεται το παρακάτω τμήμα DNA στο οποίο έχει αρχίσει η διαδικασία της αντιγραφής: 1. Στις θέσεις Α, Β, Γ, Δ, Ε, Ζ να αντιστοιχίσετε τις ενδείξεις 3 ή 5 ώστε να φαίνεται ο προσανατολισμός των αρχικών και των νεοσυντιθέμενων αλυσίδων. Μονάδες 6 2. Τι είναι τα πρωταρχικά τμήματα, πως δημιουργούνται και πως επιμηκύνονται; Μονάδες 9 3. Εξηγήστε γιατί πρέπει, στην παραπάνω διαδικασία να ενεργοποιηθεί το ένζυμο DNA δεσμάση και πώς θα δράσει αυτό; Μονάδες 6 4. Ποια ένζυμα θα επιδιορθώσουν τα πιθανά λάθη της διαδικασίας της αντιγραφής; Μονάδες ΕΣΠΕΡΙΝΑ ( ) Δίνεται τμήμα μορίου DNA ευκαρυωτικού κυττάρου που περιέχει το ασυνεχές γονίδιο το οποίο είναι υπεύθυνο για τη σύνθεση του παρακάτω πεπτιδίου: H 2 N- μεθειονίνη αλανίνη λευκίνη ασπαραγίνη COOH Δ1. Να γράψετε την κωδική και τη μη κωδική αλυσίδα του γονιδίου. (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6) Μονάδες 10 Δ2.Να γράψετε το πρόδρομο mrna, το ώριμο mrna, το εσώνιο του γονιδίου (μονάδες 6) και να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Μονάδες 15 Δίνονται οι παρακάτω αντιστοιχίσεις αμινοξέων και κωδικονίων: Aλανίνη = GCU Λευκίνη = UUG Ασπαραγίνη = AAU 2011 ΗΜΕΡΗΣΙΑ ( ) Δίδεται το παραπάνω τμήμα DNA, το οποίο αντιγράφεται. Στον κλώνο ΖΗ η αντιγραφή γίνεται με ασυνεχή τρόπο. Τα σημεία Δ και Η υποδεικνύουν τη θέση έναρξης της αντιγραφής. Δ1. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα, να σχεδιάσετε τα συνεχή και ασυνεχή τμήματα των νέων κλώνων με βέλη υποδεικνύοντας τους προσανατολισμούς των νέων και των μητρικών κλώνων (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Στον κλώνο που αντιγράφεται με συνεχή τρόπο να γράψετε την αλληλουχία των νουκλεοτιδίων και τον προσανατολισμό του πρωταρχικού τμήματος, το οποίο αποτελείται από 8 (οκτώ) νουκλεοτίδια (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 3). Δίνεται το παρακάτω τμήμα μορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. Πανελλαδικές Β. Πιτσιλαδής

22 5 -TACATGTCGCGATGCAAGTTCTAATCTCAATAΤCTT-3 3 -ATGTACAGCGCTACGTTCAAGATTAGAGTTATΑGAA-5 Δ3. Να γράψετε τα κωδικόνια του DNA που κωδικοποιούν το πεπτίδιο αυτό. Μονάδες 2 Δ4. Μετά την επίδραση ακτινοβολίας το παραπάνω τμήμα DNA σπάει στα σημεία που υποδεικνύονται από τα βέλη. Να γράψετε το τμήμα του DNA που αποκόπηκε και να σημειώσετε τον προσανατολισμό του. Μονάδες 2 Δ5. Το τμήμα του DNA που αποκόπηκε, επανασυνδέεται στα ίδια σημεία κοπής μετά από αναστροφή. Να γράψετε ολόκληρο το μόριο του DNA που προκύπτει μετά την αναστροφή (μονάδες 4). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Να γράψετε τα κωδικόνια του μορίου DNA που κωδικοποιούν το νέο πεπτίδιο. (μονάδες 2) ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ + ΕΣΠΕΡΙΝΩΝ ( ) Στο παρακάτω τμήμα δίκλωνου μορίου DNA, μεταξύ των σημείων Κ και Λ περιέχεται ένα γονίδιο. Στο διάγραμμα υποδεικνύεται η θέση του υποκινητή του γονιδίου. Να μεταφέρετε το σχήμα στο τετράδιό σας. Δ1. Να σημειώσετε στο σχήμα τους προσανατολισμούς των κλώνων του μορίου (μονάδες 2) και να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Δ2. Να τοποθετήσετε στο σχήμα και στις κατάλληλες θέσεις το κωδικόνιο έναρξης του γονιδίου και ένα από τα κωδικόνια λήξης (της επιλογής σας). (μονάδες 4) Να αιτιολογήσετε την απάντησή σας. (μονάδες 9) Δ3. Να εξηγήσετε τι γίνεται κατά την έναρξη της μεταγραφής ενός γονιδίου. Μονάδες 6 ΕΣΠΕΡΙΝΑ ( ) Σ ένα μόριο DNA ευκαρυωτικού κυττάρου υπάρχουν δύο γονίδια Α και Β, όπως φαίνεται στο σχήμα: Δ1. Να μεταφέρετε το σχήμα στο τετράδιό σας και να ορίσετε τους προσανατολισμούς των αλυσίδων του DNA (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ2. Τα γονίδια Α και Β μεταγράφονται σε RNA. Να ορίσετε τους προσανατολισμούς του RNA (μονάδες 2). Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Δ3. Ποια είναι η κωδική αλυσίδα για το γονίδιο Α και ποια για το Β (μονάδες 2); Να αιτιολογήσετε την απάντησή σας (μονάδες 5). Δ4. Τι είναι ο υποκινητής (μονάδες 2); Να ορίσετε τη θέση του υποκινητή για κάθε γονίδιο με ένα βέλος (μονάδες 4). Πανελλαδικές Β. Πιτσιλαδής

23 2012 ΟΜΟΓΕΝΩΝ ( ) Δίνεται το παρακάτω τμήμα DNA το οποίο αντιγράφεται. Τα σημεία Α και Γ υποδεικνύουν τη θέση έναρξης της αντιγραφής. Δ1. Να μεταφέρετε στο τετράδιό σας το παραπάνω σχήμα και να σημειώσετε πάνω σ αυτό τους προσανατολισμούς των μητρικών αλυσίδων (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ2. Να σχεδιάσετε στο ίδιο σχήμα τα ασυνεχή και τα συνεχή τμήματα των δύο νέων αλυσίδων με βέλη και να σημειώσετε πάνω σ αυτά τους προσανατολισμούς τους (Μονάδες 3). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ3. Η μητρική αλυσίδα του DNA που αντιγράφεται με συνεχή τρόπο, αμέσως μετά μεταγράφεται. Να γράψετε το τμήμα του RNA που σχηματίζεται κατά τη μεταγραφή και να σημειώσετε τον προσανατολισμό του (Μονάδες 2). Να αιτιολογήσετε την απάντησή σας (Μονάδες 4). Δ4. Ποια είναι η δράση της RNA πολυμεράσης μετά την πρόσδεσή της στον υποκινητή ενός γονιδίου; Μονάδες 6 ΕΣΠΕΡΙΝΑ ( ) Δίνεται το παρακάτω τμήμα DNA προκαρυωτικού κυττάρου το οποίο κωδικοποιεί ένα ολιγοπεπτίδιο. TTTCATGTCTCGGGCTGCATGGCT αλυσίδα Ι. AAAGTACAGAGCCCGACGTACCGA αλυσίδα ΙΙ Δ1. Να εντοπίσετε την κωδική αλυσίδα. (μονάδα 1) Να σημειώσετε τον προσανατολισμό των αλυσίδων. (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6 Δ2. Να γράψετε το mrna που προκύπτει από τη μεταγραφή του παραπάνω τμήματος DNA και να ορίσετε τα 5 και 3 άκρα του. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6 Δ3. Από πόσα αμινοξέα θα αποτελείται το ολιγοπεπτίδιο το οποίο παράγεται; (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 6) Μονάδες 8 Δ4. Να γράψετε τα αντικωδικόνια, με τον προσανατολισμό τους, τα οποία θα χρησιμοποιηθούν κατά τη μετάφραση του mrna. Μονάδες 5 Πανελλαδικές Β. Πιτσιλαδής

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 2 ΚΕΦΑΛΑΙΟ 2 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ. Ζήτηµα 4ο 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής του DΝΑ χαρακτηρίζεται από

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2012 2 0 1 3 ΛΥΚΕΙΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ 5 Γ Ε Λ Χ Α Λ Α Ν Δ Ρ Ι Ο Υ Περιεχόμενα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ)

1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 1 Ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΟ 2 Ο ΚΕΦΑΛΑΙΟ (ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ) 2000 ΗΜΕΡΗΣΙΟ Ζήτηµα 2ο Α. Η διαδικασία της αντιγραφής

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΙΚΟΝΑ 2.4 ΣΤΑΔΙΑ ΜΕΤΑΦΡΑΣΗΣ σ ε λ ί δ α 1 ΕΙΚΟΝΑ 4.2β ΕΡΩΤΗΣΕΙΣ 1. Να συμπληρώσετε τα κενά πλαίσια της εικόνας με την κατάλληλη λέξη ή φράση 2. Να γράψετε τον προσανατολισμό της μετακίνησης του ριβοσώματος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ. Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2015 2 0 1 5 ΗΜΕΡΗΣΙΑ ΛΥΚΕΙΑ ΕΣΠΕΡΙΝΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Βασίλης Πιτσιλαδής ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Θέματα Πανελλαδικών Εξετάσεων ανά Κεφάλαιο 2000-2013 2 0 1 3 ΛΥΚΕΙΑ ΛΥΚΕΙΑ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΣΠΕΡΙΝΩΝ 5 Γ Ε Λ Χ Α Λ Α Ν Δ Ρ Ι Ο Υ Περιεχόμενα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ

Διαβάστε περισσότερα

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ

ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΕΡΩΤΗΣΕΙΣ ΚΑΤΑΝΟΗΣΗΣ ΚΕΦΑΛΑΙΟ 2 ο 1. Με ποιο μηχανισμό αντιγράφεται το DNA σύμφωνα με τους Watson και Crick; 2. Ένα κύτταρο που περιέχει ένα μόνο χρωμόσωμα τοποθετείται σε θρεπτικό υλικό που περιέχει ραδιενεργό

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΘΕΜΑ 1 Ο ΑΠΑΝΤΗΣΕΙΣ Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας συνδέεται με το ρυθμιστικό γονίδιο Β. Το

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ, ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ EIKONA 2.1 Ημισυντηρητικός μηχανισμός αντιγραφής του DNA 1. Να γράψετε τα ένζυμα που (α) προκαλούν ξετύλιγμα των αλυσίδων του αρχικού (μητρικού μορίου) DNA και (β) συνθέτουν τις νέες αλυσίδες του DNA.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 02/12/2012 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 22 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και

Διαβάστε περισσότερα

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση

8. Σε στέλεχος του βακτηρίου E.coli δε λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερόνιου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση Γονιδιακή ρύθμιοη 1. Εντοπίστε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και στους ευκαρυωτικούς οργανισμούς. Α. Η ρύθμιση της γσνιδιακής έκφρασης στους προκαρυωτικούς

Διαβάστε περισσότερα

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ

Τηλ: Ανδρέου Δημητρίου 81 & Ακριτών 26 -ΚΑΛΟΓΡΕΖΑ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ- ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ (Ιανουάριος 2014) 1 ο ΘΕΜΑ Απαντήστε στις παρακάτω ερωτήσεις πολλαπλής επιλογής. Μία απάντηση είναι η σωστή. 1. Υβριδοποίηση: Α. Είναι ιδιότητα του DNA

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 4 ΚΕΦΑΛΑΙΟ 4 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ

Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ. Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΤΑΞΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Ημερομηνία: Κυριακή 23 Οκτωβρίου 2016 Διάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Στις ημιτελείς προτάσεις Α1 Α4 να γράψετε στο

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Το γονίδιο

Διαβάστε περισσότερα

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ

ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΠΡΟΣΟΜΟΙΩΤΙΚΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Κεφάλαια: 1 o 2 o ΑΠΑΝΤΗΣΕΙΣ ΖΗΤΗΜΑ 1 ο Να επιλέξτε το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1.

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας

Βιολογία Θετικής Κατεύθυνσης. Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Βιολογία Θετικής Κατεύθυνσης Κεφάλαιο 2 ο Αντιγραφή, έκφραση & ρύθμιση της γενετικής πληροφορίας Αντιγραφή του DNA Οι Watson & Crick το 1953 μαζί με το μοντέλο της διπλής έλικας, πρότειναν και έναν τρόπο

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο

ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο ΑΣΚΗΣΕΙΣ στο 2 ο κεφάλαιο 1. Ένας κλώνος ενός γονιδίου προκαρυωτικού κυττάρου έχει την παρακάτω αλληλουχία βάσεων: AAAATGTATACGGGCGCTGATACGGCAAACCCACTCATGTAA Βρείτε: Α) την αλληλουχία των βάσεων του mrna

Διαβάστε περισσότερα

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής:

1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 2 ΚΕΦΑΛΑΙΟ 1. H αλληλουχία ενός μορίου mrna που περιέχει την πληροφορία για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας σε ένα βακτηριακό κύτταρο είναι η εξής: 5 -ΑΑΑGGAUGGCGUAUCCCAUG...UGCGCGUGAUUUAAAA-3

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

DNA. 2 η Βάση 3 η U C A G

DNA. 2 η Βάση 3 η U C A G DNA Ο Γενετικός κώδικας θα σας είναι χρήσιμος για να απαντήσετε ορισμένες από τις ερωτήσεις που ακολουθούν 1 η Βάση U C A G 2 η Βάση 3 η U C A G Βάση UUU φαινυλανανίνη UCU σερίνη UAU τυροσίνη UGU κυστεΐνη

Διαβάστε περισσότερα

4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G

4. σε μια θέση έναρξης αντιγραφής η σύνθεση στη μια αλυσίδα είναι συνεχής, όπως φαίνεται και στο παρακάτω σχήμα T C C Α Α Τ A T T A A G G ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΖΑΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΚΕΦΑΛΑΙΟ 2 ο - ΑΣΚΗΣΕΙΣ ΑΝΤΙΓΡΑΦΗ Γράφουμε τον ημισυντηρητικό τρόπο αντιγραφής του DNA. Αν χρειαστεί και τον κανόνα συμπληρωματικότητας

Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Δʹ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 2 ΙΟΥΝΙΟΥ 2000 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-5, να γράψετε στο τετράδιό σας τον αριθμό της

Διαβάστε περισσότερα

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια)

28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ. ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (10 μόρια) ΕΠΩΝΥΜΟ:... ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 28/11/2010 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ / Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 4 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν:

3. Σε ένα σωματικό κύτταρο ανθρώπου που βρίσκεται στη μεσόφαση πριν την αντιγραφή υπάρχουν: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Στο οπερόνιο της λακτόζης: Α. Η πρωτεΐνη καταστολέας

Διαβάστε περισσότερα

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α! " # $ % & ' ( ) ( ) ( * % + α ι α

Β. Σελ 60 σχολικού: «Η αποµόνωση του συνολικού έως και σελ 61 από µία cdna βιβλιοθήκη.». Γ. ι ι α α α ι α α ι α α α!  # $ % & ' ( ) ( ) ( * % + α ι α ! THΛ: 270727 222594 THΛ: 919113 949422 Απαντήσεις: " # $ % & ' 1=γ, 2=β, 3=γ, 4=β, 5=δ. " # $ % ( ' εδοµένα από την ανάλυση του ποσοστού των βάσεων σε µόρια DNA από διαφορετικούς οργανισµούς έδειχναν

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ & ΕΠΑΛ (ΟΜΑΔΑ Β ) ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΗΜΕΡΟΜΗΝΙΑ ΕΞΕΤΑΣΗΣ: 27/05/2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΟΠ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέμα Α Α1:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι

Α Τ Υ Ο Τ Ο Ι Π Ι Λ Π Α Λ Σ Α ΙΑ Ι Ζ Α Ε Ζ ΤΑ Τ Ι ΚΕΦΑΛΑΙΟ 2ο: Σελίδες 27-43 ANTIΓΡΑΦΗ, ΕΚΦΡΑΣΗ & ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ 1 O µηχανισµός µε τον οποίο το DNA αντιγράφεται χαρακτηρίζεται ηµισυντηρητικός Ο Watson και Crick φαντάστηκαν µια διπλή

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 2ο 1. Δύο μόρια DΝΑ αποτελούνται το καθένα από 10.000 ζεύγη αζωτούχων βάσεων με 14 Ν. Τα μόρια μεταφέρονται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15

Διαβάστε περισσότερα

) 4 x 10 5 ) 2 x 10 5

) 4 x 10 5 ) 2 x 10 5 1 & ( ) 27 2016 - : ( ) ( ) : (5) 1 5,,,. 1.. DNA. DNA. DNA. RNA. 2.. 46... DNA 1,5 x 10 9. 3. Dolly. DNA.. 1. DNA. 4. (ADA),. AIDS.... 1 5 2 & 5. Ti. Agrobacterium tumefaciens. T 2. DNA.. 1. N,,,. 1.

Διαβάστε περισσότερα

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ

ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ. Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ. Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ ΗΛΙΑΣΚΟΣ ΦΡΟΝΤΙΣΤΗΡΙΑ ΥΠΗΡΕΣΙΕΣ ΠΑΙΔΕΙΑΣ ΥΨΗΛΟΥ ΕΠΙΠΕΔΟΥ Θετικής Κατεύθυνσης Βιολογία Γ Λυκείου Επιμέλεια: ΚΩΣΤΑΣ ΓΚΑΤΖΕΛΑΚΗΣ e-mail: info@iliaskos.gr www.iliaskos.gr ΚΕΦΑΛΑΙΟ 1 TO ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ Ερωτήσεις

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ DNA RNA Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ ΕΡΩΤΗΣΕΙΣ 4 ου ΚΕΦΑΛΑΙΟΥ 1.Τα παρακάτω στοιχεία να μπουν στην κατάλληλη στήλη ( ΣΥΓΚΡΙΣΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗΣ

Διαβάστε περισσότερα

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ

ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΟ 2 ο ΚΕΦΑΛΑΙΟ ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ ΜΕΤΑΦΡΑΣΗ ΓΟΝΙΔΙΑΚΗ ΕΚΦΡΑΣΗ : 1. Αντιγραφή: Η διαδικασία της αντιγραφής γίνεται με τον ημισυντηρητικό τρόπο, δηλαδή κάθε νέο μόριο αποτελείται

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ 1 ο ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. δ 2. β 3. γ 4. γ 5. β Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Λάθος 4. Λάθος 5. Σωστό ΘΕΜΑ

Διαβάστε περισσότερα

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ

ΘΕΜΑ 1ο ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 27 ΜΑΪΟΥ 2008 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛAΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 16-06-2017 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Α. φωσφορική ομάδα (Ι) E. υδροξύλιο (II) Β. mrna

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ/ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 27 /9/2015 1 ο Θέμα 1.α 2.β 3.δ 4.γ 5.γ 2 ο Θέμα A. Να απαντήσετε στις παρακάτω ερωτήσεις: i)τι είναι το οπερόνιο της λακτόζης και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ-ΑΣΚΗΣΕΩΝ ΚΑΙ ΠΡΟΒΛΗΜΑΤΩΝ ΤΟΥ ΒΙΒΛΙΟΥ ΤΟΥ ΜΑΘΗΤΗ Υποενότητες 4.1 και 4.2 1. Το αντικωδικόνιο που βρίσκεται στο trna συνδέεται (βάλτε σε κύκλο το σωστό): α. Με το αμινοξύ β. Με το

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΝΕΟ & ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΥΘΥΝΣΗΣ (ΠΑΛΑΙΟ

Διαβάστε περισσότερα

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες

DNA RNA ΝΟΥΚΛΕΙΝΙΚΑ ΟΞΕΑ. Όσα αφορούν τη δομή του DNA δόθηκαν στο κεφάλαιο οργανικές ουσίες Ο φορέας της γενετικής πληροφορίας (DNA), σελ. 293 320 μέχρι και την πρώτη παράγραφο. (εκτός ύλης: Ο μηχανισμός της ημισυντηρητικής αντιγραφής του DNA, σελ. 297-301, Από το 14.4 ΜΕΤΑΛΛΑΞΕΙΣ, Σύνδρομο Down

Διαβάστε περισσότερα

Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι :

Το ώριμο m-rna που προκύπτει μετά την απομάκρυνση του εσωνίου από το πρόδρομο m-rna είναι : ΑΠΑΝΤΗΣΕΙΣ ΑΣΚΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ 2 ΟΥ ΚΕΦΑΛΑΙΟΥ ΑΠΟ ΤΙΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΕΞΕΤΑΣΕΙΣ 2000 Έστω ένα τμήμα μεταγραφόμενου κλώνου DNA με την ακόλουθη αλληλουχία βάσεων : 5 -TCA-CGG-AAT-TTC-TAG-CAT-3. Α)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής 1. β 2. δ 3. α 4. γ 5. δ Β. Ερωτήσεις σωστού λάθους 1. Λάθος 2. Σωστό 3. Σωστό 4. Σωστό 5.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική t-rna που να αντιστοιχούν σε αυτά. ( ) 2.5.45. Η μετακίνηση των ριβοσωμάτων στο mrna γίνεται προς το 3 άκρο του mrna. ( ) 2.5.46. Πολλά μόρια mrna μπορούν να μεταγράφονται από ένα μόνο γονίδιο. ( ) 2.5.47.

Διαβάστε περισσότερα

ΙΑΓΩΝΙΣΜΑ Εργαστηριακή άσκηση

ΙΑΓΩΝΙΣΜΑ Εργαστηριακή άσκηση ΚΕΦΑΛΑΙΟ 2 ο ΚΕΦΑΛΑΙΟ 2 ο... 2 I.... 2 ΠΡΟΒΛΗΜΑΤΑ... 8 ΕΡΩΤΗΣΕΙΣ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ...12 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.(α)... 23 ΝΑ ΣΥΜΠΛΗΡΩΣΕΤΕ ΤΑ ΚΕΝΑ ΜΕ ΤΗΝ ΚΑΤΑΛΛΗΛΗ ΛΕΞΗ.(β)... 24

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, Ημ/νία: 27 Μαΐου 2016 ΘΕΜΑ Α Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Προσανατολισμού Θετικών Σπουδών, A1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. Στήλη Ι 1. DNA δεσμάση 2. DNA ελίκαση

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής:

ΘΕΜΑ Α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ. Α1. β. Α2. γ. Α3. δ. Α4. γ. Α5. β Β1. 5, 4, 2, 1, 3. Β2. Τα δομικά μέρη του οπερονίου της λακτόζης είναι κατά σειρά τα εξής: ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΔΕΥΤΕΡΑ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 18 Μαΐου 2011 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ;

Α3) Στα νουκλεοτίδια του γονιδίου, έχουν νόημα 120 x 3 x 2 = 720 νουκλεοτίδια Στα 100 Υ = ; Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr Απαντήσεις ΘΕΜΑ 1 Ο Α) 3 Β) 3 Γ) 4 Δ) 3 Ε) 4 ΘΕΜΑ 2 Ο Α1) Νπρόδρομου mrna = 300A + 800G + 400C + 500T =

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15 ΙΟΥΝΙΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2011 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Δ ΕΣΠΕΡΙΝΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 16 IOYNIOΥ 2017 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο 1. Ασκήσεις με βάση το μηχανισμό αντιγραφής του DΝΑ. Το DΝΑ αντιγράφεται με ημισυντηρητικό τρόπο. Η κατεύθυνση της αντιγραφής είναι πάντα 5 3. Στο αρχικό μόριο δεν περιέχονται

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΚΩΛΕΤΤΗ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 27 ΜΑΙΟΥ 2016 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΚΑΤΕΘΥΝΣΗ (ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ) Ε Ν Δ Ε Ι Κ Τ

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2017 Α ΦΑΣΗ ΤΑΞΗ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΣ: ΘΕΤΙΚΩΝ ΣΠΟΥ ΩΝ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Σάββατο 7 Ιανουαρίου 2017 ιάρκεια Εξέτασης: 3 ώρες ΘΕΜΑ Α Α1 δ, Α2 γ, Α3 β, Α4 δ, Α5 α ΘΕΜΑ Β ΑΠΑΝΤΗΣΕΙΣ Β1. Για τη

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA

ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΠΑΝΕΛΛΗΝΙΩΝ ΕΞΕΤΑΣΕΩΝ ΣΤΗΝ ΤΕΧΝΟΛΟΓΙΑ ΑΝΑΣΥΝ ΥΑΣΜΕΝΟΥ DNA 2000 ΗΜΕΡΗΣΙΟ 5. Οι περιοριστικές ενδονουκλεάσες: α. συµµετέχουν στην ωρίµανση του RΝΑ β. είναι απαραίτητες

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 15/11/2015 ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Δεοξυριβονουκλεοτίδια

Διαβάστε περισσότερα

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο

ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr. Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΘΕΜΑ 1 Ο Μάθημα: Βιολογία Προσανατολισμού Εξεταζόμενη ύλη: 1o,2o κεφάλαιο ΚΟΡΥΦΑΙΟ ΦΡΟΝΤΙΣΤΗΡΙΟ korifeo.gr ΘΕΜΑ 1 Ο Να βάλετε σε κύκλο τον αριθμό που αντιστοιχεί στη σωστή απάντηση ή συμπληρώνει σωστά την πρόταση

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 2ο ΟΜΑΔΑ Α 1. Μόριο DΝΑ αποτελείται από 8.000 αζωτούχες βάσεις με 14 Ν. Το μόριο μεταφέρεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια που περιέχουν 15 Ν και αντιγράφεται δύο φορές.

Διαβάστε περισσότερα

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα. προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. μαθητικό φροντιστήριο 25ης Μαρτίου 111 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 20 990-210 50 27 990 25ης Μαρτίου 74 - ΠΕΤΡΟΥΠΟΛΗ - 210 50 50 658-210 50 60 845 Γραβιάς 85 -

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΩΝ 2017 ΘΕΜΑ Α Α1. δ Α2. δ Α3. β Α4. γ Α5. α ΘΕΜΑ Β Β1. Ι Α, ΙΙ Ε, ΙΙΙ ΣΤ, ΙV Β, V Ζ, VII Γ, VII Δ Β2. Η εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο. Στους προκαρυωτικούς

Διαβάστε περισσότερα

1. Ο Griffith στα πειράματά του χρησιμοποίησε:

1. Ο Griffith στα πειράματά του χρησιμοποίησε: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΧΕΙΜΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 27/11/11 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ο Griffith στα πειράματά

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις 2016

Πανελλαδικές εξετάσεις 2016 Θέμα Α Α1: β Α2: β Α3: δ Α4: γ Α5: γ Θέμα Β Πανελλαδικές εξετάσεις 2016 Ενδεικτικές απαντήσεις στο μάθημα «ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ» Β1. 1:Α, 2:Γ, 3:Α, 4:Β, 5:Α, 6:Α, 7:Γ Β2. Σχολ. Βιβλ. Κεφ.1, σελ. 24

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 10 ΙΟΥΝΙΟΥ 2005 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ 1ο Α. Για τις ημιτελείς προτάσεις

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ Β ΚΥΚΛΟΥ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΤΑΞΗ Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ 25/4/2016 ΘΕΜΑ Α Α1. Μέσω του καρυότυπου δεν μπορούν να ανιχνευτούν : α. οι δομικές χρωμοσωμικές ανωμαλίες β.

Διαβάστε περισσότερα

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000

Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Ζήτηµα 1ο Θέµατα Βιολογίας Θετικής Κατεύθυνσης Γ Λυκείου 2000 Στις ερωτήσεις 1-5, να γράψετε στο τετράδιο σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Σε µια συνεχή

Διαβάστε περισσότερα

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ BIOΛΟΓΙΑ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Β2. Καρυότυπος σχολ. βιβλίο σελ. 24: «Κάθε φυσιολογικός καρυότυπος». Συμπεράσματα: - Φύλο ατόμου

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία:

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΣΤΗΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ' ΛΥΚΕΙΟΥ Ονοματεπώνυμο: Ημερομηνία: ΘΕΜΑ 1 ο Α. Ερωτήσεις πολλαπλής επιλογής. 1. Ο πρώτος νόμος του Mendel περιγράφει: α. τον ελεύθερο συνδυασμό των

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΠΕΝΤΕ (5)

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση.

ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2, να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΣΑΒΒΑΤΟ 1 ΙΟΥΝΙΟΥ 2002 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Α. Στις ερωτήσεις 1-2,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας

Κεφάλαιο 2ο. Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας Κεφάλαιο 2ο Αντιγραφή, έκφραση και ρύθμιση της γενετικής πληροφορίας 1. Το DNA αυτοδιπλασιάζεται 3ο ε.λ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης 3 Ο μηχανισμός της αντιγραφής του DNA Ο μηχανισμός αυτοδιπλασιασμού

Διαβάστε περισσότερα

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί

Με τον εμβολιασμό προστίθενται στο θρεπτικό υλικό μιας καλλιέργειας πρωτεΐνες πλασμίδια αντισώματα δ. μικροοργανισμοί ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ' ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 24 ΜΑΪΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Κανάρη 36, Δάφνη Τηλ. 210 9713934 & 210 9769376 ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΘΕΜΑ Α Α1.Γ. Α2.Γ. Α3.Β. Α4.Β. Α5.Β. ΘΕΜΑ Β 1. Οι σωστές απαντήσεις είναι: A. Μεγαλύτερη συμβολή γενετικού

Διαβάστε περισσότερα